Effect of eicosapentaenoic acid on innate immune responses in Atlantic salmon cells infected with infectious salmon anemia virus

Effect of eicosapentaenoic acid on innate immune responses in Atlantic salmon cells infected with infectious salmon anemia virus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effect of eicosapentaenoic acid on innate immune responses in Atlantic salmon cells infected with infectious salmon anemia virus Ingrid Holmlund, Samira Ahmadi, Bente Ruyter, Tone-Kari Østbye, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5071779/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 09 Jan, 2025 Read the published version in Virology Journal → Version 1 posted 9 You are reading this latest preprint version Abstract Aquaculture is one of the world's fastest-growing sectors in food production but with multiple challenges related to animal handling and infections. The disease caused by infectious salmon anemia virus (ISAV) leads to outbreaks of local epidemics, reducing animal welfare, and causing significant economic losses. The composition of feed has shifted from marine ingredients such as fish oil and fish meal towards a more plant-based diet causing reduced levels of EPA. The aim of this study was to investigate whether low or high levels of EPA affect the expression of genes related to the innate immune response 48 hours after infection with ISAV. The study includes seven experimental groups: ± ISAV and various levels of EPA up to 200 µM. Analysis of RNA sequencing data showed that more than 3000 genes were affected by ISAV alone (without additional EPA). In cells with increasing levels of EPA, more than 2500 additional genes were differentially expressed. This indicates that high levels of EPA concentration have an independent effect on gene expression in virus-infected cells, not observed at lower levels of EPA. Analyses of enriched biological processes and molecular functions (GO and KEGG analysis) revealed that EPA had a limited impact on the innate immune system alone, but that many processes were affected by EPA when cells were virus infected. Several biological pathways were affected, including protein synthesis (ribosomal transcripts), peroxisome proliferator activated receptor (PPAR) signaling, and ferroptosis. Cells exposed to both increasing concentrations of EPA and virus displayed gene expression patterns indicating increased formation of oxygen radicals and that cell death via ferroptosis was activated. This gene expression pattern was not observed during infection at low EPA levels or when ASK cells were exposed to the highest EPA level (200 μM) without virus infection. Cell death via ferroptosis may therefore be a mechanism for controlled cell death and thus reduction of virus replication when there are enough PUFA in the membrane. Atlantic salmon Polyunsaturated fatty acid Eicosapentaenoic acid Virus Infectious salmon anemia virus Transcriptomics Viral disease Ferroptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Since the first reports of an Atlantic salmon anemia disease and the identifications of the causative agent, infectious salmon anemia virus (ISAV) ( 1 ), this virus has created serious health and fish welfare problems on both sides of the Atlantic ( 2 , 3 ). Using strict management procedures, the initial wave of outbreaks was reduced ( 4 ) and vaccines have been developed ( 5 ), but this disease is still a serious problem for the salmon aquaculture industry. ISAV belongs to the Orthomyxidae negative sense segmented RNA viruses which also includes the influenza genera ( 6 ). Detailed studies of host and tissue tropism ( 2 , 7 , 8 ), uptake ( 9 , 10 ), replication ( 11 , 12 ) as well as innate ( 13 – 15 ) and adaptive immune responses during ISAV infections ( 16 – 19 ) have been reported but many questions regarding virus-host interactions remains to be investigated. The recent publication of the first reverse genetics system for ISAV will certainly open new avenues for deeper molecular characterization and vaccine development ( 20 ). Another important area of research into virus-host interactions is the role of dietary and cellular fatty acids on innate and adaptive immune responses during infection. Results from both experimental ( 21 – 25 ) and clinical studies ( 26 – 29 ) suggest that polyunsaturated fatty acids (PUFA) like eicosapentaenoic (EPA) and docosahexaenoic acid (DHA) and their metabolites play important roles in host responses against a range of infections ( 30 ). This focus on the interplay between metabolism and immunity have led to development of a branch of immunology called immunometabolism ( 31 ) and many of these insights are relevant for aquaculture as much as the feed is the one of the main elements in the production chain of fish ( 32 ). As in mammals, multiple studies suggest a role for PUFAs in the maintenance of growth and health in Atlantic salmon ( 33 – 35 ) as well as immunity ( 36 – 38 ). To protect limited marine raw materials (like herring and capelin) for salmon feed production, plant and algae based raw materials with lower PUFA levels are taking over ( 32 ). Although long chain PUFAs like EPA and DHA have been regarded as essential for optimal growth and development in vertebrates ( 33 , 39 ), the dietary demand for EPA in Atlantic salmon has recently been questioned ( 40 ). Recent findings concerning the intersection of energy metabolism with innate immunity to viral infections like the interaction of STING (stimulator of interferon genes) with FADS2 (fatty acid synthase 2) ( 41 ) and the role of lactate in regulation of MAVS (mitochondrial antiviral signaling protein) ( 42 ) suggest that dietary lipids play a role in innate immunity. Likewise, expression levels of an enzyme involved in production of endogenous fatty acids (oleoyl-acyl-carrier-protein (ACP) hydrolase (OLAH)) was associated with severity of multiple viral respiratory functions via effects on macrophage lipid droplet dynamics ( 43 ). The regulated cell death pathway named ferroptosis ( 44 ) occurring during various forms of viral infections ( 45 ) have also been linked to the level of cellular PUFAs. These recent developments incited us to investigate the role of EPA in antiviral immunity in Atlantic salmon kidney (ASK) cells. The cellular levels of EPA may affect antiviral signaling responses in at least three separate ways. Firstly, as ligands for peroxisome proliferator-activated receptors (PPARs) or G-protein coupled receptor 120 (GPR120) ( 46 ). Secondly, as metabolic precursors of immune modulators like resolvins and eicosanoids ( 47 ) and lastly, by altering the composition of membrane microdomains called “rafts” where membrane bound signaling proteins like toll-like receptors (TLRs) and MAVS anchor and signal from ( 48 , 49 ). Previous studies of PUFA effects on innate immunity in tissues or cells from Atlantic salmon are not conclusive as EPA may confer detrimental (50, 51 ), neutral, ( 52 , 53 ) or supportive ( 54 ) effects, depending on developmental stage and type of stressor. To gain a more mechanistic view of the interplay between EPA and innate immunity to viral infection in Atlantic salmon, we measured transcriptional responses to ISAV infection at five different cellular EPA levels. One of the main findings not observed with virus or high EPA alone (only in combination) were the enrichment of transcripts related to the ferroptosis and PPAR pathways. This may suggest that the combined stress of high PUFA and viral infection initiates iron dependent lipid peroxide formation and cell death as a host defense mechanism to control viral replication. Materials and Methods Cell culture Knut Falk (Norwegian Veterinary Institute) kindly provided the Atlantic salmon kidney (ASK) cell line used in this project. The cells were cultivated at 20°C and split (1:2) once a week. The cell media consisted of Leibovitz L-15 medium (Lonza BioWhittaker, Verviers, Belgium) supplemented with L-glutamine (4 mM - Lonza BioWhittaker, Verviers, Belgium), fetal bovine serum (10% - Gibco, Life Technologies, Bleiswijk, The Netherlands), 2-mercaptoethanol (40 µM - Gibco, Life Technologies, Bleiswijk, The Netherlands) and gentamicin (50 mg/mL - Lonza BioWhittaker, Walkersville, USA). The cells were acclimatized one week before the experiment started; the cultivation temperature was reduced to 15°C, and the content of fetal bovine serum in the media was reduced to 2%. These conditions were also used during the experimental period. Virus propagation The ISAV strain used in this experiment was Glesvær 2/90, which has been shown to result in high mortality in Atlantic salmon ( 55 ). The virus was produced and isolated as described by Andresen et al. ( 56 ). Experimental design ASK cells (passages 40–50) were seeded in 14 wells (35 mm, 6-well plates), with a density of 1.5 x 10 5 cells per well. The cells were cultivated overnight (15°C) for adhesion. Thereafter, EPA (Sigma-Aldrich, St. Louis, MO, USA) (bound to BSA) of different concentrations (0, 0, 25, 50, 100, 200, 200 µM) was added to duplicate wells (n = 2), and the cells were incubated for 7 days. The wells were washed three times with sterile PBS (QIAGEN, Hilden, Germany), before performing the in vitro infection. A virus suspension with a multiplicity of infection (MOI) of 1 in serum-free L-15 medium was added to 10 of the wells (0, 25, 50, 100, 200 µM). The extra wells without EPA (n = 2) and with 200 µM EPA (n = 2) were used as uninfected controls. The infected wells were incubated for 4 h to allow for virus adsorption, followed by addition of previous culture medium (L-15 supplemented ± EPA). The cells were incubated for 48 h post-infection (9 days of cultivation in total), then washed three times with PBS, lysed using buffer RLT (QIAGEN, Hilden, Germany) and stored at -20°C until RNA isolation. This experiment was repeated three times, which resulted in six technical replicates per sample (n = 6), and 42 samples in total. Fatty acid analysis ASK cells were grown in flasks (75 cm 2 ) with L-15 supplemented medium (2% FBS) and EPA (0, 25, 50, 100, 200 µM) for one week. The total lipids of the cells and cell culture media were extracted as described by Folch et al. ( 57 ), by homogenizing the tissue with 2:1 chloroform-methanol (v/v). The chloroform phase was isolated, and nitrogen was used to evaporate the solvent, resulting in the residual lipid extract. Benzene was used to re-dissolve the lipids, and 2,2-dimethoxypropane and methanolic HCl were added for transesterification overnight at room temperature, as described by Mason and Waller and by Hoshi et al. ( 58 , 59 ). A gas chromatograph (Hewlett Packard 6890) with helium as a carrier gas, a split injector, a SGE BPX70 capillary column (length: 60 m, internal diameter: 0.25 mm, thickness of film: 0.25 µM), a flame ionization detector (FID) and the HP Chem Station software was used to separate the fatty acid methyl esters and monitor the process. The detector and injector of the chromatograph had a temperature of 300°C, while the oven temperature was raised from 50 to 170°C (4°C/min) and then further raised to 200°C (0.5°C/min). Peaks appeared in the chromatogram as the different compounds eluted from the column and passed through the detector. Individual fatty acid methyl esters were identified by reference to well-characterized standards. The relative amount of each fatty acid was expressed as a percentage of the total amount of fatty acid in the analyzed sample, and the absolute amount of fatty acid per gram of tissue was calculated using C23:0 methyl ester as the internal standard. Total RNA isolation Total RNA was extracted for sequencing and qPCR using RNeasy Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer’s tissue protocol, with an optional on-column DNase I digestion to remove gDNA (RNase-Free DNase Set, QIAGEN, Hilden, Germany). The RNA samples were eluted in 50 µL RNase free distilled water, and the RNA concentrations were measured using a PicoDrop Pico100 (PicoDrop Technologies, Cambridge, UK). RNA sequencing The RNA samples (n = 42) were sent to the Norwegian Sequencing Centre (NSC), where the RNA qualities were checked using the Agilent 2100 Bioanalyzer (Agilent, USA). The cDNA libraries were prepared using the TruSeq Stranded mRNA Library Prep Kit (Illumina Inc., San Diego, USA) and sequenced to 150 bp paired end reads with the Illumina HiSeq 4000 sequencer. Qualitative PCR (qPCR) The High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, United States) was used to make cDNA, using the manufacturer’s protocol. The LightCycler 480 and SYBR Green Master Mix (both from Roche Diagnostics, Basel, Switzerland) was used to perform qPCR in 96-well plates. The initial heating lasted for 5 minutes (95°C), and the cycling conditions (40 cycles) were 95°C (10 sec), 60°C (10 sec), and 72°C (10 sec), and the melting curves were measured at 95°C (5 sec) and 65°C (1 min). The qPCR experiment was repeated three times with two technical replicates per sample. The cycle threshold (Ct) values of the samples were obtained to calculate the relative expression levels of the genes (delta-delta Ct method) ( 60 ), with 18S and ef1a as reference genes ( 61 ). The primers used are listed in Table 1 . Table 1 List of primers used in qPCR analysis. Genes Direction Sequence 5′→3′ Accession Number Amplicon Reference ef1a F CACCACCGGCCATCTGATCTACAA AF321836 77 (62) R TCAGCAGCCTCCTTCTCGAACTTC 18S F TGTGCCGCTAGAGGTGAAATT AJ427629.1 61 (63) R GCAAATGCTTTCGCTTTCG ifna1 F CCTGCCATGAAACCTGAGAAGA AY216594 107 (61) R TTTCCTGATGAGCTCCCATGC isg15 F ATGGTGCTGATTACGGAGCC AY926456 151 (64) R TCTGTTGGTTGGCAGGGACT mx1/2 F TGATCGATAAAGTGACTGCATTCA NM_001123690.1/ NM_001123693.1 80 (65) R TGAGACGAACTCCGCTTTTTCA ifih1 F GAGAGCCCGTCCAAAGTGAA XM_014164134 389 (56) R TCCTCTGAACTTTCGGCCAC ISAVseg5 F GAAAGCCCTGCTCTGGC HQ259675.1 50 (66) R TCCTCAAGTCTGCTTCGGGA ISAVseg6 F AGGCCAAAAACGGAAATGGA HQ259676.1 118 (66) R CCGTCAGTGCAGTCATTGGTT ISAVseg7 F GAAATGGACAGAGACGGCGTATCA HQ259677.1 124 (66) R GCTCAACTCCAGCTCTCTCATTGT ef1a - elongation factor 1 alpha, 18S − 18S ribosomal RNA, ifna1 – interferon alpha-1, isg15 - interferon-stimulated gene 15, mx1/2 - interferon-induced GTP-binding protein Mx1/2, ifih1 - interferon induced with helicase C domain 1, ISAVseg5 – infectious salmon anemia virus gene segment 5, ISAVseg6 – infectious salmon anemia virus gene segment 6, ISAVseg7 – infectious salmon anemia virus gene segment 7. Bioinformatics and statistics HISAT2 ( 67 ) was used to map the FASTQ sequence read files from the RNA sequencing to the Atlantic salmon genome (GCF_000233375.1_ICSASG_v2_genomic.fna). The existing Atlantic salmon annotation file (GCF_000233375.1_ICSASG_v2_genomic.gff) was used to assemble the transcripts with StringTie ( 68 ). Both the genome and the annotation file were downloaded from NCBI (annotation release 100). Following the alignment and assembly of transcripts, the R software package DESeq2 (version 1.40.2) was utilized to quantify the differential expression of genes between the samples and against the controls ( 69 , 70 ). The resulting gene expression tables were filtered using a threshold of median > 10, to remove genes that had zero or low counts. The adjusted p-value (padj) was calculated using the Benjamini-Hochberg (BH) procedure, and the genes classified as differentially expressed genes (DEGs) had a p-value (padj) below 0.01. A gene was considered upregulated if the log2 fold change (Log2FC) > 1, and downregulated if Log2FC < -1. The sample analysis and the exploratory plots are shown in Supplementary file 1. The gene ontology and KEGG pathway analysis was performed using the R package clusterProfiler ( 71 ), with 0.01 as a cutoff for the p-values and q-values (BH adjusted). The KEGG pathway maps were visualized using the R package Pathview ( 72 ). Results Verification of infection To verify that cells were infected and responsive before submitting the samples for sequencing, we analyzed a few well known viral and interferon induced salmon transcripts by qPCR. Figure 1 shows that all four transcripts were robustly upregulated by ISAV at 48 h p.i. suggesting that the cells were indeed infected. We also confirmed infection by qPCR of three ISAV genomic RNA segments, and the cells were positive for all (not shown). Fatty acid analysis The EPA content (%) of cells and cell culture media is presented in Supplementary file 1 (Figure S1 ). The cellular content of EPA increased from 2% when no EPA was added, to 21% of total fatty acids when EPA was supplemented at 200 µM. RNA sequencing An exploratory analysis of the RNA-seq raw data is presented in Supplementary file 1 (Figure S2-S7). Briefly, the samples were sequenced to a depth of about 15–20 million reads (150 nt, double reads) with a mapping frequency to the Atlantic salmon genome of about 80%. Counts were log normally distributed and tests of replicate correlation showed good agreement between technical replicates. PCA and clustering analysis suggested that ISAV infection was the main driver of variability, but EPA also displayed an effect. One of the samples had corrupted sequencing files and were removed from further analyses (EPA, 50 µM, replicate 6). Transcriptome effects of ISAV infection and EPA alone As previously shown by Andresen ( 56 ), infection of ISAV in these cells had strong transcriptional effects with more than 3000 genes dysregulated at 48 h p.i. (Fig. 2 ). This virus elicits expression of transcripts that were enriched in antiviral and immune system responses related to biological processes and pathways (Fig. 3 ). As a control, the effects of only 200 µM EPA for 9 days without virus was also analyzed. Only 268 transcripts were moderately differentially expressed in this group, suggesting that EPA treatment alone did not stress the cells (not shown). Transcriptome effects of increasing levels of EPA during ISAV infection When cells exposed to increasing levels of EPA (0–200 µM) for 7 days were infected with ISAV, a total of 2921 transcripts were affected by the levels of this fatty acid (adjusted p-value < 0.01). Compared to the effects of virus alone, the changes in expression levels were modest but many transcripts displayed a clear dose response to EPA levels (Figs. 4 and 5 ). Transcripts that showed a positive correlation to EPA levels included antimicrobial peptides (cathelicidin), MMP9 , and ARF4 among others. Transcripts with a negative correlation to cellular EPA levels included GTP binding signaling proteins, thrombospondin, and thioredoxin interacting protein. The overlap of transcripts between DEGs induced by ISAV alone and DEGs affected by the level of EPA was limited (Fig. 6 ). Only 120 of 3421 transcripts changed by viral infection were modulated by the cellular levels of EPA, suggesting that alternative signaling pathways were activated with increasing levels of the fatty acid. When analyzing the levels of viral transcripts (ISAV segments 5, 6, and 7) at 48 hours p.i. we did not observe a significant effect of EPA levels on viral replication (Fig. 7 ). KEGG pathway enrichment analysis with gene sets that were affected by EPA revealed that processes related to protein synthesis, amino acid, RNA metabolism, PPAR pathway, fatty metabolism, and ferroptosis were enriched with transcripts stimulated by EPA (Fig. 8 ). Cell cycle, p53 pathway, and TGF-beta signaling pathways were enriched with transcripts inhibited by EPA. Taking a closer look at the affected transcripts in the PPAR pathway revealed that all transcripts connected to this pathway were upregulated by EPA. Target genes for PPAR-alpha, -delta, and -gamma were affected by EPA in ISAV infected cells (Fig. 9 ) Enrichment of transcripts in the ferroptosis pathway was another interesting feature of transcriptional changes observed with increasing EPA levels not seen in control cells infected with ISAV. Ferroptosis is a regulated iron dependent cell death pathway characterized by reduced antioxidant capacity, accumulation of lipid peroxides, and reactive oxygen species ( 44 ). High levels of ferritin combined with reduced levels of the system Xc − subunit SLC7A11 (transporter for glutathione precursor cysteine) and glutathione peroxidase 4 (GPX4) was observed in EPA treated cells infected with ISAV, which may trigger activation of this pathway (Fig. 10 ). Discussion Recent developments in the understanding of the interplay between dietary fatty acids and the immune responses at the cellular and organismal levels ( 41 , 73 , 74 ) requires further investigations of these relationships in farmed aquatic animals where feed is one of the main material factors ( 32 , 75 ). Previous reports suggest that salmon feeds with higher levels of EPA may confer a protective effect against viral ( 76 , 77 ) and bacterial infections ( 78 ). However, the minimal dietary requirements for EPA in salmon feed are not firmly established and may be dependent on developmental stage and other environmental factors ( 79 – 81 ). Some reports conclude that EPA is not essential for normal health and growth of Atlantic salmon ( 40 ). Nevertheless, that study was a short-term study (14 weeks) and used small fish of approximately 53 g at the beginning and concluded when fish reached approximately 200 g at the end of the feeding trial. Further, prior to the experiment a commercial diet was used. Commercial diets at this life stage are typically rich in n-3 VLC-PUFAs and this may have provided enough n-3 PUFAs to be sustained by the fish during the short feeding trial. In this report we have studied the transcriptomic responses to infectious salmon anemia virus in salmon cells under various cellular levels of EPA (from 2 to 21% of total fatty acids). We first confirmed the infection model by qPCR of canonical interferon transcripts and viral genomic segments and found that the cells were robustly infected. RNA-seq analysis also confirmed the transcriptomic changes resulting from this infection in cells cultured in standard medium ( 56 ). The sampling time point (48 h p.i.) was based on previous kinetic studies ( 56 ), capturing the innate transcriptional response in these cells. However, this sample was probably too early to capture effects of EPA on viral replication, as this normally takes about 72 hours to develop quantifiable levels ( 82 ). Results from pathway enrichment analysis were similar but not identical to a comparable study using the interferon inducer poly I:C instead of virus as the immunological stimuli ( 83 ). The effects of poly I:C in combination with high levels of EPA were more restricted in the sense that multiple pathways like ECM-receptor interaction, autophagy, apelin, and VEGF-signaling were suppressed. Incubation with the highest concentration of EPA alone without any additional inflammatory stimuli had limited effects on the transcriptional profile of the cells and did not reveal enriched GO or KEGG terms. This suggests that the highest concentration (200 µM) was well tolerated by the cells. However, combined with ISAV infection as the inflammatory signal, robust transcriptional changes involving multiple metabolic pathways were observed at higher levels of EPA. In addition to more general pathways like ribosome, carbohydrate, amino acid, and fatty acid metabolism, pathways enriched by EPA were ferroptosis, PPAR signaling, and lysosomal pathways. Transcripts downregulated by EPA were involved in cell cycle p53- and TGF-beta signaling (Fig. 7 ). These observations are in line with results obtained using poly I:C as inflammatory stimuli ( 83 ). Although originally described as regulators of lipid metabolism, PPARs are now also recognized for their role in controlling inflammation induced by lipopolysaccharides ( 84 ) or via inhibition of interferon production ( 85 ). In our experimental in vitro model, higher levels of EPA may therefore attenuate inflammatory responses to viral infection via activation of PPAR pathways, similar to effects observed with other viruses ( 86 ). In dietary studies of Atlantic salmon combined with outbreaks of viral disease, a protective effect of higher PUFA levels was observed ( 87 ). Ferroptosis is a mechanism of controlled cell death characterized by increased cellular Fe 2+ concentration, iron-dependent oxidation of unsaturated membrane fatty acids, and mitochondrial contraction. This cell death can be experimentally induced by inhibition of cysteine uptake (precursor for the antioxidant glutathione) via the amino acid transporter system X c − , inactivation/reduction of glutathione peroxidase 4 (GPX4), depletion of coenzyme Q10, or lipid peroxidation due to PUFA overload ( 88 ) (Fig. 10 ). The observed downregulation of system X c − combined with high levels of ferritin (and hence stored iron) in ISAV infected ASK cells may explain the triggering of ferroptosis observed in our study. How ferroptosis contributes to physiological homeostasis is not completely understood but it may play a role in tumor suppression ( 89 ), immunity ( 90 ), and development ( 91 ). Recent studies suggest that ferroptosis may limit viral replication and pathogenesis ( 92 ) and be a part of the host innate immune response limiting viral spread ( 93 ). The role of ferroptosis during ISAV infection under high levels of PUFAs like EPA observed here needs confirmation by biochemical assays of iron and peroxidation products in addition to analyzing the effects of ferroptosis inhibitors and activators on viral replication. These will be interesting avenues of further research given the important role and high levels of PUFAs in ISAVs most important host, farmed Atlantic salmon. Conclusion The interplay between lipid metabolism and immunity is receiving increased attention and constitutes a major part of immunometabolism. In this study, we have shown that various cellular levels of EPA in Atlantic salmon cells affect the regulation of multiple transcripts involved in innate immune responses to viral infection. At high levels of EPA, viral infection may precipitate regulated cell death pathways like ferroptosis due to increased oxidative stress. This supports previous studies using other viruses ( 92 ) and encourages further investigations on the interplay between metabolism and immunity in this species. Abbreviations ACP Acyl carrier protein ASK Atlantic salmon kidney BH Benjamini-Hochberg Ct Cycle threshold DEG Differentially expressed genes DHA Docosahexaenoic acid ECM Extracellular matrix EPA Eicosapentaenoic acid FADS2 Fatty acid desaturase 2 GO Gene ontology GPR120 G-protein coupled receptor 120 GPX4 Glutathione peroxidase 4 IFIH1 Interferon induced with helicase C domain 1 IFNa Interferon alpha-1 ISAV Infectious salmon anemia virus ISG15 Interferon-stimulated gene 15 KEGG Kyoto Encyclopedia of Genes and Genomes MAVS Mitochondrial antiviral-signaling protein MOI Multiplicity of infection Mx1 Interferon-induced GTP-binding protein Mx1 OLAH Oleoyl-ACP hydrolase PCA Principal component analysis Poly I C :Polyinosinic-polycytidylic acid PPAR Peroxisome proliferator activated receptor p.i. Post-infection STING Stimulator of interferon genes TGF Transforming growth factor VEGF Vascular endothelial growth factor VLC-PUFA Very-long-chain polyunsaturated fatty acids Declarations Ethical approval and consent to participate Not applicable Consent for publication Not applicable Availability of data and materials Raw data from this project is available from the SRA archive (Bioproject ID : PRJNA1113821) Competing interest The authors declare no competing interest. Funding This research was funded by Norwegian Seafood Research Fund (FHF) grant number 901484. Authors' contribution Conceptualization, B.R., T.K.Ø., M.B. and T.G.; methodology, B.R., T.K.Ø., M.B. and T.G..; software, I.H., S.A. and T.G..; validation, I.H., S.A. and T.G., formal analysis, I.H., S.A., B.R., T.K.Ø., M.B. and T.G., investigation, I.H., S.A., B.R., T.K.Ø., M.B. and T.G.; resources, B.R., T.K.Ø., M.B. and T.G.; data curation I.H., S.A. and T.G.; writing—original draft preparation, I.H. and T.G..; writing—review and editing, I.H., S.A., B.R., T.K.Ø., M.B. and T.G.; visualization, I.H., S.A. and T.G.; supervision, B.R., T.K.Ø., M.B. and T.G.; project administration, B.R., T.K.Ø., M.B. and T.G..; funding acquisition, B.R., T.K.Ø., M.B. and T.G.. All authors have read and agreed to the published version of the manuscript. Acknowledgments We thank Beata Urbanczyk Mohebi for skillful technical assistance. References Thorud K, Djupvik H. Infectious anaemia in Atlantic salmon (Salmo salar L.). Bull Eur Assoc Fish Pathol. 1988;8(5):109-11. Aamelfot M, Dale OB, Falk K. Infectious salmon anaemia - pathogenesis and tropism. J Fish Dis. 2014;37(4):291-307. Godoy MG, Kibenge MJ, Suarez R, Lazo E, Heisinger A, Aguinaga J, et al. Infectious salmon anaemia virus (ISAV) in Chilean Atlantic salmon (Salmo salar) aquaculture: emergence of low pathogenic ISAV-HPR0 and re-emergence of virulent ISAV-HPR∆: HPR3 and HPR14. Virology journal. 2013;10(1):344. Hastein T, Hill BJ, Winton JR. Successful aquatic animal disease emergency programmes. Revue scientifique et technique. 1999;18(1):214-27. Dhar AK, Manna SK, Thomas Allnutt FC. Viral vaccines for farmed finfish. Virusdisease. 2014;25(1):1-17. Knipe DM, Howley PM. Fields virology. 6th ed. Philadelphia, PA: Wolters Kluwer/Lippincott Williams & Wilkins Health; 2013. 2 volumes p. Aamelfot M, Dale OB, Weli SC, Koppang EO, Falk K. Expression of the infectious salmon anemia virus receptor on atlantic salmon endothelial cells correlates with the cell tropism of the virus. J Virol. 2012;86(19):10571-8. Weli S, Aamelfot M, Dale O, Koppang E, Falk K. Infectious salmon anaemia virus infection of Atlantic salmon gill epithelial cells. Virology Journal. 2013;10(1):5. Eliassen TM, Frøystad MK, Dannevig BH, Jankowska M, Brech A, Falk K, et al. Initial events in infectious salmon anemia virus infection: evidence for the requirement of a low-pH step. Journal of virology. 2000;74(1):218-27. Hellebø A, Vilas U, Falk K, Vlasak R. Infectious Salmon Anemia Virus Specifically Binds to and Hydrolyzes 4-O-Acetylated Sialic Acids. Journal of Virology. 2004;78(6):3055-62. Mjaaland S, Rimstad E, Falk K, Dannevig BH. Genomic characterization of the virus causing infectious salmon anemia in Atlantic salmon (Salmo salar L.): an orthomyxo-like virus in a teleost. Journal of Virology. 1997;71(10):7681-6. Rimstad E, Mjaaland S. Infectious salmon anaemia virus. APMIS : acta pathologica, microbiologica, et immunologica Scandinavica. 2002;110(4):273-82. Jensen I, Albuquerque A, Sommer A, Robertsen B. Effect of poly I:C on the expression of Mx proteins and resistance against infection by infectious salmon anaemia virus in Atlantic salmon. Fish & Shellfish Immunology [Fish Shellfish Immunol]. 2002;13(4):311-26. Djordjevic B, Skugor S, Jorgensen SM, Overland M, Mydland LT, Krasnov A. Modulation of splenic immune responses to bacterial lipopolysaccharide in rainbow trout (Oncorhynchus mykiss) fed lentinan, a beta-glucan from mushroom Lentinula edodes. Fish & shellfish immunology. 2009;26(2):201-9. LeBlanc F, Arseneau JR, Leadbeater S, Glebe B, Laflamme M, Gagne N. Transcriptional response of Atlantic salmon (Salmo salar) after primary versus secondary exposure to infectious salmon anemia virus (ISAV). Mol Immunol. 2012;51(2):197-209. Kibenge MT, Opazo B, Rojas AH, Kibenge FS. Serological evidence of infectious salmon anaemia virus (ISAV) infection in farmed fishes, using an indirect enzyme-linked immunosorbent assay (ELISA). Diseases of Aquatic Organisms. 2002;51(1):1-11. Hetland DL, Jorgensen SM, Skjodt K, Dale OB, Falk K, Xu C, et al. In situ localisation of major histocompatibility complex class I and class II and CD8 positive cells in infectious salmon anaemia virus (ISAV)-infected Atlantic salmon. Fish & shellfish immunology. 2010;28(1):30-9. Lauscher A, Krossoy B, Frost P, Grove S, Konig M, Bohlin J, et al. Immune responses in Atlantic salmon (Salmo salar) following protective vaccination against Infectious salmon anemia (ISA) and subsequent ISA virus infection. Vaccine. 2011. Kossack C, Fuentes N, Maisey K. In silico prediction of B and T cell epitopes of infectious salmon anemia virus proteins and molecular modeling of T cell epitopes to salmon major histocompatibility complex (MHC) class I. Fish Shellfish Immunol. 2022;128:335-47. Toro-Ascuy D, Cardenas M, Vasquez-Martinez Y, Cortez-San Martin M. Rescue of Infectious Salmon Anemia Virus (ISAV) from Cloned cDNA. Methods Mol Biol. 2024;2733:87-99. Hwang D. Essential fatty acids and immune response. Faseb J. 1989;3(9):2052-61. Dustin LB, Shea CM, Soberman RJ, Lu CY. Docosahexaenoic acid, a constituent of rodent fetal serum and fish oil diets, inhibits acquisition of macrophage tumoricidal function. J Immunol. 1990;144(12):4888-97. Waagbo R. The impact of nutritional factors on the immune system in Atlantic salmon, Salmo salar L.: a review. Aquaculture Research. 1994;25(2):175-97. Calder PC. n-3 polyunsaturated fatty acids and cytokine production in health and disease. Ann Nutr Metab. 1997;41(4):203-34. March BE. Essential fatty acids in fish physiology. CanJPhysiolPharmacol. 1993;71:684-9. Velotti F, Costantini L, Merendino N. Omega-3 Polyunsaturated Fatty Acids (n-3 PUFAs) for Immunomodulation in COVID-19 Related Acute Respiratory Distress Syndrome (ARDS). J Clin Med. 2022;12(1). Mori TA, Beilin LJ. Omega-3 fatty acids and inflammation. Curr Atheroscler Rep. 2004;6(6):461-7. Miles EA, Calder PC. Influence of marine n-3 polyunsaturated fatty acids on immune function and a systematic review of their effects on clinical outcomes in rheumatoid arthritis. Br J Nutr. 2012;107 Suppl 2:S171-84. Mebarek S, Ermak N, Benzaria A, Vicca S, Dubois M, Nemoz G, et al. Effects of increasing docosahexaenoic acid intake in human healthy volunteers on lymphocyte activation and monocyte apoptosis. Br J Nutr. 2009;101(6):852-8. Gallo CG, Fiorino S, Posabella G, Antonacci D, Tropeano A, Pausini E, et al. The function of specialized pro-resolving endogenous lipid mediators, vitamins, and other micronutrients in the control of the inflammatory processes: Possible role in patients with SARS-CoV-2 related infection. Prostaglandins Other Lipid Mediat. 2022;159:106619. Ayres JS. Immunometabolism of infections. Nat Rev Immunol. 2020;20(2):79-80. Aas TS, Åsgård T, Ytrestøyl T. Utilization of feed resources in the production of Atlantic salmon (Salmo salar) in Norway: An update for 2020. Aquaculture Reports. 2022;26:101316. Ruyter, RosjO, Einen, Thomassen. Essential fatty acids in Atlantic salmon: effects of increasing dietary doses of n-6 and n-3 fatty acids on growth, survival and fatty acid composition of liver, blood and carcass. Aquaculture Nutrition. 2000;6(2):119-27. Bell JG, Sargent JR, Raynard RS. Effects of increasing dietary linoleic acid on phospholipid fatty acid composition and eicosanoid production in leucocytes and gill cells of Atlantic salmon (Salmo salar). Prostaglandins Leukot Essent Fatty Acids. 1992;45(3):197-206. Bell JG, Tocher DR, Farndale BM, Cox DI, McKinney RW, Sargent JR. The effect of dietary lipid on polyunsaturated fatty acid metabolism in Atlantic salmon ( Salmo salar ) undergoing Parr- Smolt transformation. Lipids. 1997;32(5):515-25. Bell JG, Ashton I, Secombes CJ, Weitzel BR, Dick JR, Sargent JR. Dietary lipid affects phospholipid fatty acid compositions, eicosanoid production and immune function in Atlantic salmon (Salmo salar). Prostaglandins, Leukotrienes and Essential Fatty Acids. 1996;54:173-82. Holen E, Araujo P, Sissener NH, Rosenlund G, Waagbø R. Corrigendum to “A comparative study: Difference in omega-6/omega-3 balance and saturated fat in diets for Atlantic salmon (Salmo salar) affect immune-, fat metabolism-, oxidative and apoptotic-gene expression, and eicosanoid secretion in head kidney leukocytes” [Fish Shellfish Immunol. 72 (2018) 57–68]. Fish & shellfish immunology. 2018;83:449. Andresen AMS, Lutfi E, Ruyter B, Berge G, Gjoen T. Interaction between dietary fatty acids and genotype on immune response in Atlantic salmon (Salmo salar) after vaccination: A transcriptome study. PLoS One. 2019;14(7):e0219625. Ruyter, Røsjø, Einen, Thomassen. Essential fatty acids in Atlantic salmon: effects of increasing dietary doses of n-6 and n-3 fatty acids on growth, survival and fatty acid composition of liver, blood and carcass. Aquaculture Nutrition. 2000;6(2):119-27. Emery JA, Norambuena F, Trushenski J, Turchini GM. Uncoupling EPA and DHA in Fish Nutrition: Dietary Demand is Limited in Atlantic Salmon and Effectively Met by DHA Alone. Lipids. 2016;51(4):399-412. Vila IK, Chamma H, Steer A, Saccas M, Taffoni C, Turtoi E, et al. STING orchestrates the crosstalk between polyunsaturated fatty acid metabolism and inflammatory responses. Cell metabolism. 2022;34(1):125-39 e8. Zhang W, Wang G, Xu ZG, Tu H, Hu F, Dai J, et al. Lactate Is a Natural Suppressor of RLR Signaling by Targeting MAVS. Cell. 2019;178(1):176-89 e15. Jia X, Crawford JC, Gebregzabher D, Monson EA, Mettelman RC, Wan Y, et al. High expression of oleoyl-ACP hydrolase underpins life-threatening respiratory viral diseases. Cell. 2024;187(17):4586-604.e20. Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012;149(5):1060-72. Zhao X, Zhang Y, Luo B. Ferroptosis, from the virus point of view: opportunities and challenges. Crit Rev Microbiol. 2024:1-18. Calder PC. The relationship between the fatty acid composition of immune cells and their function. Prostaglandins Leukot Essent Fatty Acids. 2008;79(3-5):101-8. Serhan CN, Chiang N, Van Dyke TE. Resolving inflammation: dual anti-inflammatory and pro-resolution lipid mediators. Nat Rev Immunol. 2008;8(5):349-61. Motshwene PG, Moncrieffe MC, Grossmann JG, Kao C, Ayaluru M, Sandercock AM, et al. An oligomeric signaling platform formed by the Toll-like receptor signal transducers MyD88 and IRAK-4. J Biol Chem. 2009;284(37):25404-11. Hwang Keun Y, Choi Young B. Modulation of Mitochondrial Antiviral Signaling by Human Herpesvirus 8 Interferon Regulatory Factor 1. Journal of Virology. 2015;90(1):506-20. Arnemo M, Kavaliauskis A, Andresen AMS, Bou M, Berge GM, Ruyter B, Gjøen T. Effects of dietary n-3 fatty acids on Toll-like receptor activation in primary leucocytes from Atlantic salmon (Salmo salar). Fish Physiology and Biochemistry. 2017;43(4):1065-80. B. Ruyter CR, T. Einen. Essential fatty acids in Atlantic salmon: effects of increasing dietary doses of n-6 and n-3 fatty acids on growth, survival and fatty acid composition of liver, blood and carcass. Aquaculture Nutrition. 2001;6(2):8. Gjøen T, Kleveland EJ, Moya-Falcón C, Frøystad MK, Vegusdal A, Hvattum E, et al. Effects of dietary thia fatty acids on lipid composition, morphology and macrophage function of Atlantic salmon ( Salmo salar L.) kidney. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology. 2007;148(1):103-11. Metochis CP, Spanos I, Auchinachie N, Crampton VO, Bell JG, Adams A, Thompson KD. The effects of increasing dietary levels of soy protein concentrate (SPC) on the immune responses and disease resistance (furunculosis) of vaccinated and non-vaccinated Atlantic salmon (Salmo salar L.) parr. Fish Shellfish Immunol. 2016;59:83-94. Caballero-Solares A, Hall JR, Xue X, Eslamloo K, Taylor RG, Parrish CC, Rise ML. The dietary replacement of marine ingredients by terrestrial animal and plant alternatives modulates the antiviral immune response of Atlantic salmon (Salmo salar). Fish Shellfish Immunol. 2017;64:24-38. Mjaaland S, Markussen T, Sindre H, Kjoglum S, Dannevig BH, Larsen S, Grimholt U. Susceptibility and immune responses following experimental infection of MHC compatible Atlantic salmon (Salmo salar L.) with different infectious salmon anaemia virus isolates. Archives of Virology. 2005;150(11):2195-216. Andresen AMS, Boudinot P, Gjoen T. Kinetics of transcriptional response against poly (I:C) and infectious salmon anemia virus (ISAV) in Atlantic salmon kidney (ASK) cell line. Dev Comp Immunol. 2020;110:103716. Folch J, Lees M, Stanley GHS. A SIMPLE METHOD FOR THE ISOLATION AND PURIFICATION OF TOTAL LIPIDES FROM ANIMAL TISSUES. Journal of Biological Chemistry. 1957;226(1):497-509. Mason ME, Waller GR. Dimethoxypropane Induced Transesterification of Fats and Oils in Preparation of Methyl Esters for Gas Chromatographic Analysis. Analytical Chemistry. 1964;36(3):583-6. Hoshi M, Williams M, Kishimoto Y. Esterification of fatty acids at room temperature by chloroform-methanolic HCl–cupric acetate. Journal of Lipid Research. 1973;14(5):599-601. Pfaffl MW. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Research. 2001;29(9):e45. Jørgensen SM, Kleveland EJ, Grimholt U, Gjøen T. Validation of reference genes for real-time polymerase chain reaction studies in Atlantic salmon. Marine biotechnology. 2006;8(4):398-408. Jorgensen SM, Grimholt U, Gjoen T. Cloning and expression analysis of an Atlantic salmon (Salmo salar L.) tapasin gene. Developmental and Comparative Immunology. 2007;31(7):708-19. Hansen TE, Jorgensen JB. Cloning and characterisation of p38 MAP kinase from Atlantic salmon A kinase important for regulating salmon TNF-2 and IL-1beta expression. Mol Immunol. 2007;44(12):3137-46. Schiotz BL, Baekkevold ES, Poulsen LC, Mjaaland S, Gjoen T. Analysis of host- and strain-dependent cell death responses during infectious salmon anemia virus infection in vitro. Virol J. 2009;6:91. Jorgensen SM, Lyng-Syvertsen B, Lukacs M, Grimholt U, Gjoen T. Expression of MHC class I pathway genes in response to infectious salmon anaemia virus in Atlantic salmon (Salmo salar L.) cells. Fish & shellfish immunology. 2006;21(5):548-60. Clouthier SC, Rector T, Brown NEC, Anderson ED. Genomic organization of infectious salmon anaemia virus. Journal of General Virology [J Gen Virol]. 2002;83(2):421-8. Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019;37(8):907-15. Pertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 2015;33(3):290-5. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014;15(12):550. Love MI, Anders S, Kim V, Huber W. RNA-Seq workflow: gene-level exploratory analysis and differential expression. F1000Research. 2015;4:1070-. Yu G, Wang L-G, Han Y, He Q-Y. clusterProfiler: an R Package for Comparing Biological Themes Among Gene Clusters. OMICS: A Journal of Integrative Biology. 2012;16(5):284-7. Luo W, Brouwer C. Pathview: an R/Bioconductor package for pathway-based data integration and visualization. Bioinformatics. 2013;29(14):1830-1. Sularea VM, Sugrue JA, O'Farrelly C. Innate antiviral immunity and immunometabolism in hepatocytes. Curr Opin Immunol. 2023;80:102267. Liang D, Minikes AM, Jiang X. Ferroptosis at the intersection of lipid metabolism and cellular signaling. Molecular Cell. 2022. Lutfi E, Berge GM, Bæverfjord G, Sigholt T, Bou M, Larsson T, et al. Increasing dietary levels of the n-3 long-chain PUFA, EPA and DHA, improves the growth, welfare, robustness and fillet quality of Atlantic salmon in sea cages. British Journal of Nutrition. 2023;129(1):10-28. Martinez-Rubio L, Morais S, Evensen O, Wadsworth S, Ruohonen K, Vecino JL, et al. Functional feeds reduce heart inflammation and pathology in Atlantic Salmon (Salmo salar L.) following experimental challenge with Atlantic salmon reovirus (ASRV). PLoS One. 2012;7(11):e40266. Martinez-Rubio L, Evensen O, Krasnov A, Jorgensen SM, Wadsworth S, Ruohonen K, et al. Effects of functional feeds on the lipid composition, transcriptomic responses and pathology in heart of Atlantic salmon (Salmo salar L.) before and after experimental challenge with Piscine Myocarditis Virus (PMCV). BMC Genomics. 2014;15:462. Rorvik KA, Dehli A, Thomassen M, Ruyter B, Steien SH, Salte R. Synergistic effects of dietary iron and omega-3 fatty acid levels on survival of farmed Atlantic salmon, Salmo salar L., during natural outbreaks of furunculosis and cold water vibriosis. J Fish Dis. 2003;26(8):477-85. Selvam C, Philip AJP, Lutfi E, Sigholt T, Norberg B, Baeverfjord G, et al. Long-term feeding of Atlantic salmon with varying levels of dietary EPA + DHA alters the mineral status but does not affect the stress responses after mechanical delousing stress. Br J Nutr. 2022;128(12):2291-307. Huyben D, Grobler T, Matthew C, Bou M, Ruyter B, Glencross B. Requirement for omega-3 long-chain polyunsaturated fatty acids by Atlantic salmon is relative to the dietary lipid level. Aquaculture. 2021;531:735805. Rosenlund G, Torstensen BE, Stubhaug I, Usman N, Sissener NH. Atlantic salmon require long-chain n-3 fatty acids for optimal growth throughout the seawater period. J Nutr Sci. 2016;5:e19. Svingerud T, Holand JK, Robertsen B. Infectious salmon anemia virus (ISAV) replication is transiently inhibited by Atlantic salmon type I interferon in cell culture. Virus Research. 2013;177(2):163-70. Gjøen T, Ruyter, B. , Østbye, T-K. K. Effects of eicosapentaneoic acid on innate immune responses in an Atlantic salmon kidney cell line in vitro. PLOS One. 2024;In press. Heming M, Gran S, Jauch SL, Fischer-Riepe L, Russo A, Klotz L, et al. Peroxisome Proliferator-Activated Receptor-gamma Modulates the Response of Macrophages to Lipopolysaccharide and Glucocorticoids. Front Immunol. 2018;9:893. Zhao W, Wang L Fau - Zhang M, Zhang M Fau - Wang P, Wang P Fau - Zhang L, Zhang L Fau - Yuan C, Yuan C Fau - Qi J, et al. Peroxisome proliferator-activated receptor gamma negatively regulates IFN-beta production in Toll-like receptor (TLR) 3- and TLR4-stimulated macrophages by preventing interferon regulatory factor 3 binding to the IFN-beta promoter. (1083-351X (Electronic)). Fantacuzzi MA-O, Amoroso RA-O, Ammazzalorso AA-O. PPAR Ligands Induce Antiviral Effects Targeting Perturbed Lipid Metabolism during SARS-CoV-2, HCV, and HCMV Infection. LID - 10.3390/biology11010114 [doi] LID - 114. (2079-7737 (Print)). Lutfi E, Berge GM, Baeverfjord G, Sigholt T, Bou M, Larsson T, et al. Increasing dietary levels of the omega-3 long-chain polyunsaturated fatty acids, EPA and DHA, improves the growth, welfare, robustness, and fillet quality of Atlantic salmon in sea cages. Br J Nutr. 2022;129(1):1-48. Stockwell BR. Ferroptosis turns 10: Emerging mechanisms, physiological functions, and therapeutic applications. Cell. 2022;185(14):2401-21. Jiang L, Kon N, Li T, Wang SJ, Su T, Hibshoosh H, et al. Ferroptosis as a p53-mediated activity during tumour suppression. Nature. 2015;520(7545):57-62. Yao Y, Chen Z, Zhang H, Chen C, Zeng M, Yunis J, et al. Selenium–GPX4 axis protects follicular helper T cells from ferroptosis. Nature Immunology. 2021;22(9):1127-39. Zheng H, Jiang L, Tsuduki T, Conrad M, Toyokuni S. Embryonal erythropoiesis and aging exploit ferroptosis. Redox Biology. 2021;48. Xu XQ, Xu T, Ji W, Wang C, Ren Y, Xiong X, et al. Herpes Simplex Virus 1-Induced Ferroptosis Contributes to Viral Encephalitis. mBio. 2023;14(1):e0237022. Yamane D, Hayashi Y, Matsumoto M, Nakanishi H, Imagawa H, Kohara M, et al. FADS2-dependent fatty acid desaturation dictates cellular sensitivity to ferroptosis and permissiveness for hepatitis C virus replication. Cell Chemical Biology. 2022;29(5):799-810.e4. Additional Declarations No competing interests reported. Supplementary Files S1VirologyJournal090924.docx Supplementary information Supplementary file 1: This file contains results from the fatty acid analysis and the exploratory plots of the RNA-seq data. Cite Share Download PDF Status: Published Journal Publication published 09 Jan, 2025 Read the published version in Virology Journal → Version 1 posted Editorial decision: Revision requested 23 Nov, 2024 Reviews received at journal 22 Nov, 2024 Reviews received at journal 14 Nov, 2024 Reviewers agreed at journal 06 Nov, 2024 Reviewers agreed at journal 06 Nov, 2024 Reviewers invited by journal 28 Oct, 2024 Editor assigned by journal 12 Sep, 2024 Submission checks completed at journal 12 Sep, 2024 First submitted to journal 11 Sep, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5071779","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":381635245,"identity":"1236a66d-3f60-4e0e-816f-e2a52a71c5bd","order_by":0,"name":"Ingrid Holmlund","email":"","orcid":"","institution":"University of Oslo","correspondingAuthor":false,"prefix":"","firstName":"Ingrid","middleName":"","lastName":"Holmlund","suffix":""},{"id":381635246,"identity":"2cb4a483-a9bf-4c0f-9cbb-de00d6ab31f9","order_by":1,"name":"Samira Ahmadi","email":"","orcid":"","institution":"University of Oslo","correspondingAuthor":false,"prefix":"","firstName":"Samira","middleName":"","lastName":"Ahmadi","suffix":""},{"id":381635247,"identity":"cb6913a0-d952-40cb-abfd-63188b529ae3","order_by":2,"name":"Bente Ruyter","email":"","orcid":"","institution":"Nofima","correspondingAuthor":false,"prefix":"","firstName":"Bente","middleName":"","lastName":"Ruyter","suffix":""},{"id":381635248,"identity":"c255ab9d-babd-40d7-b03f-8c4a998d434f","order_by":3,"name":"Tone-Kari Østbye","email":"","orcid":"","institution":"Nofima","correspondingAuthor":false,"prefix":"","firstName":"Tone-Kari","middleName":"","lastName":"Østbye","suffix":""},{"id":381635249,"identity":"435d9800-eda9-4eac-ad96-c2346dbde583","order_by":4,"name":"Marta Bou","email":"","orcid":"","institution":"Nofima","correspondingAuthor":false,"prefix":"","firstName":"Marta","middleName":"","lastName":"Bou","suffix":""},{"id":381635250,"identity":"acb0af06-a359-4b25-a7c3-9efe567d2390","order_by":5,"name":"Tor Gjøen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIiWNgGAWjYNACHiBmb3wAZrMB8QFCiiEkz2EDUrSAgESyAXFOsmfvfcD4RcZGzlzyMePnyhw7ez4GHsMDHxjuyOG0hee4AbMMT5qx5exkZsmz25IT2xh4DA7OYHhmjFOLRBoDswTP4cQNt/MPSDZuY05gA2o5zMNwOLGBgJb6DTcPM/9s3FZvT5QWxg88hxMMbjCzAW05zNhGUMuZYwyHGXjSDDecSWazbNx2PLGNma3g4AyDwzj9wt7exvjwZ4+NvMHxw8w3G7dV28u3N2/+8KHiMM4QA4HDvD3IXGYQQSCOGH/8wK9gFIyCUTAKRjgAAP4WTt1iLT18AAAAAElFTkSuQmCC","orcid":"","institution":"University of Oslo","correspondingAuthor":true,"prefix":"","firstName":"Tor","middleName":"","lastName":"Gjøen","suffix":""}],"badges":[],"createdAt":"2024-09-11 14:07:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5071779/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5071779/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12985-024-02619-0","type":"published","date":"2025-01-09T15:57:43+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":71993614,"identity":"ee079e8e-8b02-4951-8b86-b4b840742581","added_by":"auto","created_at":"2024-12-20 12:11:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":18961,"visible":true,"origin":"","legend":"\u003cp\u003eRelative expression of interferon induced with helicase C domain 1 (IFIH1), interferon alpha-1 (IFNa), interferon-stimulated gene 15 (ISG15) and interferon-induced GTP-binding protein Mx1 (Mx1) in infected control vs. non infected control (0 µM EPA). Expression level is calculated as relative expression to two housekeeping genes (ef1a - elongation factor 1 alpha and 18S - 18S ribosomal RNA) using the delta-delta Ct method. Data are displayed as median (horizontal line), 25 and 75% percentiles (box) and 5 and 95% percentiles (whiskers) log2 fold change. All four transcripts were significantly different from control (Wilcoxon rank sum test, p \u0026lt; 0.01, n = 6).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5071779/v1/3ffac869351f9c4b6a107cfd.png"},{"id":71993613,"identity":"ebf096a2-d895-4c45-99b7-5c925dc36cdb","added_by":"auto","created_at":"2024-12-20 12:11:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":60975,"visible":true,"origin":"","legend":"\u003cp\u003eVolcano plot of DEGs in ASK cells 48 h after infection with ISA virus. Red dots are upregulated (2090 transcripts), blue dots are downregulated genes (1331 transcripts). Grey dots are not significantly changed (adjusted p-value \u0026gt; 0.01).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5071779/v1/39674a7dde3c975d26b7bcd5.png"},{"id":71995404,"identity":"5d18c26e-c6de-4288-8368-eb7c1c3ff79e","added_by":"auto","created_at":"2024-12-20 12:27:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":146915,"visible":true,"origin":"","legend":"\u003cp\u003eGO enrichment analysis of DEGs in ISAV infected ASK cells.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5071779/v1/e0c92d31d17321d8a348d253.png"},{"id":71993616,"identity":"265f65d6-199d-425c-aab5-b74001da9063","added_by":"auto","created_at":"2024-12-20 12:11:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":226348,"visible":true,"origin":"","legend":"\u003cp\u003ePlot of raw counts and best fit line for the transcripts most positively correlated to EPA concentration in ISAV infected ASK cells.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5071779/v1/508257d9dfdadc9bb6d27ab0.png"},{"id":71994244,"identity":"3732d0dc-9424-47d0-bb6f-6950a8d7b327","added_by":"auto","created_at":"2024-12-20 12:19:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":243234,"visible":true,"origin":"","legend":"\u003cp\u003ePlot of raw counts and best fit line for the transcripts most negatively correlated to EPA concentration in ISAV infected ASK cells.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5071779/v1/f491383b26b624bd206df147.png"},{"id":71995954,"identity":"39040ce7-d6aa-4202-bfde-ef3ccd287bc7","added_by":"auto","created_at":"2024-12-20 12:35:09","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":88087,"visible":true,"origin":"","legend":"\u003cp\u003eVenn diagram showing overlap of significant DEGs in the various experimental groups.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5071779/v1/596b837d181856c9fc5261ae.png"},{"id":71994250,"identity":"34f1497e-5a58-440b-b955-011a8c28d429","added_by":"auto","created_at":"2024-12-20 12:19:11","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":39855,"visible":true,"origin":"","legend":"\u003cp\u003eqPCR analysis of three ISAV gene segments in infected ASK cell cultures (red bars) or noninfected cells (green bars) at various EPA levels at 48 h after infection (n= 6).\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5071779/v1/25d6221bd682e9f41f336cef.png"},{"id":71994246,"identity":"b4ab0989-7241-4adb-92d2-73f6712ca5c9","added_by":"auto","created_at":"2024-12-20 12:19:09","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":112679,"visible":true,"origin":"","legend":"\u003cp\u003eKEGG pathway enrichment analysis (biological processes) of gene sets significantly affected by EPA levels in ISAV infected ASK cells. Count represents number of transcripts in gene set. Color represents direction of EPA effect (blue = inhibition, red = stimulation).\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-5071779/v1/e9ce7913b929449422f42b23.png"},{"id":71995401,"identity":"2c722d1f-5b1e-4905-bf44-afe08f3aeff2","added_by":"auto","created_at":"2024-12-20 12:27:09","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":123989,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of EPA on transcripts in the PPAR pathway during ISAV infection in ASK cells.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-5071779/v1/435dc12efd7e190a474c1940.png"},{"id":71993622,"identity":"d05b02b0-de17-44b4-9358-9d510fbc63af","added_by":"auto","created_at":"2024-12-20 12:11:09","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":120121,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of EPA on transcripts in the ferroptosis pathway during ISAV infection in ASK cells.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-5071779/v1/14e1d4ca3ef312396f22cd2e.png"},{"id":73693962,"identity":"d93b7075-1992-4e5e-a003-2ee72ee1bb6f","added_by":"auto","created_at":"2025-01-13 16:09:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1713893,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5071779/v1/7380700b-32ef-4357-8320-89fd5e96dcb8.pdf"},{"id":71997332,"identity":"7556a741-e49c-4093-bd67-4a89f09df594","added_by":"auto","created_at":"2024-12-20 12:43:09","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":430283,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary file 1: \u003c/strong\u003eThis file contains results from the fatty acid analysis and the exploratory plots of the RNA-seq data.\u003c/p\u003e","description":"","filename":"S1VirologyJournal090924.docx","url":"https://assets-eu.researchsquare.com/files/rs-5071779/v1/9742b4195fa0678adfb14b48.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effect of eicosapentaenoic acid on innate immune responses in Atlantic salmon cells infected with infectious salmon anemia virus","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSince the first reports of an Atlantic salmon anemia disease and the identifications of the causative agent, infectious salmon anemia virus (ISAV) (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e), this virus has created serious health and fish welfare problems on both sides of the Atlantic (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Using strict management procedures, the initial wave of outbreaks was reduced (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) and vaccines have been developed (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e), but this disease is still a serious problem for the salmon aquaculture industry. ISAV belongs to the Orthomyxidae negative sense segmented RNA viruses which also includes the influenza genera (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Detailed studies of host and tissue tropism (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e), uptake (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e), replication (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e) as well as innate (\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e) and adaptive immune responses during ISAV infections (\u003cspan additionalcitationids=\"CR17 CR18\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e) have been reported but many questions regarding virus-host interactions remains to be investigated. The recent publication of the first reverse genetics system for ISAV will certainly open new avenues for deeper molecular characterization and vaccine development (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Another important area of research into virus-host interactions is the role of dietary and cellular fatty acids on innate and adaptive immune responses during infection. Results from both experimental (\u003cspan additionalcitationids=\"CR22 CR23 CR24\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e) and clinical studies (\u003cspan additionalcitationids=\"CR27 CR28\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e) suggest that polyunsaturated fatty acids (PUFA) like eicosapentaenoic (EPA) and docosahexaenoic acid (DHA) and their metabolites play important roles in host responses against a range of infections (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). This focus on the interplay between metabolism and immunity have led to development of a branch of immunology called immunometabolism (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e) and many of these insights are relevant for aquaculture as much as the feed is the one of the main elements in the production chain of fish (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). As in mammals, multiple studies suggest a role for PUFAs in the maintenance of growth and health in Atlantic salmon (\u003cspan additionalcitationids=\"CR34\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e) as well as immunity (\u003cspan additionalcitationids=\"CR37\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). To protect limited marine raw materials (like herring and capelin) for salmon feed production, plant and algae based raw materials with lower PUFA levels are taking over (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Although long chain PUFAs like EPA and DHA have been regarded as essential for optimal growth and development in vertebrates (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e), the dietary demand for EPA in Atlantic salmon has recently been questioned (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Recent findings concerning the intersection of energy metabolism with innate immunity to viral infections like the interaction of STING (stimulator of interferon genes) with FADS2 (fatty acid synthase 2) (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e) and the role of lactate in regulation of MAVS (mitochondrial antiviral signaling protein) (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e) suggest that dietary lipids play a role in innate immunity. Likewise, expression levels of an enzyme involved in production of endogenous fatty acids (oleoyl-acyl-carrier-protein (ACP) hydrolase (OLAH)) was associated with severity of multiple viral respiratory functions via effects on macrophage lipid droplet dynamics (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). The regulated cell death pathway named ferroptosis (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e) occurring during various forms of viral infections (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e) have also been linked to the level of cellular PUFAs. These recent developments incited us to investigate the role of EPA in antiviral immunity in Atlantic salmon kidney (ASK) cells. The cellular levels of EPA may affect antiviral signaling responses in at least three separate ways. Firstly, as ligands for peroxisome proliferator-activated receptors (PPARs) or G-protein coupled receptor 120 (GPR120) (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e). Secondly, as metabolic precursors of immune modulators like resolvins and eicosanoids (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e) and lastly, by altering the composition of membrane microdomains called \u0026ldquo;rafts\u0026rdquo; where membrane bound signaling proteins like toll-like receptors (TLRs) and MAVS anchor and signal from (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). Previous studies of PUFA effects on innate immunity in tissues or cells from Atlantic salmon are not conclusive as EPA may confer detrimental (50, 51 ), neutral, (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e) or supportive (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e) effects, depending on developmental stage and type of stressor. To gain a more mechanistic view of the interplay between EPA and innate immunity to viral infection in Atlantic salmon, we measured transcriptional responses to ISAV infection at five different cellular EPA levels. One of the main findings not observed with virus or high EPA alone (only in combination) were the enrichment of transcripts related to the ferroptosis and PPAR pathways. This may suggest that the combined stress of high PUFA and viral infection initiates iron dependent lipid peroxide formation and cell death as a host defense mechanism to control viral replication.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eKnut Falk (Norwegian Veterinary Institute) kindly provided the Atlantic salmon kidney (ASK) cell line used in this project. The cells were cultivated at 20\u0026deg;C and split (1:2) once a week. The cell media consisted of Leibovitz L-15 medium (Lonza BioWhittaker, Verviers, Belgium) supplemented with L-glutamine (4 mM - Lonza BioWhittaker, Verviers, Belgium), fetal bovine serum (10% - Gibco, Life Technologies, Bleiswijk, The Netherlands), 2-mercaptoethanol (40 \u0026micro;M - Gibco, Life Technologies, Bleiswijk, The Netherlands) and gentamicin (50 mg/mL - Lonza BioWhittaker, Walkersville, USA).\u003c/p\u003e \u003cp\u003eThe cells were acclimatized one week before the experiment started; the cultivation temperature was reduced to 15\u0026deg;C, and the content of fetal bovine serum in the media was reduced to 2%. These conditions were also used during the experimental period.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eVirus propagation\u003c/h2\u003e \u003cp\u003eThe ISAV strain used in this experiment was Glesv\u0026aelig;r 2/90, which has been shown to result in high mortality in Atlantic salmon (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e). The virus was produced and isolated as described by Andresen et al. (\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eExperimental design\u003c/h2\u003e \u003cp\u003eASK cells (passages 40\u0026ndash;50) were seeded in 14 wells (35 mm, 6-well plates), with a density of 1.5 x 10\u003csup\u003e5\u003c/sup\u003e cells per well. The cells were cultivated overnight (15\u0026deg;C) for adhesion. Thereafter, EPA (Sigma-Aldrich, St. Louis, MO, USA) (bound to BSA) of different concentrations (0, 0, 25, 50, 100, 200, 200 \u0026micro;M) was added to duplicate wells (n\u0026thinsp;=\u0026thinsp;2), and the cells were incubated for 7 days. The wells were washed three times with sterile PBS (QIAGEN, Hilden, Germany), before performing the \u003cem\u003ein vitro\u003c/em\u003e infection.\u003c/p\u003e \u003cp\u003eA virus suspension with a multiplicity of infection (MOI) of 1 in serum-free L-15 medium was added to 10 of the wells (0, 25, 50, 100, 200 \u0026micro;M). The extra wells without EPA (n\u0026thinsp;=\u0026thinsp;2) and with 200 \u0026micro;M EPA (n\u0026thinsp;=\u0026thinsp;2) were used as uninfected controls. The infected wells were incubated for 4 h to allow for virus adsorption, followed by addition of previous culture medium (L-15 supplemented\u0026thinsp;\u0026plusmn;\u0026thinsp;EPA).\u003c/p\u003e \u003cp\u003eThe cells were incubated for 48 h post-infection (9 days of cultivation in total), then washed three times with PBS, lysed using buffer RLT (QIAGEN, Hilden, Germany) and stored at -20\u0026deg;C until RNA isolation. This experiment was repeated three times, which resulted in six technical replicates per sample (n\u0026thinsp;=\u0026thinsp;6), and 42 samples in total.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eFatty acid analysis\u003c/h2\u003e \u003cp\u003eASK cells were grown in flasks (75 cm\u003csup\u003e2\u003c/sup\u003e) with L-15 supplemented medium (2% FBS) and EPA (0, 25, 50, 100, 200 \u0026micro;M) for one week. The total lipids of the cells and cell culture media were extracted as described by Folch et al. (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e), by homogenizing the tissue with 2:1 chloroform-methanol (v/v). The chloroform phase was isolated, and nitrogen was used to evaporate the solvent, resulting in the residual lipid extract. Benzene was used to re-dissolve the lipids, and 2,2-dimethoxypropane and methanolic HCl were added for transesterification overnight at room temperature, as described by Mason and Waller and by Hoshi et al. (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e). A gas chromatograph (Hewlett Packard 6890) with helium as a carrier gas, a split injector, a SGE BPX70 capillary column (length: 60 m, internal diameter: 0.25 mm, thickness of film: 0.25 \u0026micro;M), a flame ionization detector (FID) and the HP Chem Station software was used to separate the fatty acid methyl esters and monitor the process. The detector and injector of the chromatograph had a temperature of 300\u0026deg;C, while the oven temperature was raised from 50 to 170\u0026deg;C (4\u0026deg;C/min) and then further raised to 200\u0026deg;C (0.5\u0026deg;C/min).\u003c/p\u003e \u003cp\u003ePeaks appeared in the chromatogram as the different compounds eluted from the column and passed through the detector. Individual fatty acid methyl esters were identified by reference to well-characterized standards. The relative amount of each fatty acid was expressed as a percentage of the total amount of fatty acid in the analyzed sample, and the absolute amount of fatty acid per gram of tissue was calculated using C23:0 methyl ester as the internal standard.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eTotal RNA isolation\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted for sequencing and qPCR using RNeasy Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer\u0026rsquo;s tissue protocol, with an optional on-column DNase I digestion to remove gDNA (RNase-Free DNase Set, QIAGEN, Hilden, Germany). The RNA samples were eluted in 50 \u0026micro;L RNase free distilled water, and the RNA concentrations were measured using a PicoDrop Pico100 (PicoDrop Technologies, Cambridge, UK).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eRNA sequencing\u003c/h2\u003e \u003cp\u003eThe RNA samples (n\u0026thinsp;=\u0026thinsp;42) were sent to the Norwegian Sequencing Centre (NSC), where the RNA qualities were checked using the Agilent 2100 Bioanalyzer (Agilent, USA). The cDNA libraries were prepared using the TruSeq Stranded mRNA Library Prep Kit (Illumina Inc., San Diego, USA) and sequenced to 150 bp paired end reads with the Illumina HiSeq 4000 sequencer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eQualitative PCR (qPCR)\u003c/h2\u003e \u003cp\u003eThe High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, United States) was used to make cDNA, using the manufacturer\u0026rsquo;s protocol. The LightCycler 480 and SYBR Green Master Mix (both from Roche Diagnostics, Basel, Switzerland) was used to perform qPCR in 96-well plates. The initial heating lasted for 5 minutes (95\u0026deg;C), and the cycling conditions (40 cycles) were 95\u0026deg;C (10 sec), 60\u0026deg;C (10 sec), and 72\u0026deg;C (10 sec), and the melting curves were measured at 95\u0026deg;C (5 sec) and 65\u0026deg;C (1 min). The qPCR experiment was repeated three times with two technical replicates per sample. The cycle threshold (Ct) values of the samples were obtained to calculate the relative expression levels of the genes (delta-delta Ct method) (\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e), with \u003cem\u003e18S\u003c/em\u003e and \u003cem\u003eef1a\u003c/em\u003e as reference genes (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e). The primers used are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primers used in qPCR analysis.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDirection\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence 5\u0026prime;\u0026rarr;3\u0026prime;\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAccession Number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAmplicon\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eef1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCACCGGCCATCTGATCTACAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAF321836\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(62)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAGCAGCCTCCTTCTCGAACTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003e18S\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTGCCGCTAGAGGTGAAATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAJ427629.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(63)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAAATGCTTTCGCTTTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eifna1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGCCATGAAACCTGAGAAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAY216594\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(61)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTCCTGATGAGCTCCCATGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eisg15\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGGTGCTGATTACGGAGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAY926456\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(64)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTGTTGGTTGGCAGGGACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003emx1/2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGATCGATAAAGTGACTGCATTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001123690.1/\u003c/p\u003e \u003cp\u003eNM_001123693.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(65)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAGACGAACTCCGCTTTTTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eifih1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGAGCCCGTCCAAAGTGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_014164134\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e389\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(56)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCTCTGAACTTTCGGCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eISAVseg5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAAGCCCTGCTCTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHQ259675.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(66)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCTCAAGTCTGCTTCGGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eISAVseg6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGCCAAAAACGGAAATGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHQ259676.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e118\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(66)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCGTCAGTGCAGTCATTGGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eISAVseg7\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAATGGACAGAGACGGCGTATCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHQ259677.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e124\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(66)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCAACTCCAGCTCTCTCATTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eef1a\u003c/em\u003e - elongation factor 1 alpha, \u003cem\u003e18S\u003c/em\u003e \u0026minus;\u0026thinsp;18S ribosomal RNA, \u003cem\u003eifna1\u003c/em\u003e \u0026ndash; interferon alpha-1, \u003cem\u003eisg15\u003c/em\u003e - interferon-stimulated gene 15, \u003cem\u003emx1/2\u003c/em\u003e - interferon-induced GTP-binding protein Mx1/2, \u003cem\u003eifih1\u003c/em\u003e - interferon induced with helicase C domain 1, \u003cem\u003eISAVseg5\u003c/em\u003e \u0026ndash; infectious salmon anemia virus gene segment 5, \u003cem\u003eISAVseg6\u003c/em\u003e \u0026ndash; infectious salmon anemia virus gene segment 6, \u003cem\u003eISAVseg7\u003c/em\u003e \u0026ndash; infectious salmon anemia virus gene segment 7.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics and statistics\u003c/h2\u003e \u003cp\u003eHISAT2 (\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e) was used to map the FASTQ sequence read files from the RNA sequencing to the Atlantic salmon genome (GCF_000233375.1_ICSASG_v2_genomic.fna). The existing Atlantic salmon annotation file (GCF_000233375.1_ICSASG_v2_genomic.gff) was used to assemble the transcripts with StringTie (\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e). Both the genome and the annotation file were downloaded from NCBI (annotation release 100). Following the alignment and assembly of transcripts, the R software package DESeq2 (version 1.40.2) was utilized to quantify the differential expression of genes between the samples and against the controls (\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e). The resulting gene expression tables were filtered using a threshold of median\u0026thinsp;\u0026gt;\u0026thinsp;10, to remove genes that had zero or low counts. The adjusted p-value (padj) was calculated using the Benjamini-Hochberg (BH) procedure, and the genes classified as differentially expressed genes (DEGs) had a p-value (padj) below 0.01. A gene was considered upregulated if the log2 fold change (Log2FC)\u0026thinsp;\u0026gt;\u0026thinsp;1, and downregulated if Log2FC \u0026lt; -1. The sample analysis and the exploratory plots are shown in Supplementary file 1. The gene ontology and KEGG pathway analysis was performed using the R package clusterProfiler (\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e), with 0.01 as a cutoff for the p-values and q-values (BH adjusted). The KEGG pathway maps were visualized using the R package Pathview (\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eVerification of infection\u003c/h2\u003e\n \u003cp\u003eTo verify that cells were infected and responsive before submitting the samples for sequencing, we analyzed a few well known viral and interferon induced salmon transcripts by qPCR. Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e shows that all four transcripts were robustly upregulated by ISAV at 48 h p.i. suggesting that the cells were indeed infected. We also confirmed infection by qPCR of three ISAV genomic RNA segments, and the cells were positive for all (not shown).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eFatty acid analysis\u003c/h2\u003e\n \u003cp\u003eThe EPA content (%) of cells and cell culture media is presented in Supplementary file 1 (Figure \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e). The cellular content of EPA increased from 2% when no EPA was added, to 21% of total fatty acids when EPA was supplemented at 200 \u0026micro;M.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eRNA sequencing\u003c/h2\u003e\n \u003cp\u003eAn exploratory analysis of the RNA-seq raw data is presented in Supplementary file 1 (Figure S2-S7). Briefly, the samples were sequenced to a depth of about 15\u0026ndash;20\u0026nbsp;million reads (150 nt, double reads) with a mapping frequency to the Atlantic salmon genome of about 80%. Counts were log normally distributed and tests of replicate correlation showed good agreement between technical replicates. PCA and clustering analysis suggested that ISAV infection was the main driver of variability, but EPA also displayed an effect. One of the samples had corrupted sequencing files and were removed from further analyses (EPA, 50 \u0026micro;M, replicate 6).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eTranscriptome effects of ISAV infection and EPA alone\u003c/h2\u003e\n \u003cp\u003eAs previously shown by Andresen (\u003cspan class=\"CitationRef\"\u003e56\u003c/span\u003e), infection of ISAV in these cells had strong transcriptional effects with more than 3000 genes dysregulated at 48 h p.i. (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eThis virus elicits expression of transcripts that were enriched in antiviral and immune system responses related to biological processes and pathways (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eAs a control, the effects of only 200 \u0026micro;M EPA for 9 days without virus was also analyzed. Only 268 transcripts were moderately differentially expressed in this group, suggesting that EPA treatment alone did not stress the cells (not shown).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eTranscriptome effects of increasing levels of EPA during ISAV infection\u003c/h2\u003e\n \u003cp\u003eWhen cells exposed to increasing levels of EPA (0\u0026ndash;200 \u0026micro;M) for 7 days were infected with ISAV, a total of 2921 transcripts were affected by the levels of this fatty acid (adjusted p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Compared to the effects of virus alone, the changes in expression levels were modest but many transcripts displayed a clear dose response to EPA levels (Figs. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). Transcripts that showed a positive correlation to EPA levels included antimicrobial peptides (cathelicidin), \u003cem\u003eMMP9\u003c/em\u003e, and \u003cem\u003eARF4\u003c/em\u003e among others. Transcripts with a negative correlation to cellular EPA levels included GTP binding signaling proteins, thrombospondin, and thioredoxin interacting protein.\u003c/p\u003e\n \u003cp\u003eThe overlap of transcripts between DEGs induced by ISAV alone and DEGs affected by the level of EPA was limited (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). Only 120 of 3421 transcripts changed by viral infection were modulated by the cellular levels of EPA, suggesting that alternative signaling pathways were activated with increasing levels of the fatty acid.\u003c/p\u003e\n \u003cp\u003eWhen analyzing the levels of viral transcripts (ISAV segments 5, 6, and 7) at 48 hours p.i. we did not observe a significant effect of EPA levels on viral replication (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eKEGG pathway enrichment analysis with gene sets that were affected by EPA revealed that processes related to protein synthesis, amino acid, RNA metabolism, PPAR pathway, fatty metabolism, and ferroptosis were enriched with transcripts stimulated by EPA (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e). Cell cycle, p53 pathway, and TGF-beta signaling pathways were enriched with transcripts inhibited by EPA.\u003c/p\u003e\n \u003cp\u003eTaking a closer look at the affected transcripts in the PPAR pathway revealed that all transcripts connected to this pathway were upregulated by EPA. Target genes for PPAR-alpha, -delta, and -gamma were affected by EPA in ISAV infected cells (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e)\u003c/p\u003e\n \u003cp\u003eEnrichment of transcripts in the ferroptosis pathway was another interesting feature of transcriptional changes observed with increasing EPA levels not seen in control cells infected with ISAV. Ferroptosis is a regulated iron dependent cell death pathway characterized by reduced antioxidant capacity, accumulation of lipid peroxides, and reactive oxygen species (\u003cspan class=\"CitationRef\"\u003e44\u003c/span\u003e). High levels of ferritin combined with reduced levels of the system Xc\u003csup\u003e\u0026minus;\u003c/sup\u003e subunit SLC7A11 (transporter for glutathione precursor cysteine) and glutathione peroxidase 4 (GPX4) was observed in EPA treated cells infected with ISAV, which may trigger activation of this pathway (Fig. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eRecent developments in the understanding of the interplay between dietary fatty acids and the immune responses at the cellular and organismal levels (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e, \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e) requires further investigations of these relationships in farmed aquatic animals where feed is one of the main material factors (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e). Previous reports suggest that salmon feeds with higher levels of EPA may confer a protective effect against viral (\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e) and bacterial infections (\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e). However, the minimal dietary requirements for EPA in salmon feed are not firmly established and may be dependent on developmental stage and other environmental factors (\u003cspan additionalcitationids=\"CR80\" citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e). Some reports conclude that EPA is not essential for normal health and growth of Atlantic salmon (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Nevertheless, that study was a short-term study (14 weeks) and used small fish of approximately 53 g at the beginning and concluded when fish reached approximately 200 g at the end of the feeding trial. Further, prior to the experiment a commercial diet was used. Commercial diets at this life stage are typically rich in n-3 VLC-PUFAs and this may have provided enough n-3 PUFAs to be sustained by the fish during the short feeding trial.\u003c/p\u003e \u003cp\u003eIn this report we have studied the transcriptomic responses to infectious salmon anemia virus in salmon cells under various cellular levels of EPA (from 2 to 21% of total fatty acids). We first confirmed the infection model by qPCR of canonical interferon transcripts and viral genomic segments and found that the cells were robustly infected. RNA-seq analysis also confirmed the transcriptomic changes resulting from this infection in cells cultured in standard medium (\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). The sampling time point (48 h p.i.) was based on previous kinetic studies (\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e), capturing the innate transcriptional response in these cells. However, this sample was probably too early to capture effects of EPA on viral replication, as this normally takes about 72 hours to develop quantifiable levels (\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e). Results from pathway enrichment analysis were similar but not identical to a comparable study using the interferon inducer poly I:C instead of virus as the immunological stimuli (\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e). The effects of poly I:C in combination with high levels of EPA were more restricted in the sense that multiple pathways like ECM-receptor interaction, autophagy, apelin, and VEGF-signaling were suppressed. Incubation with the highest concentration of EPA alone without any additional inflammatory stimuli had limited effects on the transcriptional profile of the cells and did not reveal enriched GO or KEGG terms. This suggests that the highest concentration (200 \u0026micro;M) was well tolerated by the cells. However, combined with ISAV infection as the inflammatory signal, robust transcriptional changes involving multiple metabolic pathways were observed at higher levels of EPA. In addition to more general pathways like ribosome, carbohydrate, amino acid, and fatty acid metabolism, pathways enriched by EPA were ferroptosis, PPAR signaling, and lysosomal pathways. Transcripts downregulated by EPA were involved in cell cycle p53- and TGF-beta signaling (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). These observations are in line with results obtained using poly I:C as inflammatory stimuli (\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e). Although originally described as regulators of lipid metabolism, PPARs are now also recognized for their role in controlling inflammation induced by lipopolysaccharides (\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e) or via inhibition of interferon production (\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e). In our experimental \u003cem\u003ein vitro\u003c/em\u003e model, higher levels of EPA may therefore attenuate inflammatory responses to viral infection via activation of PPAR pathways, similar to effects observed with other viruses (\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e). In dietary studies of Atlantic salmon combined with outbreaks of viral disease, a protective effect of higher PUFA levels was observed (\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFerroptosis is a mechanism of controlled cell death characterized by increased cellular Fe\u003csup\u003e2+\u003c/sup\u003e concentration, iron-dependent oxidation of unsaturated membrane fatty acids, and mitochondrial contraction. This cell death can be experimentally induced by inhibition of cysteine uptake (precursor for the antioxidant glutathione) via the amino acid transporter system X\u003csub\u003ec\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e, inactivation/reduction of glutathione peroxidase 4 (GPX4), depletion of coenzyme Q10, or lipid peroxidation due to PUFA overload (\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e). The observed downregulation of system X\u003csub\u003ec\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e combined with high levels of ferritin (and hence stored iron) in ISAV infected ASK cells may explain the triggering of ferroptosis observed in our study. How ferroptosis contributes to physiological homeostasis is not completely understood but it may play a role in tumor suppression (\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e), immunity (\u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e), and development (\u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e). Recent studies suggest that ferroptosis may limit viral replication and pathogenesis (\u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e) and be a part of the host innate immune response limiting viral spread (\u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e). The role of ferroptosis during ISAV infection under high levels of PUFAs like EPA observed here needs confirmation by biochemical assays of iron and peroxidation products in addition to analyzing the effects of ferroptosis inhibitors and activators on viral replication. These will be interesting avenues of further research given the important role and high levels of PUFAs in ISAVs most important host, farmed Atlantic salmon.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe interplay between lipid metabolism and immunity is receiving increased attention and constitutes a major part of immunometabolism. In this study, we have shown that various cellular levels of EPA in Atlantic salmon cells affect the regulation of multiple transcripts involved in innate immune responses to viral infection. At high levels of EPA, viral infection may precipitate regulated cell death pathways like ferroptosis due to increased oxidative stress. This supports previous studies using other viruses (\u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e) and encourages further investigations on the interplay between metabolism and immunity in this species.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eACP\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAcyl carrier protein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eASK\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAtlantic salmon kidney\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eBH\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBenjamini-Hochberg\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCt\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCycle threshold\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDEG\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDifferentially expressed genes\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDHA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDocosahexaenoic acid\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eECM\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eExtracellular matrix\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eEPA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eEicosapentaenoic acid\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eFADS2\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFatty acid desaturase 2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eGO\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGene ontology\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eGPR120\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eG-protein coupled receptor 120\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eGPX4\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGlutathione peroxidase 4\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eIFIH1\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInterferon induced with helicase C domain 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eIFNa\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInterferon alpha-1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eISAV\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInfectious salmon anemia virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eISG15\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInterferon-stimulated gene 15\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eKEGG\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eKyoto Encyclopedia of Genes and Genomes\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eMAVS\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMitochondrial antiviral-signaling protein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eMOI\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMultiplicity of infection\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eMx1\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInterferon-induced GTP-binding protein Mx1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eOLAH\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eOleoyl-ACP hydrolase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ePCA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePrincipal component analysis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ePoly I\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e \u003cb\u003eC\u003c/b\u003e:Polyinosinic-polycytidylic acid\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ePPAR\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePeroxisome proliferator activated receptor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ep.i.\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePost-infection\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eSTING\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eStimulator of interferon genes\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eTGF\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTransforming growth factor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eVEGF\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eVascular endothelial growth factor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eVLC-PUFA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eVery-long-chain polyunsaturated fatty acids\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003eEthical approval and consent to participate\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003eAvailability of data and materials\u003c/p\u003e\n\u003cp\u003eRaw data from this project is available from the SRA archive (Bioproject ID : PRJNA1113821)\u003c/p\u003e\n\u003cp\u003eCompeting interest\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis research was funded by Norwegian Seafood Research Fund (FHF) grant number 901484.\u003c/p\u003e\n\u003cp\u003eAuthors'\u0026nbsp;contribution\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConceptualization, B.R., T.K.Ø., M.B. and T.G.; methodology, B.R., T.K.Ø., M.B. and T.G..; software, I.H., S.A. and T.G..; validation, I.H., S.A. and T.G., formal analysis, I.H., S.A., B.R., T.K.Ø., M.B. and T.G., investigation, I.H., S.A., B.R., T.K.Ø., M.B. and T.G.; resources, B.R., T.K.Ø., M.B. and T.G.; data curation I.H., S.A. and T.G.; writing—original draft preparation, I.H. and T.G..; writing—review and editing, I.H., S.A., B.R., T.K.Ø., M.B. and T.G.; visualization, I.H., S.A. and T.G.; supervision, \u0026nbsp;B.R., T.K.Ø., M.B. and T.G.; project administration, \u0026nbsp;B.R., T.K.Ø., M.B. and T.G..; funding acquisition, B.R., T.K.Ø., M.B. and T.G.. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Beata Urbanczyk Mohebi for skillful technical assistance.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eThorud K, Djupvik H. Infectious anaemia in Atlantic salmon (Salmo salar L.). Bull Eur Assoc Fish Pathol. 1988;8(5):109-11.\u003c/li\u003e\n\u003cli\u003eAamelfot M, Dale OB, Falk K. Infectious salmon anaemia - pathogenesis and tropism. J Fish Dis. 2014;37(4):291-307.\u003c/li\u003e\n\u003cli\u003eGodoy MG, Kibenge MJ, Suarez R, Lazo E, Heisinger A, Aguinaga J, et al. Infectious salmon anaemia virus (ISAV) in Chilean Atlantic salmon (Salmo salar) aquaculture: emergence of low pathogenic ISAV-HPR0 and re-emergence of virulent ISAV-HPR∆: HPR3 and HPR14. Virology journal. 2013;10(1):344.\u003c/li\u003e\n\u003cli\u003eHastein T, Hill BJ, Winton JR. Successful aquatic animal disease emergency programmes. Revue scientifique et technique. 1999;18(1):214-27.\u003c/li\u003e\n\u003cli\u003eDhar AK, Manna SK, Thomas Allnutt FC. Viral vaccines for farmed finfish. Virusdisease. 2014;25(1):1-17.\u003c/li\u003e\n\u003cli\u003eKnipe DM, Howley PM. Fields virology. 6th ed. Philadelphia, PA: Wolters Kluwer/Lippincott Williams \u0026amp; Wilkins Health; 2013. 2 volumes p.\u003c/li\u003e\n\u003cli\u003eAamelfot M, Dale OB, Weli SC, Koppang EO, Falk K. Expression of the infectious salmon anemia virus receptor on atlantic salmon endothelial cells correlates with the cell tropism of the virus. J Virol. 2012;86(19):10571-8.\u003c/li\u003e\n\u003cli\u003eWeli S, Aamelfot M, Dale O, Koppang E, Falk K. Infectious salmon anaemia virus infection of Atlantic salmon gill epithelial cells. Virology Journal. 2013;10(1):5.\u003c/li\u003e\n\u003cli\u003eEliassen TM, Fr\u0026oslash;ystad MK, Dannevig BH, Jankowska M, Brech A, Falk K, et al. Initial events in infectious salmon anemia virus infection: evidence for the requirement of a low-pH step. Journal of virology. 2000;74(1):218-27.\u003c/li\u003e\n\u003cli\u003eHelleb\u0026oslash; A, Vilas U, Falk K, Vlasak R. Infectious Salmon Anemia Virus Specifically Binds to and Hydrolyzes 4-O-Acetylated Sialic Acids. Journal of Virology. 2004;78(6):3055-62.\u003c/li\u003e\n\u003cli\u003eMjaaland S, Rimstad E, Falk K, Dannevig BH. Genomic characterization of the virus causing infectious salmon anemia in Atlantic salmon (Salmo salar L.): an orthomyxo-like virus in a teleost. Journal of Virology. 1997;71(10):7681-6.\u003c/li\u003e\n\u003cli\u003eRimstad E, Mjaaland S. Infectious salmon anaemia virus. APMIS : acta pathologica, microbiologica, et immunologica Scandinavica. 2002;110(4):273-82.\u003c/li\u003e\n\u003cli\u003eJensen I, Albuquerque A, Sommer A, Robertsen B. Effect of poly I:C on the expression of Mx proteins and resistance against infection by infectious salmon anaemia virus in Atlantic salmon. Fish \u0026amp; Shellfish Immunology [Fish Shellfish Immunol]. 2002;13(4):311-26.\u003c/li\u003e\n\u003cli\u003eDjordjevic B, Skugor S, Jorgensen SM, Overland M, Mydland LT, Krasnov A. Modulation of splenic immune responses to bacterial lipopolysaccharide in rainbow trout (Oncorhynchus mykiss) fed lentinan, a beta-glucan from mushroom Lentinula edodes. Fish \u0026amp; shellfish immunology. 2009;26(2):201-9.\u003c/li\u003e\n\u003cli\u003eLeBlanc F, Arseneau JR, Leadbeater S, Glebe B, Laflamme M, Gagne N. Transcriptional response of Atlantic salmon (Salmo salar) after primary versus secondary exposure to infectious salmon anemia virus (ISAV). Mol Immunol. 2012;51(2):197-209.\u003c/li\u003e\n\u003cli\u003eKibenge MT, Opazo B, Rojas AH, Kibenge FS. Serological evidence of infectious salmon anaemia virus (ISAV) infection in farmed fishes, using an indirect enzyme-linked immunosorbent assay (ELISA). Diseases of Aquatic Organisms. 2002;51(1):1-11.\u003c/li\u003e\n\u003cli\u003eHetland DL, Jorgensen SM, Skjodt K, Dale OB, Falk K, Xu C, et al. In situ localisation of major histocompatibility complex class I and class II and CD8 positive cells in infectious salmon anaemia virus (ISAV)-infected Atlantic salmon. Fish \u0026amp; shellfish immunology. 2010;28(1):30-9.\u003c/li\u003e\n\u003cli\u003eLauscher A, Krossoy B, Frost P, Grove S, Konig M, Bohlin J, et al. Immune responses in Atlantic salmon (Salmo salar) following protective vaccination against Infectious salmon anemia (ISA) and subsequent ISA virus infection. Vaccine. 2011.\u003c/li\u003e\n\u003cli\u003eKossack C, Fuentes N, Maisey K. In silico prediction of B and T cell epitopes of infectious salmon anemia virus proteins and molecular modeling of T cell epitopes to salmon major histocompatibility complex (MHC) class I. Fish Shellfish Immunol. 2022;128:335-47.\u003c/li\u003e\n\u003cli\u003eToro-Ascuy D, Cardenas M, Vasquez-Martinez Y, Cortez-San Martin M. Rescue of Infectious Salmon Anemia Virus (ISAV) from Cloned cDNA. Methods Mol Biol. 2024;2733:87-99.\u003c/li\u003e\n\u003cli\u003eHwang D. Essential fatty acids and immune response. Faseb J. 1989;3(9):2052-61.\u003c/li\u003e\n\u003cli\u003eDustin LB, Shea CM, Soberman RJ, Lu CY. Docosahexaenoic acid, a constituent of rodent fetal serum and fish oil diets, inhibits acquisition of macrophage tumoricidal function. J Immunol. 1990;144(12):4888-97.\u003c/li\u003e\n\u003cli\u003eWaagbo R. The impact of nutritional factors on the immune system in Atlantic salmon, Salmo salar L.: a review. Aquaculture Research. 1994;25(2):175-97.\u003c/li\u003e\n\u003cli\u003eCalder PC. n-3 polyunsaturated fatty acids and cytokine production in health and disease. Ann Nutr Metab. 1997;41(4):203-34.\u003c/li\u003e\n\u003cli\u003eMarch BE. Essential fatty acids in fish physiology. CanJPhysiolPharmacol. 1993;71:684-9.\u003c/li\u003e\n\u003cli\u003eVelotti F, Costantini L, Merendino N. Omega-3 Polyunsaturated Fatty Acids (n-3 PUFAs) for Immunomodulation in COVID-19 Related Acute Respiratory Distress Syndrome (ARDS). J Clin Med. 2022;12(1).\u003c/li\u003e\n\u003cli\u003eMori TA, Beilin LJ. Omega-3 fatty acids and inflammation. Curr Atheroscler Rep. 2004;6(6):461-7.\u003c/li\u003e\n\u003cli\u003eMiles EA, Calder PC. Influence of marine n-3 polyunsaturated fatty acids on immune function and a systematic review of their effects on clinical outcomes in rheumatoid arthritis. Br J Nutr. 2012;107 Suppl 2:S171-84.\u003c/li\u003e\n\u003cli\u003eMebarek S, Ermak N, Benzaria A, Vicca S, Dubois M, Nemoz G, et al. Effects of increasing docosahexaenoic acid intake in human healthy volunteers on lymphocyte activation and monocyte apoptosis. Br J Nutr. 2009;101(6):852-8.\u003c/li\u003e\n\u003cli\u003eGallo CG, Fiorino S, Posabella G, Antonacci D, Tropeano A, Pausini E, et al. The function of specialized pro-resolving endogenous lipid mediators, vitamins, and other micronutrients in the control of the inflammatory processes: Possible role in patients with SARS-CoV-2 related infection. Prostaglandins Other Lipid Mediat. 2022;159:106619.\u003c/li\u003e\n\u003cli\u003eAyres JS. Immunometabolism of infections. Nat Rev Immunol. 2020;20(2):79-80.\u003c/li\u003e\n\u003cli\u003eAas TS, \u0026Aring;sg\u0026aring;rd T, Ytrest\u0026oslash;yl T. Utilization of feed resources in the production of Atlantic salmon (Salmo salar) in Norway: An update for 2020. Aquaculture Reports. 2022;26:101316.\u003c/li\u003e\n\u003cli\u003eRuyter, RosjO, Einen, Thomassen. Essential fatty acids in Atlantic salmon: effects of increasing dietary doses of n-6 and n-3 fatty acids on growth, survival and fatty acid composition of liver, blood and carcass. Aquaculture Nutrition. 2000;6(2):119-27.\u003c/li\u003e\n\u003cli\u003eBell JG, Sargent JR, Raynard RS. Effects of increasing dietary linoleic acid on phospholipid fatty acid composition and eicosanoid production in leucocytes and gill cells of Atlantic salmon (Salmo salar). Prostaglandins Leukot Essent Fatty Acids. 1992;45(3):197-206.\u003c/li\u003e\n\u003cli\u003eBell JG, Tocher DR, Farndale BM, Cox DI, McKinney RW, Sargent JR. The effect of dietary lipid on polyunsaturated fatty acid metabolism in Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e) undergoing Parr- Smolt transformation. Lipids. 1997;32(5):515-25.\u003c/li\u003e\n\u003cli\u003eBell JG, Ashton I, Secombes CJ, Weitzel BR, Dick JR, Sargent JR. Dietary lipid affects phospholipid fatty acid compositions, eicosanoid production and immune function in Atlantic salmon (Salmo salar). Prostaglandins, Leukotrienes and Essential Fatty Acids. 1996;54:173-82.\u003c/li\u003e\n\u003cli\u003eHolen E, Araujo P, Sissener NH, Rosenlund G, Waagb\u0026oslash; R. Corrigendum to \u0026ldquo;A comparative study: Difference in omega-6/omega-3 balance and saturated fat in diets for Atlantic salmon (Salmo salar) affect immune-, fat metabolism-, oxidative and apoptotic-gene expression, and eicosanoid secretion in head kidney leukocytes\u0026rdquo; [Fish Shellfish Immunol. 72 (2018) 57\u0026ndash;68]. Fish \u0026amp; shellfish immunology. 2018;83:449.\u003c/li\u003e\n\u003cli\u003eAndresen AMS, Lutfi E, Ruyter B, Berge G, Gjoen T. Interaction between dietary fatty acids and genotype on immune response in Atlantic salmon (Salmo salar) after vaccination: A transcriptome study. PLoS One. 2019;14(7):e0219625.\u003c/li\u003e\n\u003cli\u003eRuyter, R\u0026oslash;sj\u0026oslash;, Einen, Thomassen. Essential fatty acids in Atlantic salmon: effects of increasing dietary doses of n-6 and n-3 fatty acids on growth, survival and fatty acid composition of liver, blood and carcass. Aquaculture Nutrition. 2000;6(2):119-27.\u003c/li\u003e\n\u003cli\u003eEmery JA, Norambuena F, Trushenski J, Turchini GM. Uncoupling EPA and DHA in Fish Nutrition: Dietary Demand is Limited in Atlantic Salmon and Effectively Met by DHA Alone. Lipids. 2016;51(4):399-412.\u003c/li\u003e\n\u003cli\u003eVila IK, Chamma H, Steer A, Saccas M, Taffoni C, Turtoi E, et al. STING orchestrates the crosstalk between polyunsaturated fatty acid metabolism and inflammatory responses. Cell metabolism. 2022;34(1):125-39 e8.\u003c/li\u003e\n\u003cli\u003eZhang W, Wang G, Xu ZG, Tu H, Hu F, Dai J, et al. Lactate Is a Natural Suppressor of RLR Signaling by Targeting MAVS. Cell. 2019;178(1):176-89 e15.\u003c/li\u003e\n\u003cli\u003eJia X, Crawford JC, Gebregzabher D, Monson EA, Mettelman RC, Wan Y, et al. High expression of oleoyl-ACP hydrolase underpins life-threatening respiratory viral diseases. Cell. 2024;187(17):4586-604.e20.\u003c/li\u003e\n\u003cli\u003eDixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012;149(5):1060-72.\u003c/li\u003e\n\u003cli\u003eZhao X, Zhang Y, Luo B. Ferroptosis, from the virus point of view: opportunities and challenges. Crit Rev Microbiol. 2024:1-18.\u003c/li\u003e\n\u003cli\u003eCalder PC. The relationship between the fatty acid composition of immune cells and their function. Prostaglandins Leukot Essent Fatty Acids. 2008;79(3-5):101-8.\u003c/li\u003e\n\u003cli\u003eSerhan CN, Chiang N, Van Dyke TE. Resolving inflammation: dual anti-inflammatory and pro-resolution lipid mediators. Nat Rev Immunol. 2008;8(5):349-61.\u003c/li\u003e\n\u003cli\u003eMotshwene PG, Moncrieffe MC, Grossmann JG, Kao C, Ayaluru M, Sandercock AM, et al. An oligomeric signaling platform formed by the Toll-like receptor signal transducers MyD88 and IRAK-4. J Biol Chem. 2009;284(37):25404-11.\u003c/li\u003e\n\u003cli\u003eHwang Keun Y, Choi Young B. Modulation of Mitochondrial Antiviral Signaling by Human Herpesvirus 8 Interferon Regulatory Factor 1. Journal of Virology. 2015;90(1):506-20.\u003c/li\u003e\n\u003cli\u003eArnemo M, Kavaliauskis A, Andresen AMS, Bou M, Berge GM, Ruyter B, Gj\u0026oslash;en T. Effects of dietary n-3 fatty acids on Toll-like receptor activation in primary leucocytes from Atlantic salmon (Salmo salar). Fish Physiology and Biochemistry. 2017;43(4):1065-80.\u003c/li\u003e\n\u003cli\u003eB. Ruyter CR, T. Einen. Essential fatty acids in Atlantic salmon: effects of increasing dietary doses of n-6 and n-3 fatty acids on growth, survival and fatty acid composition of liver, blood and carcass. Aquaculture Nutrition. 2001;6(2):8.\u003c/li\u003e\n\u003cli\u003eGj\u0026oslash;en T, Kleveland EJ, Moya-Falc\u0026oacute;n C, Fr\u0026oslash;ystad MK, Vegusdal A, Hvattum E, et al. Effects of dietary thia fatty acids on lipid composition, morphology and macrophage function of Atlantic salmon ( Salmo salar L.) kidney. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology. 2007;148(1):103-11.\u003c/li\u003e\n\u003cli\u003eMetochis CP, Spanos I, Auchinachie N, Crampton VO, Bell JG, Adams A, Thompson KD. The effects of increasing dietary levels of soy protein concentrate (SPC) on the immune responses and disease resistance (furunculosis) of vaccinated and non-vaccinated Atlantic salmon (Salmo salar L.) parr. Fish Shellfish Immunol. 2016;59:83-94.\u003c/li\u003e\n\u003cli\u003eCaballero-Solares A, Hall JR, Xue X, Eslamloo K, Taylor RG, Parrish CC, Rise ML. The dietary replacement of marine ingredients by terrestrial animal and plant alternatives modulates the antiviral immune response of Atlantic salmon (Salmo salar). Fish Shellfish Immunol. 2017;64:24-38.\u003c/li\u003e\n\u003cli\u003eMjaaland S, Markussen T, Sindre H, Kjoglum S, Dannevig BH, Larsen S, Grimholt U. Susceptibility and immune responses following experimental infection of MHC compatible Atlantic salmon (Salmo salar L.) with different infectious salmon anaemia virus isolates. Archives of Virology. 2005;150(11):2195-216.\u003c/li\u003e\n\u003cli\u003eAndresen AMS, Boudinot P, Gjoen T. Kinetics of transcriptional response against poly (I:C) and infectious salmon anemia virus (ISAV) in Atlantic salmon kidney (ASK) cell line. Dev Comp Immunol. 2020;110:103716.\u003c/li\u003e\n\u003cli\u003eFolch J, Lees M, Stanley GHS. A SIMPLE METHOD FOR THE ISOLATION AND PURIFICATION OF TOTAL LIPIDES FROM ANIMAL TISSUES. Journal of Biological Chemistry. 1957;226(1):497-509.\u003c/li\u003e\n\u003cli\u003eMason ME, Waller GR. Dimethoxypropane Induced Transesterification of Fats and Oils in Preparation of Methyl Esters for Gas Chromatographic Analysis. Analytical Chemistry. 1964;36(3):583-6.\u003c/li\u003e\n\u003cli\u003eHoshi M, Williams M, Kishimoto Y. Esterification of fatty acids at room temperature by chloroform-methanolic HCl\u0026ndash;cupric acetate. Journal of Lipid Research. 1973;14(5):599-601.\u003c/li\u003e\n\u003cli\u003ePfaffl MW. A new mathematical model for relative quantification in real-time RT\u0026ndash;PCR. Nucleic Acids Research. 2001;29(9):e45.\u003c/li\u003e\n\u003cli\u003eJ\u0026oslash;rgensen SM, Kleveland EJ, Grimholt U, Gj\u0026oslash;en T. Validation of reference genes for real-time polymerase chain reaction studies in Atlantic salmon. Marine biotechnology. 2006;8(4):398-408.\u003c/li\u003e\n\u003cli\u003eJorgensen SM, Grimholt U, Gjoen T. Cloning and expression analysis of an Atlantic salmon (Salmo salar L.) tapasin gene. Developmental and Comparative Immunology. 2007;31(7):708-19.\u003c/li\u003e\n\u003cli\u003eHansen TE, Jorgensen JB. Cloning and characterisation of p38 MAP kinase from Atlantic salmon A kinase important for regulating salmon TNF-2 and IL-1beta expression. Mol Immunol. 2007;44(12):3137-46.\u003c/li\u003e\n\u003cli\u003eSchiotz BL, Baekkevold ES, Poulsen LC, Mjaaland S, Gjoen T. Analysis of host- and strain-dependent cell death responses during infectious salmon anemia virus infection in vitro. Virol J. 2009;6:91.\u003c/li\u003e\n\u003cli\u003eJorgensen SM, Lyng-Syvertsen B, Lukacs M, Grimholt U, Gjoen T. Expression of MHC class I pathway genes in response to infectious salmon anaemia virus in Atlantic salmon (Salmo salar L.) cells. Fish \u0026amp; shellfish immunology. 2006;21(5):548-60.\u003c/li\u003e\n\u003cli\u003eClouthier SC, Rector T, Brown NEC, Anderson ED. Genomic organization of infectious salmon anaemia virus. Journal of General Virology [J Gen Virol]. 2002;83(2):421-8.\u003c/li\u003e\n\u003cli\u003eKim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019;37(8):907-15.\u003c/li\u003e\n\u003cli\u003ePertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 2015;33(3):290-5.\u003c/li\u003e\n\u003cli\u003eLove MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014;15(12):550.\u003c/li\u003e\n\u003cli\u003eLove MI, Anders S, Kim V, Huber W. RNA-Seq workflow: gene-level exploratory analysis and differential expression. F1000Research. 2015;4:1070-.\u003c/li\u003e\n\u003cli\u003eYu G, Wang L-G, Han Y, He Q-Y. clusterProfiler: an R Package for Comparing Biological Themes Among Gene Clusters. OMICS: A Journal of Integrative Biology. 2012;16(5):284-7.\u003c/li\u003e\n\u003cli\u003eLuo W, Brouwer C. Pathview: an R/Bioconductor package for pathway-based data integration and visualization. Bioinformatics. 2013;29(14):1830-1.\u003c/li\u003e\n\u003cli\u003eSularea VM, Sugrue JA, O\u0026apos;Farrelly C. Innate antiviral immunity and immunometabolism in hepatocytes. Curr Opin Immunol. 2023;80:102267.\u003c/li\u003e\n\u003cli\u003eLiang D, Minikes AM, Jiang X. Ferroptosis at the intersection of lipid metabolism and cellular signaling. Molecular Cell. 2022.\u003c/li\u003e\n\u003cli\u003eLutfi E, Berge GM, B\u0026aelig;verfjord G, Sigholt T, Bou M, Larsson T, et al. Increasing dietary levels of the n-3 long-chain PUFA, EPA and DHA, improves the growth, welfare, robustness and fillet quality of Atlantic salmon in sea cages. British Journal of Nutrition. 2023;129(1):10-28.\u003c/li\u003e\n\u003cli\u003eMartinez-Rubio L, Morais S, Evensen O, Wadsworth S, Ruohonen K, Vecino JL, et al. Functional feeds reduce heart inflammation and pathology in Atlantic Salmon (Salmo salar L.) following experimental challenge with Atlantic salmon reovirus (ASRV). PLoS One. 2012;7(11):e40266.\u003c/li\u003e\n\u003cli\u003eMartinez-Rubio L, Evensen O, Krasnov A, Jorgensen SM, Wadsworth S, Ruohonen K, et al. Effects of functional feeds on the lipid composition, transcriptomic responses and pathology in heart of Atlantic salmon (Salmo salar L.) before and after experimental challenge with Piscine Myocarditis Virus (PMCV). BMC Genomics. 2014;15:462.\u003c/li\u003e\n\u003cli\u003eRorvik KA, Dehli A, Thomassen M, Ruyter B, Steien SH, Salte R. Synergistic effects of dietary iron and omega-3 fatty acid levels on survival of farmed Atlantic salmon, Salmo salar L., during natural outbreaks of furunculosis and cold water vibriosis. J Fish Dis. 2003;26(8):477-85.\u003c/li\u003e\n\u003cli\u003eSelvam C, Philip AJP, Lutfi E, Sigholt T, Norberg B, Baeverfjord G, et al. Long-term feeding of Atlantic salmon with varying levels of dietary EPA + DHA alters the mineral status but does not affect the stress responses after mechanical delousing stress. Br J Nutr. 2022;128(12):2291-307.\u003c/li\u003e\n\u003cli\u003eHuyben D, Grobler T, Matthew C, Bou M, Ruyter B, Glencross B. Requirement for omega-3 long-chain polyunsaturated fatty acids by Atlantic salmon is relative to the dietary lipid level. Aquaculture. 2021;531:735805.\u003c/li\u003e\n\u003cli\u003eRosenlund G, Torstensen BE, Stubhaug I, Usman N, Sissener NH. Atlantic salmon require long-chain n-3 fatty acids for optimal growth throughout the seawater period. J Nutr Sci. 2016;5:e19.\u003c/li\u003e\n\u003cli\u003eSvingerud T, Holand JK, Robertsen B. Infectious salmon anemia virus (ISAV) replication is transiently inhibited by Atlantic salmon type I interferon in cell culture. Virus Research. 2013;177(2):163-70.\u003c/li\u003e\n\u003cli\u003eGj\u0026oslash;en T, Ruyter, B. , \u0026Oslash;stbye, T-K. K. Effects of eicosapentaneoic acid on innate immune responses in an Atlantic salmon kidney cell line in vitro. PLOS One. 2024;In press.\u003c/li\u003e\n\u003cli\u003eHeming M, Gran S, Jauch SL, Fischer-Riepe L, Russo A, Klotz L, et al. Peroxisome Proliferator-Activated Receptor-gamma Modulates the Response of Macrophages to Lipopolysaccharide and Glucocorticoids. Front Immunol. 2018;9:893.\u003c/li\u003e\n\u003cli\u003eZhao W, Wang L Fau - Zhang M, Zhang M Fau - Wang P, Wang P Fau - Zhang L, Zhang L Fau - Yuan C, Yuan C Fau - Qi J, et al. Peroxisome proliferator-activated receptor gamma negatively regulates IFN-beta production in Toll-like receptor (TLR) 3- and TLR4-stimulated macrophages by preventing interferon regulatory factor 3 binding to the IFN-beta promoter. (1083-351X (Electronic)).\u003c/li\u003e\n\u003cli\u003eFantacuzzi MA-O, Amoroso RA-O, Ammazzalorso AA-O. PPAR Ligands Induce Antiviral Effects Targeting Perturbed Lipid Metabolism during SARS-CoV-2, HCV, and HCMV Infection. LID - 10.3390/biology11010114 [doi] LID - 114. (2079-7737 (Print)).\u003c/li\u003e\n\u003cli\u003eLutfi E, Berge GM, Baeverfjord G, Sigholt T, Bou M, Larsson T, et al. Increasing dietary levels of the omega-3 long-chain polyunsaturated fatty acids, EPA and DHA, improves the growth, welfare, robustness, and fillet quality of Atlantic salmon in sea cages. Br J Nutr. 2022;129(1):1-48.\u003c/li\u003e\n\u003cli\u003eStockwell BR. Ferroptosis turns 10: Emerging mechanisms, physiological functions, and therapeutic applications. Cell. 2022;185(14):2401-21.\u003c/li\u003e\n\u003cli\u003eJiang L, Kon N, Li T, Wang SJ, Su T, Hibshoosh H, et al. Ferroptosis as a p53-mediated activity during tumour suppression. Nature. 2015;520(7545):57-62.\u003c/li\u003e\n\u003cli\u003eYao Y, Chen Z, Zhang H, Chen C, Zeng M, Yunis J, et al. Selenium\u0026ndash;GPX4 axis protects follicular helper T cells from ferroptosis. Nature Immunology. 2021;22(9):1127-39.\u003c/li\u003e\n\u003cli\u003eZheng H, Jiang L, Tsuduki T, Conrad M, Toyokuni S. Embryonal erythropoiesis and aging exploit ferroptosis. Redox Biology. 2021;48.\u003c/li\u003e\n\u003cli\u003eXu XQ, Xu T, Ji W, Wang C, Ren Y, Xiong X, et al. Herpes Simplex Virus 1-Induced Ferroptosis Contributes to Viral Encephalitis. mBio. 2023;14(1):e0237022.\u003c/li\u003e\n\u003cli\u003eYamane D, Hayashi Y, Matsumoto M, Nakanishi H, Imagawa H, Kohara M, et al. FADS2-dependent fatty acid desaturation dictates cellular sensitivity to ferroptosis and permissiveness for hepatitis C virus replication. Cell Chemical Biology. 2022;29(5):799-810.e4.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Atlantic salmon, Polyunsaturated fatty acid, Eicosapentaenoic acid, Virus, Infectious salmon anemia virus, Transcriptomics, Viral disease, Ferroptosis","lastPublishedDoi":"10.21203/rs.3.rs-5071779/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5071779/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAquaculture is one of the world's fastest-growing sectors in food production but with multiple challenges related to animal handling and infections. The disease caused by infectious salmon anemia virus (ISAV) leads to outbreaks of local epidemics, reducing animal welfare, and causing significant economic losses. The composition of feed has shifted from marine ingredients such as fish oil and fish meal towards a more plant-based diet causing reduced levels of EPA. The aim of this study was to investigate whether low or high levels of EPA affect the expression of genes related to the innate immune response 48 hours after infection with ISAV. The study includes seven experimental groups: ± ISAV and various levels of EPA up to 200 µM. Analysis of RNA sequencing data showed that more than 3000 genes were affected by ISAV alone (without additional EPA). In cells with increasing levels of EPA, more than 2500 additional genes were differentially expressed. This indicates that high levels of EPA concentration have an independent effect on gene expression in virus-infected cells, not observed at lower levels of EPA. Analyses of enriched biological processes and molecular functions (GO and KEGG analysis) revealed that EPA had a limited impact on the innate immune system alone, but that many processes were affected by EPA when cells were virus infected. Several biological pathways were affected, including protein synthesis (ribosomal transcripts), peroxisome proliferator activated receptor (PPAR) signaling, and ferroptosis. Cells exposed to both increasing concentrations of EPA and virus displayed gene expression patterns indicating increased formation of oxygen radicals and that cell death via ferroptosis was activated. This gene expression pattern was not observed during infection at low EPA levels or when ASK cells were exposed to the highest EPA level (200 μM) without virus infection. Cell death via ferroptosis may therefore be a mechanism for controlled cell death and thus reduction of virus replication when there are enough PUFA in the membrane.\u003c/p\u003e","manuscriptTitle":"Effect of eicosapentaenoic acid on innate immune responses in Atlantic salmon cells infected with infectious salmon anemia virus","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-20 12:11:04","doi":"10.21203/rs.3.rs-5071779/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-11-23T05:35:40+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-22T09:24:49+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-14T08:27:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"313757904542429082942294334337590300723","date":"2024-11-06T14:53:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"26598908350420261085529192860027075272","date":"2024-11-06T08:51:00+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-28T07:31:57+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-09-12T23:57:06+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-09-12T23:22:25+00:00","index":"","fulltext":""},{"type":"submitted","content":"Virology Journal","date":"2024-09-11T14:06:24+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"92cf8749-5ade-4d04-b1ec-7d2e275e9a8b","owner":[],"postedDate":"December 20th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-01-13T16:03:03+00:00","versionOfRecord":{"articleIdentity":"rs-5071779","link":"https://doi.org/10.1186/s12985-024-02619-0","journal":{"identity":"virology-journal","isVorOnly":false,"title":"Virology Journal"},"publishedOn":"2025-01-09 15:57:43","publishedOnDateReadable":"January 9th, 2025"},"versionCreatedAt":"2024-12-20 12:11:04","video":"","vorDoi":"10.1186/s12985-024-02619-0","vorDoiUrl":"https://doi.org/10.1186/s12985-024-02619-0","workflowStages":[]},"version":"v1","identity":"rs-5071779","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5071779","identity":"rs-5071779","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}