The contribution of neutrophils to bacteriophage clearance and pharmacokinetics in vivo

bacteriophage therapy, pharmacokinetics, biodistribution, neutrophils Abbreviations: Half-life (t1/2); Initial concentration 0.25h after dose (Cmax) concentration at 24h after dose (C24h); area under the curve from time 0 to last measurable concentration (AUClast); area under the curve from time 0 to infinity ( AUCInf); Mean residence time (MRT); Volume of distribution at steady state (Vss); clearance (CL). (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint

With the increasing prevalence of antimicrobial -resistant bacterial infections, there is great interest in using lytic bacteriophages (phages) to treat such infections. However, the factors that govern bacteriophage pharmacokinetics in vivo remain poorly understood. Here, we have examined the contribution of neutrophils, the most abundant phagocytes in the body, to the pharmacokinetics of intravenously administered bacteriophage in uninfected mice. A single dose of LPS-5, an antipseudomonal bacteriophage recently used in human clinical trials, was administered intravenously to both wild-type BALB/c and neutropenic ICR mice. Phage concentrations were assessed in peripheral blood and spleen at 0.5, 1, 2, 4, 8, 12, and 24 hours after administration by plaque assay and qPCR. We observed that the phage clearance is only minimally affected by neutropenia. Indeed, the half-life of phages in blood in BALB/c and ICR mice is 3.45 and 3.66 hour s, respectively. These data suggest that neutrophil - mediated phagocytosis is not a major determinant of phage clearance. Conversely, w e observed a substantial discrepancy in circulating phage levels over time when measured by qPCR versus plaque assay, suggest ing that substantial functional inactivation of circulating phages occurs over tim e. These data indicate that circulating factors, but not neutrophils, inactivate intravenously administered phages. Word count: 196 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint

The global crisis of bacterial antimicrobial resistance (AMR) represents a profound challenge to human health. Once -treatable infections are now responsible for extensive morbidity and mortality and have the potential to evolve into global health problems of pandemic dimensions1. Pseudomonas aeruginosa (Pa) is one of the most problematic pathogens for which new treatment options are needed 2-4. Multidrug -resistant strains of Pa are prevalent in environmental and clinical settings due to acquired resistance and intrinsic mechanisms of resistance5,6. There is a need for innovative treatments to treat AMR Pa and other pathogens. Lytic bacteriophages (phages), viruses that kill bacteria, are an exciting treatment option for AMR bacterial infections7-10. Multiple studies have demonstrated the efficacy of phage therapy against MDR Pa11-14, either alone or in conjunction with conventional antibiotics 15. Phage therapy is saving lives ; however, success has been inconsistent 16-18. This has limited the therapeutic and commercial prospects of this approach. Critical to the successful development of phages as a therapeutic treatment will be a deep understanding of its pharmacokinetics (PK)19. While there is, in fact, a large body of literature on phage therapy, it is heterogenous, difficult to access, as much of it is in the non- English-language literature, and often pre-dates the current era of phage therapy. Fortunately, this literature has been summarized in an excellent recent review20. From this literature, it is clear that phage PK depends on the route of administration. Following intravenous (IV) administration, the half-life (t1/2) of phages in the blood of mice has been reported between 2.2 h and 4.5 h in different animal models21,22. Most phages are cleared by the liver and spleen within minutes to hours 23-25. However, systemic administration of phages leads to their accumulation in tissues. The removal of phages from circulation and their clearance decreases the number of infective phage particles and affects therapeutic efficacy26. However, the factors responsible for phage clearance are unclear. This is important to understand in order to better optimize phage delivery and treatment protocols. The immune system has been implicated in phage clearance with phagocytosis playing a prominent role in the clearance of many viruses and foreign molecules. Large viral particles exit the circulation and enter the liver and splenic sinusoids, where a high density of phagocytes are present26,27. Nanosized virions are destroyed in the reticuloendothelial system (RES) of the liver and spleen, which leads to rapid removal of phages from circulation. While in the reticuloendothelial system, phages may also exert pharmacodynamic effects by influencing the inflammatory properties of mononuclear cells22,28,29. Neutrophils are the most abundant phagocytes in the body and can be found in the liver, spleen, and in peripheral tissues. Neutrophils have been reported to engulf viruses36–38. However, the contributions of neutrophils and phagocytosis to phage clearance remains unclear. In this study, we evaluate d the pharmacokinetics of intravenously administered Pseudomonas aeruginosa phage LPS-5 in a wild-type and neutropenic mouse model. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint

Chemicals and reagents The following materials were used in these studies: 0.9% NaCl (Sin-Tong, Taiwan), 2X Power SYBR Green PCR Master, Bacto TM Agar (214040, BD, USA), Disodium phosphate (Na2HPO4, 71640, Sigma, USA), LB Broth (Lennox) (240230, BD, USA), Magnesium sulfate (MgSO4, M2643, Sigma, USA), Nutrient agar (NA) plates (CMP0101312, CMP, Taiwan), Nutrient broth (DIFCO, USA), Phosphate buffered saline (PBS) tablet, pH 7.4 (P4417, Sigma, USA), Potassium phosphate monobasic ( KH2PO4, P5379, Sigma, USA), Sodium chloride (NaCl, S7653, Sigma, USA), TANBead nucleic acid extraction kit (M665A46, OptiPure Viral Auto plate, Taiwan), Tryptic soy broth (TSB) (211825, BD, USA), and Water for injection (Tai- Yu, Taiwan). Animals Specific pathogen -free immunocompetent female BALB/c mice, 7 -8 weeks of age, were used for the pharmacokinetics study. Animals were housed for 3 days in quarantine prior to the pharmacokinetics study. Specific pathogen-free neutropenic female Institute of Cancer Research Hsd: ICR (ICR) mice, weighing 22 ± 2 g were used. Animals were immunosuppressed by two intraperitoneal injections of cyclophosphamide, the first at 150 mg/kg 4 days before infection (Day –4) and the second at 100 mg/kg 1 day before infection (Day –1), prior to infection on Day 0 per the industry -standard metho ds30. Pharmacology Discovery Services, PDS, determined that this cyclophosphamide treatment schedule resulted in neutropenia (<100 neutrophils per µL) until Day 2 after infection. Phage suspension Phages were propagated using techniques that are well -established at Felix Biotechnology (South San Francisco, CA). Briefly, we infected planktonic cultures of bacteria with phage until clearing was observed relative to a non-infected control culture, removed gross bacterial debris by centrifugation (8000 x g, 20 min, 4 °C), and filtered the supernatant through a 0.22 um PES membrane (Corning, Corning, New York, Product #4311188). The supernatant was treated with 5 U/ mL Benzonase nuclease (Sigma -Aldrich, Saint Louis, MO, Catalog #E8263) overnight at 37 °C to digest free DNA. Phage was precipitated by the addition of 0.5 M NaCl + 4% w/v polyethylene glycol 8000 (Sigma -Aldrich, Saint Louis, MO, Catalog #PHR2894) overnight at 4 °C. Precipitated phage was then pelleted by centrifugation (14,000 x g, 20 min, 4 °C), washed in 30 mL Tris-EDTA buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), and re -pelleted by centrifugation (14,000 x g, 20 min, 4 °C). The phage pellet was then resuspended in 3 mL of the buffer appropriate to that phage/experiment and dialyzed against 4 L of the same buffer three times through a 10 kDa dialysis membrane to remove residual salts and PEG. Felix Biotechnology supplied t he LPS-5.eng bacteriophage stock solution at 1.0 x 1011 PFU/mL and the heat-inactivated phage solution. PDS then stored the phages at 4 °C upon arrival at PDS. Dosing solutions for injection were prepared by diluting the stock solution in filtered phage buffer ( KH2PO4 144 mg/L, Na2HPO4 421.62 mg/L, NaCl 9000 mg/L, MgSO4 1203.6 mg/L) within 1 h before administration on each dosing day. The phage dose solutions were titered twice on two separate test occasions with the plaque method. Treatment LPS-5 phage was administered intravenously via tail vein injection at a single dose (0.1 mL/mouse with a concentration of 1 x 1011 PFU/mL) to BALB/c mice or ICR mice. Animals were observed at 5 -15 min after IV dosing to detect acute toxicity, which would have been recorded. No toxicity was observed. Animals were then sacrificed after 0.25 h, 1 h, 2 h, 4 h, 8 h, 12 h and 24 h. For every sampling time point, five mice were sacrificed. Phage concentration was measured in whole blood, liver and spleen homogenates using a plaque assay and qPCR. Blood and Tissue Collection (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint Animals were euthanized via CO2 euthanasia at the time points noted for blood and tissue collection. Blood samples were collected by cardiac puncture under CO 2 euthanasia using lithium heparin blood collection tubes. The blood samples were stored on ice and divided into two vials, one for PFU enumeration and one for quantitative PCR (qPCR). Tissues were aseptically recovered, blotted dry, weighed, then combined with 1 mL PBS followed by homogenization with a Polytron homogenizer (10,000 x rpm for 15 -30 seconds). The homogenized samples were centrifuged and the supernatant was transferred to two vials, one for PFU enumeration and one for quantitative PCR (qPCR). All samples were stored on ice during processing which was completed within one hour. Plaque assays Plaque assays were used to quantify the number of infectious phage particles per mL. Serial 10-fold dilutions of plasma and clarified homogenates were prepared in phage dilution buffer. The assay was conducted on rectangular OneWell bottom agar plates (128 x 86 mm), containing LB agar (1.5%) with 10 mM MgSO4. Seeded top agar, ~10 mL, was spread evenly over the upper surface of the bottom agar plate and was prepared by combining 300 µL of overnight culture of P. aeruginosa (PAO1) with 10 mL molten top agar medium (LB broth medium with 10 mM MgSO 4 and 0.75% agar). The overnight culture of strain P. aeruginosa (PAO1) was grown in LB with 10 mM MgSO4. After solidification, 5 µL of each sample dilution was pipetted onto the surface of the top agar, then left to dry. The plate was incubated at 37 °C for 18 h then plaques were counted and PFU/ mL values were calculated. Plaques were counted on the spots with 1 to 50 distinguishable plaques to calculate PFU/ mL values. The number of plaques per dilution was tabulated and the PFU/tissue or PFU/ mL blood was calculated and reported. Transmission electron microscopy (TEM) TEM imaging was done as previously reported 31. In brief, the size and morphology of phages were examined with transmission electron microscopy (TEM) using a JEOL JEM1400 (JEOL USA Inc., Peabody, MA) at 80 kV. 5 µL of diluted phage solution was dropped onto carbon-coated copper grids (FCF-200-Cu, Electron Microscopy Sciences, Hatfield, PA). After 3 minutes, the grid was dipped into a ddH 2O droplet and then 1% uranyl acetate for staining was dropped at the sample and was allowed to dry for 15 minutes before performing microscopy. Quantitative PCR (qPCR) Sample Preparation: Nucleic acid was extracted from the collected blood samples, and clarified tissue homogenates using the TANBead Nucleic Acid Extraction kit with the Maelstrom 4810 fully automated DNA/RNA extraction system following the manufacturer’s instructions Quantitative PCR: qPCR was conducted with 2X Power SYBR Green PCR Master Mix, Thermo Fisher, USA using the standard assay components of the kit. The qPCR reactions were performed on a ViiA ™ 7 Real-Time PCR System (Applied Biosystems) using a 96-well format. Assay wells were sealed with optical films and then briefly centrifuged to consolidate the droplets from the sides of wells. Thermal cycling included an initial 10-min heat activation of the polymerase, followed by 40 repeated cycles of DNA denaturation, primer annealing, and target elongation. Two primer pairs with sequences supplied by Felix Biotechnology were used for the qPCR. The MCP_set2 primer set targets nucleotides 5223 to 5367 of the phage and yields a 145 bp product with a melting temperature of 81.51 °C. The Barcode primer set targets a unique barcode in the genetically modified phage at nucleotides 70423 to 70750 and yields a 328 bp product with a melting temperature of 85.34 °C. MCP_set2_F: CGCAACTGGGCTAACACCGC and R: GGTTGGTCAGGTCGAAGCC Barc ode_F_oFB123: GTGCAGGAGGAATCGGGCC and R_oFB121: GGGTCACTTTCACTTGCACGC. Condition optimization: qPCR condition optimization by analysis of melting temperatures was conducted to inspect for the specificity of the amplified product. To assess specificity, qPCR was performed with primer pairs for each phage using nucleic acid prepared (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint from infected P. aeruginosa mouse blood. The qPCR signal and the threshold cycle value (CT) was measured in triplicate in each of these samples and the signal-to-background values were determined. Tests were conducted to confirm that the primers would only yield amplicons from template samples that contained phage DNA. Template samples containing mouse blood or bacteria, but lacking phage, were tested with the expectation that they would not yield an amplification signal. A dilution series of the phage were tested to define the linear range of the qPCR assay for each phage, the lower limit of detection and quantification (LLOD and LLOQ), the upper limit of quantification (if measurable, ULOQ), and the efficiency of amplification, The experiment assessed the linearity of the qPCR signal from the phage over ten concentrations: 0, 10, 25, 50, 102, 103, 104, 105, 106, 107, and 108 PFU. Blood samples and homogenized tissue samples were spiked with phage dilutions at these ten concentrations to mimic samples from treated animals. Mouse biosamples without spiked phage were included as negative controls. DNA was extracted and measured as described above. The qPCR analysis of each sample was conducted in triplicate to assess intra-assay variability. qPCR standard curve Calibration curve samples were generated by spiking homogenized tissues or blood samples with phage dilutions of defined concentrations in an 8 -point dilution series, ranging from 101 to 108 PFU/mL. Triplicate qPCR measurements of each phage were conducted for each sample. For calibration curve samples, the CT values were graphed as a function of the nominal phage concentration (data not shown). The concentration of each phage in the tissue sample of unknown concentration was determined by comparing the mea sured CT values against the calibration curve from the same biological matrix, per the formula below. Each qPCR condition included four QC samples that are prepared according to the same extraction procedure and the same test occasion as the test samples. Clarified tissue or blood homogenates, were spiked at four concentrations: the LLOQ, low, mid, and high concentrations of phage, three replicate samples. Controls included no phage vehicle samples. The no-phage blanks were evaluated for the presence of signal artifacts due to contamination. The CT values of the dilution samples were graphed as a function of the logarithm of the nominal phage concentration (PFU/mL). The amplification efficiency, E, was determined from the slope per the equation below. Regression analysis was conducted to determine the r values to assess linearity. Concentrations of phage (PFU/ mL) in each sample were back -calculated from the calibration standard curve, per the equation below. The calculated concentrations were compared to the nominal concentrations to calculate the assay precision. Efficiency = 10-1/slope - 1 DNA phage equivalence (PFU/mL or PFU/tissue) = 10(Ct value – Yintercept)/slope Accuracy: measured/nominal*100% Precision: SD/Mean*100% Acceptance criteria: The dilution series is to yield an r value of 0.98 or higher over seven or more concentrations. The precision is to be 85-115% for 70% of the calibration curve samples. The amplification efficiency is to be 85 -105%. The linear range should be between 103 to 108 PFU/mL or PFU/tissue of samples. The concentration of each phage titer was determined in the blood and tissue samples. The concentration-time profile of phage measured with qPCR was characterized as described above for the plaque assay. The outcomes of the qPCR and the phage titration ass ays were compared. PK-data analysis Plots of phage concentration in blood, spleen, and liver tissues over time were generated with GraphPad Prism software. Non-compartmental analysis (NCA) was conducted with Phoenix WinNonLin to estimate pharmacokinetic parameters. Cmax and C24h were taken directly from the data. The terminal elimination rate ( lz) was determined by linear regression (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint analysis of the terminal portion of the log plasma concentration–time curve. The terminal half- life (t1/2) was calculated as ln 2/lz. AUClast was found using the trapezoidal method. Summation of AUClast plus the concentration at the last measured point divided by lz yielded AUCInf. CL was calculated as dose/AUCInf. The mean residence time (MRT) was calculated as the ratio of the area under the moment curve (AUMCInf divided by AUCInf. Volume of distribution based on the terminal phase (Vz) was calculated as Dose/(lz x AUCinf).

Calibration studies to evaluate our ability to assess phage concentrations. As the phage in this study, we used LPS-5, a lytic phage recently included in a human clinical trial of phage therapy , the CYstic Fibrosis bacterioPHage Study at Yale (CYPHY) (ClinicalTrials.gov Identifier: NCT04684641) . LPS-5 is a lytic phage that infects Pa. It is a member of the Pakpunavirus family and uses pseudomonal lipopolysaccharide (LPS) for viral entry14. A representative transmission electron microscopy image of LPS-5 and representative lytic plaque morphology on Pseudomonas aeruginosa PAO1 are shown in Fig. 1. We first sought to assess the linearity, accuracy , and precision of our methods to quantify phages in serum and tissues collected from conventional BALB/c mice. To assess this, we performed titration studies to d etermine the accuracy and precision of phage measurement over a broad phage range of concentrations. For these studies, previously collected peripheral blood and excised spleen tissue were spiked with phage in eight concentrations (108, 107, 106, 105, 104, and 103 PFU/sample). For spleen tissues, the phages were spiked in, and these were homogenized together at 10,000 x rpm. For blood, the phages were added into whole blood and mixed. As readouts for these studies, we used plaque assays and qPCR studies, as detailed in the Material & Methods section. For these studies. phages with established, nominal concentrations were added to PBS (saline), blood, or spleen tissue collected from BALB/c mice (A-F) or ICR mice (G-L). These were then analyzed using plaque assays (A-C, G-I) or qPCR (D-F, J-L) (Fig. 2). For the qPCR studies, the accuracy in BALB/c samples was determined to be 100 % (99-121) (spleen) and 101 % (94-104) (blood). The uncertainty was determined to be 0.7 % (0.2-2.0) (spleen) and 0.4% (0.2-3.0) (blood). The accuracy in ICR samples was determined to be between 87% (81-92) (spleen) and 97% (93-99) (blood). The uncertainty was determined to 0.3 % (0.2-1.5) (spleen) and 0.4 % (0.2-3.0) (blood). The limit of detection (LOD) was determined to be 200 PFU/sample. The lower limit of qualification (LLOQ) was determined to be 1000 PFU/sample. These are indications of excellent linearity and reproducibility using these approaches. The PK of phage LPS-5 in conventional BALB/c mice. Having established our ability to assess phage levels in these samples, we next asked whether we could also assess the pharmacokinetics of phages in vivo. For these studies, we used a well-established mouse commonly used in pharmacology studies, the BALB/c mouse. Using these animals , we then examined phage pharmacokinetics using the prot ocol outlined in Fig. 3. In these studies, LPS -5 Phage was IV administered at a single dose (0.1 mL/mouse with a concentration of 1 x 1011 PFU/mL) to BALB/c mice. Animals were then sacrificed after 0.25 h, 1 h, 2h, 4 h, 8 h, 12 h and 24 h. For every sampling time point, five mice were sacrificed. Overall, 45 immun ocompetent mice were used. Phage concentration was measured in whole blood and spleen homogenates using a plaque assay and qPCR. The concentration over time was graphed and non-compartmental analysis (NCA) was conducted with Phoenix WinNonLin to estimate pharmacokinetic parameters. The concentration-time profile as measured by plaque assay of active LPS-5 after IV administration in conventional BALB/c mice is shown Fig. 4A. The Cmax of active phages in blood in BALB/c mice was 1.97 x 106 PFU/mL. Circulating active phages then demonstrated first order elimination with a terminal t1/2 of 3.45 h. By 24 h, very low concentrations of active phage remained in the blood ( C24 = 740 PFU/mL). In contrast, high c oncentrations of active phages in spleen tissue were rapidly achieved (Cmax = 5.21 x 108 PFU/mL) and remained high (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint over the 24 hours period of measurement (C 24 = 6.46 x 107 PFU/mL) (Fig. 4B) . Other pharmacokinetic parameters are listed in Table 1. Together, these data suggest that bacteriophages leave the circulation rapidly after administration and accumulate in reticuloendothelial system compartments like the spleen. The PK of phage LPS-5 in neutrophil-deficient mice. We then asked how neutropenia impacted phage PK and biodistribution. For these studies, we used the ICR neutropenic mouse model where ICR mice are treated with cyclophosphamide to render them neutropenic, as detailed in the methods section. These animals are often used to study pharmacokinetics 39,40. Here again, in these studies, LPS -5 phage was IV administered at a single dose (0.1 mL/mouse with a concentration of 1 x 1011 PFU/mL) to BALB/c mice or ICR mice. Animals were then sacrificed after 0.25 h, 1 h, 2 h, 4 h, 8 h, 12 h and 24 h. For every sampling time point, five mice were sacrificed. Overall, 45 neutropenic mice were used. Phage concentration was once again measured in whole blood and spleen homogenates using a plaque assay and qPCR. As with the BALB/c mice, we once again observed a notable decrease in active phage particles in blood from ICR mice (Fig. 4C). The Cmax of phages in ICR mice is 1.97 x 107 PFU/mL, whereas the C24 is 280 PFU/mL. The t1/2 of phages in the blood of ICR mice is 3.66 h. In contrast, the concentration of active viral particles only decreased slightly in spleen tissue over the measured duration. The Cmax of LPS-5 in the spleen s of ICR mice was 3.89 x 108 PFU/mL, whereas the C 24 of phages in ICR mice was 5.31 x 106 PFU/mL (Fig. 4D). Other pharmacokinetic parameters are listed in Table 1. As with the BALB/c mice, these data indicate that in neutropenic ICR mice, LPS-5 bacteriophages leave the circulation rapidly after administration and accumulate in other compartments like the spleen. In comparing the figures for neutropenic ICR mice to those from conventional BALB/c mice we are struck that the figures for Cmax, C24, and t1/2 are very similar between these strains. For example, the t1/2 of phages in blood in BALB/c and ICR mice is 3.45 and 3.66 h, respectively. These data suggest that neutrophil -mediated phag ocytosis is not a major determinant of phage clearance. Phages are inactivated in circulation. Our data reveal a substantial discrepancy in phage quantity over time when measured by qPCR versus plaque assay in blood. The C24 in the blood of the BALB/c mice measured by qPCR is 2.73 x 104 PFU/mL versus 740 PFU/mL measured by plaque assay. This is a difference of around 30 -fold. In the ICR mice, the C 24 is 3610 PFU/ mL measured by qPCR versus 280 measured by plaque assay. This is equivalent to a 12-fold difference, approximately (Table 1). This observation is also supported by the disparity in the calculated t1/2. The t1/2 in the blood of the BALB/c mice measured by qPCR is 16.26 h versus 3.45 h measured by plaque assay. In the ICR mice, the t1/2 is 9.15 h measured by qPCR versus 3.66 h measured by plaque assay (Table 1). These data indicate that factors in circulation reduce the number of functional phages (measured by plaque assay) compared to the total number of phages (measured by qPCR). The fact that the phages stay active for longer in the spleen than in the blood suggests that soluble factors in the blood inactivate phage particles. Additionally, we can conclude that phages can retain activity in spleen tissue over the measured time whereas their activity drops in the blood compartment.

Here, we have examined the role of neutrophils in bacteriophage pharmacokinetics using well -established mouse models and a phage from a recent human clinical trial. We observe that the clearance of phages from blood and spleen is only minimally affected by neutropenia. For example, the t1/2 of phages in blood in BALB/c and ICR mice is 3.45 and 3.66 h, respectively. These data suggest that phagocytosis is unlikely to be a major cause of phage clearance in the body. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint These data are consistent with other literature suggesting that phag ocytosis is not a major factor in phage clearance. Indeed, the small size of phage particles (25-250 nm) may be too small for conventional phag ocytic mechanisms, as this typically involves particles of 2 –3 μm32. Our data do implicate serum factors in phage neutralization. We observe a substantial discrepancy in phage levels over time when measured by qPCR versus plaque assay. For example, the blood t1/2 of phages is 16.26 vs. 3.45 h when measured by qPCR or plaque assay, respectively. This suggests that substantial functional inactivation of circulating phages occurs over time, perhaps due to complement , fibrinogen, or other factors. To this point, there are reports indicating that bacteriophages are susceptible to complement -mediated inactivation via direct destruction or opsonization33,34. Since these mice had not seen LPS-5 phage before, it is extremely unlikely that they possessed neutralizing antibodies against these phages. These studies have several implications for phage therapy. These data suggest that clearance from peripheral blood is fairly rapid and that local delivery may prove beneficial. They suggests that approaches to identify and nullify factors involved in phage clearance in circulation might promote better pharmacokinetics. This work has several limitations. One limitation is that these studies do not include bacterial infection. The presence of infection and inflammation could dramatically impact the biodistribution and pharmacokinetics of phages. Moreover, since the phage population replicates itself in the presence of host bacteria , this element of increase through self - replication in phage populations is missing from our study. These issues and the impact of phage replication on pharmacokinetics were addressed in an excellent recent review35. Future studies will calculate the PK of phages in other tissue compartments beyond the spleen and blood and will extend this work to other phages and more complex dosing regimens. Acknowledgments We gratefully acknowledge the following funding: National Institutes of Health grant R01 HL148184-01, R01 AI12492093, R01 D C019965, and grants from the Cystic Fibrosis Foundation (CFF), the Cystic Fibrosis Research Institute (CFRI) and the Emerson Collective grant (to PLB) and grants from the Stanford University Medical Scientist Training Program grant T32 -GM007365 and the Stan ford Interdisciplinary Graduate Fellowship, Gold Family Graduate Fellow (to TD) and the Merrigan fellowship (to AE). Author Contributions: Conceptualization: AE, PLB, Methodology: TD, AE, Investigation: TD, AE, and Writing: TD, AE, PLB Competing Interest Statement: RM is a member of Felix Biotechnology, Inc., a phage therapy company. All other authors declare they have no competing interests.

1 Antimicrobial Resistance, C. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet 399, 629-655 (2022). https://doi.org:10.1016/S0140-6736(21)02724-0 2 Eva Morales and Francesc Cots and Maria Sala and Mercè Comas and Francesc Belvis and Marta Riu and Margarita Salvadá and Santiago Grau and Juan, P. H. a. M. M. M. Hospital costs of nos°Comial multi-drug resistant Pseudomonas aeruginosa acquisition. BMC Health Services Research 12, 1-8 , pmid = 22621745 (2012). https://doi.org:10.1186/1472-6963-12-122 3 Julia Emerson and Margaret Rosenfeld and Sharon McNamara and Bonnie Ramsey and Ronald, L. G. Pseudomonas aeruginosa and other predictors of mortality and morbidity in young children with cystic fibrosis. Pediatric Pulmonology 34 (2002). https://doi.org:10.1002/ppul.10127 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint 4 Malhotra, S., Hayes, D., Jr. & Wozniak, D. J. Cystic Fibrosis and Pseudomonas aeruginosa: the Host-Microbe Interface. Clin Microbiol Rev 32 (2019). https://doi.org:10.1128/CMR.00138-18 5 Pang, Z., Raudonis, R., Glick, B. R., Lin, T. J. & Cheng, Z. Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies. Biotechnol Adv 37, 177-192 (2019). https://doi.org:10.1016/j.biotechadv.2018.11.013 6 Lister, P. D., Wolter, D. J. & Hanson, N. D. Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin Microbiol Rev 22, 582-610 (2009). https://doi.org:10.1128/CMR.00040-09 7 Van Nieuwenhuyse, B. et al. Bacteriophage-antibiotic combination therapy against extensively drug-resistant Pseudomonas aeruginosa infection to allow liver transplantation in a toddler. Nat Commun 13, 5725 (2022). https://doi.org:10.1038/s41467-022-33294-w 8 Waters, EW et al., Phage therapy is highly effective against chronic lung infections with Pseudomonas aeruginosa. Thorax 72 (2017). https://doi.org:10.1136/thoraxjnl- 2016-209265 9 Kortright, K. E., Chan, B. K., Koff, J. L. & Turner, P. E. Phage Therapy: A Renewed Approach to Combat Antibiotic-Resistant Bacteria. Cell Host Microbe 25, 219-232 (2019). https://doi.org:10.1016/j.chom.2019.01.014 10 Cano, E. J. et al. Phage Therapy for Limb-threatening Prosthetic Knee Klebsiella pneumoniae Infection: Case Report and In Vitro Characterization of Anti-biofilm Activity. Clin Infect Dis (2020). https://doi.org:10.1093/cid/ciaa705 11 Yang, X., Haque, A., Matsuzaki, S., Matsumoto, T. & Nakamura, S. The Efficacy of Phage Therapy in a Murine Model of Pseudomonas aeruginosa Pneumonia and Sepsis. Front Microbiol 12, 682255 (2021). https://doi.org:10.3389/fmicb.2021.682255 12 Chow, M. Y. T. et al. Pharmacokinetics and Time-Kill Study of Inhaled Antipseudomonal Bacteriophage Therapy in Mice. Antimicrob Agents Chemother 65 (2020). https://doi.org:10.1128/AAC.01470-20 13 Chan, B. K. et al. Phage selection restores antibiotic sensitivity in MDR Pseudomonas aeruginosa. Sci Rep 6, 26717 (2016). https://doi.org:10.1038/srep26717 14 Kohler, T. et al. Personalized aerosolised bacteriophage treatment of a chronic lung infection due to multidrug-resistant Pseudomonas aeruginosa. Nat Commun 14, 3629 (2023). https://doi.org:10.1038/s41467-023-39370-z 15 Chen, Q. et al. Bacteriophage and Bacterial Susceptibility, Resistance, and Tolerance to Antibiotics. Pharmaceutics 14 (2022). https://doi.org:10.3390/pharmaceutics14071425 16 Blasco, L. et al. Case report: Analysis of phage therapy failure in a patient with a Pseudomonas aeruginosa prosthetic vascular graft infection. Front Med (Lausanne) 10, 1199657 (2023). https://doi.org:10.3389/fmed.2023.1199657 17 Le Fl°Ch et al., Efficacy and tolerability of a c°Cktail of bacteriophages to treat burn wounds infected by Pseudomonas aeruginosa (PhagoBurn): a randomised, controlled, double-blind phase 1/2 trial. The Lancet Infectious Diseases 19 (2019). https://doi.org:10.1016/S1473-3099(18)30482-1 18 Mitropoulou, G. et al. Phage therapy for pulmonary infections: lessons from clinical experiences and key considerations. Eur Respir Rev 31 (2022). https://doi.org:10.1183/16000617.0121-2022 19 Nang, S. C. et al. Pharmacokinetics/pharmacodynamics of phage therapy: a major hurdle to clinical translation. Clin Microbiol Infect 29, 702-709 (2023). https://doi.org:10.1016/j.cmi.2023.01.021 20 Dabrowska, K. & Abedon, S. T. Pharmacologically Aware Phage Therapy: Pharmacodynamic and Pharmacokinetic Obstacles to Phage Antibacterial Action in Animal and Human Bodies. Microbiol Mol Biol Rev 83 (2019). https://doi.org:10.1128/MMBR.00012-19 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint 21 Tiwari, B. R., Kim, S., Rahman, M. & Kim, J. Antibacterial efficacy of lytic Pseudomonas bacteriophage in normal and neutropenic mice models. J Microbiol 49, 994-999 (2011). https://doi.org:10.1007/s12275-011-1512-4 22 Molenaar, T. J. et al. Uptake and pr°Cessing of modified bacteriophage M13 in mice: implications for phage display. Virology 293, 182-191 (2002). https://doi.org:10.1006/viro.2001.1254 23 Mark, R. G. a. M. E. T. a. C. R. M. Fate of bacteriophage lambda in Non-immune germ-free mice. Nature 246, 221-223 , pmid = 4586796 , publisher = Nature Publishing Group (1973). https://doi.org:10.1038/246221a0 24 Keller, R. & Engley, F. B., Jr. Fate of bacteriophage particles introduced into mice by various routes. Pr°C S°C Exp Biol Med 98, 577-580 (1958). https://doi.org:10.3181/00379727-98-24112 25 Dana Holger and Razieh Kebriaei and Taylor Morrisette and Katherine Lev and Jose Alexander and Michael, R. Clinical Pharmacology of Bacteriophage Therapy: A F°Cus on Multidrug-Resistant Pseudomonas aeruginosa Infections. Antibiotics 10 (2021). https://doi.org:10.3390/antibiotics10050556 26 Hodyra-Stefaniak, K. et al. Mammalian Host-Versus-Phage immune response determines phage fate in vivo. Scientific Reports 5, 14802 (2015). https://doi.org:10.1038/srep14802 27 Geier, M. R., Trigg, M. E. & Merril, C. R. Fate of bacteriophage lambda in non- immune germ-free mice. Nature 246, 221-223 (1973). https://doi.org:10.1038/246221a0 28 Van Belleghem, J. D., Clement, F., Merabishvili, M., Lavigne, R. & Vaneechoutte, M. Pro- and anti-inflammatory responses of peripheral blood mononuclear cells induced by Staphyl°C°Ccus aureus and Pseudomonas aeruginosa phages. Sci Rep 7, 8004 (2017). https://doi.org:10.1038/s41598-017-08336-9 29 Zhang, L. et al. Staphyl°C°Ccus aureus Bacteriophage Suppresses LPS-Induced Inflammation in MAC-T Bovine Mammary Epithelial Cells. Front Microbiol 9, 1614 (2018). https://doi.org:10.3389/fmicb.2018.01614 30 Zuluaga, A. F. et al. Neutropenia induced in outbred mice by a simplified low-dose cyclophosphamide regimen: characterization and applicability to diverse experimental models of infectious diseases. BMC Infect Dis 6, 55 (2006). https://doi.org:10.1186/1471-2334-6-55 31 Dharmaraj, T. et al. Rapid assessment of changes in phage bioactivity using dynamic light scattering. PNAS Nexus 2, pgad406 (2023). https://doi.org:10.1093/pnasnexus/pgad406 32 Champion, J. A., Walker, A. & Mitragotri, S. Role of particle size in phag°Cytosis of polymeric microspheres. Pharm Res 25, 1815-1821 (2008). https://doi.org:10.1007/s11095-008-9562-y 33 ROSENBLUM, S. E. S. a. R. A. F. a. E. D. Effect of Zymosan on Bacteriophage Clearance. Science 125, 742-743 , publisher = American Ass°Ciation for the Advancement of Science (AAAS) (1957). https://doi.org:10.1126/science.125.3251.742 34 Gorski, K. D. a. P. M. a. A. P. a. K. H. a. B. O. a. D. L. a. Z. K. a. A. L. a. A. Immunogenicity Studies of Proteins Forming the T4 Phage Head Surface. Journal of Virology 88, 12551-12557 , publisher = American S°Ciety for Microbiology (2014). https://doi.org:10.1128/jvi.02043-14 35 Abedon, S. T. How Simple Maths Can Inform Our Basic Understanding of Phage Therapy. Clin Infect Dis 77, S401-S406 (2023). https://doi.org:10.1093/cid/ciad480 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint Figure 1: LPS5, the phage used in these studies. A. A representative transmission electron microscopy image of LPS-5 is shown at 80,000x magnification. B. Lytic plaque morphology for LPS-5 on Pseudomonas aeruginosa PAO1. Phage LPS-5 Order: Caudovirales Family: Myoviridae Genus: Pakpunavirus Tail length: 140 ± 2 nm Tail width: 20 ± 1 nm Head length: 70 ± 3 nm A B (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint BALB/c mice – plaque assay 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.503*X + 43.54 R2=0.9935 0 2 4 6 8 10 0 10 20 30 40 Spleen spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.363*X + 45.18 R2=0.9944 0 2 4 6 8 10 0 10 20 30 40 Blood spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.551*X + 44.73 R2=0.9994 0 2 4 6 8 10 0 2 4 6 8 10 PBS spiked with phage Nominal titer (PFU/sample) Measured titer (PFU/sample) Y = 0.9886*X - 0.3805 R2 = 0.9977 0 2 4 6 8 10 0 2 4 6 8 10 PBS spiked with phage Nominal titer (PFU/sample) Measured titer (PFU/sample) Y = 0.9886*X - 0.3805 R2 = 0.9977 0 2 4 6 8 10 0 2 4 6 8 10 PBS spiked with phage Nominal titer (PFU/sample) Measured titer (PFU/sample) Y = 0.9886*X - 0.3805 R2 = 0.9977 0 2 4 6 8 10 0 2 4 6 8 10 PBS spiked with phage Nominal titer (PFU/sample) Measured titer (PFU/sample) Y = 0.9886*X - 0.3805 R2 = 0.9977 0 2 4 6 8 10 0 2 4 6 8 10 Spleen Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 1.012*X - 0.2649 R2=0.9939 0 2 4 6 8 10 0 2 4 6 8 10 Blood Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 1.0078*X - 0.2146 R2=0.9942 0 2 4 6 8 10 0 2 4 6 8 10 Pure phage Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 0.9888*X - 0.07345 R2=0.9986 0 2 4 6 8 10 0 2 4 6 8 10 Spleen Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 1.012*X - 0.2649 R2=0.9939 0 2 4 6 8 10 0 2 4 6 8 10 Blood Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 1.0078*X - 0.2146 R2=0.9942 0 2 4 6 8 10 0 2 4 6 8 10 PBS spiked with phage Nominal titer (PFU/sample) M easured titer (PFU/sam ple) Y = 0.9886*X - 0.3805 R2 = 0.9977 0 2 4 6 8 10 0 2 4 6 8 10 PBS spiked with phage Nominal titer (PFU/sample) M easured titer (PFU/sam ple) Y = 0.9886*X - 0.3805 R2 = 0.9977 0 2 4 6 8 10 0 2 4 6 8 10 PBS spiked with phage Nominal titer (PFU/sample) M easured titer (PFU/sam ple) Y = 0.9886*X - 0.3805 R2 = 0.9977 0 2 4 6 8 10 0 2 4 6 8 10 PBS spiked with phage Nominal titer (PFU/sample) Measured titer (PFU/sample) Y = 0.9886*X - 0.3805 R2 = 0.9977 0 2 4 6 8 10 0 2 4 6 8 10 PBS spiked with phage Nominal titer (PFU/sample) Measured titer (PFU/sample) Y = 0.9886*X - 0.3805 R2 = 0.9977 0 2 4 6 8 10 0 2 4 6 8 10 PBS spiked with phage Nominal titer (PFU/sample) Measured titer (PFU/sample) Y = 0.9886*X - 0.3805 R2 = 0.9977 Neutropenic ICR mice – plaque assay A B C D E F 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 0 2 4 6 8 10 0 10 20 30 40 Spleen spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.215*X + 42.56 R2=0.9939 0 2 4 6 8 10 0 10 20 30 40 Blood spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.309*X + 43.68 R2=0.9937 0 2 4 6 8 10 0 2 4 6 8 10 PBS spiked with phage Nominal titer (PFU/sample) Measured titer (PFU/sample) Y = 0.9886*X - 0.3805 R2 = 0.9977 0 2 4 6 8 10 0 2 4 6 8 10 Spleen spiked with phage Nominal titer (PFU/sample) Measured titer (PFU/sample) Y = 0.9746*X - 0.07514 R2 = 0.9987 0 2 4 6 8 10 0 2 4 6 8 10 Blood spiked with phage Nominal titer (PFU/mL) Measured titer (PFU/mL) Y = 0.9929*X - 0.2521 R2 = 0.9930 G H I J K L Figure 2: Calibration curves for phage titrations in blood and spleen. To assess our ability to accurately quantify phages in blood and tissue samples, we performed titration studies using plaque assays and qPCR assays as our readouts. For these studies phages with established, nominal concentrations were added to PBS (saline), blood, or spleen tissue collected from BalbC mice (A-F) or ICR mice (G-L). These were then analyzed using plaque assays (A-C, G-I) or qPCR (D-F, J-L). Neutropenic ICR mice – qPCR assay BALB/c mice – qPCR assay 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 0 2 4 6 8 10 0 2 4 6 8 10 Spleen Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 1.012*X - 0.2649 R2=0.9939 0 2 4 6 8 10 0 2 4 6 8 10 Blood Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 1.0078*X - 0.2146 R2=0.9942 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 0 2 4 6 8 10 0 2 4 6 8 10 Spleen Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 1.012*X - 0.2649 R2=0.9939 0 2 4 6 8 10 0 2 4 6 8 10 Blood Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 1.0078*X - 0.2146 R2=0.9942 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 0 2 4 6 8 10 0 2 4 6 8 10 Spleen Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 1.012*X - 0.2649 R2=0.9939 0 2 4 6 8 10 0 2 4 6 8 10 Blood Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 1.0078*X - 0.2146 R2=0.9942 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 0 2 4 6 8 10 0 2 4 6 8 10 Spleen Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 1.012*X - 0.2649 R2=0.9939 0 2 4 6 8 10 0 2 4 6 8 10 Blood Log10 (Spike phage titer) (PFU/sample) Log10 (Recovered phage titer) (PFU/sample) Y = 1.0078*X - 0.2146 R2=0.9942 0 2 4 6 8 10 0 10 20 30 40 PBS spiked sample: Barcode standard curve Nominal Titer (PFU) Ct value Y = -3.718*X + 45.76 R2=0.9970 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint Figure 3: Schematic of biodistribution and pharmacokinetics experiment. In these studies, Phage LPS5 was administered IV as a single dose (0.1 mL/mouse at 1x1011 PFU/mL) to BALB/c mice or ICR mice. Animals were sacrificed after 0.25, 1, 2, 4, 8, 12 or 24. At every sampling time point, five mice were sacrificed, and the phage concentration was measured in whole blood and spleen homogenates by qPCR and plaque assay. Non-compartmental analysis (NCA) was conducted with Phoenix WinNonLin to estimate pharmacokinetic parameters. Phage LPS5 BALB/c or ICR mice qPCR and plaque assay Tissue collection (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint Figure 4. Pharmacokinetics and biodistribution of LPS5 bacteriophage in blood and spleen tissue over time in BalbC (wild type) and ICR (neutropenic) mice. Mice were injected with 0.1 mL of an 1x1010 PFU/mL LPS5 phage suspension. At each sample time point over 24 h, five mice were sacrificed at the 0.25, 1, 2, 4, 8, 12, and 24 h. qPCR and plaque assays were performed on blood and spleen tissue homogenates. 45 immunocompetent mice and 45 neutropenic mice were used (for experimental design, see Material and Methods). Mean +/- SD is plotted over time. (A, C) Blood pharmacokinetics of LPS5 in immunocompetent BALB/c (A) and neutropenic ICR (C) mice. (B, D) Spleen biodistribution of LPS5 in immunocompetent BALB/c (B) and neutropenic ICR (D) mice. LOD = limit of detection. 0 10 20 30 1×100 1×101 1×102 1×103 1×104 1×105 1×106 1×107 1×108 1×109 LOD qPCR-assay Spotting assay 0 10 20 30 1×100 1×101 1×102 1×103 1×104 1×105 1×106 1×107 1×108 1×109 LOD qPCR-assay Spotting assay 0 10 20 30 1×100 1×101 1×102 1×103 1×104 1×105 1×106 1×107 1×108 1×109 LOD qPCR-assay Spotting assay 0 10 20 30 1×100 1×101 1×102 1×103 1×104 1×105 1×106 1×107 1×108 1×109 LOD qPCR-assay Spotting assay BALB/c mice; Blood ICR mice; Blood BALB/c mice; Spleen ICR mice; Spleen A B C D PFU/mLPFU/mL PFU/mL Time (hours) Time (hours) Time (hours) PFU/mL Time (hours) (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint Table 1: Pharmacokinetic parameters for BALB/c and neutropenic ICR mice in blood and spleen based on qPCR ad plaque assay. The pharmacokinetic parameters were obtained from non-compartmental analysis (NCA) using Phoenix WinNonlin software. The following values were calculated: elimination half-life t1/2, Initial concentration 0.25h after dose C0, concentration after 24h C24, Area under the curve from the time of dosing to the time of the last measurable concentration AUClast, AUC from the time of dosing extrapolated to infinity AUCInf, Mean residence time MRT, Volume of distribution at steady state Vss, and clearance CL CMAX (PFU/mL) (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted January 27, 2024. ; https://doi.org/10.1101/2024.01.25.577154doi: bioRxiv preprint