Depleted housing elicits cardiopulmonary dysfunction after a single flaming eucalyptus wildfire smoke exposure in a sex-specific manner in ApoE knockout mice

Depleted housing elicits cardiopulmonary dysfunction after a single flaming eucalyptus wildfire smoke exposure in a sex-specific manner in ApoE knockout mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Depleted housing elicits cardiopulmonary dysfunction after a single flaming eucalyptus wildfire smoke exposure in a sex-specific manner in ApoE knockout mice Michelle Fiamingo, Sydnie Toler, Kaleb Lee, Wendy Oshiro, Todd Krantz, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4237383/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 24 Jul, 2024 Read the published version in Cardiovascular Toxicology → Version 1 posted 7 You are reading this latest preprint version Abstract Although it is well established that wildfire smoke exposure can increase cardiovascular morbidity and mortality, the combined effects of non-chemical stressors and wildfire smoke remains understudied. Housing is a non-chemical stressor that is a major determinant of cardiovascular health, however, disparities in neighborhood and social status have exacerbated the cardiovascular health gaps within the United States. Further, pre-existing cardiovascular morbidities, such as atherosclerosis, can worsen the response to wildfire smoke exposures. This represents a potentially hazardous interaction between inadequate housing and stress, cardiovascular morbidities, and worsened responses to wildfire smoke exposures. The purpose of this study was to examine the effects of enriched (EH) versus depleted (DH) housing on pulmonary and cardiovascular responses to a single flaming eucalyptus wildfire smoke (WS) exposure in male and female apolipoprotein E (ApoE) knockout mice, which develop an atherosclerosis-like phenotype. The results of this study show that cardiopulmonary responses to WS exposure occur in a sex-specific manner. EH blunts adverse WS-induced ventilatory responses, specifically an increase in tidal volume (TV), expiratory time (Te), and relaxation time (RT) after a WS exposure, but only in females. EH also blunted a WS-induced increase in isovolumic relaxation time (IVRT) and the myocardial performance index (MPI) 1-wk after exposures, also only in females. Our results suggest that housing alters the cardiovascular response to a single WS exposure, and that DH might cause increased susceptibility to environmental exposures that manifest in altered ventilation patterns and diastolic dysfunction in a sex-specific manner. Housing wildfires resiliency cardiovascular atherosclerosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Living conditions are now widely accepted as important determinants of cardiovascular disease (CVD) incidence and progression [ 1 ]. While the impacts of biological, behavioral, and genetic risk factors on the progression of CVD [ 2 ] have long been appreciated, it has become increasingly clear that psychosocial factors, including stress [ 3 ], depression [ 4 ], and anxiety [ 5 ] are also associatied with the onset and progression of CVD. For example, socioeconomic conditions from childhood are inversely associated with CVD risk in adulthood [ 6 ], emphasizing how non-chemical risk factors can have long-term effects on human health. The Multi-Ethnic Study of Atherosclerosis found that low-support and disorderly neighborhood environments are associated with a less healthy diet and decreased access to nutritious food [ 7 , 8 ], a decrease in physical activity [ 9 , 10 ], and sleep perturbations [ 11 , 12 ], all of which increase CVD risk [ 13 ]. Thus, housing and neighborhoods indirectly affect cardiovascular health, and likely play an role in disease pathology. However, research that examines the impacts of direct housing interventions on the progression of CVD and the biological mechanisms responsible for such effects remains scarce. Housing and neighborhood status can also affect physiological resiliency to environmental and chemical exposures. For example, wildfire smoke (WS) has been found to disproportionately impact cardiopulmonary outcomes based on measures of community health, such as income, education, and family and social support [ 14 ], while air pollution disproportionately affects lower socioeconomic status (SES) communities [ 15 ]. Widlfire smoke exposure has also been shown to induce adverse cardiovascular responses, including triggering a pro-atherosclerotic vascular response to WS in mice [ 16 ] and an increased prevalence of atherosclerotic plaques and carotid-intima media thickness [ 17 ]. In addition, there is significant epidemiological evidence that air pollution, specifically fine particulate matter (PM 2.5 ), is associated with atherosclerotic CVD [ 18 ]. Worsening climate conditions have prompted an increase in the prevalence and severity of wildfires [ 19 ], and as such may increase the likelihood for spatiotemporal juxgaposition of chemical stressors (i.e., WS) with non-chemical stress from inadequate housing and psychosocial perturbances. Rodent models are a suitable approach to extrapolate human responses considering living condition-induced psychosocial stress causes similar cardiovascular deficits in both [ 20 ], and have been used extensively to study cardiovascular physiology and the cardiopulmonary response to air pollutants [ 21 , 22 , 23 ]. For instance, spontaneously hypertensive rats experience increased blood pressure and heart rate when social enrichment was removed from their cages [ 24 ], indicating that housing can affect baseline cardiovascular function. Similarly, rat models have shown that environmental enrichment can mitigate and reverse neurocognitive dysfunction caused by developmental lead exposure [ 25 , 26 ], suggesting that housing can also alter body resiliency to toxicants. However, few studies have focused on characterizing changes in cardiovascular physiology and function from housing enrichment and the ability of housing to modulate resiliency against an air pollution exposure. Our previous work showed that depleted housing causes increased heart rate, incidence of arrhythmias, and lower activity levels in healthy mice during a single smoke exposure [ 27 ]. However, the effect of this housing paradigm on underlying CVD and the corresponding response to WS remains unknown. The objective of the present study was to identify the effects of depleted (DH) versus enriched housing (EH) on cardiomechanical function and physiology in a atherosclerosis-prone mouse model and characterize the response to eucalyptus WS. Materials and Methods Animals – Eight-week-old male and female ApoE (-/-) mice (Jackson Laboratories – Bar Harbor, ME) were utilized in this study. Mice were housed 5 animals per cage with alpha-dri bedding and a 12-hour light/dark cycle in polycarbonate cages. These facilities are maintained at 21°C and 50% relative humidity in our Association for Assessment and Accreditation of Laboratory Animal Care (AALAC)- approved facilities at the United States Environmental Protection Agency (USEPA). The animals were given access to food and water ad libitum , except during the exposures, and were allowed to acclimate for 7-days prior to the beginning of the study. Study Design – Mice were acclimated to the facilities for one week before being randomly separated into either enriched (EH) or depleted (DH) housing. Enriched housed mice had access to a hut and a wheel, a nestlet (Lab Supply, Durham, NC), a scratchpad, and a tunnel, whereas the DH mice were kept in a bare cage with alpha-dri bedding (Fig. 1 ). Mice were housed in these conditions for 18 weeks before being randomly exposed once to either one-hour eucalyptus smoke (WS) or a filtered air (FA) sham (n = 6/sex/group). High-frequency echocardiography was assessed approximately 1-2-weeks before and 24hrs and one-week after the exposure in order to evaluate the immediate effects from WS-exposure, as well as any long-term interactions between housing and WS, and whole-body plethysmography was performed the week before and immediately after exposure. The necropsy was conducted after 19 weeks, and the mice were approximately 27 weeks old at this time. Serum was collected and the distal aorta was excised and frozen at -80°C for gene expression analyses. Tube Furnace Exposure System for whole-body exposure to flaming eucalyptus biomass smoke – An automated control tube furnace system at the USEPA was utilized to create the eucalyptus biomass wildfire smoke under flaming conditions (2L/min), which has been previously described [ 28 ]. Animals were exposed to either the eucalyptus wildfire smoke or a filtered air sham for one-hour in whole-body inhalation chambers (0.3m 3 Hinners style stainless steel and glass exposure chamber). Eucalyptus fuel was acquired as writing pen blanks (rectangles at 0.75 inches square by 6 inches long) (Woodworkers source Arizona). A gasoline powered wood shredder (Echo bearcat model number SC3206) was utilized to process the wood and was cleaned in between use. The particulate matter (PM) concentration was monitored continuously and adjusted by a proportional-integral-derivative (PID) feedback loop. Carbon dioxide and carbon monoxide were monitored continuously utilizing a non-dispersive infrared analyzer (Model: 602 CO/CO 2 ; CAI Inc., Orange, CA). PM was also collected on a glass fiber filter that was installed in the exhaust line to determine average PM concentrations gravimetrically by weighing the filter before and after the inhalation exposures. The real-time measurements of the wildfire smoke properties and engineering parameters (ie. temperatures, relative humidity, static pressures and flow rate) were continuously monitored and analyzed utilizing data acquisition software (Dasylab version 13.0, National Instruments, Austin, TX). Whole-Body Plethysmography (WBP) – To assess changes in ventilation patterns, animals were monitored by WBP (Emka Technologies, Falls Church, VA) one week before exposure (pre-exposure) and immediately post-exposure, as previously described [ 29 ]. The mice were placed in clear plethysmography chambers (3.5” diameter x 2.5” height) and given a 5 min acclimation period. Following the acclimation period, data was collected for 15 min and averaged over three five-minute periods, where the following breathing parameters were assessed: inhalation time (Ti), exhalation time (Te), peak inspiratory flow (PIF), peak expiratory flow (PEF), breathing frequency (f), tidal volume (TV), minute volume (MV), relaxation time (RT), and enhanced pause (PenH). Data was collected and analyzed using EMKA iox 2 software (SCIREQ, Montreal, Canada). High Frequency Echocardiography (HF-echo) – Cardiac physiology and function was assessed with a high-frequency echocardiography ultrasound system (Vevo 2100, FujiFilm Visual Sonics Inc., Toronto, Canada), as previously described [ 30 ]. Animals were anesthetized with 1.5-3% isoflurane delivered in 100% O 2 at 0.8-1.0L/min in a sealed whole-body chamber. Once under light anesthesia, the animals were placed on a heated Vevo® Mouse Handling Table (FujiFilm Visual Sonics, Inc.), where isoflurane was continually delivered via nose cone, in dorsal recumbency with each paw grounded to an electrode using Electrode Crème (Cat# 600-0001-01-S, Indus Instruments, Webster, TX, USA) for physiological monitoring and recording of electrocardiogram, heart rate, and respiration rate. An MS-550D transducer was used to image the parasternal long-axis view of the left ventricle using B-mode and M-mode imaging. Pulsed wave Doppler measurements of pulmonary artery and transmitral blood flow was viewed from the short axis and apical four-chamber view, respectively. The sonographer was blinded to the exposure group identities and 3 cine-loops were collected in each view for data analysis. Echocardiographic analysis – Echocardiographic analysis was completed utilizing Vevo® Lab Software (FujiFilm Visual Sonics, Inc.), as previously described (Martin et al. 2018). Briefly, while blinded to exposure groups, two beats between breaths for three cine-loops were analyzed. Long-axis M-mode cine-loops were analyzed to measure endpoints related to cardiovascular physiology and cardio-mechanical function, such as, heart rate (HR), cardiac output (CO), stroke volume (SV), fractional shortening (FS), ejection fraction (EF), end systolic volume (ESV), end diastolic volume (EDV), left ventricle anterior wall systole (LVAW;s), left ventricle anterior wall diastole (LVAW;d), left ventricle posterior wall systole (LVPW;s), and left ventricle posterior wall diastole (LVPW;d). Utilizing pulsed wave doppler measurements, we also analyzed blood flow through the pulmonary artery to assess pulmonary artery acceleration time (PAT) and pulmonary artery ejection time (PET). A ratio of these two parameters (PAT/PET) was also calculated. Transmitral blood flow was also assessed utilizing pulsed wave doppler measurements to calculate isovolumic contraction time (IVCT), aortic ejection time (AET), and isovolumetric relaxation time (IVRT). The myocardial performance index was calculated with the following equation: (IVCT + IVRT)/AET. Necropsy and Tissue Collection – After the final ultrasound, mice were given an intraperitoneal injection of Euthasol (100mg/kg Na + pentobarbital 25 mg/kg phenytoin; Virbac Animal Health, Fort Worth, TX, USA). After the animals were unresponsive to a hind paw pinch, blood was collected from the abdominal aorta in serum separator tubes (no anti-coagulant) and centrifuged at 3500 rpm, 4°C for 10 min. Serum samples were stored at -80°C for later analyses with commercially available kits for a KoneLab Arena 30 Clinical Chemical Analyzer (Thermo Chemical Lab Systems, Espoo, Finland). Serum levels of total cholesterol, trigylcerides, and glucose were evaluated with kits from TECO Diagnostics (Anaheim, California). High-density lipoprotein (HDL) and low-density lipoprotein (LDL) serum levels were evaluated with a kit from Sekisui Diagnostics LLC (Burlington, MA), and free fatty acids (FFA) serum levels were analyzed with kits from Cell Biolabs, Inc (San Diego, California). The whole heart was weighed and the distal aorta was excised and frozen in liquid nitrogen and stored at -80°C. RNA Extraction and real time quantitative polymerase chain reaction (RT- qPCR) – RNA was isolated from ~ 10mg of aortic tissue from consistent regions of the aortic arch. Direct-zol RNA Miniprep Plus kit (Zymo Research, Irvine, CA) and QIAzol lysis reagent (Qiagen, Valencia, CA) were used to isolate RNA according to instructions provided from the manufacturer. Total RNA quantity and quality (260/280 and 260/230 ratios) was assesses using a Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA). cDNA synthesis using RNA templates was performed using qScript (Quanta Biosciences, Beverly, MA) following manufactuers instructions. Primers were designed using the publicly available NCBI database. Forward and reverse primers were purchased from Integrated DNA Technologies, Inc. (Coralville, IA): Act-β f- CTCCCTGGAGAAGAGCTATGA, r- CCAAGAAGGAAGGCTGGAAA; Vcam-1 f- GAAATGCCACCCTCACCTTA, r- TCTGCTTTGTCTCTCCCAATC; Icam-1 f- CCAAGAAACGCTGACTTCATTC, r- GGTCTTCTTGCTTGTGTCTACT; Il-6 f- CTTCCATCCAGTTGCCTTCT, r- CTCCGACTTGTGAAGTGGTATAG; Ptx3 f- AGGGTGGACTCCTACAGATT, r- TGAGAACCCGATCCCAGATA; Nampt f- CCTGACTCTGGAAATCCTCTTG, r- AAGGTGGCAGCAACTTGTA. The relative difference in aortic DNA was quantified through qPCR on a QuantStudio™ 7 system (ThermoFisher Scientific, Waltham, MA) using Sybr Green PCR Master Mix (ThermoFisher Scientific, Waltham, MA) and 15ng of DNA. Relative gene expression differences were normalized using the ΔΔ CT method and β-actin as the housekeeping gene and DH- FA as the control. Bronchoalveolar Lavage – Bronchoalveolar lavage fluid (BALF) samples were collected at necropsy. Room temperature Hank’s Balanced Salt Solution (HBSS) was injected into the lungs via the trachea and repeated for each animal so that there were three aliquots of 0.6mL of HBSS for analysis. The cells were resuspended in 1.0mL of HBSS and placed into Coulter vials for total cell counts (Z1 Beckman-Coulter Counter, Miami, Florida). Aliquots of 200µL were then deposited into Cytospin funnels and spun at 250rpm for 10 min. The slides were then stained with DiffQuick (RAL Diagnostics) and the number of neutrophils, macrophages, and lymphocytes in the BALF was determined. Statistics All endpoints were analyzed utilizing IBM SPSS Statistics (Version 29.0) using a repeated measures or univariate general linear model in SPSS to assess the main effects and interactions of between subject factors of sex, housing, and exposure and within subjects factors of time (for repeated measures analyses), with a Sidak’s adjustment for pairwise comparisons. Pairwise comparisons were only performed when main factors or interaction terms in the overall model were significant. Tukey’s method for outliers was conducted within groups with notable violations of homogeneity of variance, and normality was assessed utilizing a Shapiro-Wilk test. Box cox transformations were performed if needed and in rare cases where normality was still not met, data was analyzed in the same manner as the other endpoints. Findings were considered significant when p < 0.05. Sex-differences in all parameters are not discussed due to body-mass differences, however, were still performed and can be found in the supplementary material. Graphs were created utilizing GraphPad Prism (GraphPad Software Version 9.0, San Diego, CA). Results Exposure characterization — All gas and particle concentrations for the wildfire smoke exposures are in Table 1 . The average particulate matter (PM) generated from these exposures was 464.0 ± 340.6 µg/m 3 . Table 1 Average parameters for the flaming eucalyptus wildfire smoke exposures. PM (µg/m 3 ) CO (ppm) CO2 (ppm) Smoke Temp (°C) Smoke RH (%) Smoke Flow (LPM) Eucalyptus WS 464.0 ± 340.6 23.6 ± 16.5 1401.4 ± 414.1 71.1 ± 0.5 53.8 ± 1.1 98.4 ± 0.9 Body weight and bronchoalveolar lavage (BAL) – While male mice weighed more than females, there were no differences in body weight due to housing across the entire study (Table S1 – Supplementary Material). Thus, sex- comparisons for cardiopulmonary parameters (HF-Echo and WBP) are not presented because they likely represent differences in body mass. The bronchoalveolar lavage also was not significantly different based on housing or exposure (Table S2 – Supplementary Material). Ventilatory function – In general, all naïve animals experience a decrease in ventilatory parameters during whole-body plethysmography testing, this is because they eventually relax during the testing period. Regardless, most ventilatory changes (pre-to-post exposure) were observed in female mice. WS caused PIF (Fig. 2 C) and PEF (Fig. 2 D) to be significantly less decreased in male EH mice when compared to FA. Although not significant, this also appeared to be the trend with male DH mice. There were no other differences in male mice. Overall, EH prolonged Te (Fig. 2 B), decreased MV (Fig. 2 G), and showed a decreasing trend in PEF and TV (Fig. 2 D, 2 F) in all female mice when compared to DH. WS caused Te, RT (Fig. 2 E), and TV to significantly increase in female DH mice, this did not occur in female EH mice. While not significant, female DH-FA mice had less decrease in F compared to EH-FA mice (Fig. 1 H). Cardiovascular Function – Cardiovascular physiology was assessed 1–2 weeks before (pre-exposure), 24hrs and one-week after exposure. The results are presented to show changes from housing over time, when compared to pre-exposure measurements, as well as between groups to signify effects from both housing and exposure. All statistical analyses, including across sex and all time points, are presented (Tables S3-S5 in the Supplementary Material). There were no differences between DH and EH in both male and female mice at pre-exposure for any parameters (Fig. 3 – 5 ). There were no significant differences in HR between any of the groups of male or female mice at 24hrs or one-week post-exposure (Fig. 3 A). Male DH-FA mice experienced a decrease (-10.0%) in HR 24hrs post-exposure and an increase (24.0%) one-week later, while male EH-FA had a 0.9% decrease and 8.4% increase at the same time points (Table 2 ). Male DH-WS mice had a small increase (3.0%) in HR 24hrs post-exposure, whereas EH-WS mice had a decrease (-1.1%). HR increased in male DH-WS (13.5%) and EH-WS (8.4%) male mice one-week later. Female EH-WS mice had a significant increase (11.7%) 24hrs after exposure, however, one-week post-exposure this change was mitigated (2.1%) (Table 2 ). There was no difference in EF between any of the male or female groups 24hrs after exposure (Fig. 3 B). However, when compared to pre-exposure, WS caused EF to significantly decrease in male DH mice 24hrs post-exposure, and in both male DH and EH mice one-week after exposure (Table 2 ), with the response being greater with EH (-23.0% EH vs. -7.6% DH). EH caused EF to decrease in WS-exposed male mice one-week after exposure when compared to FA (Fig. 3 B). For cardiac output (CO), the only group difference was that WS caused a trend of decrease (p = 0.08) in male DH mice 24hrs post-exposure when compared to EH (Fig. 3 C); there were no other differences in any other male or female groups. It is worth noting, that although the groups did not differ statistically at 24hrs or one-week, there were WS-induced changes in males that differed by housing at both time points. Male EH-FA and DH-FA mice both had decreases in CO (-10.8% and − 8.3%, respectively), whereas male DH-WS had a slight increase (1.4%) and EH-WS mice had a larger increase (15.4%) 24-hrs post-exposure. However, 1-wk later, male DH mice had an increase in CO regardless of exposure (FA 26.1%, WS 21.2%), and the WS-induced a decrease in male EH mice (-18.3%) compared to an increase in the EH-FA group (11.8%). In the females, WS-induced changes appear to elicit similar changes in both EH and DH mice, with increases 24-hr post-exposure (DH WS 7.6%, EH WS 7.3%), followed by a decrease 1-wk later (DH WS -4.9%, EH WS -8.5%) There were no significant differences in FS between any of the groups, male or female, at either 24hrs or one-week post-exposure (Fig. 3 D), however there were significant changes in FS over time. Compared to pre-exposure, male EH-WS and female EH-FA mice had significantly decreased FS both 24hrs (-17.3% and − 25.3%, respectively) and one-week after the exposures (-25.5% and − 2.9%), while female DH-FA mice also had a decrease in FS only one-week post-exposure (-17.3%) (Table 2 and Fig. 3 ). On the other hand, WS caused a significant increase in SV in male EH mice 24hrs post-exposure compared to male DH-WS (Fig. 3 E). However, one-week later, the male EH-WS mice had a significant decrease in SV (-41.1%), which remained significantly lower than both EH-FA and DH-WS mice (Table 2 and S3). Lastly, there were no differences in LV mass between any of the male or female groups, nor was there any significant change over time (Fig. 3 F). There were no differences in EDV and ESV between any groups of male or female mice. However, when compared to pre-exposure, WS caused ESV to increase in male DH mice at one-week post-exposure and in male EH mice at 24hrs and one-week. In contrast, increased ESV was observed in all female mice exposed to FA at 24hrs and one-week post-exposure (Table S3). There were no differences in LV anterior or posterior wall thickness between any of the male groups, whether during diastole or systole. On the other hand, WS caused LVAW during diastole and systole to be significantly greater in female EH mice when compared to its effects on DH at 24hrs post-exposure. One-week later, both female EH-FA and DH-WS mice had significantly larger LVAW during diastole and sytole and LVPW during diastole than DH-FA (Fig. 4 A-D). There were no significant changes across time. Pulsed-wave doppler imaging assessed blood flow through the pulmonary artery, and imaging of the apical 4-chamber view assessed transmitral blood flow and left ventricular myocardial performance. There were no group differences betwen the male mouse groups. Hemodynamic changes occurred almost exclusively in female mice, and changes in these parameters are noted at each time point (Fig. 5 A-D). WS caused a significantly prolonged PAT and PAT/PET in female DH mice one-week after exposure when compared to both female DH exposed to FA and female EH mice exposed to WS (Fig. 5 A and C). There were no significant changes in PET for groups for both sexes or over time (Fig. 5 B). Interestingly, when compared to pre-exposure, all male mice had an increase in PET 24hrs post-exposure, followed by a decrease one-week later, while it decreased at both 24hrs and one-week in the females. WS-induced changes in PAT and PAT/PET in male EH-WS mice, with a decrease in both parameters 24-hrs post-exposure, and 1-wk later an increase in PAT/PET. Similarly, WS-induced an increase in PAT/PET in female EH-WS mice 24-hrs after exposure. Female DH-WS and EH-FA both had an increase in PAT and PAT/PET 1-wk post-exposures (Table 3 ). Significant changes between groups in transmitral blood also occured almost exclusively in female mice, however DH caused a trend towards decreased AET, and increased IVRT and MPI in male mice when compared to EH 24hrs after FA (Fig. 6 A, C, and D). Female EH-FA mice had a significantly increased AET 24hrs after exposure when compared to female EH-WS and DH-FA mice (Fig. 6 A), and a significanltly lower MPI value when compared to female EH-WS (Fig. 6 D). On the other hand, WS caused a significantly higher IVCT in female DH mice when compared to FA 24hrs after exposure (Fig. 6 B). One-week later, WS caused AET to be significantly decreased and increased MPI in female DH mice when compared to EH, and had significantly lowered IVCT and IVRT. DH also induced a significant increase in MPI when compared to EH-FA mice, and a trend towards an increased MPI when compared to EH-WS mice. Furthermore, female DH-FA, DH-WS, and EH-FA all had significant reductions in AET from either pre-exposure or 24hrs to 1-wk later, while female EH-WS mice had a significant increase in IVCT 24hrs after exposures (Table S4). Serum Biomarkers – There were few changes in serum biomarkers. Male EH-WS mice had significantly elevated levels of low density lipoprotein (LDL) and triglycerides, when compared to male EH-FA mice (Fig. S1 A, S1D – Supplementary Materials). There were no other significant changes by groups, and there were no significant changes in females for any biomarker. Aortic gene expression – Male EH-WS mice had significantly higher Il-6 and Vcam-1 or had an increased trend compared to male DH-WS mice (Fig. 7 A, 7 C). Female EH-WS mice had a decreased trend for Vcam-1 compared to EH-FA mice (Fig. 7 A). Female DH-WS mice had significantly increased Nampt compared to DH-FA mice (Fig. 7 E). Discussion The results of this study show that living conditions, specifically housing enrichment, alter the cardiovascular and ventilatory response to WS, and has potential implications for impacting the progression of disease-related cardiovascular physiology. Psychosocial stressors, such as depleted housing, likely impact the response to wildfire smoke and other chemical stressors by altering cardiopulmonary physiology, and thus, contribute to heightened subsequent adverse effects. While it is clear that wildfire smoke is associated with increased morbidity and mortality [ 31 ], the ability of non-chemical stressors to modify the response to these extreme events, especially in the presence of underlying disease remains understudied. We compared enriched housing, which includes several forms of environmental enrichment, with depleted housing to evaluate the role of non-chemical stressors like living conditions in modifying physiological resiliency to a single smoke exposure. Our previous work showed that enriched housing improves cardiovascular outcomes, specifically a lower heart-rate, during and after a wildfire smoke exposure and promotes an increase in the expression of cardioprotective genes in the left ventricle [ 27 ]. The current study expanded this approach to assess whether housing alters cardiovascular function in atherosclerotic-prone mice and whether the effects are sex-specific. We found that the effect of housing on baseline cardiovascular function and the cardiovascular response to WS in ApoE (-/-) mice occurs in a sex-specific manner. The condition of housing (i.e., depleted vs. enriched) did not cause significant changes in cardiovascular physiology over 16 weeks prior to exposure, 24hrs and one-week after a single WS exposure, male mice exhibited changes in cardiomechanical function, specifically, WS-induced a decrease in SV and EF in male EH mice, and a decreased IVRT, MPI, and PAT in female EH mice. The ApoE(-/-) mouse has been a proven model for the spontaneous development of atherosclerosis in both male and female mice [ 32 , 33 ]. Atheroscletoric lesions occur as early as 10–15 weeks of age, and the lesions grow larger in size and in complexity as the mice continue to age [ 33 , 34 ]. Moreover, exposure to PM 2.5 has been associated with an increase in the prevalence of atherosclerotic plagues in male ApoE (-/-) mice [ 35 ], increased carotid intima media thickness and prevalence of carotid plaques [ 17 ], and an elevated proatherosclerotic response [ 36 ]. Coronary artery diseases, such as atherosclerosis, have been shown to adversely impact left ventricular structure, leading to perturbations in left ventricular diastole and myocardial stiffness, seen with increased load and diastolic dysfunction [ 37 ]. In human populations, studies have shown that the adverse cardiovascular effects from air pollution can occur in a lag period of up to 40 days [ 38 ], which might be mediated by altered neuroendocrine stress axes that can affect immune, inflammatory, and metabolic processes [ 39 ], leading to prolonged adverse health effects. Stress has been shown to potentiate this effect by perturbing natural homeostatic function, leading to allostasis and thus an increased susceptibility to chemical exposures [ 40 ], such as wildfire smoke. Our results show that while EH causes significant changes in cardiovascualr function in male mice 24-hrs post-exposure, including a decreaed SV and EF, the physiological response changed one week later, with these parameters returning to near baseline for EH mice with a subsequent increase in these parameters for the DH mice. Thus, DH mice exhibit sustained effects from the WS exposure, indicating a potential disruption in stress axes. Moreover, the DH mice exhibit an increase in SV, EF, and ESV 1-wk after the WS exposure. This indicates that the male DH mice might be experiencing an increase in afterload on the heart, or an increase in the pressure needed to eject blood during ventricular contractions, 1-wk following the WS exposure. Chronic increases in afterload can lead to concentric hypertrophy and systolic heart failure through a decrease in ventricular compliance and further diastolic dysfunction [ 41 ]. Similarly, previous studies have shown that exposure to concentrated ambient PM 2.5 for 15 weeks elicits reversible cardiac dysfunction through decreases in cardiac output and stroke volume and a concurrent elevation in blood pressure in spontaneously hypertensive rats [ 42 ], indicating that EH might be protective against this type of cardiovascular dysfunction following a WS exposure. While not evaluated in this study, other potential mechanisms that could be causing these cardiovascular changes could include a decrease in cardiac contractility, or inotropy, as well as changes in autonomic function. Interestingly, female mice did not exhibit changes in the cardiomechanical parameters that were measured (ie. HR, CO, SV, etc), but rather it was evident in the hemodynamic measurements (ie. IVRT, MPI, etc). Depleted housing caused an increase in both IVRT and MPI in female mice one-week after exposures to both FA and WS, with the response potentiated by WS. An increase in IVRT, or the time from when the aortic valve closes until the mitral valve opens before ventricular filling, may indicate left ventricular diastolic dysfunction that occurs when there is impaired left ventricular relaxation but normal filling patterns [ 43 ]. The MPI, also called the Tei index, is a calculated parameter from HF-echo Doppler imaging that evaluates changes in cardiac time intervals, IVCT, IVRT, and AET, to provide information on combined systolic and diastolic function [ 44 ]. An increase in the MPI has been shown to be a reliable marker for cardiac dysfunction in congestive heart failure patients [ 45 ] and diastolic dysfunction from acute myocardial infarctions [ 46 ]. Moreover, WS caused an increase in left ventricular wall measurements one-week after exposures in female DH mice, but not EH. Increased left ventricular anterior wall measurements, or the intraventricular septum, have been found to be associated with increased systolic blood pressure [ 47 ], and increased left ventricular anterior and posterior wall measurements are associated with the incidence of left-ventricular hypertrophy [ 48 ]. Although responses vary between sex, WS elicits cardiac dysfunction in both male and female mice, and EH might offer some protection against this dysfunction. A possible explanation to these sex-specific changes in pathologies might be due to female ApoE (-/-) mice developing atherosclerotic lesions and plaques faster than the male mice [ 49 ], thus the disease progression, and therefore the response to both housing and WS might differ by sex in this model. While atherosclerotic plaque sizes were not measured in this study, future studies should include histopathology of atherosclerotic lesions and other overt measurements of disease progression to further inform this work. In addition, epidemiological studies have shown that women are more susceptible to long-term cardiovascular complications from air pollution compared to men [ 50 , 51 ], indicating that sex itself might be acting as a biological variable that is leading to the differential changes we see in our study. Chronic stress can alter lipid metabolism, as well as autonomic and hormonal homeostasis, through activation of the hypothalamus-pituitary adrenal gland (HPA) axis and the sympathetic-adrenal-medullary (SAM) axis [ 52 ], which can be a risk factor for atherosclerosis [ 53 ]. Our results show that male EH-WS mice have increased levels of triglycerides and serum LDL one-week after exposures, indicating that there could be alterations in the HPA-axis, leading to lipid dysregulation [ 54 , 55 , 56 ]. Similarly, male EH-WS mice also have increased expression of IL-6 and Vcam-1 in the aorta, which have been shown to be predictive of peripheral atherosclerosis progression and acute myocardial infarctions [ 57 , 58 ]. Although our initial hypothesis was that enrichment of living conditions might protect against the development/progression of cardiovascular dysfunction in this model, it is clear that potential worsening of these conditions might not necessarily be ameliorated by psychosocial interventions. We noticed a higher degree of fighting and resource-related aggression in the male EH mice. A previous study has shown that social stress with a male dominant intruder can increase progression [ 59 ]. Thus, there still may have been some amount of psychosocial stress in this group, which contributed to pro-atherosclerotic signs. Moreover, while both male and female ApoE (-/-) mice spontaneously develop atherosclerosis, the females are generally found to have worsened atherosclerotic development than males even with similar serum lipid and chemistry levels [ 49 ]. Interestingly, our results showed that female DH mice exposed to WS might have worsened atherosclerotic progression due to an increased expression of Nampt , a gene that is associated with both atherosclerosis and insulin resistance [ 60 , 61 ]. However, the lack of robust change in serum chemistry markers or gene expression changes in the distal aorta is likely due to the ability of the animals to recover over the one-week between the WS exposure and tissue collection, and so, it could be argued that measurements in the tissues and serum at an earlier time point might have elicited changes in these biomarkers. WS is made up of a complex mixture of toxic gases and particulate matter [ 62 ] and has been shown to elicit adverse upper and lower airway respiratory conditions [ 63 , 64 ]. Our results show that housing is able to impact ventilatory outcomes in a sex-specific manner. Breathing frequency was decreased in all groups, as a result of acclimation to the whole body chamber consistent with our previous findings [ 65 , 66 ]. WS exposure caused an increase in Te, TV, and RT exclusively in female DH mice, portraying a potential irritant response in the upper airways, indicating that female DH mice might be more susceptible [ 67 , 68 ]. Women have been shown to be more at risk to adverse responses to ambient air pollution than men [ 50 ], and rodent studies have shown that female mice have an elevated response to chronic stress due to increased HPA-axis activity [ 69 ], which might be a possible mechanism driving our observations. Further, WS caused an increase in PIF and PEF in male EH mice, but not DH mice. However, there were no significant changes in the inflammatory cells in the bronchoalveolar lavage, likely due to the relatively low WS exposure concentration used and/or the time of the lavage assessments in this study. Other studies from our group have exposed animals to much higher concentrations, and have elicited an increased cardiopulmonary and inflammatory response to the WS (PM = 4.2mg/m 3 prior study vs. 0.46mg/m 3 current study) [ 28 ]. In conclusion, housing conditions contribute to sex-specific cardiovascular and ventilatory responses to WS. DH conditions alter the cardiomechanical and hemodynamic response to WS to elicit signs of diastolic dysfunction in male and female ApoE (-/-) mice, respectively. Both male and female mice also exhibit alterations in the ventilatory response to WS due to DH, although the response appears to be attenuated in females. Despite this, the cardiovascular changes that were seen from a relatively low PM 2.5 concentration indicate the ability of housing to alter body resiliency against a chemical stressor. Future work should evaluate the disease progression in both males and females to understand if atherosclerotic-progression could have impacted the sex-specific responses, and if housing can mitigate the advancement of the disease. Moreover, a focus on characterizing the stress response to DH and subsequent activation of the hypothalamic-pituitary-adrenal (HPA) axis and autonomic modulation to evaluate allostatic load, or how housing might modify baseline physiology due to chronic stress, might be beneficial in characterizing the role living conditions play in toxicological risk. Regardless, this work points to the ability of depleted housing as a non-chemical stressor to alter cardiovascular and ventilatory responses to an environmental challenge, with data pointing towards separations in these responses based on sex. Evaluating psychosocial stress as possible modifiers of the toxicological response might be important in determining the health and future-risk to chemical and environmental exposures within human populations. Declarations Funding Information This work was supported by intramural funding of the Office of Research and Development of the United States Environmental Protection Agency and the Environmental Protection Agency Cooperative Agreement with the University of North Carolina at Chapel Hill (UNC) CR 84033801. The investigation by MF was supported in part by a pre-doctoral traineeship (National Research Service Award T32 ES007126) from the National Institute of Environmental Health Sciences, National Institutes of Health. Acknowledgements The authors would like to thank Drs. Yongho Kim and Rebecca Arachevala for their review of this manuscript prior to submission. The authors would also like to thank Dr. Thomas Jackson for statistical help, Dr. Colette Miller for assistance with RT-qPCR, and Wanda Williams for running the chemical analyzer. Disclosure Statement This paper has been reviewed and approved for release by the Center for Public Health and Environmental Risk Assessment, U.S. Environmental Protection Agency. Approval does not signify that the contents necessarily reflect the views and policies of the U.S. Environmental Protection Agency, nor does mention of trade names of commercial products constitute as endorsement or recommendation for use. Additional Information The authors declare no competing financial interests. Author Contribution MF - study design, experimentation, analysis, manuscript writing (including all figures)ST - experimentation and analysisKL - experimentation and analysisWO - experimentationTK - exposuresPE - exposures DD - exposuresIG - study supervisionAF - study supervisionMH - study design, experimentation, manuscript review and overall supervision All authors reviewed the manuscript Data Availability All data for this study is available via USEPA's Science Hub References Sims, M., Kershaw, K. N., Breathett, K., Jackson, E. A., Lewis, L. M., Mujahid, M. S., Suglia, S. F., & Suglia (2020). Importance of Housing and Cardiovascular Health and Well-Being: A Scientific Statement From the American Heart Association. Circulation: Cardiovascular Quality and Outcomes , 13 (8), e000089. https://doi.org/10.1161/HCQ.0000000000000089 . Lloyd-Jones, D. M., Hong, Y., Labarthe, D., Mozaffarian, D., Appel, L. J., Van Horn, L., Greenlund, K., Daniels, S., Nichol, G., Tomaselli, G. F., Arnett, D. K., Fonarow, G. C., Ho, P. M., Lauer, M. S., Masoudi, F. A., Robertson, R. M., Roger, V., Schwamm, L. H., & Sorlie, P. (2010). Defining and setting national goals for cardiovascular health promotion and disease reduction: The American Heart Association’s strategic Impact Goal through 2020 and beyond. Circulation , 121 (4), 586–613. https://doi.org/10.1161/CIRCULATIONAHA.109.192703 . American Heart Association Strategic Planning Task Force and Statistics Committee. Steptoe, A., & Kivimäki, M. (2012). Stress and cardiovascular disease. Nature Reviews Cardiology , 9 (6), 360–370. https://doi.org/10.1038/nrcardio.2012.45 . Mulle, J. G., & Vaccarino, V. (2013). Cardiovascular Disease, Psychosocial Factors, and Genetics: The Case of Depression. Progress in Cardiovascular Diseases , 55 (6), 557–562. https://doi.org/10.1016/j.pcad.2013.03.005 . Celano, C. M., Daunis, D. J., Lokko, H. N., Campbell, K. A., & Huffman, J. C. (2016). Anxiety disorders and cardiovascular disease. Current Psychiatry Reports , 18 (11), 101. https://doi.org/10.1007/s11920-016-0739-5 . Galobardes, B., Smith, G. D., & Lynch, J. W. (2006). Systematic review of the influence of childhood socioeconomic circumstances on risk for cardiovascular disease in adulthood. Annals of Epidemiology , 16 (2), 91–104. https://doi.org/10.1016/j.annepidem.2005.06.053 . Curl, C. L., Beresford, S. A. A., Hajat, A., Kaufman, J. D., Moore, K., Nettleton, J. A., & Diez-Roux, A. V. (2013). Associations of Organic Produce Consumption with Socioeconomic Status and the Local Food Environment: Multi-Ethnic Study of Atherosclerosis (MESA). PLOS ONE , 8 (7), e69778. https://doi.org/10.1371/journal.pone.0069778 . Moore, L. V., Roux, D., Nettleton, A. V., J. A., & Jacobs, D. R. (2008). Associations of the local food environment with diet quality–a comparison of assessments based on surveys and geographic information systems: The multi-ethnic study of atherosclerosis. American Journal of Epidemiology , 167 (8), 917–924. https://doi.org/10.1093/aje/kwm394 . Hirsch, J. A., Moore, K. A., Evenson, K. R., Rodriguez, D. A., & Diez Roux, A. V. (2013). Walk Score® and Transit Score® and walking in the multi-ethnic study of atherosclerosis. American Journal of Preventive Medicine , 45 (2), 158–166. https://doi.org/10.1016/j.amepre.2013.03.018 . Rodríguez, D. A., Evenson, K. R., Roux, D., A. V., & Brines, S. J. (2009). Land Use, Residential Density, and Walking. American Journal of Preventive Medicine , 37 (5), 397–404. https://doi.org/10.1016/j.amepre.2009.07.008 . Billings, M. E., Johnson, D. A., Simonelli, G., Moore, K., Patel, S. R., Roux, D., A. V., & Redline, S. (2016). Neighborhood Walking Environment and Activity Level Are Associated With OSA: The Multi-Ethnic Study of Atherosclerosis. Chest , 150 (5), 1042–1049. https://doi.org/10.1016/j.chest.2016.06.012 . Johnson, D. A., Simonelli, G., Moore, K., Billings, M., Mujahid, M. S., Rueschman, M., Kawachi, I., Redline, S., Roux, D., A. V., & Patel, S. R. (2017). The Neighborhood Social Environment and Objective Measures of Sleep in the Multi-Ethnic Study of Atherosclerosis. Sleep , 40 (1), zsw016. https://doi.org/10.1093/sleep/zsw016 . Diez Roux, A. V., Mujahid, M. S., Hirsch, J. A., Moore, K., & Moore, L. V. (2016). The impact of neighborhoods on cardiovascular risk: The MESA Neighborhood Study. Global Heart , 11 (3), 353–363. https://doi.org/10.1016/j.gheart.2016.08.002 . Rappold, A. G., Cascio, W. E., Kilaru, V. J., Stone, S. L., Neas, L. M., Devlin, R. B., & Diaz-Sanchez, D. (2012). Cardio-respiratory outcomes associated with exposure to wildfire smoke are modified by measures of community health. Environmental Health , 11 (1), 71. https://doi.org/10.1186/1476-069X-11-71 . Jbaily, A., Zhou, X., Liu, J., Lee, T. H., Kamareddine, L., Verguet, S., & Dominici, F. (2022). Air pollution exposure disparities across US population and income groups. Nature , 601 (7892), 228–233. https://doi.org/10.1038/s41586-021-04190-y . Seilkop, S. K., Campen, M. J., Lund, A. K., McDonald, J. D., & Mauderly, J. L. (2012). Identification of chemical components of combustion emissions that affect pro-atherosclerotic vascular responses in mice. Inhalation Toxicology , 24 (5), 270–287. https://doi.org/10.3109/08958378.2012.667455 . Painschab, M. S., Davila-Roman, V. G., Gilman, R. H., Vasquez-Villar, A. D., Pollard, S. L., Wise, R. A., Miranda, J. J., Checkley, W., & CRONICAS Cohort Study Group. (2013). Chronic exposure to biomass fuel is associated with increased carotid artery intima-media thickness and a higher prevalence of atherosclerotic plaque. Heart (British Cardiac Society) , 99 (14), 984–991. https://doi.org/10.1136/heartjnl-2012-303440 . Bevan, G. H., Al-Kindi, S. G., Brook, R. D., Münzel, T., & Rajagopalan, S. (2021). Ambient Air Pollution and Atherosclerosis. Arteriosclerosis Thrombosis and Vascular Biology , 41 (2), 628–637. https://doi.org/10.1161/ATVBAHA.120.315219 . Grant, E., & Runkle, J. D. (2022). Long-term health effects of wildfire exposure: A scoping review. The Journal of Climate Change and Health , 6 , 100110. https://doi.org/10.1016/j.joclim.2021.100110 . Kaltsas, G. A., & Chrousos, G. P. (2007). The neuroendocrinology of stress. In Handbook of psychophysiology, 3rd ed (pp. 303–318). Cambridge University Press. https://doi.org/10.1017/CBO9780511546396.013 . Hazari, M. S., Stratford, K. M., Krantz, Q. T., King, C., Krug, J., Farraj, A. K., & Gilmour, M. I. (2018). Comparative Cardiopulmonary Effects of Particulate Matter- And Ozone-Enhanced Smog Atmospheres in Mice. Environmental Science & Technology , 52 (5), 3071–3080. https://doi.org/10.1021/acs.est.7b04880 . Kurhanewicz, N., McIntosh-Kastrinsky, R., Tong, H., Ledbetter, A., Walsh, L., Farraj, A., & Hazari, M. (2017). TRPA1 mediates changes in heart rate variability and cardiac mechanical function in mice exposed to acrolein. Toxicology and Applied Pharmacology , 324 , 51–60. https://doi.org/10.1016/j.taap.2016.10.008 . Thompson, L. C., Walsh, L., Martin, B. L., McGee, J., Wood, C., Kovalcik, K., Pancras, J. P., Haykal-Coates, N., Ledbetter, A. D., Davies, D., Cascio, W. E., Higuchi, M., Hazari, M. S., & Farraj, A. K. (2019). Ambient Particulate Matter and Acrolein Co-Exposure Increases Myocardial Dyssynchrony in Mice via TRPA1. Toxicological Sciences , 167 (2), 559–572. https://doi.org/10.1093/toxsci/kfy262 . Lawson, D. M., Churchill, M., & Churchill, P. C. (2000). The effects of housing enrichment on cardiovascular parameters in spontaneously hypertensive rats. Contemporary Topics in Laboratory Animal Science , 39 (1), 9–13. Guilarte, T. R., Toscano, C. D., McGlothan, J. L., & Weaver, S. A. (2003). Environmental enrichment reverses cognitive and molecular deficits induced by developmental lead exposure. Annals of Neurology , 53 (1), 50–56. https://doi.org/10.1002/ana.10399 . Schneider, T., Turczak, J., & Przewłocki, R. (2006). Environmental Enrichment Reverses Behavioral Alterations in Rats Prenatally Exposed to Valproic Acid: Issues for a Therapeutic Approach in Autism. Neuropsychopharmacology : Official Publication Of The American College Of Neuropsychopharmacology , 31 (1), 36–46. https://doi.org/10.1038/sj.npp.1300767 . Harmon, M. E., Fiamingo, M., Toler, S., Lee, K., Kim, Y., Martin, B., Gilmour, I., Farraj, A. K., & Hazari, M. S. (2024). The effect of enriched versus depleted housing on eucalyptus smoke-induced cardiovascular dysfunction in mice (p. 2024.02.26.582161). bioRxiv. https://doi.org/10.1101/2024.02.26.582161 . Kim, Y. H., King, C., Krantz, T., Hargrove, M. M., George, I. J., McGee, J., Copeland, L., Hays, M. D., Landis, M. S., Higuchi, M., Gavett, S. H., & Gilmour, M. I. (2019). The role of fuel type and combustion phase on the toxicity of biomass smoke following inhalation exposure in mice. Archives of Toxicology , 93 (6), 1501–1513. https://doi.org/10.1007/s00204-019-02450-5 . Kim, Y. H., Vance, S. A., Aurell, J., Holder, A. L., Pancras, J. P., Gullett, B., Gavett, S. H., McNesby, K. L., & Gilmour, M. I. (2022). Chemistry and lung toxicity of particulate matter emitted from firearms. Scientific Reports , 12 (1). Article 1. https://doi.org/10.1038/s41598-022-24856-5 . Martin, B. L., Thompson, L. C., Kim, Y., Williams, W., Snow, S. J., Schladweiler, M. C., Phillips, P., King, C., Richards, J., Haykal-Coates, N., Higuchi, M., Ian Gilmour, M., Kodavanti, U. P., Hazari, M. S., & Farraj, A. K. (2018). Acute peat smoke inhalation sensitizes rats to the postprandial cardiometabolic effects of a high fat oral load. The Science of the Total Environment , 643 , 378–391. https://doi.org/10.1016/j.scitotenv.2018.06.089 . Hadley, M. B., Henderson, S. B., Brauer, M., & Vedanthan, R. (2022). Protecting Cardiovascular Health From Wildfire Smoke. Circulation , 146 (10), 788–801. https://doi.org/10.1161/CIRCULATIONAHA.121.058058 . Ishibashi, S., Brown, M. S., Goldstein, J. L., Gerard, R. D., Hammer, R. E., & Herz, J. (1993). Hypercholesterolemia in low density lipoprotein receptor knockout mice and its reversal by adenovirus-mediated gene delivery. The Journal of Clinical Investigation , 92 (2), 883–893. https://doi.org/10.1172/JCI116663 . Zhang, S. H., Reddick, R. L., Piedrahita, J. A., & Maeda, N. (1992). Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science (New York N Y) , 258 (5081), 468–471. https://doi.org/10.1126/science.1411543 . Reddick, R. L., Zhang, S. H., & Maeda, N. (1994). Atherosclerosis in mice lacking apo E. Evaluation of lesional development and progression. Arteriosclerosis and Thrombosis: A Journal of Vascular Biology , 14 (1), 141–147. https://doi.org/10.1161/01.atv.14.1.141 . Sun, Q., Wang, A., Jin, X., Natanzon, A., Duquaine, D., Brook, R. D., Aguinaldo, J. G. S., Fayad, Z. A., Fuster, V., Lippmann, M., Chen, L. C., & Rajagopalan, S. (2005). Long-term Air Pollution Exposure and Acceleration of Atherosclerosis and Vascular Inflammation in an Animal Model. Journal Of The American Medical Association , 294 (23), 3003–3010. https://doi.org/10.1001/jama.294.23.3003 . Chen, H., Samet, J. M., Bromberg, P. A., & Tong, H. (2021). Cardiovascular health impacts of wildfire smoke exposure. Particle and Fibre Toxicology , 18 (1), 2. https://doi.org/10.1186/s12989-020-00394-8 . Pagliaro, B. R., Cannata, F., Stefanini, G. G., & Bolognese, L. (2020). Myocardial ischemia and coronary disease in heart failure. Heart Failure Reviews , 25 (1), 53–65. https://doi.org/10.1007/s10741-019-09831-z . Zanobetti, A., Schwartz, J., Samoli, E., Gryparis, A., Touloumi, G., Peacock, J., Anderson, R. H., Tertre, L., Bobros, A., Celko, J., Goren, M., Forsberg, A., Michelozzi, B., Rabczenko, P., Hoyos, D., Wichmann, S. P., H. E., & Katsouyanni, K. (2003). The temporal pattern of respiratory and heart disease mortality in response to air pollution. Environmental Health Perspectives , 111 (9), 1188–1193. https://doi.org/10.1289/ehp.5712 . Snow, S. J., Henriquez, A. R., Costa, D. L., & Kodavanti, U. P. (2018). Neuroendocrine Regulation of Air Pollution Health Effects: Emerging Insights. Toxicological Sciences , 164 (1), 9. https://doi.org/10.1093/toxsci/kfy129 . Thomson, E. M. (2019). Air Pollution, Stress, and Allostatic Load: Linking Systemic and Central Nervous System Impacts. Journal of Alzheimer’s Disease , 69 (3), 597–614. https://doi.org/10.3233/JAD-190015 . LaCombe, P., Tariq, M. A., & Lappin, S. L. (2023). Physiology, Afterload Reduction. In StatPearls . StatPearls Publishing. http://www.ncbi.nlm.nih.gov/books/NBK493174/ . Ying, Z., Xie, X., Bai, Y., Chen, M., Wang, X., Zhang, X., Morishita, M., Sun, Q., & Rajagopalan, S. (2015). Exposure to concentrated ambient particulate matter induces reversible increase of heart weight in spontaneously hypertensive rats. Particle and Fibre Toxicology , 12 , 15. https://doi.org/10.1186/s12989-015-0092-6 . Nagueh, S. F., Smiseth, O. A., Appleton, C. P., Byrd, B. F., Dokainish, H., Edvardsen, T., Flachskampf, F. A., Gillebert, T. C., Klein, A. L., Lancellotti, P., Marino, P., Oh, J. K., Popescu, B. A., & Waggoner, A. D. (2016). Recommendations for the Evaluation of Left Ventricular Diastolic Function by Echocardiography: An Update from the American Society of Echocardiography and the European Association of Cardiovascular Imaging. Journal of the American Society of Echocardiography: Official Publication of the American Society of Echocardiography , 29 (4), 277–314. https://doi.org/10.1016/j.echo.2016.01.011 . Harjai, K. J., Scott, L., Vivekananthan, K., Nunez, E., & Edupuganti, R. (2002). The Tei index: A new prognostic index for patients with symptomatic heart failure. Journal of the American Society of Echocardiography: Official Publication of the American Society of Echocardiography , 15 (9), 864–868. https://doi.org/10.1067/mje.2002.120892 . Bruch, C., Schmermund, A., Marin, D., Katz, M., Bartel, T., Schaar, J., & Erbel, R. (2000). Tei-index in patients with mild-to-moderate congestive heart failure. European Heart Journal , 21 (22), 1888–1895. https://doi.org/10.1053/euhj.2000.2246 . Nearchou, N. S., Tsakiris, A. K., Tsitsirikos, M. D., Karatzis, E. N., Lolaka, M. D., Flessa, K. D., Bogiatzis, D. T., & Skoufas, P. D. (2005). Tei index as a method of evaluating left ventricular diastolic dysfunction in acute myocardial infarction. Hellenic Journal of Cardiology: HJC = Hellenike Kardiologike Epitheorese , 46 (1), 35–42. Eliakim-Raz, N., Prokupetz, A., Gordon, B., Shochat, T., & Grossman, A. (2015). Interventricular Septum and Posterior Wall Thickness Are Associated With Higher Systolic Blood Pressure. The Journal of Clinical Hypertension , 18 (7), 703–706. https://doi.org/10.1111/jch.12738 . McFarland, T. M., Alam, M., Goldstein, S., Pickard, S. D., & Stein, P. D. (1978). Echocardiographic diagnosis of left ventricular hypertrophy. Circulation , 57 (6), 1140–1144. https://doi.org/10.1161/01.cir.57.6.1140 . Marek, I., Canu, M., Cordasic, N., Rauh, M., Volkert, G., Fahlbusch, F. B., Rascher, W., Hilgers, K. F., Hartner, A., & Menendez-Castro, C. (2017). Sex differences in the development of vascular and renal lesions in mice with a simultaneous deficiency of Apoe and the integrin chain Itga8. Biology of Sex Differences , 8 , 19. https://doi.org/10.1186/s13293-017-0141-y . Liu, G., Sun, B., Yu, L., Chen, J., Han, B., Li, Y., & Chen, J. (2020). The Gender-Based Differences in Vulnerability to Ambient Air Pollution and Cerebrovascular Disease Mortality: Evidences Based on 26781 Deaths (1). 15 (1), Article 1. https://doi.org/10.5334/gh.849 . Zhang, J., Wang, X., Yan, M., Shan, A., Wang, C., Yang, X., & Tang, N. (2022). Sex Differences in Cardiovascular Risk Associated With Long-Term PM2.5 Exposure: A Systematic Review and Meta-Analysis of Cohort Studies. Frontiers in Public Health , 10 , 802167. https://doi.org/10.3389/fpubh.2022.802167 . Kadmiel, M., & Cidlowski, J. A. (2013). Glucocorticoid receptor signaling in health and disease. Trends in Pharmacological Sciences , 34 (9), 518–530. https://doi.org/10.1016/j.tips.2013.07.003 . Yao, B., Meng, L., Hao, M., Zhang, Y., Gong, T., & Guo, Z. (2019). Chronic stress: A critical risk factor for atherosclerosis. The Journal of International Medical Research , 47 (4), 1429–1440. https://doi.org/10.1177/0300060519826820 . Anni, N. S., Jung, S. J., Shim, J. S., Jeon, Y. W., Lee, G. B., & Kim, H. C. (2021). Stressful life events and serum triglyceride levels: The Cardiovascular and Metabolic Diseases Etiology Research Center cohort in Korea. Epidemiology and Health , 43 , e2021042. https://doi.org/10.4178/epih.e2021042 . Assadi, S. N. (2017). What are the effects of psychological stress and physical work on blood lipid profiles? Medicine , 96 (18), e6816. https://doi.org/10.1097/MD.0000000000006816 . Brindley, D. N., & Rolland, Y. (1989). Possible connections between stress, diabetes, obesity, hypertension and altered lipoprotein metabolism that may result in atherosclerosis. Clinical Science (London England: 1979) , 77 (5), 453–461. https://doi.org/10.1042/cs0770453 . Lino, D. O. C., Freitas, I. A., Meneses, G. C., Martins, A. M. C., Daher, E. F., Rocha, J. H. C., & Silva, G. B. (2019). Interleukin-6 and adhesion molecules VCAM-1 and ICAM-1 as biomarkers of post-acute myocardial infarction heart failure. Brazilian Journal of Medical and Biological Research , 52 (12), e8658. https://doi.org/10.1590/1414-431X20198658 . Tzoulaki, I., Murray, G. D., Lee, A. J., Rumley, A., Lowe, G. D. O., & Fowkes, F. G. R. (2005). C-reactive protein, interleukin-6, and soluble adhesion molecules as predictors of progressive peripheral atherosclerosis in the general population: Edinburgh Artery Study. Circulation , 112 (7), 976–983. https://doi.org/10.1161/CIRCULATIONAHA.104.513085 . Bernberg, E., Ulleryd, M. A., Johansson, M. E., & Bergström, G. M. L. (2012). Social disruption stress increases IL-6 levels and accelerates atherosclerosis in ApoE–/– mice. Atherosclerosis , 221 (2), 359–365. https://doi.org/10.1016/j.atherosclerosis.2011.11.041 . Kong, Y., Li, G., Zhang, W., Hua, X., Zhou, C., Xu, T., Li, Z., Wang, P., & Miao, C. (2019). Nicotinamide phosphoribosyltransferase aggravates inflammation and promotes atherosclerosis in ApoE knockout mice. Acta Pharmacologica Sinica , 40 (9), 1184–1192. https://doi.org/10.1038/s41401-018-0207-3 . Li, S., Wang, C., Li, K., Li, L., Tian, M., Xie, J., Yang, M., Jia, Y., He, J., Gao, L., Boden, G., Liu, H., & Yang, G. (2016). NAMPT knockdown attenuates atherosclerosis and promotes reverse cholesterol transport in ApoE KO mice with high-fat-induced insulin resistance. Scientific Reports , 6 (1). Article 1. https://doi.org/10.1038/srep26746 . Black, C., Tesfaigzi, Y., Bassein, J. A., & Miller, L. A. (2017). Wildfire smoke exposure and human health: Significant gaps in research for a growing public health issue. Environmental Toxicology and Pharmacology , 55 , 186–195. https://doi.org/10.1016/j.etap.2017.08.022 . Dhingra, R., Keeler, C., Staley, B. S., Jardel, H. V., Ward-Caviness, C., Rebuli, M. E., Xi, Y., Rappazzo, K., Hernandez, M., Chelminski, A. N., Jaspers, I., & Rappold, A. G. (2023). Wildfire smoke exposure and early childhood respiratory health: A study of prescription claims data. Environmental Health , 22 (1), 48. https://doi.org/10.1186/s12940-023-00998-5 . Hutchinson, J. A., Vargo, J., Milet, M., French, N. H. F., Billmire, M., Johnson, J., & Hoshiko, S. (2018). presentations, inpatient hospitalizations, and outpatient visits: An observational study of smoke exposure periods and a bidirectional case-crossover analysis. PLOS Medicine , 15 (7), e1002601. https://doi.org/10.1371/journal.pmed.1002601 . The San Diego 2007 wildfires and Medi-Cal emergency department. Hargrove, M. M., Kim, Y. H., King, C., Wood, C. E., Gilmour, M. I., Dye, J. A., & Gavett, S. H. (2019). Smoldering and flaming biomass wood smoke inhibit respiratory responses in mice. Inhalation Toxicology , 31 (6), 236–247. https://doi.org/10.1080/08958378.2019.1654046 . Kurhanewicz, N., Ledbetter, A., Farraj, A., & Hazari, M. (2018). TRPA1 mediates the cardiac effects of acrolein through parasympathetic dominance but also sympathetic modulation in mice. Toxicology and Applied Pharmacology , 347 , 104–114. https://doi.org/10.1016/j.taap.2018.03.027 . Alarie, Y. (1973). Sensory irritation of the upper airways by airborne chemicals. Toxicology and Applied Pharmacology , 24 (2), 279–297. https://doi.org/10.1016/0041-008X(73)90148-8 . Willis, D. N., Liu, B., Ha, M. A., Jordt, S. E., & Morris, J. B. (2011). Menthol attenuates respiratory irritation responses to multiple cigarette smoke irritants. The FASEB Journal , 25 (12), 4434–4444. https://doi.org/10.1096/fj.11-188383 . Oyola, M. G., & Handa, R. J. (2017). Hypothalamic–pituitary–adrenal and hypothalamic–pituitary–gonadal axes: Sex differences in regulation of stress responsivity. Stress (Amsterdam, Netherlands) , 20 (5), 476–494. https://doi.org/10.1080/10253890.2017.1369523 . Tables Tables 2 and 3 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Table2and3.docx HousingWSApoEsupplementalmaterial.docx Cite Share Download PDF Status: Published Journal Publication published 24 Jul, 2024 Read the published version in Cardiovascular Toxicology → Version 1 posted Editorial decision: Revision requested 23 Jun, 2024 Reviews received at journal 22 Jun, 2024 Reviewers agreed at journal 20 Apr, 2024 Reviewers invited by journal 15 Apr, 2024 Editor assigned by journal 10 Apr, 2024 Submission checks completed at journal 09 Apr, 2024 First submitted to journal 08 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4237383","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":289843992,"identity":"9f4fa926-cb85-436a-bfa4-9aab3e0fbf6d","order_by":0,"name":"Michelle Fiamingo","email":"","orcid":"","institution":"The University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Michelle","middleName":"","lastName":"Fiamingo","suffix":""},{"id":289843994,"identity":"141562cd-b2c6-478f-b7cc-d89035a31445","order_by":1,"name":"Sydnie Toler","email":"","orcid":"","institution":"The University of North Carolina at Chapel Hill","correspondingAuthor":false,"prefix":"","firstName":"Sydnie","middleName":"","lastName":"Toler","suffix":""},{"id":289843995,"identity":"c0576bbc-5d6e-4607-87e9-b13741edb36c","order_by":2,"name":"Kaleb Lee","email":"","orcid":"","institution":"Oak Ridge Institute for Science and Education","correspondingAuthor":false,"prefix":"","firstName":"Kaleb","middleName":"","lastName":"Lee","suffix":""},{"id":289843997,"identity":"67b34344-ffb3-476e-9b13-38c2c671f125","order_by":3,"name":"Wendy Oshiro","email":"","orcid":"","institution":"U.S. Environmental Protection Agency","correspondingAuthor":false,"prefix":"","firstName":"Wendy","middleName":"","lastName":"Oshiro","suffix":""},{"id":289843998,"identity":"9a9a8b49-3d39-42ca-a0fe-6cbdd4cec854","order_by":4,"name":"Todd Krantz","email":"","orcid":"","institution":"U.S. Environmental Protection Agency","correspondingAuthor":false,"prefix":"","firstName":"Todd","middleName":"","lastName":"Krantz","suffix":""},{"id":289843999,"identity":"8478493b-cfe8-4a60-89f4-a50223d02791","order_by":5,"name":"Paul Evansky","email":"","orcid":"","institution":"U.S. Environmental Protection Agency","correspondingAuthor":false,"prefix":"","firstName":"Paul","middleName":"","lastName":"Evansky","suffix":""},{"id":289844000,"identity":"a6981645-97fa-49b6-a83e-7d657e6c4804","order_by":6,"name":"David Davies","email":"","orcid":"","institution":"U.S. Environmental Protection Agency","correspondingAuthor":false,"prefix":"","firstName":"David","middleName":"","lastName":"Davies","suffix":""},{"id":289844001,"identity":"093b7195-4694-4d71-8661-13ab0c3312c7","order_by":7,"name":"M. Ian Gilmour","email":"","orcid":"","institution":"U.S. Environmental Protection Agency","correspondingAuthor":false,"prefix":"","firstName":"M.","middleName":"Ian","lastName":"Gilmour","suffix":""},{"id":289844002,"identity":"9c54faaf-77ed-47e9-8aa6-fd589e7866e2","order_by":8,"name":"Aimen Farraj","email":"","orcid":"","institution":"U.S. Environmental Protection Agency","correspondingAuthor":false,"prefix":"","firstName":"Aimen","middleName":"","lastName":"Farraj","suffix":""},{"id":289844003,"identity":"3e17e308-f468-494b-899d-d2ce78ffe205","order_by":9,"name":"Mehdi S. Hazari","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4klEQVRIiWNgGAWjYBACAzgpwWBw4APJWg7OIF4LA0QLMw8xWszZjz/8XFHAEM0v3bzxsE3FHXkG/sXHJPBpsexJSJY8Y8CQO3POsYLDOWeeGTZIPEvDq8XgQMIByQaglg03cgwO57YdZmyQOGNsgFfL+YfNP0Fa9oO0WP47bE9Yy41kNogtEkAtjA2HExv4ewwf4NfyjM2ywUAid8aNtIKDPceeJbdJsCXi13I+/fHNhj82uf0zkjd/+FFzx7af//CBA/i0QAE8iA4wsEkkEKEBCQDN5yfGjlEwCkbBKBhJAAARClJJ5arrqgAAAABJRU5ErkJggg==","orcid":"","institution":"U.S. Environmental Protection Agency","correspondingAuthor":true,"prefix":"","firstName":"Mehdi","middleName":"S.","lastName":"Hazari","suffix":""}],"badges":[],"createdAt":"2024-04-08 15:09:57","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4237383/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4237383/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12012-024-09897-8","type":"published","date":"2024-07-24T16:15:48+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":54567581,"identity":"237558af-d1a2-4bfb-854a-c67cd9542809","added_by":"auto","created_at":"2024-04-12 11:46:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":354076,"visible":true,"origin":"","legend":"\u003cp\u003eDepiction of housing paradigm and environmental design. (A) Enriched housing (EH) has a alpha-dri bedding with a hut that has an attached running wheel, nestlet, bedding enrichment, and a tunnel, and (B) Depleted Housing (DH) has only alpha-dri bedding in a polycarbonate cage. The mice were split into EH or DH for 18 weeks before being exposed to either a filtered air (FA) sham or a single flaming eucalyptus wildfire smoke (WS) exposure for one hour (C). Pre-exposure and post-physiological assessments were taken to assess ventilatory and cardiovascular function utilizing whole-body plethysmography and high-frequency echocardiography (HF-echo). Figure created with Biorender.com.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4237383/v1/b20685490f446141d18e59d1.png"},{"id":54567878,"identity":"20ca515b-22d5-4f76-be84-ff764819752c","added_by":"auto","created_at":"2024-04-12 11:54:14","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":133697,"visible":true,"origin":"","legend":"\u003cp\u003eVentilatory function was measured with whole-body plethysmography (WBP) one-week before exposures and immediately after the exposures. (A) inhalation time, (B) exhalation time, (C) peak inspiratory flow, (D) peak expiratory flow, (E) relaxation time, (F) tidal volume, (G) minute volume, (H) breathing frequency, and (I) PenH were measured pre-exposure and immediatey post-exposure. A percent change calculation from the pre-post-exposure was conducted, and data is reported in a bar graph (n=5-6). * represents significance between groups (p\u0026lt; 0.05), ** represents significance between groups (p\u0026lt;0.01), and *** represents significance between groups (p\u0026lt; 0.001). P-values that trend towards significant changes (0.05 \u0026lt; p \u0026lt;0.1) are also indicated.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4237383/v1/3ec91418221d38d0ac0a87ac.png"},{"id":54567877,"identity":"60a54c52-133b-4758-9dde-ae40d0d5b9ee","added_by":"auto","created_at":"2024-04-12 11:54:13","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":125392,"visible":true,"origin":"","legend":"\u003cp\u003eCardio-mechanical functioning measured utilizing HF-echo. Heart rate (A), cardiac output (B), stroke volume (C), left ventricle mass (mg) / body weight (g) (D), end systolic volume (E), and diastolic (F) were measured pre-exposure, 24hrs post-exposure, and one-week post-exposure. Data is reported using boxplots showing min to max and all points (n=5-6). * represents significance between groups (p\u0026lt; 0.05), ** represents significance between groups (p\u0026lt;0.01), and *** represents significance between groups (p\u0026lt; 0.001), † represents significance compared to the pre-exposure timepoint, ‡ represents significance compared to the 24-hr timepoint. P-values that trend towards significant changes (0.05 \u0026lt; p \u0026lt;0.1) are also indicated. The magnitude of significance for changes in time are not indicated on the graph and can be found in Supplementary Table 3.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4237383/v1/4c87a11414968474383bd912.png"},{"id":54567587,"identity":"eae41986-9528-4d6b-890a-c65ecba42fa4","added_by":"auto","created_at":"2024-04-12 11:46:14","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":156081,"visible":true,"origin":"","legend":"\u003cp\u003eCardiovascular physiology was assessed utilizing HF-echo. Left ventricular anterior wall size during systole (LVAW;s) (A) and diastole (LVAW;d) (B), and left ventricular posterior wall size during systole (LVPW;s) (C) and diastole (LVPW;d) (D) were measured pre-exposure, 24hrs post-exposure, and one-week post-exposure. Data is reported using boxplots showing min to max and all points (n=5-6). * represents significance between groups (p\u0026lt; 0.05), ** represents significance between groups (p\u0026lt;0.01), and *** represents significance between groups (p\u0026lt; 0.001), † represents significance compared to the pre-exposure timepoint, ‡ represents significance compared to the 24-hr timepoint. P-values that trend towards significant changes (0.05 \u0026lt; p \u0026lt;0.1) are also indicated. The magnitude of significance for changes in time are not indicated on the graph and can be found in Supplementary Table 3.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4237383/v1/63a4f7348793a3ea3df3f773.png"},{"id":54567880,"identity":"f23d3209-2e61-469e-b7f8-bfd2a4ded978","added_by":"auto","created_at":"2024-04-12 11:54:14","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":159130,"visible":true,"origin":"","legend":"\u003cp\u003eHemodynamic functioning measured utilizing HF-echo. Pulmonary acceleration time (PAT) (A), pulmonary ejection time (PET) (B) and the ratio between PAT/PET (C) were measured pre-exposure, 24hrs post-exposure, and one-week post-exposure. Data is reported using boxplots showing min to max and all points (n=5-6). * represents significance between groups (p\u0026lt; 0.05), ** represents significance between groups (p\u0026lt;0.01), and *** represents significance between groups (p\u0026lt; 0.001), † represents significance compared to the pre-exposure timepoint, ‡ represents significance compared to the 24-hr timepoint. P-values that trend towards significant changes (0.05 \u0026lt; p \u0026lt;0.1) are also indicated. The magnitude of significance for changes in time are not indicated on the graph and can be found in Supplementary Table 4.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4237383/v1/d44ab0c610df35e63017153f.png"},{"id":54567588,"identity":"047f3db4-22cd-4bb7-8ddb-b6506371e567","added_by":"auto","created_at":"2024-04-12 11:46:14","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":156094,"visible":true,"origin":"","legend":"\u003cp\u003eTransmitral blood flow was measured utilizing HF-echo pulsed-wave doppler measurments. Aortic ejection time (AET) (A), isovolumic contraction time (IVCT) (B), isovolumic relaxation time (IVRT) (C), and the myocardial performance index (MPI) (D) were measured pre-exposure, 24hrs after exposure, and one-week post-exposure. Data is reported using boxplots showing min to max and all points (n=5-6). * represents significance between groups (p\u0026lt; 0.05), ** represents significance between groups (p\u0026lt;0.01), and *** represents significance between groups (p\u0026lt; 0.001), † represents significance compared to the pre-exposure timepoint, ‡ represents significance compared to the 24-hr timepoint. P-values that trend towards significant changes (0.05 \u0026lt; p \u0026lt;0.1) are also indicated. The magnitude of significance for changes in time are not indicated on the graph and can be found in Supplementary Table 4.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4237383/v1/8e6fd767693a38b063361543.png"},{"id":54567876,"identity":"6eeec6b3-b7a5-4227-8256-9b6aa8495f91","added_by":"auto","created_at":"2024-04-12 11:54:13","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":46163,"visible":true,"origin":"","legend":"\u003cp\u003eAortic mRNA expression was assessed utilizing RT-qPCR. \u003cem\u003eVcam-1 \u003c/em\u003e(A)\u003cem\u003e, Icam-1 \u003c/em\u003e(B)\u003cem\u003e, Il-6 \u003c/em\u003e(C), \u003cem\u003ePtx3 \u003c/em\u003e(D), and \u003cem\u003eNampt \u003c/em\u003e(E) were assessed one-week after the exposures. Data is reported with bar graphs showing all points (n=4-6, ± SEM). * represents significance between groups (p\u0026lt; 0.05), ** represents significance between groups (p\u0026lt;0.01), and *** represents significance between groups (p\u0026lt; 0.001). P-values that trend towards significant changes (0.05 \u0026lt; p \u0026lt;0.1) are also indicated.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4237383/v1/77446e3d4935ad1f494bb27e.png"},{"id":61596273,"identity":"24470fbd-b0ca-4779-a07b-edf52f8af4a6","added_by":"auto","created_at":"2024-08-01 17:26:11","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1754414,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4237383/v1/2428ae7d-a845-4338-a2bf-fb24503fcda7.pdf"},{"id":54567582,"identity":"abcf8284-a6ee-48fb-878c-9bd2d2c3f858","added_by":"auto","created_at":"2024-04-12 11:46:13","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":28095,"visible":true,"origin":"","legend":"","description":"","filename":"Table2and3.docx","url":"https://assets-eu.researchsquare.com/files/rs-4237383/v1/0aac1c7c77d4c26d5efb32d7.docx"},{"id":54567590,"identity":"97820dcc-5fd0-421a-b130-9271deed90be","added_by":"auto","created_at":"2024-04-12 11:46:15","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":669225,"visible":true,"origin":"","legend":"","description":"","filename":"HousingWSApoEsupplementalmaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-4237383/v1/f91ca240f314824b20c16422.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Depleted housing elicits cardiopulmonary dysfunction after a single flaming eucalyptus wildfire smoke exposure in a sex-specific manner in ApoE knockout mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLiving conditions are now widely accepted as important determinants of cardiovascular disease (CVD) incidence and progression [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. While the impacts of biological, behavioral, and genetic risk factors on the progression of CVD [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] have long been appreciated, it has become increasingly clear that psychosocial factors, including stress [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], depression [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], and anxiety [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] are also associatied with the onset and progression of CVD. For example, socioeconomic conditions from childhood are inversely associated with CVD risk in adulthood [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], emphasizing how non-chemical risk factors can have long-term effects on human health. The Multi-Ethnic Study of Atherosclerosis found that low-support and disorderly neighborhood environments are associated with a less healthy diet and decreased access to nutritious food [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], a decrease in physical activity [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], and sleep perturbations [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], all of which increase CVD risk [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Thus, housing and neighborhoods indirectly affect cardiovascular health, and likely play an role in disease pathology. However, research that examines the impacts of direct housing interventions on the progression of CVD and the biological mechanisms responsible for such effects remains scarce.\u003c/p\u003e \u003cp\u003eHousing and neighborhood status can also affect physiological resiliency to environmental and chemical exposures. For example, wildfire smoke (WS) has been found to disproportionately impact cardiopulmonary outcomes based on measures of community health, such as income, education, and family and social support [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], while air pollution disproportionately affects lower socioeconomic status (SES) communities [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Widlfire smoke exposure has also been shown to induce adverse cardiovascular responses, including triggering a pro-atherosclerotic vascular response to WS in mice [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] and an increased prevalence of atherosclerotic plaques and carotid-intima media thickness [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In addition, there is significant epidemiological evidence that air pollution, specifically fine particulate matter (PM\u003csub\u003e2.5\u003c/sub\u003e), is associated with atherosclerotic CVD [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Worsening climate conditions have prompted an increase in the prevalence and severity of wildfires [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], and as such may increase the likelihood for spatiotemporal juxgaposition of chemical stressors (i.e., WS) with non-chemical stress from inadequate housing and psychosocial perturbances.\u003c/p\u003e \u003cp\u003eRodent models are a suitable approach to extrapolate human responses considering living condition-induced psychosocial stress causes similar cardiovascular deficits in both [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], and have been used extensively to study cardiovascular physiology and the cardiopulmonary response to air pollutants [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. For instance, spontaneously hypertensive rats experience increased blood pressure and heart rate when social enrichment was removed from their cages [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], indicating that housing can affect baseline cardiovascular function. Similarly, rat models have shown that environmental enrichment can mitigate and reverse neurocognitive dysfunction caused by developmental lead exposure [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], suggesting that housing can also alter body resiliency to toxicants. However, few studies have focused on characterizing changes in cardiovascular physiology and function from housing enrichment and the ability of housing to modulate resiliency against an air pollution exposure. Our previous work showed that depleted housing causes increased heart rate, incidence of arrhythmias, and lower activity levels in healthy mice during a single smoke exposure [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, the effect of this housing paradigm on underlying CVD and the corresponding response to WS remains unknown. The objective of the present study was to identify the effects of depleted (DH) versus enriched housing (EH) on cardiomechanical function and physiology in a atherosclerosis-prone mouse model and characterize the response to eucalyptus WS.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eAnimals \u0026ndash; Eight-week-old male and female ApoE (-/-) mice (Jackson Laboratories \u0026ndash; Bar Harbor, ME) were utilized in this study. Mice were housed 5 animals per cage with alpha-dri bedding and a 12-hour light/dark cycle in polycarbonate cages. These facilities are maintained at 21\u0026deg;C and 50% relative humidity in our Association for Assessment and Accreditation of Laboratory Animal Care (AALAC)- approved facilities at the United States Environmental Protection Agency (USEPA). The animals were given access to food and water \u003cem\u003ead libitum\u003c/em\u003e, except during the exposures, and were allowed to acclimate for 7-days prior to the beginning of the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStudy Design\u003c/strong\u003e \u0026ndash; Mice were acclimated to the facilities for one week before being randomly separated into either enriched (EH) or depleted (DH) housing. Enriched housed mice had access to a hut and a wheel, a nestlet (Lab Supply, Durham, NC), a scratchpad, and a tunnel, whereas the DH mice were kept in a bare cage with alpha-dri bedding (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Mice were housed in these conditions for 18 weeks before being randomly exposed once to either one-hour eucalyptus smoke (WS) or a filtered air (FA) sham (n\u0026thinsp;=\u0026thinsp;6/sex/group). High-frequency echocardiography was assessed approximately 1-2-weeks before and 24hrs and one-week after the exposure in order to evaluate the immediate effects from WS-exposure, as well as any long-term interactions between housing and WS, and whole-body plethysmography was performed the week before and immediately after exposure. The necropsy was conducted after 19 weeks, and the mice were approximately 27 weeks old at this time. Serum was collected and the distal aorta was excised and frozen at -80\u0026deg;C for gene expression analyses.\u003c/p\u003e\n\u003cp\u003eTube Furnace Exposure System for whole-body exposure to flaming eucalyptus biomass smoke \u0026ndash; An automated control tube furnace system at the USEPA was utilized to create the eucalyptus biomass wildfire smoke under flaming conditions (2L/min), which has been previously described [\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e]. Animals were exposed to either the eucalyptus wildfire smoke or a filtered air sham for one-hour in whole-body inhalation chambers (0.3m\u003csup\u003e3\u003c/sup\u003e Hinners style stainless steel and glass exposure chamber). Eucalyptus fuel was acquired as writing pen blanks (rectangles at 0.75 inches square by 6 inches long) (Woodworkers source Arizona). A gasoline powered wood shredder (Echo bearcat model number SC3206) was utilized to process the wood and was cleaned in between use. The particulate matter (PM) concentration was monitored continuously and adjusted by a proportional-integral-derivative (PID) feedback loop. Carbon dioxide and carbon monoxide were monitored continuously utilizing a non-dispersive infrared analyzer (Model: 602 CO/CO\u003csub\u003e2\u003c/sub\u003e; CAI Inc., Orange, CA). PM was also collected on a glass fiber filter that was installed in the exhaust line to determine average PM concentrations gravimetrically by weighing the filter before and after the inhalation exposures. The real-time measurements of the wildfire smoke properties and engineering parameters (ie. temperatures, relative humidity, static pressures and flow rate) were continuously monitored and analyzed utilizing data acquisition software (Dasylab version 13.0, National Instruments, Austin, TX).\u003c/p\u003e\n\u003cp\u003eWhole-Body Plethysmography (WBP) \u0026ndash; To assess changes in ventilation patterns, animals were monitored by WBP (Emka Technologies, Falls Church, VA) one week before exposure (pre-exposure) and immediately post-exposure, as previously described [\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e]. The mice were placed in clear plethysmography chambers (3.5\u0026rdquo; diameter x 2.5\u0026rdquo; height) and given a 5 min acclimation period. Following the acclimation period, data was collected for 15 min and averaged over three five-minute periods, where the following breathing parameters were assessed: inhalation time (Ti), exhalation time (Te), peak inspiratory flow (PIF), peak expiratory flow (PEF), breathing frequency (f), tidal volume (TV), minute volume (MV), relaxation time (RT), and enhanced pause (PenH). Data was collected and analyzed using EMKA iox 2 software (SCIREQ, Montreal, Canada).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHigh Frequency Echocardiography (HF-echo) \u0026ndash;\u003c/strong\u003e Cardiac physiology and function was assessed with a high-frequency echocardiography ultrasound system (Vevo 2100, FujiFilm Visual Sonics Inc., Toronto, Canada), as previously described [\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e]. Animals were anesthetized with 1.5-3% isoflurane delivered in 100% O\u003csub\u003e2\u003c/sub\u003e at 0.8-1.0L/min in a sealed whole-body chamber. Once under light anesthesia, the animals were placed on a heated Vevo\u0026reg; Mouse Handling Table (FujiFilm Visual Sonics, Inc.), where isoflurane was continually delivered via nose cone, in dorsal recumbency with each paw grounded to an electrode using Electrode Cr\u0026egrave;me (Cat# 600-0001-01-S, Indus Instruments, Webster, TX, USA) for physiological monitoring and recording of electrocardiogram, heart rate, and respiration rate. An MS-550D transducer was used to image the parasternal long-axis view of the left ventricle using B-mode and M-mode imaging. Pulsed wave Doppler measurements of pulmonary artery and transmitral blood flow was viewed from the short axis and apical four-chamber view, respectively. The sonographer was blinded to the exposure group identities and 3 cine-loops were collected in each view for data analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEchocardiographic analysis\u003c/strong\u003e \u0026ndash; Echocardiographic analysis was completed utilizing Vevo\u0026reg; Lab Software (FujiFilm Visual Sonics, Inc.), as previously described (Martin et al. 2018). Briefly, while blinded to exposure groups, two beats between breaths for three cine-loops were analyzed. Long-axis M-mode cine-loops were analyzed to measure endpoints related to cardiovascular physiology and cardio-mechanical function, such as, heart rate (HR), cardiac output (CO), stroke volume (SV), fractional shortening (FS), ejection fraction (EF), end systolic volume (ESV), end diastolic volume (EDV), left ventricle anterior wall systole (LVAW;s), left ventricle anterior wall diastole (LVAW;d), left ventricle posterior wall systole (LVPW;s), and left ventricle posterior wall diastole (LVPW;d). Utilizing pulsed wave doppler measurements, we also analyzed blood flow through the pulmonary artery to assess pulmonary artery acceleration time (PAT) and pulmonary artery ejection time (PET). A ratio of these two parameters (PAT/PET) was also calculated. Transmitral blood flow was also assessed utilizing pulsed wave doppler measurements to calculate isovolumic contraction time (IVCT), aortic ejection time (AET), and isovolumetric relaxation time (IVRT). The myocardial performance index was calculated with the following equation: (IVCT\u0026thinsp;+\u0026thinsp;IVRT)/AET.\u003c/p\u003e\n\u003cp\u003eNecropsy and Tissue Collection \u0026ndash; After the final ultrasound, mice were given an intraperitoneal injection of Euthasol (100mg/kg Na\u003csup\u003e+\u003c/sup\u003e pentobarbital 25 mg/kg phenytoin; Virbac Animal Health, Fort Worth, TX, USA). After the animals were unresponsive to a hind paw pinch, blood was collected from the abdominal aorta in serum separator tubes (no anti-coagulant) and centrifuged at 3500 rpm, 4\u0026deg;C for 10 min. Serum samples were stored at -80\u0026deg;C for later analyses with commercially available kits for a KoneLab Arena 30 Clinical Chemical Analyzer (Thermo Chemical Lab Systems, Espoo, Finland). Serum levels of total cholesterol, trigylcerides, and glucose were evaluated with kits from TECO Diagnostics (Anaheim, California). High-density lipoprotein (HDL) and low-density lipoprotein (LDL) serum levels were evaluated with a kit from Sekisui Diagnostics LLC (Burlington, MA), and free fatty acids (FFA) serum levels were analyzed with kits from Cell Biolabs, Inc (San Diego, California). The whole heart was weighed and the distal aorta was excised and frozen in liquid nitrogen and stored at -80\u0026deg;C.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA Extraction and real time quantitative polymerase chain reaction (RT- qPCR) \u0026ndash;\u003c/strong\u003e RNA was isolated from ~\u0026thinsp;10mg of aortic tissue from consistent regions of the aortic arch. Direct-zol RNA Miniprep Plus kit (Zymo Research, Irvine, CA) and QIAzol lysis reagent (Qiagen, Valencia, CA) were used to isolate RNA according to instructions provided from the manufacturer. Total RNA quantity and quality (260/280 and 260/230 ratios) was assesses using a Nanodrop 1000 (ThermoFisher Scientific, Waltham, MA). cDNA synthesis using RNA templates was performed using qScript (Quanta Biosciences, Beverly, MA) following manufactuers instructions. Primers were designed using the publicly available NCBI database. Forward and reverse primers were purchased from Integrated DNA Technologies, Inc. (Coralville, IA): \u003cem\u003eAct-\u0026beta;\u003c/em\u003e f- CTCCCTGGAGAAGAGCTATGA, r- CCAAGAAGGAAGGCTGGAAA; \u003cem\u003eVcam-1\u003c/em\u003e f- GAAATGCCACCCTCACCTTA, r- TCTGCTTTGTCTCTCCCAATC; \u003cem\u003eIcam-1\u003c/em\u003e f- CCAAGAAACGCTGACTTCATTC, r- GGTCTTCTTGCTTGTGTCTACT; \u003cem\u003eIl-6\u003c/em\u003e f- CTTCCATCCAGTTGCCTTCT, r- CTCCGACTTGTGAAGTGGTATAG; \u003cem\u003ePtx3\u003c/em\u003e f- AGGGTGGACTCCTACAGATT, r- TGAGAACCCGATCCCAGATA; \u003cem\u003eNampt\u003c/em\u003e f- CCTGACTCTGGAAATCCTCTTG, r- AAGGTGGCAGCAACTTGTA. The relative difference in aortic DNA was quantified through qPCR on a QuantStudio\u0026trade; 7 system (ThermoFisher Scientific, Waltham, MA) using Sybr Green PCR Master Mix (ThermoFisher Scientific, Waltham, MA) and 15ng of DNA. Relative gene expression differences were normalized using the \u003csup\u003e\u0026Delta;\u0026Delta;\u003c/sup\u003eCT method and \u0026beta;-actin as the housekeeping gene and DH- FA as the control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBronchoalveolar Lavage \u0026ndash;\u003c/strong\u003e Bronchoalveolar lavage fluid (BALF) samples were collected at necropsy. Room temperature Hank\u0026rsquo;s Balanced Salt Solution (HBSS) was injected into the lungs via the trachea and repeated for each animal so that there were three aliquots of 0.6mL of HBSS for analysis. The cells were resuspended in 1.0mL of HBSS and placed into Coulter vials for total cell counts (Z1 Beckman-Coulter Counter, Miami, Florida). Aliquots of 200\u0026micro;L were then deposited into Cytospin funnels and spun at 250rpm for 10 min. The slides were then stained with DiffQuick (RAL Diagnostics) and the number of neutrophils, macrophages, and lymphocytes in the BALF was determined.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll endpoints were analyzed utilizing IBM SPSS Statistics (Version 29.0) using a repeated measures or univariate general linear model in SPSS to assess the main effects and interactions of between subject factors of sex, housing, and exposure and within subjects factors of time (for repeated measures analyses), with a Sidak\u0026rsquo;s adjustment for pairwise comparisons. Pairwise comparisons were only performed when main factors or interaction terms in the overall model were significant. Tukey\u0026rsquo;s method for outliers was conducted within groups with notable violations of homogeneity of variance, and normality was assessed utilizing a Shapiro-Wilk test. Box cox transformations were performed if needed and in rare cases where normality was still not met, data was analyzed in the same manner as the other endpoints. Findings were considered significant when p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Sex-differences in all parameters are not discussed due to body-mass differences, however, were still performed and can be found in the supplementary material. Graphs were created utilizing GraphPad Prism (GraphPad Software Version 9.0, San Diego, CA).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eExposure characterization \u0026mdash; All gas and particle concentrations for the wildfire smoke exposures are in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. The average particulate matter (PM) generated from these exposures was 464.0\u0026thinsp;\u0026plusmn;\u0026thinsp;340.6 \u0026micro;g/m\u003csup\u003e3\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eAverage parameters for the flaming eucalyptus wildfire smoke exposures.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePM (\u0026micro;g/m\u003csup\u003e3\u003c/sup\u003e)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCO (ppm)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCO2 (ppm)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSmoke Temp (\u0026deg;C)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSmoke RH (%)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSmoke Flow (LPM)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eEucalyptus WS\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e464.0\u0026thinsp;\u0026plusmn;\u0026thinsp;340.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e23.6\u0026thinsp;\u0026plusmn;\u0026thinsp;16.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1401.4\u0026thinsp;\u0026plusmn;\u0026thinsp;414.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e71.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e53.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e98.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBody weight and bronchoalveolar lavage (BAL)\u003c/strong\u003e \u0026ndash; While male mice weighed more than females, there were no differences in body weight due to housing across the entire study (Table \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e \u0026ndash; Supplementary Material). Thus, sex- comparisons for cardiopulmonary parameters (HF-Echo and WBP) are not presented because they likely represent differences in body mass. The bronchoalveolar lavage also was not significantly different based on housing or exposure (Table S2 \u0026ndash; Supplementary Material).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVentilatory function \u0026ndash;\u003c/strong\u003e In general, all na\u0026iuml;ve animals experience a decrease in ventilatory parameters during whole-body plethysmography testing, this is because they eventually relax during the testing period. Regardless, most ventilatory changes (pre-to-post exposure) were observed in female mice. WS caused PIF (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC) and PEF (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD) to be significantly less decreased in male EH mice when compared to FA. Although not significant, this also appeared to be the trend with male DH mice. There were no other differences in male mice. Overall, EH prolonged Te (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB), decreased MV (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eG), and showed a decreasing trend in PEF and TV (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD, \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eF) in all female mice when compared to DH. WS caused Te, RT (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eE), and TV to significantly increase in female DH mice, this did not occur in female EH mice. While not significant, female DH-FA mice had less decrease in F compared to EH-FA mice (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eH).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCardiovascular Function \u0026ndash;\u003c/strong\u003e Cardiovascular physiology was assessed 1\u0026ndash;2 weeks before (pre-exposure), 24hrs and one-week after exposure. The results are presented to show changes from housing over time, when compared to pre-exposure measurements, as well as between groups to signify effects from both housing and exposure. All statistical analyses, including across sex and all time points, are presented (Tables S3-S5 in the Supplementary Material). There were no differences between DH and EH in both male and female mice at pre-exposure for any parameters (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThere were no significant differences in HR between any of the groups of male or female mice at 24hrs or one-week post-exposure (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA). Male DH-FA mice experienced a decrease (-10.0%) in HR 24hrs post-exposure and an increase (24.0%) one-week later, while male EH-FA had a 0.9% decrease and 8.4% increase at the same time points (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Male DH-WS mice had a small increase (3.0%) in HR 24hrs post-exposure, whereas EH-WS mice had a decrease (-1.1%). HR increased in male DH-WS (13.5%) and EH-WS (8.4%) male mice one-week later. Female EH-WS mice had a significant increase (11.7%) 24hrs after exposure, however, one-week post-exposure this change was mitigated (2.1%) (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThere was no difference in EF between any of the male or female groups 24hrs after exposure (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB). However, when compared to pre-exposure, WS caused EF to significantly decrease in male DH mice 24hrs post-exposure, and in both male DH and EH mice one-week after exposure (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e), with the response being greater with EH (-23.0% EH vs. -7.6% DH). EH caused EF to decrease in WS-exposed male mice one-week after exposure when compared to FA (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e\n\u003cp\u003eFor cardiac output (CO), the only group difference was that WS caused a trend of decrease (p\u0026thinsp;=\u0026thinsp;0.08) in male DH mice 24hrs post-exposure when compared to EH (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC); there were no other differences in any other male or female groups. It is worth noting, that although the groups did not differ statistically at 24hrs or one-week, there were WS-induced changes in males that differed by housing at both time points. Male EH-FA and DH-FA mice both had decreases in CO (-10.8% and \u0026minus;\u0026thinsp;8.3%, respectively), whereas male DH-WS had a slight increase (1.4%) and EH-WS mice had a larger increase (15.4%) 24-hrs post-exposure. However, 1-wk later, male DH mice had an increase in CO regardless of exposure (FA 26.1%, WS 21.2%), and the WS-induced a decrease in male EH mice (-18.3%) compared to an increase in the EH-FA group (11.8%). In the females, WS-induced changes appear to elicit similar changes in both EH and DH mice, with increases 24-hr post-exposure (DH WS 7.6%, EH WS 7.3%), followed by a decrease 1-wk later (DH WS -4.9%, EH WS -8.5%)\u003c/p\u003e\n\u003cp\u003eThere were no significant differences in FS between any of the groups, male or female, at either 24hrs or one-week post-exposure (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD), however there were significant changes in FS over time. Compared to pre-exposure, male EH-WS and female EH-FA mice had significantly decreased FS both 24hrs (-17.3% and \u0026minus;\u0026thinsp;25.3%, respectively) and one-week after the exposures (-25.5% and \u0026minus;\u0026thinsp;2.9%), while female DH-FA mice also had a decrease in FS only one-week post-exposure (-17.3%) (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). On the other hand, WS caused a significant increase in SV in male EH mice 24hrs post-exposure compared to male DH-WS (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE). However, one-week later, the male EH-WS mice had a significant decrease in SV (-41.1%), which remained significantly lower than both EH-FA and DH-WS mice (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e and S3). Lastly, there were no differences in LV mass between any of the male or female groups, nor was there any significant change over time (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eF).\u003c/p\u003e\n\u003cp\u003eThere were no differences in EDV and ESV between any groups of male or female mice. However, when compared to pre-exposure, WS caused ESV to increase in male DH mice at one-week post-exposure and in male EH mice at 24hrs and one-week. In contrast, increased ESV was observed in all female mice exposed to FA at 24hrs and one-week post-exposure (Table S3).\u003c/p\u003e\n\u003cp\u003eThere were no differences in LV anterior or posterior wall thickness between any of the male groups, whether during diastole or systole. On the other hand, WS caused LVAW during diastole and systole to be significantly greater in female EH mice when compared to its effects on DH at 24hrs post-exposure. One-week later, both female EH-FA and DH-WS mice had significantly larger LVAW during diastole and sytole and LVPW during diastole than DH-FA (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA-D). There were no significant changes across time.\u003c/p\u003e\n\u003cp\u003ePulsed-wave doppler imaging assessed blood flow through the pulmonary artery, and imaging of the apical 4-chamber view assessed transmitral blood flow and left ventricular myocardial performance. There were no group differences betwen the male mouse groups. Hemodynamic changes occurred almost exclusively in female mice, and changes in these parameters are noted at each time point (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA-D). WS caused a significantly prolonged PAT and PAT/PET in female DH mice one-week after exposure when compared to both female DH exposed to FA and female EH mice exposed to WS (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA and C). There were no significant changes in PET for groups for both sexes or over time (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB). Interestingly, when compared to pre-exposure, all male mice had an increase in PET 24hrs post-exposure, followed by a decrease one-week later, while it decreased at both 24hrs and one-week in the females. WS-induced changes in PAT and PAT/PET in male EH-WS mice, with a decrease in both parameters 24-hrs post-exposure, and 1-wk later an increase in PAT/PET. Similarly, WS-induced an increase in PAT/PET in female EH-WS mice 24-hrs after exposure. Female DH-WS and EH-FA both had an increase in PAT and PAT/PET 1-wk post-exposures (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eSignificant changes between groups in transmitral blood also occured almost exclusively in female mice, however DH caused a trend towards decreased AET, and increased IVRT and MPI in male mice when compared to EH 24hrs after FA (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA, C, and D). Female EH-FA mice had a significantly increased AET 24hrs after exposure when compared to female EH-WS and DH-FA mice (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA), and a significanltly lower MPI value when compared to female EH-WS (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eD). On the other hand, WS caused a significantly higher IVCT in female DH mice when compared to FA 24hrs after exposure (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB). One-week later, WS caused AET to be significantly decreased and increased MPI in female DH mice when compared to EH, and had significantly lowered IVCT and IVRT. DH also induced a significant increase in MPI when compared to EH-FA mice, and a trend towards an increased MPI when compared to EH-WS mice.\u003c/p\u003e\n\u003cp\u003eFurthermore, female DH-FA, DH-WS, and EH-FA all had significant reductions in AET from either pre-exposure or 24hrs to 1-wk later, while female EH-WS mice had a significant increase in IVCT 24hrs after exposures (Table S4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSerum Biomarkers\u003c/strong\u003e \u0026ndash; There were few changes in serum biomarkers. Male EH-WS mice had significantly elevated levels of low density lipoprotein (LDL) and triglycerides, when compared to male EH-FA mice (Fig. \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003eA, S1D \u0026ndash; Supplementary Materials). There were no other significant changes by groups, and there were no significant changes in females for any biomarker.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAortic gene expression\u003c/strong\u003e \u0026ndash; Male EH-WS mice had significantly higher \u003cem\u003eIl-6\u003c/em\u003e and \u003cem\u003eVcam-1\u003c/em\u003e or had an increased trend compared to male DH-WS mice (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA, \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eC). Female EH-WS mice had a decreased trend for \u003cem\u003eVcam-1\u003c/em\u003e compared to EH-FA mice (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA). Female DH-WS mice had significantly increased \u003cem\u003eNampt\u003c/em\u003e compared to DH-FA mice (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eE).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe results of this study show that living conditions, specifically housing enrichment, alter the cardiovascular and ventilatory response to WS, and has potential implications for impacting the progression of disease-related cardiovascular physiology. Psychosocial stressors, such as depleted housing, likely impact the response to wildfire smoke and other chemical stressors by altering cardiopulmonary physiology, and thus, contribute to heightened subsequent adverse effects. While it is clear that wildfire smoke is associated with increased morbidity and mortality [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], the ability of non-chemical stressors to modify the response to these extreme events, especially in the presence of underlying disease remains understudied. We compared enriched housing, which includes several forms of environmental enrichment, with depleted housing to evaluate the role of non-chemical stressors like living conditions in modifying physiological resiliency to a single smoke exposure. Our previous work showed that enriched housing improves cardiovascular outcomes, specifically a lower heart-rate, during and after a wildfire smoke exposure and promotes an increase in the expression of cardioprotective genes in the left ventricle [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The current study expanded this approach to assess whether housing alters cardiovascular function in atherosclerotic-prone mice and whether the effects are sex-specific. We found that the effect of housing on baseline cardiovascular function and the cardiovascular response to WS in ApoE (-/-) mice occurs in a sex-specific manner. The condition of housing (i.e., depleted vs. enriched) did not cause significant changes in cardiovascular physiology over 16 weeks prior to exposure, 24hrs and one-week after a single WS exposure, male mice exhibited changes in cardiomechanical function, specifically, WS-induced a decrease in SV and EF in male EH mice, and a decreased IVRT, MPI, and PAT in female EH mice.\u003c/p\u003e \u003cp\u003eThe ApoE(-/-) mouse has been a proven model for the spontaneous development of atherosclerosis in both male and female mice [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Atheroscletoric lesions occur as early as 10\u0026ndash;15 weeks of age, and the lesions grow larger in size and in complexity as the mice continue to age [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Moreover, exposure to PM\u003csub\u003e2.5\u003c/sub\u003e has been associated with an increase in the prevalence of atherosclerotic plagues in male ApoE (-/-) mice [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], increased carotid intima media thickness and prevalence of carotid plaques [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], and an elevated proatherosclerotic response [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Coronary artery diseases, such as atherosclerosis, have been shown to adversely impact left ventricular structure, leading to perturbations in left ventricular diastole and myocardial stiffness, seen with increased load and diastolic dysfunction [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn human populations, studies have shown that the adverse cardiovascular effects from air pollution can occur in a lag period of up to 40 days [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], which might be mediated by altered neuroendocrine stress axes that can affect immune, inflammatory, and metabolic processes [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], leading to prolonged adverse health effects. Stress has been shown to potentiate this effect by perturbing natural homeostatic function, leading to allostasis and thus an increased susceptibility to chemical exposures [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], such as wildfire smoke. Our results show that while EH causes significant changes in cardiovascualr function in male mice 24-hrs post-exposure, including a decreaed SV and EF, the physiological response changed one week later, with these parameters returning to near baseline for EH mice with a subsequent increase in these parameters for the DH mice. Thus, DH mice exhibit sustained effects from the WS exposure, indicating a potential disruption in stress axes. Moreover, the DH mice exhibit an increase in SV, EF, and ESV 1-wk after the WS exposure. This indicates that the male DH mice might be experiencing an increase in afterload on the heart, or an increase in the pressure needed to eject blood during ventricular contractions, 1-wk following the WS exposure. Chronic increases in afterload can lead to concentric hypertrophy and systolic heart failure through a decrease in ventricular compliance and further diastolic dysfunction [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Similarly, previous studies have shown that exposure to concentrated ambient PM\u003csub\u003e2.5\u003c/sub\u003e for 15 weeks elicits reversible cardiac dysfunction through decreases in cardiac output and stroke volume and a concurrent elevation in blood pressure in spontaneously hypertensive rats [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], indicating that EH might be protective against this type of cardiovascular dysfunction following a WS exposure. While not evaluated in this study, other potential mechanisms that could be causing these cardiovascular changes could include a decrease in cardiac contractility, or inotropy, as well as changes in autonomic function.\u003c/p\u003e \u003cp\u003eInterestingly, female mice did not exhibit changes in the cardiomechanical parameters that were measured (ie. HR, CO, SV, etc), but rather it was evident in the hemodynamic measurements (ie. IVRT, MPI, etc). Depleted housing caused an increase in both IVRT and MPI in female mice one-week after exposures to both FA and WS, with the response potentiated by WS. An increase in IVRT, or the time from when the aortic valve closes until the mitral valve opens before ventricular filling, may indicate left ventricular diastolic dysfunction that occurs when there is impaired left ventricular relaxation but normal filling patterns [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. The MPI, also called the Tei index, is a calculated parameter from HF-echo Doppler imaging that evaluates changes in cardiac time intervals, IVCT, IVRT, and AET, to provide information on combined systolic and diastolic function [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. An increase in the MPI has been shown to be a reliable marker for cardiac dysfunction in congestive heart failure patients [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] and diastolic dysfunction from acute myocardial infarctions [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Moreover, WS caused an increase in left ventricular wall measurements one-week after exposures in female DH mice, but not EH. Increased left ventricular anterior wall measurements, or the intraventricular septum, have been found to be associated with increased systolic blood pressure [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], and increased left ventricular anterior and posterior wall measurements are associated with the incidence of left-ventricular hypertrophy [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Although responses vary between sex, WS elicits cardiac dysfunction in both male and female mice, and EH might offer some protection against this dysfunction. A possible explanation to these sex-specific changes in pathologies might be due to female ApoE (-/-) mice developing atherosclerotic lesions and plaques faster than the male mice [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], thus the disease progression, and therefore the response to both housing and WS might differ by sex in this model. While atherosclerotic plaque sizes were not measured in this study, future studies should include histopathology of atherosclerotic lesions and other overt measurements of disease progression to further inform this work. In addition, epidemiological studies have shown that women are more susceptible to long-term cardiovascular complications from air pollution compared to men [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], indicating that sex itself might be acting as a biological variable that is leading to the differential changes we see in our study.\u003c/p\u003e \u003cp\u003eChronic stress can alter lipid metabolism, as well as autonomic and hormonal homeostasis, through activation of the hypothalamus-pituitary adrenal gland (HPA) axis and the sympathetic-adrenal-medullary (SAM) axis [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e], which can be a risk factor for atherosclerosis [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Our results show that male EH-WS mice have increased levels of triglycerides and serum LDL one-week after exposures, indicating that there could be alterations in the HPA-axis, leading to lipid dysregulation [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Similarly, male EH-WS mice also have increased expression of \u003cem\u003eIL-6\u003c/em\u003e and \u003cem\u003eVcam-1\u003c/em\u003e in the aorta, which have been shown to be predictive of peripheral atherosclerosis progression and acute myocardial infarctions [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Although our initial hypothesis was that enrichment of living conditions might protect against the development/progression of cardiovascular dysfunction in this model, it is clear that potential worsening of these conditions might not necessarily be ameliorated by psychosocial interventions. We noticed a higher degree of fighting and resource-related aggression in the male EH mice. A previous study has shown that social stress with a male dominant intruder can increase progression [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. Thus, there still may have been some amount of psychosocial stress in this group, which contributed to pro-atherosclerotic signs.\u003c/p\u003e \u003cp\u003eMoreover, while both male and female ApoE (-/-) mice spontaneously develop atherosclerosis, the females are generally found to have worsened atherosclerotic development than males even with similar serum lipid and chemistry levels [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Interestingly, our results showed that female DH mice exposed to WS might have worsened atherosclerotic progression due to an increased expression of \u003cem\u003eNampt\u003c/em\u003e, a gene that is associated with both atherosclerosis and insulin resistance [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. However, the lack of robust change in serum chemistry markers or gene expression changes in the distal aorta is likely due to the ability of the animals to recover over the one-week between the WS exposure and tissue collection, and so, it could be argued that measurements in the tissues and serum at an earlier time point might have elicited changes in these biomarkers.\u003c/p\u003e \u003cp\u003eWS is made up of a complex mixture of toxic gases and particulate matter [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e] and has been shown to elicit adverse upper and lower airway respiratory conditions [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. Our results show that housing is able to impact ventilatory outcomes in a sex-specific manner. Breathing frequency was decreased in all groups, as a result of acclimation to the whole body chamber consistent with our previous findings [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. WS exposure caused an increase in Te, TV, and RT exclusively in female DH mice, portraying a potential irritant response in the upper airways, indicating that female DH mice might be more susceptible [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. Women have been shown to be more at risk to adverse responses to ambient air pollution than men [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], and rodent studies have shown that female mice have an elevated response to chronic stress due to increased HPA-axis activity [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e], which might be a possible mechanism driving our observations. Further, WS caused an increase in PIF and PEF in male EH mice, but not DH mice. However, there were no significant changes in the inflammatory cells in the bronchoalveolar lavage, likely due to the relatively low WS exposure concentration used and/or the time of the lavage assessments in this study. Other studies from our group have exposed animals to much higher concentrations, and have elicited an increased cardiopulmonary and inflammatory response to the WS (PM\u0026thinsp;=\u0026thinsp;4.2mg/m\u003csup\u003e3\u003c/sup\u003e prior study vs. 0.46mg/m\u003csup\u003e3\u003c/sup\u003e current study) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn conclusion, housing conditions contribute to sex-specific cardiovascular and ventilatory responses to WS. DH conditions alter the cardiomechanical and hemodynamic response to WS to elicit signs of diastolic dysfunction in male and female ApoE (-/-) mice, respectively. Both male and female mice also exhibit alterations in the ventilatory response to WS due to DH, although the response appears to be attenuated in females. Despite this, the cardiovascular changes that were seen from a relatively low PM\u003csub\u003e2.5\u003c/sub\u003e concentration indicate the ability of housing to alter body resiliency against a chemical stressor. Future work should evaluate the disease progression in both males and females to understand if atherosclerotic-progression could have impacted the sex-specific responses, and if housing can mitigate the advancement of the disease. Moreover, a focus on characterizing the stress response to DH and subsequent activation of the hypothalamic-pituitary-adrenal (HPA) axis and autonomic modulation to evaluate allostatic load, or how housing might modify baseline physiology due to chronic stress, might be beneficial in characterizing the role living conditions play in toxicological risk. Regardless, this work points to the ability of depleted housing as a non-chemical stressor to alter cardiovascular and ventilatory responses to an environmental challenge, with data pointing towards separations in these responses based on sex. Evaluating psychosocial stress as possible modifiers of the toxicological response might be important in determining the health and future-risk to chemical and environmental exposures within human populations.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by intramural funding of the Office of Research and Development of the United States Environmental Protection Agency and the Environmental Protection Agency Cooperative Agreement with the University of North Carolina at Chapel Hill (UNC) CR 84033801. The investigation by MF was supported in part by a pre-doctoral traineeship (National Research Service Award T32 ES007126) from the National Institute of Environmental Health Sciences, National Institutes of Health.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank Drs. Yongho Kim and Rebecca Arachevala for their review of this manuscript prior to submission. The authors would also like to thank Dr. Thomas Jackson for statistical help, Dr. Colette Miller for assistance with RT-qPCR, and Wanda Williams for running the chemical analyzer.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis paper has been reviewed and approved for release by the Center for Public Health and Environmental Risk Assessment, U.S. Environmental Protection Agency. Approval does not signify that the contents necessarily reflect the views and policies of the U.S. Environmental Protection Agency, nor does mention of trade names of commercial products constitute as endorsement or recommendation for use.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing financial interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMF - study design, experimentation, analysis, manuscript writing (including all figures)ST - experimentation and analysisKL - experimentation and analysisWO - experimentationTK - exposuresPE - exposures DD - exposuresIG - study supervisionAF - study supervisionMH - study design, experimentation, manuscript review and overall supervision All authors reviewed the manuscript\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data for this study is available via USEPA\u0026apos;s Science Hub\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSims, M., Kershaw, K. N., Breathett, K., Jackson, E. A., Lewis, L. M., Mujahid, M. S., Suglia, S. F., \u0026amp; Suglia (2020). Importance of Housing and Cardiovascular Health and Well-Being: A Scientific Statement From the American Heart Association. \u003cem\u003eCirculation: Cardiovascular Quality and Outcomes\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(8), e000089. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/HCQ.0000000000000089\u003c/span\u003e\u003cspan address=\"10.1161/HCQ.0000000000000089\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLloyd-Jones, D. M., Hong, Y., Labarthe, D., Mozaffarian, D., Appel, L. J., Van Horn, L., Greenlund, K., Daniels, S., Nichol, G., Tomaselli, G. F., Arnett, D. K., Fonarow, G. C., Ho, P. M., Lauer, M. S., Masoudi, F. A., Robertson, R. M., Roger, V., Schwamm, L. H., \u0026amp; Sorlie, P. (2010). Defining and setting national goals for cardiovascular health promotion and disease reduction: The American Heart Association\u0026rsquo;s strategic Impact Goal through 2020 and beyond. \u003cem\u003eCirculation\u003c/em\u003e, \u003cem\u003e121\u003c/em\u003e(4), 586\u0026ndash;613. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/CIRCULATIONAHA.109.192703\u003c/span\u003e\u003cspan address=\"10.1161/CIRCULATIONAHA.109.192703\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. American Heart Association Strategic Planning Task Force and Statistics Committee.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSteptoe, A., \u0026amp; Kivim\u0026auml;ki, M. (2012). Stress and cardiovascular disease. \u003cem\u003eNature Reviews Cardiology\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(6), 360\u0026ndash;370. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrcardio.2012.45\u003c/span\u003e\u003cspan address=\"10.1038/nrcardio.2012.45\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMulle, J. G., \u0026amp; Vaccarino, V. (2013). Cardiovascular Disease, Psychosocial Factors, and Genetics: The Case of Depression. \u003cem\u003eProgress in Cardiovascular Diseases\u003c/em\u003e, \u003cem\u003e55\u003c/em\u003e(6), 557\u0026ndash;562. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pcad.2013.03.005\u003c/span\u003e\u003cspan address=\"10.1016/j.pcad.2013.03.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCelano, C. M., Daunis, D. J., Lokko, H. N., Campbell, K. A., \u0026amp; Huffman, J. C. (2016). Anxiety disorders and cardiovascular disease. \u003cem\u003eCurrent Psychiatry Reports\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e(11), 101. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11920-016-0739-5\u003c/span\u003e\u003cspan address=\"10.1007/s11920-016-0739-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalobardes, B., Smith, G. D., \u0026amp; Lynch, J. W. (2006). Systematic review of the influence of childhood socioeconomic circumstances on risk for cardiovascular disease in adulthood. \u003cem\u003eAnnals of Epidemiology\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(2), 91\u0026ndash;104. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.annepidem.2005.06.053\u003c/span\u003e\u003cspan address=\"10.1016/j.annepidem.2005.06.053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCurl, C. L., Beresford, S. A. A., Hajat, A., Kaufman, J. D., Moore, K., Nettleton, J. A., \u0026amp; Diez-Roux, A. V. (2013). Associations of Organic Produce Consumption with Socioeconomic Status and the Local Food Environment: Multi-Ethnic Study of Atherosclerosis (MESA). \u003cem\u003ePLOS ONE\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(7), e69778. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0069778\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0069778\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoore, L. V., Roux, D., Nettleton, A. V., J. A., \u0026amp; Jacobs, D. R. (2008). Associations of the local food environment with diet quality\u0026ndash;a comparison of assessments based on surveys and geographic information systems: The multi-ethnic study of atherosclerosis. \u003cem\u003eAmerican Journal of Epidemiology\u003c/em\u003e, \u003cem\u003e167\u003c/em\u003e(8), 917\u0026ndash;924. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/aje/kwm394\u003c/span\u003e\u003cspan address=\"10.1093/aje/kwm394\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHirsch, J. A., Moore, K. A., Evenson, K. R., Rodriguez, D. A., \u0026amp; Diez Roux, A. V. (2013). Walk Score\u0026reg; and Transit Score\u0026reg; and walking in the multi-ethnic study of atherosclerosis. \u003cem\u003eAmerican Journal of Preventive Medicine\u003c/em\u003e, \u003cem\u003e45\u003c/em\u003e(2), 158\u0026ndash;166. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.amepre.2013.03.018\u003c/span\u003e\u003cspan address=\"10.1016/j.amepre.2013.03.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodr\u0026iacute;guez, D. A., Evenson, K. R., Roux, D., A. V., \u0026amp; Brines, S. J. (2009). Land Use, Residential Density, and Walking. \u003cem\u003eAmerican Journal of Preventive Medicine\u003c/em\u003e, \u003cem\u003e37\u003c/em\u003e(5), 397\u0026ndash;404. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.amepre.2009.07.008\u003c/span\u003e\u003cspan address=\"10.1016/j.amepre.2009.07.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBillings, M. E., Johnson, D. A., Simonelli, G., Moore, K., Patel, S. R., Roux, D., A. V., \u0026amp; Redline, S. (2016). Neighborhood Walking Environment and Activity Level Are Associated With OSA: The Multi-Ethnic Study of Atherosclerosis. \u003cem\u003eChest\u003c/em\u003e, \u003cem\u003e150\u003c/em\u003e(5), 1042\u0026ndash;1049. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.chest.2016.06.012\u003c/span\u003e\u003cspan address=\"10.1016/j.chest.2016.06.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson, D. A., Simonelli, G., Moore, K., Billings, M., Mujahid, M. S., Rueschman, M., Kawachi, I., Redline, S., Roux, D., A. V., \u0026amp; Patel, S. R. (2017). The Neighborhood Social Environment and Objective Measures of Sleep in the Multi-Ethnic Study of Atherosclerosis. \u003cem\u003eSleep\u003c/em\u003e, \u003cem\u003e40\u003c/em\u003e(1), zsw016. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/sleep/zsw016\u003c/span\u003e\u003cspan address=\"10.1093/sleep/zsw016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiez Roux, A. V., Mujahid, M. S., Hirsch, J. A., Moore, K., \u0026amp; Moore, L. V. (2016). The impact of neighborhoods on cardiovascular risk: The MESA Neighborhood Study. \u003cem\u003eGlobal Heart\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(3), 353\u0026ndash;363. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.gheart.2016.08.002\u003c/span\u003e\u003cspan address=\"10.1016/j.gheart.2016.08.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRappold, A. G., Cascio, W. E., Kilaru, V. J., Stone, S. L., Neas, L. M., Devlin, R. B., \u0026amp; Diaz-Sanchez, D. (2012). Cardio-respiratory outcomes associated with exposure to wildfire smoke are modified by measures of community health. \u003cem\u003eEnvironmental Health\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(1), 71. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1476-069X-11-71\u003c/span\u003e\u003cspan address=\"10.1186/1476-069X-11-71\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJbaily, A., Zhou, X., Liu, J., Lee, T. H., Kamareddine, L., Verguet, S., \u0026amp; Dominici, F. (2022). Air pollution exposure disparities across US population and income groups. \u003cem\u003eNature\u003c/em\u003e, \u003cem\u003e601\u003c/em\u003e(7892), 228\u0026ndash;233. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41586-021-04190-y\u003c/span\u003e\u003cspan address=\"10.1038/s41586-021-04190-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeilkop, S. K., Campen, M. J., Lund, A. K., McDonald, J. D., \u0026amp; Mauderly, J. L. (2012). Identification of chemical components of combustion emissions that affect pro-atherosclerotic vascular responses in mice. \u003cem\u003eInhalation Toxicology\u003c/em\u003e, \u003cem\u003e24\u003c/em\u003e(5), 270\u0026ndash;287. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3109/08958378.2012.667455\u003c/span\u003e\u003cspan address=\"10.3109/08958378.2012.667455\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePainschab, M. S., Davila-Roman, V. G., Gilman, R. H., Vasquez-Villar, A. D., Pollard, S. L., Wise, R. A., Miranda, J. J., Checkley, W., \u0026amp; CRONICAS Cohort Study Group. (2013). Chronic exposure to biomass fuel is associated with increased carotid artery intima-media thickness and a higher prevalence of atherosclerotic plaque. \u003cem\u003eHeart (British Cardiac Society)\u003c/em\u003e, \u003cem\u003e99\u003c/em\u003e(14), 984\u0026ndash;991. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1136/heartjnl-2012-303440\u003c/span\u003e\u003cspan address=\"10.1136/heartjnl-2012-303440\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBevan, G. H., Al-Kindi, S. G., Brook, R. D., M\u0026uuml;nzel, T., \u0026amp; Rajagopalan, S. (2021). Ambient Air Pollution and Atherosclerosis. \u003cem\u003eArteriosclerosis Thrombosis and Vascular Biology\u003c/em\u003e, \u003cem\u003e41\u003c/em\u003e(2), 628\u0026ndash;637. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/ATVBAHA.120.315219\u003c/span\u003e\u003cspan address=\"10.1161/ATVBAHA.120.315219\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrant, E., \u0026amp; Runkle, J. D. (2022). Long-term health effects of wildfire exposure: A scoping review. \u003cem\u003eThe Journal of Climate Change and Health\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e, 100110. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.joclim.2021.100110\u003c/span\u003e\u003cspan address=\"10.1016/j.joclim.2021.100110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaltsas, G. A., \u0026amp; Chrousos, G. P. (2007). The neuroendocrinology of stress. In \u003cem\u003eHandbook of psychophysiology, 3rd ed\u003c/em\u003e (pp. 303\u0026ndash;318). Cambridge University Press. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/CBO9780511546396.013\u003c/span\u003e\u003cspan address=\"10.1017/CBO9780511546396.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHazari, M. S., Stratford, K. M., Krantz, Q. T., King, C., Krug, J., Farraj, A. K., \u0026amp; Gilmour, M. I. (2018). Comparative Cardiopulmonary Effects of Particulate Matter- And Ozone-Enhanced Smog Atmospheres in Mice. \u003cem\u003eEnvironmental Science \u0026amp; Technology\u003c/em\u003e, \u003cem\u003e52\u003c/em\u003e(5), 3071\u0026ndash;3080. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acs.est.7b04880\u003c/span\u003e\u003cspan address=\"10.1021/acs.est.7b04880\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurhanewicz, N., McIntosh-Kastrinsky, R., Tong, H., Ledbetter, A., Walsh, L., Farraj, A., \u0026amp; Hazari, M. (2017). TRPA1 mediates changes in heart rate variability and cardiac mechanical function in mice exposed to acrolein. \u003cem\u003eToxicology and Applied Pharmacology\u003c/em\u003e, \u003cem\u003e324\u003c/em\u003e, 51\u0026ndash;60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.taap.2016.10.008\u003c/span\u003e\u003cspan address=\"10.1016/j.taap.2016.10.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThompson, L. C., Walsh, L., Martin, B. L., McGee, J., Wood, C., Kovalcik, K., Pancras, J. P., Haykal-Coates, N., Ledbetter, A. D., Davies, D., Cascio, W. E., Higuchi, M., Hazari, M. S., \u0026amp; Farraj, A. K. (2019). Ambient Particulate Matter and Acrolein Co-Exposure Increases Myocardial Dyssynchrony in Mice via TRPA1. \u003cem\u003eToxicological Sciences\u003c/em\u003e, \u003cem\u003e167\u003c/em\u003e(2), 559\u0026ndash;572. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/toxsci/kfy262\u003c/span\u003e\u003cspan address=\"10.1093/toxsci/kfy262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLawson, D. M., Churchill, M., \u0026amp; Churchill, P. C. (2000). The effects of housing enrichment on cardiovascular parameters in spontaneously hypertensive rats. \u003cem\u003eContemporary Topics in Laboratory Animal Science\u003c/em\u003e, \u003cem\u003e39\u003c/em\u003e(1), 9\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuilarte, T. R., Toscano, C. D., McGlothan, J. L., \u0026amp; Weaver, S. A. (2003). Environmental enrichment reverses cognitive and molecular deficits induced by developmental lead exposure. \u003cem\u003eAnnals of Neurology\u003c/em\u003e, \u003cem\u003e53\u003c/em\u003e(1), 50\u0026ndash;56. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ana.10399\u003c/span\u003e\u003cspan address=\"10.1002/ana.10399\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider, T., Turczak, J., \u0026amp; Przewłocki, R. (2006). Environmental Enrichment Reverses Behavioral Alterations in Rats Prenatally Exposed to Valproic Acid: Issues for a Therapeutic Approach in Autism. \u003cem\u003eNeuropsychopharmacology : Official Publication Of The American College Of Neuropsychopharmacology\u003c/em\u003e, \u003cem\u003e31\u003c/em\u003e(1), 36\u0026ndash;46. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/sj.npp.1300767\u003c/span\u003e\u003cspan address=\"10.1038/sj.npp.1300767\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarmon, M. E., Fiamingo, M., Toler, S., Lee, K., Kim, Y., Martin, B., Gilmour, I., Farraj, A. K., \u0026amp; Hazari, M. S. (2024). \u003cem\u003eThe effect of enriched versus depleted housing on eucalyptus smoke-induced cardiovascular dysfunction in mice\u003c/em\u003e (p. 2024.02.26.582161). bioRxiv. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/2024.02.26.582161\u003c/span\u003e\u003cspan address=\"10.1101/2024.02.26.582161\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, Y. H., King, C., Krantz, T., Hargrove, M. M., George, I. J., McGee, J., Copeland, L., Hays, M. D., Landis, M. S., Higuchi, M., Gavett, S. H., \u0026amp; Gilmour, M. I. (2019). The role of fuel type and combustion phase on the toxicity of biomass smoke following inhalation exposure in mice. \u003cem\u003eArchives of Toxicology\u003c/em\u003e, \u003cem\u003e93\u003c/em\u003e(6), 1501\u0026ndash;1513. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00204-019-02450-5\u003c/span\u003e\u003cspan address=\"10.1007/s00204-019-02450-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, Y. H., Vance, S. A., Aurell, J., Holder, A. L., Pancras, J. P., Gullett, B., Gavett, S. H., McNesby, K. L., \u0026amp; Gilmour, M. I. (2022). Chemistry and lung toxicity of particulate matter emitted from firearms. \u003cem\u003eScientific Reports\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003eArticle 1. https://doi.org/10.1038/s41598-022-24856-5\u003c/span\u003e\u003cspan address=\"Article 1. 10.1038/s41598-022-24856-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin, B. L., Thompson, L. C., Kim, Y., Williams, W., Snow, S. J., Schladweiler, M. C., Phillips, P., King, C., Richards, J., Haykal-Coates, N., Higuchi, M., Ian Gilmour, M., Kodavanti, U. P., Hazari, M. S., \u0026amp; Farraj, A. K. (2018). Acute peat smoke inhalation sensitizes rats to the postprandial cardiometabolic effects of a high fat oral load. \u003cem\u003eThe Science of the Total Environment\u003c/em\u003e, \u003cem\u003e643\u003c/em\u003e, 378\u0026ndash;391. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.scitotenv.2018.06.089\u003c/span\u003e\u003cspan address=\"10.1016/j.scitotenv.2018.06.089\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHadley, M. B., Henderson, S. B., Brauer, M., \u0026amp; Vedanthan, R. (2022). Protecting Cardiovascular Health From Wildfire Smoke. \u003cem\u003eCirculation\u003c/em\u003e, \u003cem\u003e146\u003c/em\u003e(10), 788\u0026ndash;801. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/CIRCULATIONAHA.121.058058\u003c/span\u003e\u003cspan address=\"10.1161/CIRCULATIONAHA.121.058058\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshibashi, S., Brown, M. S., Goldstein, J. L., Gerard, R. D., Hammer, R. E., \u0026amp; Herz, J. (1993). Hypercholesterolemia in low density lipoprotein receptor knockout mice and its reversal by adenovirus-mediated gene delivery. \u003cem\u003eThe Journal of Clinical Investigation\u003c/em\u003e, \u003cem\u003e92\u003c/em\u003e(2), 883\u0026ndash;893. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1172/JCI116663\u003c/span\u003e\u003cspan address=\"10.1172/JCI116663\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, S. H., Reddick, R. L., Piedrahita, J. A., \u0026amp; Maeda, N. (1992). Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. \u003cem\u003eScience (New York N Y)\u003c/em\u003e, \u003cem\u003e258\u003c/em\u003e(5081), 468\u0026ndash;471. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1411543\u003c/span\u003e\u003cspan address=\"10.1126/science.1411543\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReddick, R. L., Zhang, S. H., \u0026amp; Maeda, N. (1994). Atherosclerosis in mice lacking apo E. Evaluation of lesional development and progression. \u003cem\u003eArteriosclerosis and Thrombosis: A Journal of Vascular Biology\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(1), 141\u0026ndash;147. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/01.atv.14.1.141\u003c/span\u003e\u003cspan address=\"10.1161/01.atv.14.1.141\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun, Q., Wang, A., Jin, X., Natanzon, A., Duquaine, D., Brook, R. D., Aguinaldo, J. G. S., Fayad, Z. A., Fuster, V., Lippmann, M., Chen, L. C., \u0026amp; Rajagopalan, S. (2005). Long-term Air Pollution Exposure and Acceleration of Atherosclerosis and Vascular Inflammation in an Animal Model. \u003cem\u003eJournal Of The American Medical Association\u003c/em\u003e, \u003cem\u003e294\u003c/em\u003e(23), 3003\u0026ndash;3010. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1001/jama.294.23.3003\u003c/span\u003e\u003cspan address=\"10.1001/jama.294.23.3003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, H., Samet, J. M., Bromberg, P. A., \u0026amp; Tong, H. (2021). Cardiovascular health impacts of wildfire smoke exposure. \u003cem\u003eParticle and Fibre Toxicology\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e(1), 2. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12989-020-00394-8\u003c/span\u003e\u003cspan address=\"10.1186/s12989-020-00394-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePagliaro, B. R., Cannata, F., Stefanini, G. G., \u0026amp; Bolognese, L. (2020). Myocardial ischemia and coronary disease in heart failure. \u003cem\u003eHeart Failure Reviews\u003c/em\u003e, \u003cem\u003e25\u003c/em\u003e(1), 53\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10741-019-09831-z\u003c/span\u003e\u003cspan address=\"10.1007/s10741-019-09831-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZanobetti, A., Schwartz, J., Samoli, E., Gryparis, A., Touloumi, G., Peacock, J., Anderson, R. H., Tertre, L., Bobros, A., Celko, J., Goren, M., Forsberg, A., Michelozzi, B., Rabczenko, P., Hoyos, D., Wichmann, S. P., H. E., \u0026amp; Katsouyanni, K. (2003). The temporal pattern of respiratory and heart disease mortality in response to air pollution. \u003cem\u003eEnvironmental Health Perspectives\u003c/em\u003e, \u003cem\u003e111\u003c/em\u003e(9), 1188\u0026ndash;1193. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1289/ehp.5712\u003c/span\u003e\u003cspan address=\"10.1289/ehp.5712\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSnow, S. J., Henriquez, A. R., Costa, D. L., \u0026amp; Kodavanti, U. P. (2018). Neuroendocrine Regulation of Air Pollution Health Effects: Emerging Insights. \u003cem\u003eToxicological Sciences\u003c/em\u003e, \u003cem\u003e164\u003c/em\u003e(1), 9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/toxsci/kfy129\u003c/span\u003e\u003cspan address=\"10.1093/toxsci/kfy129\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomson, E. M. (2019). Air Pollution, Stress, and Allostatic Load: Linking Systemic and Central Nervous System Impacts. \u003cem\u003eJournal of Alzheimer\u0026rsquo;s Disease\u003c/em\u003e, \u003cem\u003e69\u003c/em\u003e(3), 597\u0026ndash;614. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3233/JAD-190015\u003c/span\u003e\u003cspan address=\"10.3233/JAD-190015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaCombe, P., Tariq, M. A., \u0026amp; Lappin, S. L. (2023). Physiology, Afterload Reduction. In \u003cem\u003eStatPearls\u003c/em\u003e. StatPearls Publishing. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/books/NBK493174/\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/books/NBK493174/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYing, Z., Xie, X., Bai, Y., Chen, M., Wang, X., Zhang, X., Morishita, M., Sun, Q., \u0026amp; Rajagopalan, S. (2015). Exposure to concentrated ambient particulate matter induces reversible increase of heart weight in spontaneously hypertensive rats. \u003cem\u003eParticle and Fibre Toxicology\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e, 15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12989-015-0092-6\u003c/span\u003e\u003cspan address=\"10.1186/s12989-015-0092-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagueh, S. F., Smiseth, O. A., Appleton, C. P., Byrd, B. F., Dokainish, H., Edvardsen, T., Flachskampf, F. A., Gillebert, T. C., Klein, A. L., Lancellotti, P., Marino, P., Oh, J. K., Popescu, B. A., \u0026amp; Waggoner, A. D. (2016). Recommendations for the Evaluation of Left Ventricular Diastolic Function by Echocardiography: An Update from the American Society of Echocardiography and the European Association of Cardiovascular Imaging. \u003cem\u003eJournal of the American Society of Echocardiography: Official Publication of the American Society of Echocardiography\u003c/em\u003e, \u003cem\u003e29\u003c/em\u003e(4), 277\u0026ndash;314. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.echo.2016.01.011\u003c/span\u003e\u003cspan address=\"10.1016/j.echo.2016.01.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarjai, K. J., Scott, L., Vivekananthan, K., Nunez, E., \u0026amp; Edupuganti, R. (2002). The Tei index: A new prognostic index for patients with symptomatic heart failure. \u003cem\u003eJournal of the American Society of Echocardiography: Official Publication of the American Society of Echocardiography\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(9), 864\u0026ndash;868. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1067/mje.2002.120892\u003c/span\u003e\u003cspan address=\"10.1067/mje.2002.120892\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruch, C., Schmermund, A., Marin, D., Katz, M., Bartel, T., Schaar, J., \u0026amp; Erbel, R. (2000). Tei-index in patients with mild-to-moderate congestive heart failure. \u003cem\u003eEuropean Heart Journal\u003c/em\u003e, \u003cem\u003e21\u003c/em\u003e(22), 1888\u0026ndash;1895. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1053/euhj.2000.2246\u003c/span\u003e\u003cspan address=\"10.1053/euhj.2000.2246\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNearchou, N. S., Tsakiris, A. K., Tsitsirikos, M. D., Karatzis, E. N., Lolaka, M. D., Flessa, K. D., Bogiatzis, D. T., \u0026amp; Skoufas, P. D. (2005). Tei index as a method of evaluating left ventricular diastolic dysfunction in acute myocardial infarction. \u003cem\u003eHellenic Journal of Cardiology: HJC\u0026thinsp;=\u0026thinsp;Hellenike Kardiologike Epitheorese\u003c/em\u003e, \u003cem\u003e46\u003c/em\u003e(1), 35\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEliakim-Raz, N., Prokupetz, A., Gordon, B., Shochat, T., \u0026amp; Grossman, A. (2015). Interventricular Septum and Posterior Wall Thickness Are Associated With Higher Systolic Blood Pressure. \u003cem\u003eThe Journal of Clinical Hypertension\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e(7), 703\u0026ndash;706. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jch.12738\u003c/span\u003e\u003cspan address=\"10.1111/jch.12738\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcFarland, T. M., Alam, M., Goldstein, S., Pickard, S. D., \u0026amp; Stein, P. D. (1978). Echocardiographic diagnosis of left ventricular hypertrophy. \u003cem\u003eCirculation\u003c/em\u003e, \u003cem\u003e57\u003c/em\u003e(6), 1140\u0026ndash;1144. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/01.cir.57.6.1140\u003c/span\u003e\u003cspan address=\"10.1161/01.cir.57.6.1140\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarek, I., Canu, M., Cordasic, N., Rauh, M., Volkert, G., Fahlbusch, F. B., Rascher, W., Hilgers, K. F., Hartner, A., \u0026amp; Menendez-Castro, C. (2017). Sex differences in the development of vascular and renal lesions in mice with a simultaneous deficiency of Apoe and the integrin chain Itga8. \u003cem\u003eBiology of Sex Differences\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e, 19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13293-017-0141-y\u003c/span\u003e\u003cspan address=\"10.1186/s13293-017-0141-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, G., Sun, B., Yu, L., Chen, J., Han, B., Li, Y., \u0026amp; Chen, J. (2020). \u003cem\u003eThe Gender-Based Differences in Vulnerability to Ambient Air Pollution and Cerebrovascular Disease Mortality: Evidences Based on 26781 Deaths\u003c/em\u003e (1). \u003cem\u003e15\u003c/em\u003e(1), Article 1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5334/gh.849\u003c/span\u003e\u003cspan address=\"10.5334/gh.849\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, J., Wang, X., Yan, M., Shan, A., Wang, C., Yang, X., \u0026amp; Tang, N. (2022). Sex Differences in Cardiovascular Risk Associated With Long-Term PM2.5 Exposure: A Systematic Review and Meta-Analysis of Cohort Studies. \u003cem\u003eFrontiers in Public Health\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, 802167. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpubh.2022.802167\u003c/span\u003e\u003cspan address=\"10.3389/fpubh.2022.802167\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKadmiel, M., \u0026amp; Cidlowski, J. A. (2013). Glucocorticoid receptor signaling in health and disease. \u003cem\u003eTrends in Pharmacological Sciences\u003c/em\u003e, \u003cem\u003e34\u003c/em\u003e(9), 518\u0026ndash;530. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tips.2013.07.003\u003c/span\u003e\u003cspan address=\"10.1016/j.tips.2013.07.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao, B., Meng, L., Hao, M., Zhang, Y., Gong, T., \u0026amp; Guo, Z. (2019). Chronic stress: A critical risk factor for atherosclerosis. \u003cem\u003eThe Journal of International Medical Research\u003c/em\u003e, \u003cem\u003e47\u003c/em\u003e(4), 1429\u0026ndash;1440. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/0300060519826820\u003c/span\u003e\u003cspan address=\"10.1177/0300060519826820\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnni, N. S., Jung, S. J., Shim, J. S., Jeon, Y. W., Lee, G. B., \u0026amp; Kim, H. C. (2021). Stressful life events and serum triglyceride levels: The Cardiovascular and Metabolic Diseases Etiology Research Center cohort in Korea. \u003cem\u003eEpidemiology and Health\u003c/em\u003e, \u003cem\u003e43\u003c/em\u003e, e2021042. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4178/epih.e2021042\u003c/span\u003e\u003cspan address=\"10.4178/epih.e2021042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAssadi, S. N. (2017). What are the effects of psychological stress and physical work on blood lipid profiles? \u003cem\u003eMedicine\u003c/em\u003e, \u003cem\u003e96\u003c/em\u003e(18), e6816. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/MD.0000000000006816\u003c/span\u003e\u003cspan address=\"10.1097/MD.0000000000006816\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrindley, D. N., \u0026amp; Rolland, Y. (1989). Possible connections between stress, diabetes, obesity, hypertension and altered lipoprotein metabolism that may result in atherosclerosis. \u003cem\u003eClinical Science (London England: 1979)\u003c/em\u003e, \u003cem\u003e77\u003c/em\u003e(5), 453\u0026ndash;461. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1042/cs0770453\u003c/span\u003e\u003cspan address=\"10.1042/cs0770453\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLino, D. O. C., Freitas, I. A., Meneses, G. C., Martins, A. M. C., Daher, E. F., Rocha, J. H. C., \u0026amp; Silva, G. B. (2019). Interleukin-6 and adhesion molecules VCAM-1 and ICAM-1 as biomarkers of post-acute myocardial infarction heart failure. \u003cem\u003eBrazilian Journal of Medical and Biological Research\u003c/em\u003e, \u003cem\u003e52\u003c/em\u003e(12), e8658. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1590/1414-431X20198658\u003c/span\u003e\u003cspan address=\"10.1590/1414-431X20198658\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTzoulaki, I., Murray, G. D., Lee, A. J., Rumley, A., Lowe, G. D. O., \u0026amp; Fowkes, F. G. R. (2005). C-reactive protein, interleukin-6, and soluble adhesion molecules as predictors of progressive peripheral atherosclerosis in the general population: Edinburgh Artery Study. \u003cem\u003eCirculation\u003c/em\u003e, \u003cem\u003e112\u003c/em\u003e(7), 976\u0026ndash;983. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/CIRCULATIONAHA.104.513085\u003c/span\u003e\u003cspan address=\"10.1161/CIRCULATIONAHA.104.513085\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBernberg, E., Ulleryd, M. A., Johansson, M. E., \u0026amp; Bergstr\u0026ouml;m, G. M. L. (2012). Social disruption stress increases IL-6 levels and accelerates atherosclerosis in ApoE\u0026ndash;/\u0026ndash; mice. \u003cem\u003eAtherosclerosis\u003c/em\u003e, \u003cem\u003e221\u003c/em\u003e(2), 359\u0026ndash;365. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.atherosclerosis.2011.11.041\u003c/span\u003e\u003cspan address=\"10.1016/j.atherosclerosis.2011.11.041\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong, Y., Li, G., Zhang, W., Hua, X., Zhou, C., Xu, T., Li, Z., Wang, P., \u0026amp; Miao, C. (2019). Nicotinamide phosphoribosyltransferase aggravates inflammation and promotes atherosclerosis in ApoE knockout mice. \u003cem\u003eActa Pharmacologica Sinica\u003c/em\u003e, \u003cem\u003e40\u003c/em\u003e(9), 1184\u0026ndash;1192. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41401-018-0207-3\u003c/span\u003e\u003cspan address=\"10.1038/s41401-018-0207-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, S., Wang, C., Li, K., Li, L., Tian, M., Xie, J., Yang, M., Jia, Y., He, J., Gao, L., Boden, G., Liu, H., \u0026amp; Yang, G. (2016). NAMPT knockdown attenuates atherosclerosis and promotes reverse cholesterol transport in ApoE KO mice with high-fat-induced insulin resistance. \u003cem\u003eScientific Reports\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003eArticle 1. https://doi.org/10.1038/srep26746\u003c/span\u003e\u003cspan address=\"Article 1. 10.1038/srep26746\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlack, C., Tesfaigzi, Y., Bassein, J. A., \u0026amp; Miller, L. A. (2017). Wildfire smoke exposure and human health: Significant gaps in research for a growing public health issue. \u003cem\u003eEnvironmental Toxicology and Pharmacology\u003c/em\u003e, \u003cem\u003e55\u003c/em\u003e, 186\u0026ndash;195. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.etap.2017.08.022\u003c/span\u003e\u003cspan address=\"10.1016/j.etap.2017.08.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDhingra, R., Keeler, C., Staley, B. S., Jardel, H. V., Ward-Caviness, C., Rebuli, M. E., Xi, Y., Rappazzo, K., Hernandez, M., Chelminski, A. N., Jaspers, I., \u0026amp; Rappold, A. G. (2023). Wildfire smoke exposure and early childhood respiratory health: A study of prescription claims data. \u003cem\u003eEnvironmental Health\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(1), 48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12940-023-00998-5\u003c/span\u003e\u003cspan address=\"10.1186/s12940-023-00998-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHutchinson, J. A., Vargo, J., Milet, M., French, N. H. F., Billmire, M., Johnson, J., \u0026amp; Hoshiko, S. (2018). presentations, inpatient hospitalizations, and outpatient visits: An observational study of smoke exposure periods and a bidirectional case-crossover analysis. \u003cem\u003ePLOS Medicine\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(7), e1002601. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pmed.1002601\u003c/span\u003e\u003cspan address=\"10.1371/journal.pmed.1002601\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. The San Diego 2007 wildfires and Medi-Cal emergency department.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHargrove, M. M., Kim, Y. H., King, C., Wood, C. E., Gilmour, M. I., Dye, J. A., \u0026amp; Gavett, S. H. (2019). Smoldering and flaming biomass wood smoke inhibit respiratory responses in mice. \u003cem\u003eInhalation Toxicology\u003c/em\u003e, \u003cem\u003e31\u003c/em\u003e(6), 236\u0026ndash;247. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/08958378.2019.1654046\u003c/span\u003e\u003cspan address=\"10.1080/08958378.2019.1654046\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurhanewicz, N., Ledbetter, A., Farraj, A., \u0026amp; Hazari, M. (2018). TRPA1 mediates the cardiac effects of acrolein through parasympathetic dominance but also sympathetic modulation in mice. \u003cem\u003eToxicology and Applied Pharmacology\u003c/em\u003e, \u003cem\u003e347\u003c/em\u003e, 104\u0026ndash;114. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.taap.2018.03.027\u003c/span\u003e\u003cspan address=\"10.1016/j.taap.2018.03.027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlarie, Y. (1973). Sensory irritation of the upper airways by airborne chemicals. \u003cem\u003eToxicology and Applied Pharmacology\u003c/em\u003e, \u003cem\u003e24\u003c/em\u003e(2), 279\u0026ndash;297. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0041-008X(73)90148-8\u003c/span\u003e\u003cspan address=\"10.1016/0041-008X(73)90148-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWillis, D. N., Liu, B., Ha, M. A., Jordt, S. E., \u0026amp; Morris, J. B. (2011). Menthol attenuates respiratory irritation responses to multiple cigarette smoke irritants. \u003cem\u003eThe FASEB Journal\u003c/em\u003e, \u003cem\u003e25\u003c/em\u003e(12), 4434\u0026ndash;4444. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1096/fj.11-188383\u003c/span\u003e\u003cspan address=\"10.1096/fj.11-188383\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOyola, M. G., \u0026amp; Handa, R. J. (2017). Hypothalamic\u0026ndash;pituitary\u0026ndash;adrenal and hypothalamic\u0026ndash;pituitary\u0026ndash;gonadal axes: Sex differences in regulation of stress responsivity. \u003cem\u003eStress (Amsterdam, Netherlands)\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(5), 476\u0026ndash;494. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/10253890.2017.1369523\u003c/span\u003e\u003cspan address=\"10.1080/10253890.2017.1369523\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 2 and 3 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cardiovascular-toxicology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cato","sideBox":"Learn more about [Cardiovascular Toxicology](http://link.springer.com/journal/12012)","snPcode":"12012","submissionUrl":"https://submission.nature.com/new-submission/12012/3","title":"Cardiovascular Toxicology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Housing, wildfires, resiliency, cardiovascular, atherosclerosis","lastPublishedDoi":"10.21203/rs.3.rs-4237383/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4237383/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAlthough it is well established that wildfire smoke exposure can increase cardiovascular morbidity and mortality, the combined effects of non-chemical stressors and wildfire smoke remains understudied. Housing is a non-chemical stressor that is a major determinant of cardiovascular health, however, disparities in neighborhood and social status have exacerbated the cardiovascular health gaps within the United States. Further, pre-existing cardiovascular morbidities, such as atherosclerosis, can worsen the response to wildfire smoke exposures. This represents a potentially hazardous interaction between inadequate housing and stress, cardiovascular morbidities, and worsened responses to wildfire smoke exposures. The purpose of this study was to examine the effects of enriched (EH) versus depleted (DH) housing on pulmonary and cardiovascular responses to a single flaming eucalyptus wildfire smoke (WS) exposure in male and female apolipoprotein E (ApoE) knockout mice, which develop an atherosclerosis-like phenotype. The results of this study show that cardiopulmonary responses to WS exposure occur in a sex-specific manner. EH blunts adverse WS-induced ventilatory responses, specifically an increase in tidal volume (TV), expiratory time (Te), and relaxation time (RT) after a WS exposure, but only in females. EH also blunted a WS-induced increase in isovolumic relaxation time (IVRT) and the myocardial performance index (MPI) 1-wk after exposures, also only in females. Our results suggest that housing alters the cardiovascular response to a single WS exposure, and that DH might cause increased susceptibility to environmental exposures that manifest in altered ventilation patterns and diastolic dysfunction in a sex-specific manner.\u003c/p\u003e","manuscriptTitle":"Depleted housing elicits cardiopulmonary dysfunction after a single flaming eucalyptus wildfire smoke exposure in a sex-specific manner in ApoE knockout mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-12 11:46:07","doi":"10.21203/rs.3.rs-4237383/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-06-23T15:06:14+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-23T01:50:16+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"6da62633-1714-42f4-bf47-bcfc54b77c36","date":"2024-04-20T15:26:31+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-04-15T19:21:26+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-10T19:11:17+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-09T14:42:54+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cardiovascular Toxicology","date":"2024-04-08T15:05:11+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cardiovascular-toxicology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cato","sideBox":"Learn more about [Cardiovascular Toxicology](http://link.springer.com/journal/12012)","snPcode":"12012","submissionUrl":"https://submission.nature.com/new-submission/12012/3","title":"Cardiovascular Toxicology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"9dc39ab6-6e6c-438a-8831-711fbb4c7321","owner":[],"postedDate":"April 12th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-01T17:08:01+00:00","versionOfRecord":{"articleIdentity":"rs-4237383","link":"https://doi.org/10.1007/s12012-024-09897-8","journal":{"identity":"cardiovascular-toxicology","isVorOnly":false,"title":"Cardiovascular Toxicology"},"publishedOn":"2024-07-24 16:15:48","publishedOnDateReadable":"July 24th, 2024"},"versionCreatedAt":"2024-04-12 11:46:07","video":"","vorDoi":"10.1007/s12012-024-09897-8","vorDoiUrl":"https://doi.org/10.1007/s12012-024-09897-8","workflowStages":[]},"version":"v1","identity":"rs-4237383","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4237383","identity":"rs-4237383","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}