Hematological alterations associated with the SNV rs10974944, part of the 46/1 haplotype, in patients from the Brazilian Amazon with BCR::ABL1-negative myeloproliferative neoplasms

preprint OA: closed
Full text JSON View at publisher

Abstract

BCR::ABL1-negative myeloproliferative neoplasms are hematopoietic disorders characterized by panmyelosis. JAK2 V617F is a frequent variant in these diseases and often occurs in the 46/1 haplotype. The G allele of rs10974944 has been shown to be associated with this variant, specifically its acquisition, correlations with familial cases, and laboratory alterations. This study evaluated the association between the 46/1 haplotype of JAK2 in patients with myeloproliferative neoplasms in a population from the Brazilian Amazon. Clinical, laboratory and molecular sequencing analyses were considered. Carriers of the G allele of rs10974944 with polycythemia vera showed an increase in mean corpuscular volume and mean corpuscular hemoglobin, while in those with essential thrombocythemia, there was an elevation in red blood cells, hematocrit, and hemoglobin. Associations were observed between rs10974944 and the JAK2 V617F , in which the G allele (OR: 3.47; p < 0.0001), CG genotype (OR: 8.4; p = 0.002), and GG genotype (OR: 4.1; p = 0.002) were associated with JAK2 V617F + and an increase in variant allele frequency (GG: OR 13.1; p = 0.004; G: OR: 6.0; p = 0.0002). These results suggest an association between rs10974944 (G) and a status for JAK2 V617F , JAK2 V617F +_VAF ≥50%, and laboratory alterations in the erythroid lineage.
Full text 142,002 characters · extracted from preprint-html · click to expand
Hematological alterations associated with the SNV rs10974944, part of the 46/1 haplotype, in patients from the Brazilian Amazon with BCR::ABL1-negative myeloproliferative neoplasms | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Hematological alterations associated with the SNV rs10974944, part of the 46/1 haplotype, in patients from the Brazilian Amazon with BCR::ABL1-negative myeloproliferative neoplasms Jhemerson F. Paes, Dania G. Torres, Deborah C. Aquino, Emanuela V. B. Alves, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3880113/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract BCR::ABL1-negative myeloproliferative neoplasms are hematopoietic disorders characterized by panmyelosis. JAK2 V617F is a frequent variant in these diseases and often occurs in the 46/1 haplotype. The G allele of rs10974944 has been shown to be associated with this variant, specifically its acquisition, correlations with familial cases, and laboratory alterations. This study evaluated the association between the 46/1 haplotype of JAK2 in patients with myeloproliferative neoplasms in a population from the Brazilian Amazon. Clinical, laboratory and molecular sequencing analyses were considered. Carriers of the G allele of rs10974944 with polycythemia vera showed an increase in mean corpuscular volume and mean corpuscular hemoglobin, while in those with essential thrombocythemia, there was an elevation in red blood cells, hematocrit, and hemoglobin. Associations were observed between rs10974944 and the JAK2 V617F , in which the G allele (OR: 3.47; p < 0.0001), CG genotype (OR: 8.4; p = 0.002), and GG genotype (OR: 4.1; p = 0.002) were associated with JAK2 V617F + and an increase in variant allele frequency (GG: OR 13.1; p = 0.004; G: OR: 6.0; p = 0.0002). These results suggest an association between rs10974944 (G) and a status for JAK2 V617F , JAK2 V617F +_VAF ≥50%, and laboratory alterations in the erythroid lineage. Biological sciences/Cancer/Haematological cancer/Myeloproliferative disease Biological sciences/Genetics Figures Figure 1 Figure 2 Figure 3 Introduction Myeloproliferative neoplasms (MPNs) are clonal diseases characterized by hyperplasia of the myeloid lineage with effective maturation, which results in leukocytosis in peripheral blood, increased erythrocyte mass and possible progression to medullary fibrosis or leukemic transformation 1 . They have an incidence rate of 6 cases per 100,000 individuals and mostly affect white males between 60 and 70 years of age 2 . Polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (MF) are the most common BCR::ABL1- negative MPNs, though differ in signs, symptoms, hematological and clinical alterations, and genetic findings 3 . JAK2 V617F (dbSNP ID: rs77375493 ) is the main genetic finding in MPNs and has a frequency of 95% in PV cases and between 50%-60% in ET and MF cases 4 . This somatic variant triggers the substitution of valine by phenylalanine at codon 617, which alters the pseudo-kinase domain of the JAK2 protein and conditions a constitutive activation of the JAK/STAT signaling pathway 5 . Studies have shown a significant correlation between JAK2 V617F and the 46/1 haplotype, a set of germline genetic variations distributed along chromosome 9p.24.1. This haplotype covers regions with a high number of genetic variants in JAK2 (exons 12 and 14) and is in linkage disequilibrium with the variant rs10974944 (C > G), located in intron 12 of the same gene 6 (Fig. 1 ). Studies indicate that this genetic alteration is a factor that favors the acquisition of JAK2 V617F by increasing the mutational rate of JAK2, which can lead to DNA damage and replication errors 7–9 . In addition to being identified in MPN patients of various populations, this haplotype has also been associated with more pronounced alterations in laboratory exams, presence of splenomegaly, inflammatory dysregulation, familial cases of MPNs (increasing the risk of developing any myeloproliferative neoplasm by 5 to 7 times) and abnormal methylation of the gene promoter 10–13 . Therefore, the JAK2 46/1 haplotype confers predisposition to the development of myeloproliferative neoplasms associated with the JAK2 V617F mutation (OR = 3.7; 95% CI = 3.1–4.3) and provides a conceptual framework in which a constitutional genetic component is associated with a substantial increase in the risk of acquiring a specific somatic mutation 14 . In this study, we performed genetic sequencing of intron 12 of the JAK2 gene to identify the rs10974944 variant (C > G), in strong linkage disequilibrium with the 46/1 haplotype, in 100 patients with BCR::ABL1 -negative myeloproliferative neoplasms (polycythemia vera: n = 39; essential thrombocythemia: n = 61) for whom clinical and laboratory information was available for clinical and laboratory characterization. RESULTS Characterization of the study population The study included individuals clinically diagnosed with polycythemia vera (PV) (n = 39) or essential thrombocythemia (ET) (n = 61), whose clinical-laboratory characteristics are presented in the supplementary material. The female gender was more prevalent among individuals diagnosed with ET (n = 48, p = 0.002). The median age of the participants ranged between the fifth and sixth decades of life (p = 0.441). Regarding hematological results, the medians of overall red blood cell count (RBC), hematocrit (Ht), hemoglobin (Hb), and total white blood cell count (WBC) were significantly higher in the PV group compared to the ET group (p < 0.05) (see Table SI). Other hematological markers, such as mean corpuscular volume (103.9 pg, p < 0.0001), mean corpuscular hemoglobin (33.5 fL, p < 0.0001), and overall platelet count (467,000 x cells/mm 3 , p < 0.0001), were also significantly elevated in the ET group compared to the PV group. Hemorrhagic events were more frequent in patients with ET compared to PV (p = 0.003), while the frequency of splenomegaly and thrombotic events did not differ significantly between PV and ET (p > 0.05) groups. Regarding genetic findings, the presence of JAK2 V617F + was more frequent in patients with PV (58.9%, p = 0.020) (Fig. 2 a), and a variant allele frequency (VAF) of ≥ 50% was also more common in patients with this hematologic condition (41%, p = 0.005) (Fig. 2 b). A greater frequency of patients with ET (95.1%, p G) are presented in Figs. 2 c and 2 d. Of all the individuals included in the study, 63% exhibited the rs10974944 variant (G): 26% in homozygosity (GG) and 37% in heterozygosity (CG). The GG genotype of rs10974944 was more prevalent in the PV group (36%), whereas CG was more homogeneous between the groups (33.3% in PV and 39.3% in ET). Regarding allelic frequency, the G allele was more frequent in the PV (53.6%) group, and the wild-type allele proved to be more prevalent in the ET (60.7%) group. Table 1 presents the hematological data of individuals with polycythemia vera and essential thrombocythemia stratified according to the absence or presence of the rs10974944 (CC and G carriers, respectively). In PV, G carriers showed significantly increased values for MCV and MCH (p = 0.030 and p = 0.041, respectively), while in ET, patients with the variant exhibited elevated indices of RBC, Ht, and Hb with demonstrated statistical significance (p < 0.05). Characteristics, Med, IQR Polycythemia vera (n = 39) Essential thrombocythemia (n = 61) C/C (n = 12) G carriers (n = 27) p-value C/C (n = 25) G carriers (n = 36) p-value RBC (x million/mm 3 ) 5.9 [4.7–6.6] 4.8 [4.2-6] 0.188 3.4 [3.1–3.9] 4.1 [3.3–4.7] 0.029 Ht (%) 49.8 [43-52.2] 48 [44.1–53.1] 0.866 36.9 [35-39.5] 40.4 [35.9–44.4] 0.025 Hb (g/dL) 15.7 [13.1–16.2] 15.4 [13.9–16.6] 0.958 12.1 [11.1–13.0] 13.5 [12-14.6] 0.004 MCV (pg) 83.6 [81.7–89.5] 93.7 [86.6-104.9] 0.030 106.5 [94.2113.2] 101.5 [90.5-112.6] 0.330 MCH (fL) 27.3 [24.1–29.4] 30.9 [28.1–33.3] 0.041 33.6 [31.5–37.5] 32.7 [29.8–36.6] 0.383 MCHC (g/dL) 32.1 [30.4–36.1] 32 [30.6–33.5] 0.816 32.4 [31.6–33.4] 32.5 [32.1–34.2] 0.597 WBC (x cells/mm 3 ) 6670 [3,835 − 11,118] 6540 [5,190 − 12,580] 0.911 5,260 [3,810-7,455] 5410 [4,233-6,670] 0.740 Platelets (x per mm 3 ) 258,000 [176,250–440,000] 302,000 [174,000-391,000] 0.0747 483,000 [368,500–704,500] 440,500 [323,750-1,119,000] 0.127 Table 1 : Laboratory characteristics of G carriers ( rs10974944 ) and individuals without the variant who were diagnosed with polycythemia vera or essential thrombocythemia. Abbreviations: RBC: red blood cell count, Ht: hematocrit, Hb: hemoglobin, MCV: mean corpuscular volume, MCH: mean corpuscular hemoglobin, MCHC: mean corpuscular hemoglobin concentration, WBC: white blood cell count. Reference values: RBC: 3.9–5.3 million/mm 3 , Ht: 36–48%, Hb: 12–16 g/dL, MCV: 80–100 fL, MCH: 27–33 pg, MCHC: 32–36 g/dL, WBC: 3,600 − 11,000 cells/mm 3 , Platelets: 150,000-400,000 per mm 3 . Distribution of variants in patients stratified according to JAK2 V617F status and variant allele frequency Considering the association of rs10974944 with JAK2 V617F , the genotypic frequency analysis of rs10974944 (C > G) was performed according to the positive (+) or negative (-) status of JAK2 V617F and its variant allele frequency (VAF), with data described in Table 2 . Homozygous individuals for rs10974944 (GG) showed a significantly higher frequency of JAK2 V617F + status and a higher likelihood of being positive for this variant when compared to the CC genotype (42.2% vs 20%; OR: 8.4; 95% CI 2.6–24.8; p = 0.002). The same was true for the GG/CG genotypes (42.2%/37.8% vs 20%; OR 4.1: 95% CI 1.62–9.7; p = 0.002) and the G allele. We emphasize the association of the rs10974944 G allele with the V617F variant, which demonstrated a 3.4-fold higher probability of being present in JAK2 V617F + individuals compared to individuals carrying the C allele (61.1% vs 38.9%; OR 3.47; 95% CI 1.9–6.2; p < 0.0001). Additionally, the analyses revealed that individuals with the GG genotype of rs10974944 had a 13.1-fold higher probability of having a VAF greater than 50% when compared to individuals with the CC genotype (75% vs 15%; OR 13.1; 95% CI: 1.8–72.3; p = 0.004). Regarding the allele, carriers of the G allele showed a 6-fold higher risk of having a VAF of ≥ 50% compared to the wild-type allele (C) (82.5% vs 17.5%; OR: 6.0; 95% CI: 2.1–14.8; p = 0.0002). These results demonstrate an association between rs10974944 and the variation in VAF in JAK2 V617F . Table 2 Distribution of single nucleotide variants (SNVs) in MPN patients stratified by JAK2 V617F status and variant allele frequency. Abbreviations: VAF: variant allele frequency. * In linkage disequilibrium with haplotype 46/1. Genotype/allele JAK2 V617F Status (n = 93) JAK2 V617F + _VAF (n = 45) Positive (n = 45) Negative (n = 48) OR (95% CI) p-value ≥ 50% (n = 20) < 50% (n = 25) OR (95%CI) p-value rs10974944*; n (%) CC 9 (20) 24 (50) 2.6 (0.97–7.2) 0.530 2 (10) 7 (28) 0.7 (0.1-5) 0.778 CC vs CG CG 18 (37.8) 18 (37.5) 8.4 (2.6–24.8) 0.002 3 (15) 14 (56) 3.5 (0.7–18) 0.133 CC vs GG/CG GG 19 (42.2) 6 (12.5) 4.1 (1.8–13.9) 0.002 15 (75) 4 (16) 13.1 (1.8–72.3) 0.004 CC vs GG C 35 (38.9) 66 (68.7) 3.4 (1.9–6.2) < 0.0001 7 (17.5) 28 (56) 6 (2.1–14.8) 0.0002 C vs G G 55 (61.1) 30 (31.2) 33 (82.5) 22 (44) Identified haplotypes The linkage disequilibrium (LD) of rs10974944 and JAK2 V617F ( rs77375493 ) is demonstrated in Fig. 3 . Variants identified in the analyzed region were included in the haplotype analysis. When these genetic alterations are paired, they give rise to eight haplotypes (Table 3 ). Haplotype analysis revealed that only haplotype 2 ( rs10974944 G/rs10815151C/rs1011004A/ rs77375493 T) was more prevalent in individuals with the PV phenotype (33.3%; OR: 3.3; 95% CI: 1.2–9.2; p = 0.0006), indicating that it is a possible marker associated with PV_ JAK2 V617F + . Table 3 Haplotypes of JAK2 intron 12 present in individuals with polycythemia vera (PV) or essential thrombocythemia (ET). Haplotype rs10974944 rs10815151 rs10119004 rs77375493 PV ET Chi-Square Odds ratio p-value 1 C C G G 6 (15.3%) 17 (27.8%) 3.246 0.4 (0.1–1.2) 0.07 2 G C A T 13 (33.3%) 8 (13.1%) 11.918 3.3 (1.2–9.2) 0.0006 3 G C A G 6 (15.3%) 14 (22.9%) 1.894 0.6 (0.2–1.7) 0.168 4 C T A G 6 (15.3%) 12 (21.3%) 0.495 0.7 (0.2–2.2) 0.481 5 C C A G 1 (2.5) 3 (4.9%) 1.006 0.5 (0.03–3.5) 0.315 6 C T A T 2 (5.1) 2 (3.2) 1.14 1.5 (0.2–10.4) 0.285 7 C C G T 2 (5.1) 2 (3.2) 0.28 1.5 (0.2–10.4) 0.597 8 C T A G 1 (2.5) 1 (1.6) 0.035 1.6 (0.08–31.2) 0.851 9 G C G G 1 (2.5) 1 (1.6) 0.004 1.6 (0.08–31.2) 0.949 Discussion Myeloproliferative neoplasms have characteristic alterations in laboratory exams, as well as genetic findings that permit their identification and differentiation. Findings involving genetic alterations in introns are not yet fully understood, but this scenario is becoming of increasing interest for understanding the etiopathogenic aspects and the role of these DNA regions in these diseases. Essential thrombocythemia proved to be the most frequent myeloproliferative neoplasm, which are findings that align with the premises established by Torres 15 , who studied a population with BCR::ABL1 -negative myeloproliferative neoplasms in the state of Amazonas (Brazil). Similar data were described by Macedo 16 , who reported a similar scenario in patients from the states of Paraná and São Paulo who had the same hematologic malignancy, and these data converge with descriptions found in other countries 17, 18 The age range of individuals was between the fifth and seventh decades of life, which is consistent with what is stated in other studies 19, 20 . The progressive accumulation of genetic variations in hematopoietic stem cells and the biological machinery of the DNA repair system 21, 22 , an increase or decrease in telomeres 23, 24 and cumulative exposure to risk factors throughout life, such as smoking and obesity 25, 26 , may explain the prevalence of this age group in the context of myeloproliferative neoplasms. Regarding clinical characteristics, polycythemia vera (PV) showed an equal proportion of men and women, while essential thrombocythemia (ET) revealed a majority of cases involving women, and these data are in line with the literature 27, 28 . Some studies have demonstrated that women have an increased risk of developing myeloproliferative neoplasms 29 and a higher likelihood of developing cardiovascular complications and splenomegaly 26 . The reason for this risk is uncertain, but changes in sex chromosomes, hormonal factors and gene expression may be possible contributors to this process 28 . Laboratory data, and thrombotic and hemorrhagic events presented as expected for each neoplasm: PV demonstrated a higher prevalence of increased erythrogram values and ET showed changes in the megakaryocytic series, with a higher risk of hemorrhagic events, as described by the World Health Organization 3 , and in other studies on the subject 27, 30 . Regarding the genetic findings, PV demonstrates a higher prevalence of positive cases for the JAK2 V617F variant, since it is directly associated with the specific pathogenesis of this hematologic malignancy 36 and plays a role in the constitutive activation of the JAK-STAT pathway 5 . It is interesting to note that 58% of our PV population was positive for the variant, which may initially differ from findings commonly described in the literature that point to JAK2 V617F frequencies of over 70% in Brazilian, Korean, Chinese, Japanese, and European patients 31–35 . The limited number of PV_ JAK2 V617F + patients identified in this study is related to cytoreductive therapy. We emphasize that 66.6% of patients with PV were on cytoreductive therapy, which acts to suppress and/or decrease the variant burden of JAK2 V617F through the inhibition of the myeloproliferative process of mutated hematopoietic cells, as noted in a recent study 36 . This directly affects the sensitivity of the molecular detection methods used to identify the variant, underscoring the increased importance of incorporating molecular analysis for JAK2 V617F in the initial suspicions for MPNs. In the literature, the germline haplotype 46/1, identified by the rs10974944 (C > G) variant, has a well-documented association with JAK2 V617F 14, 37–39 as also observed in our study. The high frequency of the G allele of rs10974944 in individuals positive for JAK2 V617F contributes to discussions about the non-random correlation between these two genetic alterations 13, 40 This relationship is in line with another finding from our study, haplotype 2 ( rs10974944 G/rs10815151C/rs1011004A/ rs77375493 T), which strengthens concepts based on the interaction between rs10974944 (C > G) and JAK2 V617F ( rs77375493 - G > T). These propositions are in agreement with findings involving haplotype 46/1 in other Brazilian, Taiwanese, European, Chinese, and Japanese populations 16, 32–34, 41 , indicating that the possible mechanisms preceding the acquisition of JAK2 V617F are not limited to a specific ethnic group; therefore, its evolutionary basis can be considered as a genetic predisposition factor for the disease 8 . Studies report a higher risk of individuals with the GG genotype of rs10974944 being positive for JAK2 V617F 14, 40, 42 . Consistent with the results of the aforementioned studies, our population exhibited a four-fold increase in the risk of positive JAK2 V617F in individuals with the GG genotype of rs10974944 . (OR: 4.1; 95% CI: 8-13.9). These findings support the hypothesis of hypermutability, which establishes haplotype 46/1 as a dysregulating agent of the JAK2 gene, which increases the risk of DNA replication errors and conditions a mutagenic scenario for the acquisition of variants with selective advantages, such as JAK2 V617F 43–45 The association of rs10974944 (G) and the JAK2 V617F VAF suggests a possible involvement of haplotype 46/1 in clonal expansion. We identified a six-fold higher risk of individuals carrying the G allele of rs10974944 and JAK2 V617F VAF of ≥ 50%. Our data indicate that the marker of haplotype 46/1 may play a role not only in the acquisition of JAK2 V617F but is also attributed to clonal expansion, maintenance, and survival. Tefferi 46 suggests that JAK2 V617F is not the initial clonogenic event in MPNs but rather one of several subclones derived from an ancestral clone. This is in accordance with the notes of Pardanani et al. 47 , which support the hypothesis that this haplotype is located in a favorable cis regulatory environment, which facilitates the acquisition of JAK2 V617F , and which, in turn, is responsible for clonal expansion and the development of MPNs. Furthermore, the possible role of acquired uniparental disomy, a genetic event that leads to mitotic recombination associated with neutral loss of heterozygosity of chromosome 9p in MPN patients, reducing both the haplotype and JAK2 V617F to a homozygous state 14, 48, 49 , cannot be ruled out. In this context, cells with both variants theoretically have a selective advantage, which conditions greater myeloproliferative potential and favors the establishment of variant cells over healthy cells, thus explaining the increased VAF in individuals with the combination rs10974944 (G) + rs77375493 (T) ( JAK2 V617F ) in homozygosity. Association between the elevation of hematological indices and the presence of 46/1 is observed in the literature 16, 33, 50 ; however, this is not a consensus among the scientific community 8,53,61 . Our data show significant differences in MCV, MCH values in the PV group, and RBC, Hb, and Ht in TE carriers of the G allele of rs10974944 , which has been observed in previous studies 7, 42, 51 . The present research is the first to analyze the 46/1 haplotype using the rs10974944 variant, present in intron 12 of JAK2, in a population from the Brazilian Amazon. The results of this study show that the rs10974944 (G) variant is associated with BCR::ABL1 -negative myeloproliferative neoplasms, in patients positive for JAK2 V617F , especially those with PV, and a high allelic variant burden in these patients, and hematological alterations. Furthermore, the haplotype rs10974944 G/ rs10815151 C/ rs1011004 A/ rs77375493 T was identified as a factor related to PV. Materials and Methods Population: One hundred individuals clinically diagnosed with BCR::ABL1 -negative myeloproliferative neoplasms were included in the study. The study was conducted from February 2021 to January 2023. Laboratory analysis was performed at the Genomics Laboratory of the Foundation Hospital for Hematology and Hemotherapy of the State of Amazonas. Ethical Approval: The study was submitted to and approved by the Ethics Committee of the Foundation Hospital for Hematology and Hemotherapy of the State of Amazonas under opinion No. 4,450,813 and certificate of ethical appreciation No. 39991420.6.0000.0009. Written informed consent was obtained from patients. This study complied with Resolution No. 466/2012 of the National Health Council for research involving human subjects and followed the parameters determined by the Declaration of Helsinki. Clinical and Laboratory Data: Clinical data (gender, age, splenomegaly, thrombotic and/or hemorrhagic events) and laboratory data were obtained from medical records. Biological Sample and DNA Extraction: Venous blood samples were collected in tubes containing EDTA, and DNA was extracted using Brazol (Lgcbio, Brazil), following the manufacturer’s instructions, and stored at -80 °C. Conventional PCR and PCR purification: For the amplification of the DNA region under analysis, a reaction with a final volume of 25 μL was used with 50-100 ng of genomic DNA, Buffer (1x), MgCl 2 (1.5 mM), forward primer CCAACTGAGTTTCCTTGCAG and reverse primer CTAGGTTAAGAGTATGTGGTTCC (0.4 mM), dNTP mix (0.2 mM), and TAQ (1 U). The PCR products were separated on a 1.5% agarose gel. The PCR product, a 572 bp amplicon, was purified with polyethylene glycol (PEG 8000) (Promega). Nucleotide Sequencing and Sequence Analysis : Approximately 5-30 ng of purified PCR product was applied to the sequencing reaction. Nucleotide sequencing was performed using BigDye ® Terminator v3.1 (Applied Biosystems), following the manufacturer’s recommendations and the primers described above. The products were purified by the EDTA/Ethanol protocol and evaluated in the 3500 XL Genetic Analyzer ® automatic sequencer (Applied BioSystems, USA), with POP-7 polymer. The sequences were initially analyzed using the Sequencing Analysis software (Applied BioSystems [Thermo Fisher Scientific, São Paulo, Brazil]). Geneious 6.0.6 software (Biomatters, USA) was used to map the variants and obtain contigs for the comparison with the reference sequence Homo sapiens Janus kinase 2 (JAK2), (NCBI: NG_009904.1). Haplotype Analysis: Haplotype frequencies were calculated using Haploview software (v.4.2) as a measure of linkage disequilibrium (LD). Haplotypes with frequencies of 0.8 as strong LD, <0.8 as weak, and <0.1 as negative LD. Hardy-Weinberg equilibrium was calculated by comparing estimated and observed genotype frequencies using the χ 2 test. SNVs with p-values of <0.001 were considered to be out of Hardy-Weinberg equilibrium. Statistical Analysis: The obtained results were subjected to the Shapiro-Wilk normality test. Categorical variables were expressed as absolute value (n) and relative frequency (%) and were tested using the χ 2 and Fisher’s exact test with a 95% confidence interval. Numerical variables were expressed as median (Md) and interquartile range [IQR] with 75 th percentile through GraphPad Prism v.9.0.2 software. For non-parametric variables, the Kruskal-Wallis test was performed. For both analyses, Dunn’s post-test for multiple comparisons was also conducted using GraphPad Prism v.9.0.2 software. P-values of <0.05 were considered statistically significant. Declarations Data Availability The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request. The GenBank accession number for the nucleotide sequence is PP208825. Acknowledgments The authors would like to thank the Fundação de Amparo à Pesquisa do Estado do Amazonas (FAPEAM), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). Our thanks also go to the Fundação Hospitalar de Hematologia e Hemoterapia do Amazonas (FHEMOAM) and the medical staff and laboratory professionals for their assistance in carrying out the work. Special thanks go to Dr Enedina Nogueira at the Genomics Laboratory CAM/UFAM for her support and the use of the infrastructure for the molecular analysis. Funding The present study was supported by the Fundação de Amparo à Pesquisa do Estado do Amazonas (Pro-Estado Program; grant nos. #002/2008, #007/2018 and #005/2019, and POSGRAD Program grant nos. #008/2023), Conselho Nacional de Desenvolvimento Científico e Tecnológico, and Coordenação de Aperfeiçoamento de Pessoal de Nivel Superior. Author contributions statement Carried out the experiments: J.F.P; Population diagnosis: L.N.M.P., R.S.A., N.A.F.; Biological sample collection: J.F.P., D.G.T., D.C.A., M.A.S., E.V.B.A., E.A.M.; Original Draft - writing: J.F.P.; Figure production: J.F.P.; Statistical analysis - review: G.A.V., A.M.T., L.P.S.M; Manuscript - editing: J.F.P., G.A.V., A.M.T., L.P.S.M. All authors reviewed the final version of the manuscript. Competing interests The authors declare no competing interests. References Grinfeld, J. et al. Classification and Personalized Prognosis in Myeloproliferative Neoplasms. New England Journal of Medicine. 379 (15), 1416–1430, doi: 10.1056/nejmoa1716614 (2018). Swerdlow, S.H. et al. World Health Organization Classification of Tumours This book and all other volumes of the series can be purchased: From all countri es . World Health Organization. (4th ed). (2017). Khoury, J.D. et al. The 5th edition of the World Health Organization Classification of Haematolymphoid Tumours: Myeloid and Histiocytic/Dendritic Neoplasms. Leukemia . (June), doi: 10.1038/s41375-022-01613-1 (2022). Gou, P., Zhang, W., Giraudier, S. Insights into the Potential Mechanisms of JAK2V617F Somatic Mutation Contributing Distinct Phenotypes in Myeloproliferative Neoplasms. International Journal of Molecular Sciences. 23 (3), doi: 10.3390/ijms23031013 (2022). Torres, D.G. et al. JAK2 Variant Signaling: Genetic, Hematologic and Immune Implication in Chronic Myeloproliferative Neoplasms. Biomolecules . 12 (2), 1–18, doi: 10.3390/biom12020291 (2022). Nielsen, C., Bojesen, S.E., Nordestgaard, B.G., Kofoed, K.F., Birgens, H.S. JAK2V617F somatic mutation in the general population: Myeloproliferative neoplasm development and progression rate. Haematologica . 99 (9), 1448–1455, doi: 10.3324/haematol.2014.107631 (2014). Andrikovics, H. et al. JAK2 46/1 haplotype analysis in myeloproliferative neoplasms and acute myeloid leukemia. Leukemia. 24 (10), 1809–1813, doi: 10.1038/leu.2010.172 (2010). Jones, A. V., Cross, N.C.P. Inherited predisposition to myeloproliferative neoplasms. Therapeutic Advances in Hematology. 4 (4), 237–253, doi: 10.1177/2040620713489144 (2013). Tefferi, A. et al. JAK2 germline genetic variation affects disease susceptibility in primary myelofibrosis regardless of V617F mutational status: Nullizygosity for the JAK2 46/1 haplotype is associated with inferior survival. Leukemia. 24 (1), 105–109, doi: 10.1038/leu.2009.225 (2010). Mangaonkar, A.A., Patnaik, M.M. Hereditary Predisposition to Hematopoietic Neoplasms: When Bloodline Matters for Blood Cancers. Mayo Clinic Proceedings . 95 (7), 1482–1498, doi: 10.1016/j.mayocp.2019.12.013 (2020). Olcaydu, D. et al. The role of the JAK2 GGCC haplotype and the TET2 gene in familial myeloproliferative neoplasms. Haematologica. 96 (3), 367–374, doi: 10.3324/haematol.2010.034488 (2011). Stolyar, M.A. et al. JAK2 haplotype 46/1 and JAK2 V617F allele burden in MPN: New evidence against the “hypermutability” hypothesis? International Journal of Laboratory Hematology. 40 (1), e8–e10, doi: 10.1111/ijlh.12765 (2018). Paes, J., Silva, G.A.V., Tarragô, A.M., Mourão, L.P. d. S. The Contribution of JAK2 46/1 Haplotype in the Predisposition to Myeloproliferative Neoplasms. International Journal of Molecular Sciences . 23 (20), 20, doi: 10.3390/ijms232012582 (2022). Jones, A. V. et al. JAK2 haplotype is a major risk factor for the development of myeloproliferative neoplasms. Nature Genetics. 41 (4), 446–449, doi: 10.1038/ng.334 (2009). Torres, D.G. et al. Molecular landscape of the JAK2 gene in chronic myeloproliferative neoplasm patients from the state of Amazonas, Brazil. 1–15, doi: 10.3892/br.2023.1680 (2023). Macedo, L.C. et al. JAK2 46/1 haplotype is associated with JAK2 V617F - positive myeloproliferative neoplasms in Brazilian patients. International Journal of Laboratory Hematology. 37 (5), 654–660, doi: 10.1111/ijlh.12380 (2015). Harrison, C.N. et al. The impact of myeloproliferative neoplasms (MPNs) on patient quality of life and productivity: results from the international MPN Landmark survey. Annals of Hematology. 96 (10), 1653–1665, doi: 10.1007/s00277-017-3082-y (2017). Varghese, C., Immanuel, T., Ruskova, A., Theakston, E., Kalev-Zylinska, M.L. The epidemiology of myeloproliferative neoplasms in new zealand between 2010 and 2017: Insights from the new zealand cancer registry. Current Oncology. 28 (2), 1544–1557, doi: 10.3390/curroncol28020146 (2021). Szuber, N. et al. Myeloproliferative neoplasms in the young: Mayo Clinic experience with 361 patients age 40 years or younger. American Journal of Hematology. 93 (12), 1474–1484, doi: 10.1002/ajh.25270 (2018). Büyükaşik, Y., Ali, R., Ar, C., Turgut, M., Yavuz, S., Saydam, G. Polycythemia vera: Diagnosis, clinical course, and current management. Turkish Journal of Medical Sciences. 48 (4), 698–710, doi: 10.3906/sag-1806-43 (2018). Constantinescu, S.N., Vainchenker, W., Levy, G., Papadopoulos, N. Functional Consequences of Mutations in Myeloproliferative Neoplasms. HemaSphere . doi: 10.1097/HS9.0000000000000578 (2021). Azevedo, A.N.A.P. et al. DNA repair genes polymorphisms and genetic susceptibility to Philadelphia-negative myeloproliferative neoplasms in a Portuguese population: The role of base excision repair genes polymorphisms. 4641–4650, doi: 10.3892/ol.2017.6065 (2017). Barraco, D. et al. Gender effect on phenotype and genotype in patients with post-polycythemia vera and post-essential thrombocythemia myelofibrosis: results from the MYSEC project. Blood Cancer Journal. 8 (10), 10–13, doi: 10.1038/s41408-018-0128-x (2018). Ferrer, A., Mangaonkar, A.A., Patnaik, M.M. Clonal Hematopoiesis and Myeloid Neoplasms in the Context of Telomere Biology Disorders. Current Hematologic Malignancy Reports. 61–68, doi: 10.1007/s11899-022-00662-8 (2022). Duncombe, A.S. et al. Modifiable Lifestyle and Medical Risk Factors Associated With Myeloproliferative Neoplasms. HemaSphere . 1–6 (2020). Allahverdi, N., Yassin, M., Ibrahim, M. Environmental Factors, Lifestyle Risk Factors, and Host Characteristics Associated With Philadelphia Negative Myeloproliferative Neoplasm : A Systematic Review. Cancer control. 28, 1–12, doi: 10.1177/10732748211046802 (2021). Vannucchi, A.M., Harrison, C.N. Emerging treatments for classical myeloproliferative neoplasms. Blood. 129 (6), 693–703, doi: 10.1182/blood-2016-10-695965 (2017). Geyer, H.L. et al. Associations between gender, disease features and symptom burden in patients with myeloproliferative neoplasms: an analysis by the MPN QOL International Working Group. Haematologica. 102, 85–93, doi: 10.3324/haematol.2016.149559 (2017). Patterson-Fortin, J., Moliterno, A.R. Molecular Pathogenesis of Myeloproliferative Neoplasms: Influence of Age and Gender. Current Hematologic Malignancy Reports. 12 (5), 424–431, doi: 10.1007/s11899-017-0411-0 (2017). Nangalia, J., Green, A.R. Myeloproliferative neoplasms: From origins to outcomes. Blood. 130 (23), 2475–2483, doi: 10.1182/blood-2017-06-782037 (2017). Porto-Soares, M.A., de Oliveira, R.D., Cortopassi, G.M., Machado-Neto, J.A., Palma, L.C., Figueiredo-Pontes, L.L. de Clinical and molecular profile of a Brazilian cohort of patients with classical BCR-ABL1-negative myeloproliferative neoplasms. Hematology, Transfusion and Cell Therapy. 42 (3), 238–244, doi: 10.1016/j.htct.2019.07.008 (2020). Zhang, X., Hu, T., Wu, Z., Kang, Z., Liu, W., Guan, M. The JAK2 46/1 haplotype is a risk factor for myeloproliferative neoplasms in Chinese patients. International Journal of Hematology. 96 (5), 611–616, doi: 10.1007/s12185-012-1169-8 (2012). Ohyashiki, J.H., Yoneta, M., Hisatomi, H., Iwabuchi, T., Umezu, T., Ohyashiki, K. The C allele of JAK2 rs4495487 is an additional candidate locus that contributes to myeloproliferative neoplasm predisposition in the Japanese population. BMC Medical Genetics. 13 (1), 6, doi: 10.1186/1471-2350-13-6 (2012). Lighezan, D.L. et al. TET2 rs1548483 SNP associating with susceptibility to molecularly annotated polycythemia vera and primary myelofibrosis. Journal of Personalized Medicine. 10 (4), 1–16, doi: 10.3390/jpm10040259 (2020). Lim, Y., Lee, J.O., Bang, S.M. Incidence, survival and prevalence statistics of classical myeloproliferative neoplasm in Korea. Journal of Korean Medical Science. 31 (10), 1579–1585, doi: 10.3346/jkms.2016.31.10.1579 (2016). Harrison, C., Baxter, J., Jackson, A., Fletcher, R.S., Francis, S., Clark, F.J. Effects of Tamoxifen on the Mutant Allele Burden and Disease Course in Patients with Myeloproliferative Neoplasms - Results of the Tamarin Study. doi: 10.1182/blood-2020-134764 (2020). Olcaydu, D. et al. A common JAK2 haplotype confers susceptibility to myeloproliferative neoplasms. Nature Genetics. 41 (4), 450–454, doi: 10.1038/ng.341 (2009). Anelli, L., Zagaria, A., Specchia, G., Albano, F. The JAK2 GGCC (46/1) haplotype in myeloproliferative neoplasms: Causal or random? International Journal of Molecular Sciences. 19 (4), 1–12, doi: 10.3390/ijms19041152 (2018). Kilpivaara, O. et al. A germline JAK2 SNP is associated with predisposition to the development of JAK2V617F -positive myeloproliferative neoplasms. Nature Genetics. 41 (4), 455–459, doi: 10.1038/ng.342.A (2009). Trifa, A.P. et al. The G allele of the JAK2 rs10974944 SNP, part of JAK2 46/1 haplotype, is strongly associated with JAK2 V617F-positive myeloproliferative neoplasms. Annals of Hematology. 89 (10), 979–983, doi: 10.1007/s00277-010-0960-y (2010). Chiang, Y., Chang, Y., Lin, H., Huang, L. Germline variations at JAK2, TERT, HBS1L-MYB and MECOM and the risk of myeloproliferative neoplasms in Taiwanese population. Oncotarget. 8 (44), 76204–76213 (2017). Tapper, W. et al. Genetic variation at MECOM, TERT, JAK2 and HBS1L-MYB predisposes to myeloproliferative neoplasms. Nature Communications. 6, 1–11, doi: 10.1038/ncomms7691 (2015). Masselli, E., Pozzi, G., Carubbi, C., Vitale, M. The genetic makeup of myeloproliferative neoplasms: Role of germline variants in defining disease risk, phenotypic diversity and outcome. Cells . 10 (10), doi: 10.3390/cells10102597 (2021). Campbell, P.J. Somatic and germline genetics at the JAK2 locus. Nature Methods. 41 (4), 385–386, doi: 10.1038/ng0409-385 (2009). Hermouet, S., Vilaine, M. The JAK2 46/1 haplotype: A marker of inappropriate myelomonocytic response to cytokine stimulation, leading to increased risk of inflammation, myeloid neoplasm, and impaired defense against infection? Haematologica . 96 (11), 1575–1579, doi: 10.3324/haematol.2011.055392 (2011). Tefferi, A. Molecular drug targets in myeloproliferative neoplasms: Mutant ABL1, JAK2, MPL, KIT, PDGFRA, PDGFRB and FGFR1. Journal of Cellular and Molecular Medicine. 13 (2), 215–237, doi: 10.1111/j.1582-4934.2008.00559.x (2009). Pardanani, A. et al. The JAK2 46/1 haplotype confers susceptibility to essential thrombocythemia regardless of JAK2V617F mutational statusclinical correlates in a study of 226 consecutive patients. Leukemia. 24 (1), 110–114, doi: 10.1038/leu.2009.226 (2010). Kralovics, R., Guan, Y., Prchal, J.T. Acquired uniparental disomy of chromosome 9p is a frequent stem cell defect in polycythemia vera. Experimental Hematology. 30 (3), 229–236, doi: 10.1016/S0301-472X(01)00789-5 (2002). Sullivan, J.O., Mead, A.J. Heterogeneity in myeloproliferative neoplasms: Causes and consequences. Advances in Biological Regulation. 71, 55–68, doi: 10.1016/j.jbior.2018.11.007 (2018). Martínez-Trillos, A. et al. Relationship between the 46/1 haplotype of the JAK2 gene and the JAK2 mutational status and allele burden, the initial findings, and the survival of patients with myelofibrosis. Annals of Hematology. 93 (5), 797–802, doi: 10.1007/s00277-013-1989-5 (2014). Oddsson, A. et al. The germline sequence variant rs2736100-C in TERT associates with myeloproliferative neoplasms. Leukemia. 28 (6), 1371–1374, doi: 10.1038/leu.2014.48 (2014). Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterial.pdf Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 14 Feb, 2024 Reviews received at journal 07 Feb, 2024 Reviewers agreed at journal 05 Feb, 2024 Reviewers invited by journal 01 Feb, 2024 Editor assigned by journal 01 Feb, 2024 Editor invited by journal 01 Feb, 2024 Submission checks completed at journal 01 Feb, 2024 First submitted to journal 19 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3880113","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":270446433,"identity":"7610f358-df42-4bd1-a30f-a597e48371b0","order_by":0,"name":"Jhemerson F. Paes","email":"","orcid":"","institution":"Programa de Pós-Graduação em Ciências Aplicadas à Hematologia, Universidade do Estado do Amazonas (UEA)","correspondingAuthor":false,"prefix":"","firstName":"Jhemerson","middleName":"F.","lastName":"Paes","suffix":""},{"id":270446434,"identity":"b2ed0ff8-5c32-4499-81ab-4b2a75eca620","order_by":1,"name":"Dania G. Torres","email":"","orcid":"","institution":"Programa de Pós-Graduação em Ciências Aplicadas à Hematologia, Universidade do Estado do Amazonas (UEA)","correspondingAuthor":false,"prefix":"","firstName":"Dania","middleName":"G.","lastName":"Torres","suffix":""},{"id":270446435,"identity":"160eb9c7-6744-4154-bc7c-327b46b3082c","order_by":2,"name":"Deborah C. Aquino","email":"","orcid":"","institution":"Programa de Pós-Graduação em Ciências Aplicadas à Hematologia, Universidade do Estado do Amazonas (UEA)","correspondingAuthor":false,"prefix":"","firstName":"Deborah","middleName":"C.","lastName":"Aquino","suffix":""},{"id":270446436,"identity":"40c82542-7fb5-436d-aab3-4d08447a6626","order_by":3,"name":"Emanuela V. B. Alves","email":"","orcid":"","institution":"Programa de Pós-Graduação em Ciências Aplicadas à Hematologia, Universidade do Estado do Amazonas (UEA)","correspondingAuthor":false,"prefix":"","firstName":"Emanuela","middleName":"V. B.","lastName":"Alves","suffix":""},{"id":270446437,"identity":"7fffb867-9107-4f78-aecc-0ae90e121a9c","order_by":4,"name":"Erycka A. Mesquita","email":"","orcid":"","institution":"Programa de Pós-Graduação em Ciências Aplicadas à Hematologia, Universidade do Estado do Amazonas (UEA)","correspondingAuthor":false,"prefix":"","firstName":"Erycka","middleName":"A.","lastName":"Mesquita","suffix":""},{"id":270446438,"identity":"191b4dcb-cf50-44cf-a59e-6fe594eb5fbe","order_by":5,"name":"Miliane A. Sousa","email":"","orcid":"","institution":"Programa de Pós-Graduação em Ciências Aplicadas à Hematologia, Universidade do Estado do Amazonas (UEA)","correspondingAuthor":false,"prefix":"","firstName":"Miliane","middleName":"A.","lastName":"Sousa","suffix":""},{"id":270446439,"identity":"5da619f4-b5da-47c8-8589-a1cfdc80e348","order_by":6,"name":"Nelson Abrahim Fraiji","email":"","orcid":"","institution":"Programa de Pós-Graduação em Ciências Aplicadas à Hematologia, Universidade do Estado do Amazonas (UEA)","correspondingAuthor":false,"prefix":"","firstName":"Nelson","middleName":"Abrahim","lastName":"Fraiji","suffix":""},{"id":270446440,"identity":"1d08a877-0b99-4073-9bec-e0bd32339345","order_by":7,"name":"Leny N. M. Passos","email":"","orcid":"","institution":"Programa de Pós-Graduação em Ciências Aplicadas à Hematologia, Universidade do Estado do Amazonas (UEA)","correspondingAuthor":false,"prefix":"","firstName":"Leny","middleName":"N. M.","lastName":"Passos","suffix":""},{"id":270446441,"identity":"585f36b8-4098-4277-9602-33d43e5ed74e","order_by":8,"name":"Rosângela S. Abreu","email":"","orcid":"","institution":"Programa de Pós-Graduação em Ciências Aplicadas à Hematologia, Universidade do Estado do Amazonas (UEA)","correspondingAuthor":false,"prefix":"","firstName":"Rosângela","middleName":"S.","lastName":"Abreu","suffix":""},{"id":270446442,"identity":"ec9029d3-5921-4a6c-9748-d8c7c47e58b6","order_by":9,"name":"George A. V. Silva","email":"","orcid":"","institution":"Programa de Pós-Graduação em Ciências Aplicadas à Hematologia, Universidade do Estado do Amazonas (UEA)","correspondingAuthor":false,"prefix":"","firstName":"George","middleName":"A. V.","lastName":"Silva","suffix":""},{"id":270446443,"identity":"2dc155dd-0bea-45ce-b2a2-1c63791e1813","order_by":10,"name":"Andréa M. Tarragô","email":"","orcid":"","institution":"Programa de Pós-Graduação em Ciências Aplicadas à Hematologia, Universidade do Estado do Amazonas (UEA)","correspondingAuthor":false,"prefix":"","firstName":"Andréa","middleName":"M.","lastName":"Tarragô","suffix":""},{"id":270446444,"identity":"7a372925-c19d-46c1-9cb6-f453f37bafe7","order_by":11,"name":"Lucivana P. de Souza Mourão","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYBACPigtB6HYGBgMCGlhg9LGpGtJbCBei3T7w8c8f+zSNxxvfsDwoewwg7n0AQJaZM4YG/PwJOduOHPMgHHGucMMln0JBLRI5LBJ80gw5264kWDAzNt2mMHgDCGHSaQ/k+YxqE83uP/8A/Nf4rQkmEnzJBxOMLjBY8DMSJQWoF8M5xw4bjjzTE7BwZ5z6TyWPQS08AND7MGbP9XyfMePb3zwo8xazpyHgBYGCST2ASAmqAFVyygYBaNgFIwCrAAAuFI8597kdxIAAAAASUVORK5CYII=","orcid":"","institution":"Programa de Pós-Graduação em Ciências Aplicadas à Hematologia, Universidade do Estado do Amazonas (UEA)","correspondingAuthor":true,"prefix":"","firstName":"Lucivana","middleName":"P. de Souza","lastName":"Mourão","suffix":""}],"badges":[],"createdAt":"2024-01-19 23:31:53","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3880113/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3880113/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50568839,"identity":"1f532679-3261-4d0e-ae9f-5be04d0b9014","added_by":"auto","created_at":"2024-02-02 15:27:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":68045,"visible":true,"origin":"","legend":"\u003cp\u003eThe 46/1 haplotype, (a) located on chromosome 9p24.1, (b) encompasses the genes \u003cem\u003eJAK2, INSL6\u003c/em\u003e and \u003cem\u003eINSL4\u003c/em\u003e. (c) Variants in introns 10, 12, 14, and 15 are in strong linkage disequilibrium with the 46/1 haplotype and serve as markers for the detection of this haplotype.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3880113/v1/f5e00e1b6be9b85e51b43316.png"},{"id":50568842,"identity":"2e6ee9e3-4c18-4e5b-b111-48c1c38e59ce","added_by":"auto","created_at":"2024-02-02 15:27:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":71993,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of genetic data for (a) \u003cem\u003eJAK2 V617F\u003c/em\u003e, (b) Variant allele frequency of \u003cem\u003eJAK2 V617F\u003c/em\u003e+, and (c) Genotypic frequency and (d) Allelic frequency of \u003cem\u003ers10974944\u003c/em\u003ein patients with polycythemia vera or essential thrombocythemia.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3880113/v1/de784f8321ba3b460cfdfe44.png"},{"id":50568840,"identity":"90bffe73-da30-4d85-b4a5-1b05c12da83f","added_by":"auto","created_at":"2024-02-02 15:27:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":88751,"visible":true,"origin":"","legend":"\u003cp\u003eLinkage disequilibrium (LD) structure of \u003cem\u003eJAK2\u003c/em\u003e intron 12 in patients with polycythemia vera (PV) or essential thrombocythemia (ET). Numbers in the boxes indicate the value of the LD correlation coefficient (r\u003csup\u003e2\u003c/sup\u003e) multiplied by 100. Lighter shades of boxes indicate a decreased r\u003csup\u003e2\u003c/sup\u003e value, strong LD is represented by the dark gray box. A discrete LD is observed between \u003cem\u003ers10974944\u003c/em\u003e and rs1081515; \u003cem\u003ers10974944\u003c/em\u003e and rs10119004; and \u003cem\u003ers10974944\u003c/em\u003e and \u003cem\u003ers77375493\u003c/em\u003e (\u003cem\u003eJAK2 V617F\u003c/em\u003e).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3880113/v1/cbff17e78631e73f79f2c8dd.png"},{"id":50569820,"identity":"047cc505-0d39-48c2-aa9c-8c5c16620d66","added_by":"auto","created_at":"2024-02-02 15:35:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":963896,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3880113/v1/387b8e8e-3748-4cfd-9c2b-a4bc56a5985d.pdf"},{"id":50568841,"identity":"873451dc-afd2-4164-ad3d-404a0a1e629c","added_by":"auto","created_at":"2024-02-02 15:27:09","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":325960,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3880113/v1/e2229dba5dde98e26c21825d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Hematological alterations associated with the SNV rs10974944, part of the 46/1 haplotype, in patients from the Brazilian Amazon with BCR::ABL1-negative myeloproliferative neoplasms","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMyeloproliferative neoplasms (MPNs) are clonal diseases characterized by hyperplasia of the myeloid lineage with effective maturation, which results in leukocytosis in peripheral blood, increased erythrocyte mass and possible progression to medullary fibrosis or leukemic transformation\u003csup\u003e1\u003c/sup\u003e. They have an incidence rate of 6 cases per 100,000 individuals and mostly affect white males between 60 and 70 years of age\u003csup\u003e2\u003c/sup\u003e. Polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (MF) are the most common \u003cem\u003eBCR::ABL1-\u003c/em\u003enegative MPNs, though differ in signs, symptoms, hematological and clinical alterations, and genetic findings\u003csup\u003e3\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003eJAK2 V617F\u003c/em\u003e (dbSNP ID: \u003cem\u003ers77375493\u003c/em\u003e) is the main genetic finding in MPNs and has a frequency of 95% in PV cases and between 50%-60% in ET and MF cases\u003csup\u003e4\u003c/sup\u003e. This somatic variant triggers the substitution of valine by phenylalanine at codon 617, which alters the pseudo-kinase domain of the JAK2 protein and conditions a constitutive activation of the JAK/STAT signaling pathway\u003csup\u003e5\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eStudies have shown a significant correlation between \u003cem\u003eJAK2 V617F\u003c/em\u003e and the 46/1 haplotype, a set of germline genetic variations distributed along chromosome 9p.24.1. This haplotype covers regions with a high number of genetic variants in \u003cem\u003eJAK2\u003c/em\u003e (exons 12 and 14) and is in linkage disequilibrium with the variant \u003cem\u003ers10974944\u003c/em\u003e (C\u0026thinsp;\u0026gt;\u0026thinsp;G), located in intron 12 of the same gene\u003csup\u003e6\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Studies indicate that this genetic alteration is a factor that favors the acquisition of \u003cem\u003eJAK2 V617F\u003c/em\u003e by increasing the mutational rate of JAK2, which can lead to DNA damage and replication errors\u003csup\u003e7\u0026ndash;9\u003c/sup\u003e. In addition to being identified in MPN patients of various populations, this haplotype has also been associated with more pronounced alterations in laboratory exams, presence of splenomegaly, inflammatory dysregulation, familial cases of MPNs (increasing the risk of developing any myeloproliferative neoplasm by 5 to 7 times) and abnormal methylation of the gene promoter\u003csup\u003e10\u0026ndash;13\u003c/sup\u003e. Therefore, the JAK2 46/1 haplotype confers predisposition to the development of myeloproliferative neoplasms associated with the \u003cem\u003eJAK2 V617F\u003c/em\u003e mutation (OR\u0026thinsp;=\u0026thinsp;3.7; 95% CI\u0026thinsp;=\u0026thinsp;3.1\u0026ndash;4.3) and provides a conceptual framework in which a constitutional genetic component is associated with a substantial increase in the risk of acquiring a specific somatic mutation\u003csup\u003e14\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn this study, we performed genetic sequencing of intron 12 of the \u003cem\u003eJAK2\u003c/em\u003e gene to identify the \u003cem\u003ers10974944\u003c/em\u003e variant (C\u0026thinsp;\u0026gt;\u0026thinsp;G), in strong linkage disequilibrium with the 46/1 haplotype, in 100 patients with \u003cem\u003eBCR::ABL1\u003c/em\u003e-negative myeloproliferative neoplasms (polycythemia vera: n\u0026thinsp;=\u0026thinsp;39; essential thrombocythemia: n\u0026thinsp;=\u0026thinsp;61) for whom clinical and laboratory information was available for clinical and laboratory characterization.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCharacterization of the study population\u003c/h2\u003e \u003cp\u003eThe study included individuals clinically diagnosed with polycythemia vera (PV) (n\u0026thinsp;=\u0026thinsp;39) or essential thrombocythemia (ET) (n\u0026thinsp;=\u0026thinsp;61), whose clinical-laboratory characteristics are presented in the supplementary material. The female gender was more prevalent among individuals diagnosed with ET (n\u0026thinsp;=\u0026thinsp;48, p\u0026thinsp;=\u0026thinsp;0.002). The median age of the participants ranged between the fifth and sixth decades of life (p\u0026thinsp;=\u0026thinsp;0.441).\u003c/p\u003e \u003cp\u003eRegarding hematological results, the medians of overall red blood cell count (RBC), hematocrit (Ht), hemoglobin (Hb), and total white blood cell count (WBC) were significantly higher in the PV group compared to the ET group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (see Table SI). Other hematological markers, such as mean corpuscular volume (103.9 pg, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), mean corpuscular hemoglobin (33.5 fL, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), and overall platelet count (467,000 x cells/mm\u003csup\u003e3\u003c/sup\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), were also significantly elevated in the ET group compared to the PV group. Hemorrhagic events were more frequent in patients with ET compared to PV (p\u0026thinsp;=\u0026thinsp;0.003), while the frequency of splenomegaly and thrombotic events did not differ significantly between PV and ET (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) groups.\u003c/p\u003e \u003cp\u003eRegarding genetic findings, the presence of \u003cem\u003eJAK2 V617F\u003c/em\u003e\u003csup\u003e+\u003c/sup\u003e was more frequent in patients with PV (58.9%, p\u0026thinsp;=\u0026thinsp;0.020) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea), and a variant allele frequency (VAF) of \u0026ge;\u0026thinsp;50% was also more common in patients with this hematologic condition (41%, p\u0026thinsp;=\u0026thinsp;0.005) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003eA greater frequency of patients with ET (95.1%, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) received cytoreductive treatment in comparison to PV patients (66.6%).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eIdentified genetic variants\u003c/h2\u003e \u003cp\u003eData on the allelic and genotypic frequency of \u003cem\u003ers10974944\u003c/em\u003e (C\u0026thinsp;\u0026gt;\u0026thinsp;G) are presented in Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed. Of all the individuals included in the study, 63% exhibited the \u003cem\u003ers10974944\u003c/em\u003e variant (G): 26% in homozygosity (GG) and 37% in heterozygosity (CG). The GG genotype of \u003cem\u003ers10974944\u003c/em\u003e was more prevalent in the PV group (36%), whereas CG was more homogeneous between the groups (33.3% in PV and 39.3% in ET). Regarding allelic frequency, the G allele was more frequent in the PV (53.6%) group, and the wild-type allele proved to be more prevalent in the ET (60.7%) group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003epresents the hematological data of individuals with polycythemia vera and essential thrombocythemia stratified according to the absence or presence of the \u003cem\u003ers10974944\u003c/em\u003e (CC and G carriers, respectively). In PV, G carriers showed significantly increased values for MCV and MCH (p\u0026thinsp;=\u0026thinsp;0.030 and p\u0026thinsp;=\u0026thinsp;0.041, respectively), while in ET, patients with the variant exhibited elevated indices of RBC, Ht, and Hb with demonstrated statistical significance (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCharacteristics, Med, IQR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003ePolycythemia vera (n\u0026thinsp;=\u0026thinsp;39)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e \u003cp\u003eEssential thrombocythemia (n\u0026thinsp;=\u0026thinsp;61)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC/C\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;12)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eG carriers\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;27)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eC/C\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;25)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eG carriers\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;36)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRBC (x million/mm\u003csup\u003e3\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.9 [4.7\u0026ndash;6.6]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.8 [4.2-6]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.188\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.4 [3.1\u0026ndash;3.9]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.1 [3.3\u0026ndash;4.7]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e0.029\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHt (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e49.8 [43-52.2]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e48 [44.1\u0026ndash;53.1]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.866\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e36.9 [35-39.5]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e40.4 [35.9\u0026ndash;44.4]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e0.025\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHb (g/dL)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15.7 [13.1\u0026ndash;16.2]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15.4 [13.9\u0026ndash;16.6]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.958\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12.1 [11.1\u0026ndash;13.0]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13.5 [12-14.6]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e0.004\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMCV (pg)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e83.6 [81.7\u0026ndash;89.5]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e93.7 [86.6-104.9]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.030\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e106.5 [94.2113.2]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e101.5 [90.5-112.6]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.330\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMCH (fL)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27.3 [24.1\u0026ndash;29.4]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30.9 [28.1\u0026ndash;33.3]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.041\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e33.6 [31.5\u0026ndash;37.5]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e32.7 [29.8\u0026ndash;36.6]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.383\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMCHC (g/dL)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e32.1 [30.4\u0026ndash;36.1]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e32 [30.6\u0026ndash;33.5]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.816\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e32.4 [31.6\u0026ndash;33.4]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e32.5 [32.1\u0026ndash;34.2]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.597\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWBC (x cells/mm\u003csup\u003e3\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6670\u003c/p\u003e \u003cp\u003e[3,835\u0026thinsp;\u0026minus;\u0026thinsp;11,118]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6540\u003c/p\u003e \u003cp\u003e[5,190\u0026thinsp;\u0026minus;\u0026thinsp;12,580]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.911\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5,260\u003c/p\u003e \u003cp\u003e[3,810-7,455]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5410\u003c/p\u003e \u003cp\u003e[4,233-6,670]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.740\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlatelets (x per mm\u003csup\u003e3\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e258,000\u003c/p\u003e \u003cp\u003e[176,250\u0026ndash;440,000]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e302,000\u003c/p\u003e \u003cp\u003e[174,000-391,000]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0747\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e483,000\u003c/p\u003e \u003cp\u003e[368,500\u0026ndash;704,500]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e440,500\u003c/p\u003e \u003cp\u003e[323,750-1,119,000]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.127\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e: Laboratory characteristics of G carriers (\u003cem\u003ers10974944\u003c/em\u003e) and individuals without the variant who were diagnosed with polycythemia vera or essential thrombocythemia. Abbreviations: RBC: red blood cell count, Ht: hematocrit, Hb: hemoglobin, MCV: mean corpuscular volume, MCH: mean corpuscular hemoglobin, MCHC: mean corpuscular hemoglobin concentration, WBC: white blood cell count. Reference values: RBC: 3.9\u0026ndash;5.3\u0026nbsp;million/mm\u003csup\u003e3\u003c/sup\u003e, Ht: 36\u0026ndash;48%, Hb: 12\u0026ndash;16 g/dL, MCV: 80\u0026ndash;100 fL, MCH: 27\u0026ndash;33 pg, MCHC: 32\u0026ndash;36 g/dL, WBC: 3,600\u0026thinsp;\u0026minus;\u0026thinsp;11,000 cells/mm\u003csup\u003e3\u003c/sup\u003e, Platelets: 150,000-400,000 per mm\u003csup\u003e3\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDistribution of variants in patients stratified according to\u003c/b\u003e \u003cb\u003eJAK2 V617F\u003c/b\u003e \u003cb\u003estatus and variant allele frequency\u003c/b\u003e\u003c/p\u003e \u003cp\u003eConsidering the association of \u003cem\u003ers10974944\u003c/em\u003e with \u003cem\u003eJAK2 V617F\u003c/em\u003e, the genotypic frequency analysis of \u003cem\u003ers10974944\u003c/em\u003e (C\u0026thinsp;\u0026gt;\u0026thinsp;G) was performed according to the positive (+) or negative (-) status of \u003cem\u003eJAK2 V617F\u003c/em\u003e and its variant allele frequency (VAF), with data described in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Homozygous individuals for \u003cem\u003ers10974944\u003c/em\u003e (GG) showed a significantly higher frequency of \u003cem\u003eJAK2 V617F\u003c/em\u003e\u003csup\u003e+\u003c/sup\u003e status and a higher likelihood of being positive for this variant when compared to the CC genotype (42.2% vs 20%; OR: 8.4; 95% CI 2.6\u0026ndash;24.8; p\u0026thinsp;=\u0026thinsp;0.002). The same was true for the GG/CG genotypes (42.2%/37.8% vs 20%; OR 4.1: 95% CI 1.62\u0026ndash;9.7; p\u0026thinsp;=\u0026thinsp;0.002) and the G allele. We emphasize the association of the \u003cem\u003ers10974944\u003c/em\u003e G allele with the V617F variant, which demonstrated a 3.4-fold higher probability of being present in \u003cem\u003eJAK2 V617F\u003c/em\u003e\u003csup\u003e+\u003c/sup\u003e individuals compared to individuals carrying the C allele (61.1% vs 38.9%; OR 3.47; 95% CI 1.9\u0026ndash;6.2; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001).\u003c/p\u003e \u003cp\u003eAdditionally, the analyses revealed that individuals with the GG genotype of \u003cem\u003ers10974944\u003c/em\u003e had a 13.1-fold higher probability of having a VAF greater than 50% when compared to individuals with the CC genotype (75% vs 15%; OR 13.1; 95% CI: 1.8\u0026ndash;72.3; p\u0026thinsp;=\u0026thinsp;0.004). Regarding the allele, carriers of the G allele showed a 6-fold higher risk of having a VAF of \u0026ge;\u0026thinsp;50% compared to the wild-type allele (C) (82.5% vs 17.5%; OR: 6.0; 95% CI: 2.1\u0026ndash;14.8; p\u0026thinsp;=\u0026thinsp;0.0002). These results demonstrate an association between \u003cem\u003ers10974944\u003c/em\u003e and the variation in VAF in \u003cem\u003eJAK2 V617F\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDistribution of single nucleotide variants (SNVs) in MPN patients stratified by \u003cem\u003eJAK2 V617F\u003c/em\u003e status and variant allele frequency. Abbreviations: VAF: variant allele frequency. *\u003cem\u003eIn linkage disequilibrium with haplotype 46/1.\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGenotype/allele\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003eJAK2 V617F\u003c/em\u003e Status (n\u0026thinsp;=\u0026thinsp;93)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c9\" namest=\"c6\"\u003e \u003cp\u003e\u003cem\u003eJAK2 V617F\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e_VAF (n\u0026thinsp;=\u0026thinsp;45)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;45)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;48)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOR\u003c/p\u003e \u003cp\u003e(95% CI)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;50%\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;20)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;50%\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;25)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eOR\u003c/p\u003e \u003cp\u003e(95%CI)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"10\" nameend=\"c10\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ers10974944*;\u003c/em\u003e n (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9 (20)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24 (50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.6\u003c/p\u003e \u003cp\u003e(0.97\u0026ndash;7.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.530\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2 (10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7 (28)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.7\u003c/p\u003e \u003cp\u003e(0.1-5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.778\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCC vs CG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18 (37.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18 (37.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e8.4\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(2.6\u0026ndash;24.8)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e0.002\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3 (15)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e14 (56)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3.5\u003c/p\u003e \u003cp\u003e(0.7\u0026ndash;18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.133\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCC vs GG/CG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e19 (42.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6 (12.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e4.1\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(1.8\u0026ndash;13.9)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e0.002\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15 (75)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4 (16)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e13.1\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(1.8\u0026ndash;72.3)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.004\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCC vs GG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e35 (38.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e66 (68.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003e3.4\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(1.9\u0026ndash;6.2)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.0001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7 (17.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e28 (56)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003e6\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(2.1\u0026ndash;14.8)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003e0.0002\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eC vs G\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e55 (61.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 (31.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e33 (82.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e22 (44)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eIdentified haplotypes\u003c/h2\u003e \u003cp\u003eThe linkage disequilibrium (LD) of \u003cem\u003ers10974944\u003c/em\u003e and \u003cem\u003eJAK2 V617F\u003c/em\u003e (\u003cem\u003ers77375493\u003c/em\u003e) is demonstrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Variants identified in the analyzed region were included in the haplotype analysis. When these genetic alterations are paired, they give rise to eight haplotypes (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Haplotype analysis revealed that only haplotype 2 (\u003cem\u003ers10974944\u003c/em\u003eG/rs10815151C/rs1011004A/\u003cem\u003ers77375493\u003c/em\u003eT) was more prevalent in individuals with the PV phenotype (33.3%; OR: 3.3; 95% CI: 1.2\u0026ndash;9.2; p\u0026thinsp;=\u0026thinsp;0.0006), indicating that it is a possible marker associated with PV_\u003cem\u003eJAK2 V617F\u003c/em\u003e\u003csup\u003e+\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eHaplotypes of \u003cem\u003eJAK2\u003c/em\u003e intron 12 present in individuals with polycythemia vera (PV) or essential thrombocythemia (ET).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHaplotype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ers10974944\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003ers10815151\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ers10119004\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ers77375493\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePV\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eET\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eChi-Square\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eOdds ratio\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6 (15.3%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e17 (27.8%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e3.246\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.4 (0.1\u0026ndash;1.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e0.07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eT\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e13 (33.3%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e8 (13.1%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e11.918\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e3.3 (1.2\u0026ndash;9.2)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e0.0006\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6 (15.3%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e14 (22.9%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e1.894\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.6 (0.2\u0026ndash;1.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e0.168\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6 (15.3%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e12 (21.3%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.495\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.7 (0.2\u0026ndash;2.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e0.481\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1 (2.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e3 (4.9%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e1.006\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.5 (0.03\u0026ndash;3.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e0.315\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e2 (5.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2 (3.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e1.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e1.5 (0.2\u0026ndash;10.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e0.285\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e2 (5.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2 (3.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e1.5 (0.2\u0026ndash;10.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e0.597\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1 (2.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1 (1.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.035\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e1.6 (0.08\u0026ndash;31.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e0.851\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1 (2.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1 (1.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e1.6 (0.08\u0026ndash;31.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e0.949\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMyeloproliferative neoplasms have characteristic alterations in laboratory exams, as well as genetic findings that permit their identification and differentiation. Findings involving genetic alterations in introns are not yet fully understood, but this scenario is becoming of increasing interest for understanding the etiopathogenic aspects and the role of these DNA regions in these diseases.\u003c/p\u003e \u003cp\u003eEssential thrombocythemia proved to be the most frequent myeloproliferative neoplasm, which are findings that align with the premises established by Torres\u003csup\u003e15\u003c/sup\u003e, who studied a population with \u003cem\u003eBCR::ABL1\u003c/em\u003e-negative myeloproliferative neoplasms in the state of Amazonas (Brazil). Similar data were described by Macedo\u003csup\u003e16\u003c/sup\u003e, who reported a similar scenario in patients from the states of Paran\u0026aacute; and S\u0026atilde;o Paulo who had the same hematologic malignancy, and these data converge with descriptions found in other countries\u003csup\u003e17, 18\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eThe age range of individuals was between the fifth and seventh decades of life, which is consistent with what is stated in other studies\u003csup\u003e19, 20\u003c/sup\u003e. The progressive accumulation of genetic variations in hematopoietic stem cells and the biological machinery of the DNA repair system\u003csup\u003e21, 22\u003c/sup\u003e, an increase or decrease in telomeres\u003csup\u003e23, 24\u003c/sup\u003e and cumulative exposure to risk factors throughout life, such as smoking and obesity\u003csup\u003e25, 26\u003c/sup\u003e, may explain the prevalence of this age group in the context of myeloproliferative neoplasms.\u003c/p\u003e \u003cp\u003eRegarding clinical characteristics, polycythemia vera (PV) showed an equal proportion of men and women, while essential thrombocythemia (ET) revealed a majority of cases involving women, and these data are in line with the literature\u003csup\u003e27, 28\u003c/sup\u003e. Some studies have demonstrated that women have an increased risk of developing myeloproliferative neoplasms\u003csup\u003e29\u003c/sup\u003e and a higher likelihood of developing cardiovascular complications and splenomegaly\u003csup\u003e26\u003c/sup\u003e. The reason for this risk is uncertain, but changes in sex chromosomes, hormonal factors and gene expression may be possible contributors to this process\u003csup\u003e28\u003c/sup\u003e. Laboratory data, and thrombotic and hemorrhagic events presented as expected for each neoplasm: PV demonstrated a higher prevalence of increased erythrogram values and ET showed changes in the megakaryocytic series, with a higher risk of hemorrhagic events, as described by the World Health Organization\u003csup\u003e3\u003c/sup\u003e, and in other studies on the subject\u003csup\u003e27, 30\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eRegarding the genetic findings, PV demonstrates a higher prevalence of positive cases for the \u003cem\u003eJAK2 V617F\u003c/em\u003e variant, since it is directly associated with the specific pathogenesis of this hematologic malignancy\u003csup\u003e36\u003c/sup\u003e and plays a role in the constitutive activation of the JAK-STAT pathway\u003csup\u003e5\u003c/sup\u003e. It is interesting to note that 58% of our PV population was positive for the variant, which may initially differ from findings commonly described in the literature that point to \u003cem\u003eJAK2 V617F\u003c/em\u003e frequencies of over 70% in Brazilian, Korean, Chinese, Japanese, and European patients\u003csup\u003e31\u0026ndash;35\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe limited number of PV_\u003cem\u003eJAK2 V617F\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e patients identified in this study is related to cytoreductive therapy. We emphasize that 66.6% of patients with PV were on cytoreductive therapy, which acts to suppress and/or decrease the variant burden of \u003cem\u003eJAK2 V617F\u003c/em\u003e through the inhibition of the myeloproliferative process of mutated hematopoietic cells, as noted in a recent study\u003csup\u003e36\u003c/sup\u003e. This directly affects the sensitivity of the molecular detection methods used to identify the variant, underscoring the increased importance of incorporating molecular analysis for \u003cem\u003eJAK2 V617F\u003c/em\u003e in the initial suspicions for MPNs.\u003c/p\u003e \u003cp\u003eIn the literature, the germline haplotype 46/1, identified by the \u003cem\u003ers10974944\u003c/em\u003e (C\u0026thinsp;\u0026gt;\u0026thinsp;G) variant, has a well-documented association with \u003cem\u003eJAK2 V617F\u003c/em\u003e\u003csup\u003e14, 37\u0026ndash;39\u003c/sup\u003e as also observed in our study. The high frequency of the G allele of \u003cem\u003ers10974944\u003c/em\u003e in individuals positive for \u003cem\u003eJAK2 V617F\u003c/em\u003e contributes to discussions about the non-random correlation between these two genetic alterations\u003csup\u003e13, 40\u003c/sup\u003e This relationship is in line with another finding from our study, haplotype 2 (\u003cem\u003ers10974944\u003c/em\u003eG/rs10815151C/rs1011004A/\u003cem\u003ers77375493\u003c/em\u003eT), which strengthens concepts based on the interaction between \u003cem\u003ers10974944\u003c/em\u003e (C\u0026thinsp;\u0026gt;\u0026thinsp;G) and \u003cem\u003eJAK2 V617F\u003c/em\u003e (\u003cem\u003ers77375493\u003c/em\u003e - G\u0026thinsp;\u0026gt;\u0026thinsp;T). These propositions are in agreement with findings involving haplotype 46/1 in other Brazilian, Taiwanese, European, Chinese, and Japanese populations\u003csup\u003e16, 32\u0026ndash;34, 41\u003c/sup\u003e, indicating that the possible mechanisms preceding the acquisition of \u003cem\u003eJAK2 V617F\u003c/em\u003e are not limited to a specific ethnic group; therefore, its evolutionary basis can be considered as a genetic predisposition factor for the disease\u003csup\u003e8\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eStudies report a higher risk of individuals with the GG genotype of \u003cem\u003ers10974944\u003c/em\u003e being positive for \u003cem\u003eJAK2 V617F\u003c/em\u003e\u003csup\u003e14, 40, 42\u003c/sup\u003e. Consistent with the results of the aforementioned studies, our population exhibited a four-fold increase in the risk of positive \u003cem\u003eJAK2 V617F\u003c/em\u003e in individuals with the GG genotype of \u003cem\u003ers10974944\u003c/em\u003e. (OR: 4.1; 95% CI: 8-13.9). These findings support the hypothesis of hypermutability, which establishes haplotype 46/1 as a dysregulating agent of the \u003cem\u003eJAK2\u003c/em\u003e gene, which increases the risk of DNA replication errors and conditions a mutagenic scenario for the acquisition of variants with selective advantages, such as \u003cem\u003eJAK2 V617F\u003c/em\u003e\u003csup\u003e43\u0026ndash;45\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eThe association of \u003cem\u003ers10974944\u003c/em\u003e (G) and the \u003cem\u003eJAK2 V617F\u003c/em\u003e VAF suggests a possible involvement of haplotype 46/1 in clonal expansion. We identified a six-fold higher risk of individuals carrying the G allele of \u003cem\u003ers10974944\u003c/em\u003e and \u003cem\u003eJAK2 V617F\u003c/em\u003e VAF of \u0026ge;\u0026thinsp;50%. Our data indicate that the marker of haplotype 46/1 may play a role not only in the acquisition of \u003cem\u003eJAK2 V617F\u003c/em\u003e but is also attributed to clonal expansion, maintenance, and survival. Tefferi\u003csup\u003e46\u003c/sup\u003e suggests that \u003cem\u003eJAK2 V617F\u003c/em\u003e is not the initial clonogenic event in MPNs but rather one of several subclones derived from an ancestral clone. This is in accordance with the notes of Pardanani et al.\u003csup\u003e47\u003c/sup\u003e, which support the hypothesis that this haplotype is located in a favorable cis regulatory environment, which facilitates the acquisition of \u003cem\u003eJAK2 V617F\u003c/em\u003e, and which, in turn, is responsible for clonal expansion and the development of MPNs.\u003c/p\u003e \u003cp\u003eFurthermore, the possible role of acquired uniparental disomy, a genetic event that leads to mitotic recombination associated with neutral loss of heterozygosity of chromosome 9p in MPN patients, reducing both the haplotype and \u003cem\u003eJAK2 V617F\u003c/em\u003e to a homozygous state\u003csup\u003e14, 48, 49\u003c/sup\u003e, cannot be ruled out. In this context, cells with both variants theoretically have a selective advantage, which conditions greater myeloproliferative potential and favors the establishment of variant cells over healthy cells, thus explaining the increased VAF in individuals with the combination \u003cem\u003ers10974944\u003c/em\u003e (G)\u0026thinsp;+\u0026thinsp;\u003cem\u003ers77375493\u003c/em\u003e (T) (\u003cem\u003eJAK2 V617F\u003c/em\u003e) in homozygosity.\u003c/p\u003e \u003cp\u003eAssociation between the elevation of hematological indices and the presence of 46/1 is observed in the literature\u003csup\u003e16, 33, 50\u003c/sup\u003e; however, this is not a consensus among the scientific community\u003csup\u003e8,53,61\u003c/sup\u003e. Our data show significant differences in MCV, MCH values in the PV group, and RBC, Hb, and Ht in TE carriers of the G allele of \u003cem\u003ers10974944\u003c/em\u003e, which has been observed in previous studies\u003csup\u003e7, 42, 51\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe present research is the first to analyze the 46/1 haplotype using the \u003cem\u003ers10974944\u003c/em\u003e variant, present in intron 12 of JAK2, in a population from the Brazilian Amazon. The results of this study show that the \u003cem\u003ers10974944\u003c/em\u003e (G) variant is associated with \u003cem\u003eBCR::ABL1\u003c/em\u003e-negative myeloproliferative neoplasms, in patients positive for \u003cem\u003eJAK2 V617F\u003c/em\u003e, especially those with PV, and a high allelic variant burden in these patients, and hematological alterations. Furthermore, the haplotype \u003cem\u003ers10974944\u003c/em\u003eG/\u003cem\u003ers10815151\u003c/em\u003eC/\u003cem\u003ers1011004\u003c/em\u003eA/\u003cem\u003ers77375493\u003c/em\u003eT was identified as a factor related to PV.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003ePopulation:\u003c/strong\u003e One hundred individuals clinically diagnosed with \u003cem\u003eBCR::ABL1\u003c/em\u003e-negative myeloproliferative neoplasms were included in the study. The study was conducted from February 2021 to January 2023. Laboratory analysis was performed at the Genomics Laboratory of the Foundation Hospital for Hematology and Hemotherapy of the State of Amazonas.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval:\u003c/strong\u003e The study was submitted to and approved by the Ethics Committee of the Foundation Hospital for Hematology and Hemotherapy of the State of Amazonas under opinion No. 4,450,813 and certificate of ethical appreciation No. 39991420.6.0000.0009. Written informed consent was obtained from patients. This study complied with Resolution No. 466/2012 of the National Health Council for research involving human subjects and followed the parameters determined by the Declaration of Helsinki.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical and Laboratory Data:\u003c/strong\u003e Clinical data (gender, age, splenomegaly, thrombotic and/or hemorrhagic events) and laboratory data were obtained from medical records.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBiological Sample and DNA Extraction:\u003c/strong\u003e Venous blood samples were collected in tubes containing EDTA, and DNA was extracted using Brazol (Lgcbio, Brazil), following the manufacturer\u0026rsquo;s instructions, and stored at -80 \u0026deg;C.\u003c/p\u003e\n\u003cp\u003eConventional PCR and PCR purification: For the amplification of the DNA region under analysis, a reaction with a final volume of 25 \u0026mu;L was used with 50-100 ng of genomic DNA, Buffer (1x), MgCl\u003csub\u003e2\u003c/sub\u003e (1.5 mM), forward primer CCAACTGAGTTTCCTTGCAG and reverse primer CTAGGTTAAGAGTATGTGGTTCC (0.4 mM), dNTP mix (0.2 mM), and TAQ (1 U). The PCR products were separated on a 1.5% agarose gel. The PCR product, a 572 bp amplicon, was purified with polyethylene glycol (PEG 8000) (Promega).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNucleotide Sequencing and Sequence Analysis\u003c/strong\u003e: Approximately 5-30 ng of purified PCR product was applied to the sequencing reaction. Nucleotide sequencing was performed using BigDye\u003csup\u003e\u0026reg;\u003c/sup\u003e Terminator v3.1 (Applied Biosystems), following the manufacturer\u0026rsquo;s recommendations and the primers described above. The products were purified by the EDTA/Ethanol protocol and evaluated in the 3500 XL Genetic Analyzer\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003eautomatic sequencer (Applied BioSystems, USA), with POP-7 polymer. The sequences were initially analyzed using the Sequencing Analysis software (Applied BioSystems [Thermo Fisher Scientific, S\u0026atilde;o Paulo, Brazil]). Geneious 6.0.6 software (Biomatters, USA) was used to map the variants and obtain contigs for the comparison with the reference sequence Homo sapiens Janus kinase 2 (JAK2), (NCBI: NG_009904.1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHaplotype Analysis:\u003c/strong\u003e Haplotype frequencies were calculated using Haploview software (v.4.2) as a measure of linkage disequilibrium (LD). Haplotypes with frequencies of \u0026lt;1% were not considered relevant for comparisons. Pairwise degree between nucleotides was analyzed using the LD structure, considering r\u003csup\u003e2\u003c/sup\u003e values of \u0026gt;0.8 as strong LD, \u0026lt;0.8 as weak, and \u0026lt;0.1 as negative LD. Hardy-Weinberg equilibrium was calculated by comparing estimated and observed genotype frequencies using the \u0026chi;\u003csup\u003e2\u0026nbsp;\u003c/sup\u003etest. SNVs with p-values of \u0026lt;0.001 were considered to be out of Hardy-Weinberg equilibrium.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis:\u003c/strong\u003e The obtained results were subjected to the Shapiro-Wilk normality test. Categorical variables were expressed as absolute value (n) and relative frequency (%) and were tested using the \u0026chi;\u003csup\u003e2\u003c/sup\u003e and Fisher\u0026rsquo;s exact test with a 95% confidence interval. Numerical variables were expressed as median (Md) and interquartile range [IQR] with 75\u003csup\u003eth\u003c/sup\u003e percentile through GraphPad Prism v.9.0.2 software. For non-parametric variables, the Kruskal-Wallis test was performed. For both analyses, Dunn\u0026rsquo;s post-test for multiple comparisons was also conducted using GraphPad Prism v.9.0.2 software. P-values of \u0026lt;0.05 were considered statistically significant.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request. The GenBank accession number for the nucleotide sequence is PP208825.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank the Fundação de Amparo à Pesquisa do Estado do Amazonas (FAPEAM), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES).\u0026nbsp;Our thanks also go to the Fundação Hospitalar de Hematologia e Hemoterapia do Amazonas (FHEMOAM) and the medical staff and laboratory professionals for their assistance in carrying out the work. Special thanks go to Dr Enedina Nogueira at the Genomics Laboratory CAM/UFAM for her support and the use of the infrastructure for the molecular analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present study was supported by the Fundação de Amparo à Pesquisa do Estado do Amazonas (Pro-Estado Program; grant nos. #002/2008, #007/2018 and #005/2019, and POSGRAD Program grant nos. #008/2023), Conselho Nacional de Desenvolvimento Científico e Tecnológico, and Coordenação de Aperfeiçoamento de Pessoal de Nivel Superior.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCarried out the experiments: J.F.P; Population diagnosis: L.N.M.P., R.S.A., N.A.F.; Biological sample collection: J.F.P., D.G.T., D.C.A., M.A.S., E.V.B.A., E.A.M.; Original Draft - writing: J.F.P.; Figure production: J.F.P.; Statistical analysis - review: G.A.V., A.M.T., L.P.S.M; Manuscript - editing: J.F.P., G.A.V., A.M.T., L.P.S.M. All authors reviewed the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGrinfeld, J. \u003cem\u003eet al.\u003c/em\u003e Classification and Personalized Prognosis in Myeloproliferative Neoplasms. New England Journal of Medicine. 379 (15), 1416\u0026ndash;1430, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1056/nejmoa1716614\u003c/span\u003e\u003cspan address=\"10.1056/nejmoa1716614\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSwerdlow, S.H. \u003cem\u003eet al. World Health Organization Classification of Tumours This book and all other volumes of the series can be purchased: From all countri es\u003c/em\u003e. World Health Organization. (4th ed). (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhoury, J.D. \u003cem\u003eet al.\u003c/em\u003e The 5th edition of the World Health Organization Classification of Haematolymphoid Tumours: Myeloid and Histiocytic/Dendritic Neoplasms. \u003cem\u003eLeukemia\u003c/em\u003e. (June), doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41375-022-01613-1\u003c/span\u003e\u003cspan address=\"10.1038/s41375-022-01613-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGou, P., Zhang, W., Giraudier, S. Insights into the Potential Mechanisms of JAK2V617F Somatic Mutation Contributing Distinct Phenotypes in Myeloproliferative Neoplasms. International Journal of Molecular Sciences. 23 (3), doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms23031013\u003c/span\u003e\u003cspan address=\"10.3390/ijms23031013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTorres, D.G. \u003cem\u003eet al.\u003c/em\u003e JAK2 Variant Signaling: Genetic, Hematologic and Immune Implication in Chronic Myeloproliferative Neoplasms. \u003cem\u003eBiomolecules\u003c/em\u003e. 12 (2), 1\u0026ndash;18, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/biom12020291\u003c/span\u003e\u003cspan address=\"10.3390/biom12020291\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNielsen, C., Bojesen, S.E., Nordestgaard, B.G., Kofoed, K.F., Birgens, H.S. JAK2V617F somatic mutation in the general population: Myeloproliferative neoplasm development and progression rate. \u003cem\u003eHaematologica\u003c/em\u003e. 99 (9), 1448\u0026ndash;1455, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3324/haematol.2014.107631\u003c/span\u003e\u003cspan address=\"10.3324/haematol.2014.107631\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndrikovics, H. \u003cem\u003eet al.\u003c/em\u003e JAK2 46/1 haplotype analysis in myeloproliferative neoplasms and acute myeloid leukemia. Leukemia. 24 (10), 1809\u0026ndash;1813, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/leu.2010.172\u003c/span\u003e\u003cspan address=\"10.1038/leu.2010.172\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJones, A. V., Cross, N.C.P. Inherited predisposition to myeloproliferative neoplasms. Therapeutic Advances in Hematology. 4 (4), 237\u0026ndash;253, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/2040620713489144\u003c/span\u003e\u003cspan address=\"10.1177/2040620713489144\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTefferi, A. \u003cem\u003eet al.\u003c/em\u003e JAK2 germline genetic variation affects disease susceptibility in primary myelofibrosis regardless of V617F mutational status: Nullizygosity for the JAK2 46/1 haplotype is associated with inferior survival. Leukemia. 24 (1), 105\u0026ndash;109, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/leu.2009.225\u003c/span\u003e\u003cspan address=\"10.1038/leu.2009.225\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMangaonkar, A.A., Patnaik, M.M. Hereditary Predisposition to Hematopoietic Neoplasms: When Bloodline Matters for Blood Cancers. \u003cem\u003eMayo Clinic Proceedings\u003c/em\u003e. 95 (7), 1482\u0026ndash;1498, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mayocp.2019.12.013\u003c/span\u003e\u003cspan address=\"10.1016/j.mayocp.2019.12.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlcaydu, D. \u003cem\u003eet al.\u003c/em\u003e The role of the JAK2 GGCC haplotype and the TET2 gene in familial myeloproliferative neoplasms. Haematologica. 96 (3), 367\u0026ndash;374, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3324/haematol.2010.034488\u003c/span\u003e\u003cspan address=\"10.3324/haematol.2010.034488\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStolyar, M.A. \u003cem\u003eet al.\u003c/em\u003e JAK2 haplotype 46/1 and JAK2 V617F allele burden in MPN: New evidence against the \u0026ldquo;hypermutability\u0026rdquo; hypothesis? International Journal of Laboratory Hematology. 40 (1), e8\u0026ndash;e10, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/ijlh.12765\u003c/span\u003e\u003cspan address=\"10.1111/ijlh.12765\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaes, J., Silva, G.A.V., Tarrag\u0026ocirc;, A.M., Mour\u0026atilde;o, L.P. d. S. The Contribution of JAK2 46/1 Haplotype in the Predisposition to Myeloproliferative Neoplasms. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e. 23 (20), 20, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms232012582\u003c/span\u003e\u003cspan address=\"10.3390/ijms232012582\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJones, A. V. \u003cem\u003eet al.\u003c/em\u003e JAK2 haplotype is a major risk factor for the development of myeloproliferative neoplasms. Nature Genetics. 41 (4), 446\u0026ndash;449, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ng.334\u003c/span\u003e\u003cspan address=\"10.1038/ng.334\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTorres, D.G. \u003cem\u003eet al.\u003c/em\u003e Molecular landscape of the JAK2 gene in chronic myeloproliferative neoplasm patients from the state of Amazonas, Brazil. 1\u0026ndash;15, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/br.2023.1680\u003c/span\u003e\u003cspan address=\"10.3892/br.2023.1680\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMacedo, L.C. \u003cem\u003eet al.\u003c/em\u003e JAK2 46/1 haplotype is associated with JAK2 V617F - positive myeloproliferative neoplasms in Brazilian patients. International Journal of Laboratory Hematology. 37 (5), 654\u0026ndash;660, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/ijlh.12380\u003c/span\u003e\u003cspan address=\"10.1111/ijlh.12380\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarrison, C.N. \u003cem\u003eet al.\u003c/em\u003e The impact of myeloproliferative neoplasms (MPNs) on patient quality of life and productivity: results from the international MPN Landmark survey. Annals of Hematology. 96 (10), 1653\u0026ndash;1665, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00277-017-3082-y\u003c/span\u003e\u003cspan address=\"10.1007/s00277-017-3082-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVarghese, C., Immanuel, T., Ruskova, A., Theakston, E., Kalev-Zylinska, M.L. The epidemiology of myeloproliferative neoplasms in new zealand between 2010 and 2017: Insights from the new zealand cancer registry. Current Oncology. 28 (2), 1544\u0026ndash;1557, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/curroncol28020146\u003c/span\u003e\u003cspan address=\"10.3390/curroncol28020146\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzuber, N. \u003cem\u003eet al.\u003c/em\u003e Myeloproliferative neoplasms in the young: Mayo Clinic experience with 361 patients age 40 years or younger. American Journal of Hematology. 93 (12), 1474\u0026ndash;1484, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ajh.25270\u003c/span\u003e\u003cspan address=\"10.1002/ajh.25270\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB\u0026uuml;y\u0026uuml;kaşik, Y., Ali, R., Ar, C., Turgut, M., Yavuz, S., Saydam, G. Polycythemia vera: Diagnosis, clinical course, and current management. Turkish Journal of Medical Sciences. 48 (4), 698\u0026ndash;710, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3906/sag-1806-43\u003c/span\u003e\u003cspan address=\"10.3906/sag-1806-43\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConstantinescu, S.N., Vainchenker, W., Levy, G., Papadopoulos, N. Functional Consequences of Mutations in Myeloproliferative Neoplasms. \u003cem\u003eHemaSphere\u003c/em\u003e. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/HS9.0000000000000578\u003c/span\u003e\u003cspan address=\"10.1097/HS9.0000000000000578\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAzevedo, A.N.A.P. \u003cem\u003eet al.\u003c/em\u003e DNA repair genes polymorphisms and genetic susceptibility to Philadelphia-negative myeloproliferative neoplasms in a Portuguese population: The role of base excision repair genes polymorphisms. 4641\u0026ndash;4650, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/ol.2017.6065\u003c/span\u003e\u003cspan address=\"10.3892/ol.2017.6065\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarraco, D. \u003cem\u003eet al.\u003c/em\u003e Gender effect on phenotype and genotype in patients with post-polycythemia vera and post-essential thrombocythemia myelofibrosis: results from the MYSEC project. Blood Cancer Journal. 8 (10), 10\u0026ndash;13, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41408-018-0128-x\u003c/span\u003e\u003cspan address=\"10.1038/s41408-018-0128-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerrer, A., Mangaonkar, A.A., Patnaik, M.M. Clonal Hematopoiesis and Myeloid Neoplasms in the Context of Telomere Biology Disorders. Current Hematologic Malignancy Reports. 61\u0026ndash;68, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11899-022-00662-8\u003c/span\u003e\u003cspan address=\"10.1007/s11899-022-00662-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuncombe, A.S. \u003cem\u003eet al.\u003c/em\u003e Modifiable Lifestyle and Medical Risk Factors Associated With Myeloproliferative Neoplasms. \u003cem\u003eHemaSphere\u003c/em\u003e. 1\u0026ndash;6 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllahverdi, N., Yassin, M., Ibrahim, M. Environmental Factors, Lifestyle Risk Factors, and Host Characteristics Associated With Philadelphia Negative Myeloproliferative Neoplasm : A Systematic Review. Cancer control. 28, 1\u0026ndash;12, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/10732748211046802\u003c/span\u003e\u003cspan address=\"10.1177/10732748211046802\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVannucchi, A.M., Harrison, C.N. Emerging treatments for classical myeloproliferative neoplasms. Blood. 129 (6), 693\u0026ndash;703, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1182/blood-2016-10-695965\u003c/span\u003e\u003cspan address=\"10.1182/blood-2016-10-695965\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeyer, H.L. \u003cem\u003eet al.\u003c/em\u003e Associations between gender, disease features and symptom burden in patients with myeloproliferative neoplasms: an analysis by the MPN QOL International Working Group. Haematologica. 102, 85\u0026ndash;93, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3324/haematol.2016.149559\u003c/span\u003e\u003cspan address=\"10.3324/haematol.2016.149559\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatterson-Fortin, J., Moliterno, A.R. Molecular Pathogenesis of Myeloproliferative Neoplasms: Influence of Age and Gender. Current Hematologic Malignancy Reports. 12 (5), 424\u0026ndash;431, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11899-017-0411-0\u003c/span\u003e\u003cspan address=\"10.1007/s11899-017-0411-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNangalia, J., Green, A.R. Myeloproliferative neoplasms: From origins to outcomes. Blood. 130 (23), 2475\u0026ndash;2483, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1182/blood-2017-06-782037\u003c/span\u003e\u003cspan address=\"10.1182/blood-2017-06-782037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePorto-Soares, M.A., de Oliveira, R.D., Cortopassi, G.M., Machado-Neto, J.A., Palma, L.C., Figueiredo-Pontes, L.L. de Clinical and molecular profile of a Brazilian cohort of patients with classical BCR-ABL1-negative myeloproliferative neoplasms. Hematology, Transfusion and Cell Therapy. 42 (3), 238\u0026ndash;244, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.htct.2019.07.008\u003c/span\u003e\u003cspan address=\"10.1016/j.htct.2019.07.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, X., Hu, T., Wu, Z., Kang, Z., Liu, W., Guan, M. The JAK2 46/1 haplotype is a risk factor for myeloproliferative neoplasms in Chinese patients. International Journal of Hematology. 96 (5), 611\u0026ndash;616, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12185-012-1169-8\u003c/span\u003e\u003cspan address=\"10.1007/s12185-012-1169-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOhyashiki, J.H., Yoneta, M., Hisatomi, H., Iwabuchi, T., Umezu, T., Ohyashiki, K. The C allele of JAK2 rs4495487 is an additional candidate locus that contributes to myeloproliferative neoplasm predisposition in the Japanese population. BMC Medical Genetics. 13 (1), 6, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1471-2350-13-6\u003c/span\u003e\u003cspan address=\"10.1186/1471-2350-13-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLighezan, D.L. \u003cem\u003eet al.\u003c/em\u003e TET2 rs1548483 SNP associating with susceptibility to molecularly annotated polycythemia vera and primary myelofibrosis. Journal of Personalized Medicine. 10 (4), 1\u0026ndash;16, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/jpm10040259\u003c/span\u003e\u003cspan address=\"10.3390/jpm10040259\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim, Y., Lee, J.O., Bang, S.M. Incidence, survival and prevalence statistics of classical myeloproliferative neoplasm in Korea. Journal of Korean Medical Science. 31 (10), 1579\u0026ndash;1585, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3346/jkms.2016.31.10.1579\u003c/span\u003e\u003cspan address=\"10.3346/jkms.2016.31.10.1579\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarrison, C., Baxter, J., Jackson, A., Fletcher, R.S., Francis, S., Clark, F.J. Effects of Tamoxifen on the Mutant Allele Burden and Disease Course in Patients with Myeloproliferative Neoplasms - Results of the Tamarin Study. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1182/blood-2020-134764\u003c/span\u003e\u003cspan address=\"10.1182/blood-2020-134764\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlcaydu, D. \u003cem\u003eet al.\u003c/em\u003e A common JAK2 haplotype confers susceptibility to myeloproliferative neoplasms. Nature Genetics. 41 (4), 450\u0026ndash;454, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ng.341\u003c/span\u003e\u003cspan address=\"10.1038/ng.341\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnelli, L., Zagaria, A., Specchia, G., Albano, F. The JAK2 GGCC (46/1) haplotype in myeloproliferative neoplasms: Causal or random? International Journal of Molecular Sciences. 19 (4), 1\u0026ndash;12, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms19041152\u003c/span\u003e\u003cspan address=\"10.3390/ijms19041152\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKilpivaara, O. \u003cem\u003eet al.\u003c/em\u003e A germline JAK2 SNP is associated with predisposition to the development of JAK2V617F -positive myeloproliferative neoplasms. Nature Genetics. 41 (4), 455\u0026ndash;459, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ng.342.A\u003c/span\u003e\u003cspan address=\"10.1038/ng.342.A\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrifa, A.P. \u003cem\u003eet al.\u003c/em\u003e The G allele of the JAK2 rs10974944 SNP, part of JAK2 46/1 haplotype, is strongly associated with JAK2 V617F-positive myeloproliferative neoplasms. Annals of Hematology. 89 (10), 979\u0026ndash;983, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00277-010-0960-y\u003c/span\u003e\u003cspan address=\"10.1007/s00277-010-0960-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChiang, Y., Chang, Y., Lin, H., Huang, L. Germline variations at JAK2, TERT, HBS1L-MYB and MECOM and the risk of myeloproliferative neoplasms in Taiwanese population. Oncotarget. 8 (44), 76204\u0026ndash;76213 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTapper, W. \u003cem\u003eet al.\u003c/em\u003e Genetic variation at MECOM, TERT, JAK2 and HBS1L-MYB predisposes to myeloproliferative neoplasms. Nature Communications. 6, 1\u0026ndash;11, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ncomms7691\u003c/span\u003e\u003cspan address=\"10.1038/ncomms7691\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMasselli, E., Pozzi, G., Carubbi, C., Vitale, M. The genetic makeup of myeloproliferative neoplasms: Role of germline variants in defining disease risk, phenotypic diversity and outcome. \u003cem\u003eCells\u003c/em\u003e. 10 (10), doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cells10102597\u003c/span\u003e\u003cspan address=\"10.3390/cells10102597\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCampbell, P.J. Somatic and germline genetics at the JAK2 locus. Nature Methods. 41 (4), 385\u0026ndash;386, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ng0409-385\u003c/span\u003e\u003cspan address=\"10.1038/ng0409-385\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHermouet, S., Vilaine, M. The JAK2 46/1 haplotype: A marker of inappropriate myelomonocytic response to cytokine stimulation, leading to increased risk of inflammation, myeloid neoplasm, and impaired defense against infection? \u003cem\u003eHaematologica\u003c/em\u003e. 96 (11), 1575\u0026ndash;1579, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3324/haematol.2011.055392\u003c/span\u003e\u003cspan address=\"10.3324/haematol.2011.055392\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTefferi, A. Molecular drug targets in myeloproliferative neoplasms: Mutant ABL1, JAK2, MPL, KIT, PDGFRA, PDGFRB and FGFR1. Journal of Cellular and Molecular Medicine. 13 (2), 215\u0026ndash;237, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1582-4934.2008.00559.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1582-4934.2008.00559.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePardanani, A. \u003cem\u003eet al.\u003c/em\u003e The JAK2 46/1 haplotype confers susceptibility to essential thrombocythemia regardless of JAK2V617F mutational statusclinical correlates in a study of 226 consecutive patients. Leukemia. 24 (1), 110\u0026ndash;114, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/leu.2009.226\u003c/span\u003e\u003cspan address=\"10.1038/leu.2009.226\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKralovics, R., Guan, Y., Prchal, J.T. Acquired uniparental disomy of chromosome 9p is a frequent stem cell defect in polycythemia vera. Experimental Hematology. 30 (3), 229\u0026ndash;236, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0301-472X(01)00789-5\u003c/span\u003e\u003cspan address=\"10.1016/S0301-472X(01)00789-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSullivan, J.O., Mead, A.J. Heterogeneity in myeloproliferative neoplasms: Causes and consequences. Advances in Biological Regulation. 71, 55\u0026ndash;68, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jbior.2018.11.007\u003c/span\u003e\u003cspan address=\"10.1016/j.jbior.2018.11.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMart\u0026iacute;nez-Trillos, A. \u003cem\u003eet al.\u003c/em\u003e Relationship between the 46/1 haplotype of the JAK2 gene and the JAK2 mutational status and allele burden, the initial findings, and the survival of patients with myelofibrosis. Annals of Hematology. 93 (5), 797\u0026ndash;802, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00277-013-1989-5\u003c/span\u003e\u003cspan address=\"10.1007/s00277-013-1989-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOddsson, A. \u003cem\u003eet al.\u003c/em\u003e The germline sequence variant rs2736100-C in TERT associates with myeloproliferative neoplasms. Leukemia. 28 (6), 1371\u0026ndash;1374, doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/leu.2014.48\u003c/span\u003e\u003cspan address=\"10.1038/leu.2014.48\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3880113/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3880113/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBCR::ABL1-negative myeloproliferative neoplasms are hematopoietic disorders characterized by panmyelosis. \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eJAK2 V617F\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e is a frequent variant in these diseases and often occurs in the 46/1 haplotype. The G allele of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ers10974944\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e has been shown to be associated with this variant, specifically its acquisition, correlations with familial cases, and laboratory alterations. This study evaluated the association between the 46/1 haplotype of JAK2 in patients with myeloproliferative neoplasms in a population from the Brazilian Amazon. Clinical, laboratory and molecular sequencing analyses were considered. Carriers of the G allele of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ers10974944\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e with polycythemia vera showed an increase in mean corpuscular volume and mean corpuscular hemoglobin, while in those with essential thrombocythemia, there was an elevation in red blood cells, hematocrit, and hemoglobin. Associations were observed between \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ers10974944\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eJAK2 V617F\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, in which the G allele (OR: 3.47; p \u0026lt; 0.0001), CG genotype (OR: 8.4; p = 0.002), and GG genotype (OR: 4.1; p = 0.002) were associated with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eJAK2 V617F\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e+ and an increase in variant allele frequency (GG: OR 13.1; p = 0.004; G: OR: 6.0; p = 0.0002). These results suggest an association between \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ers10974944\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e (G) and a status for \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eJAK2 V617F\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eJAK2 V617F\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e+_VAF ≥50%, and laboratory alterations in the erythroid lineage.\u003c/strong\u003e\u003c/p\u003e","manuscriptTitle":"Hematological alterations associated with the SNV rs10974944, part of the 46/1 haplotype, in patients from the Brazilian Amazon with BCR::ABL1-negative myeloproliferative neoplasms","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-02 15:27:04","doi":"10.21203/rs.3.rs-3880113/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-02-15T03:32:58+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-02-07T07:30:37+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"0c0a3b9a-dd6f-41fa-b3d7-fff746e31212","date":"2024-02-05T14:30:13+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-02-01T11:31:10+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-02-01T08:54:11+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-02-01T08:47:20+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-02-01T05:16:05+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-01-19T23:18:02+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3b9b88b1-b236-4d3f-b675-e7d8e33f3e65","owner":[],"postedDate":"February 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":28507646,"name":"Biological sciences/Cancer/Haematological cancer/Myeloproliferative disease"},{"id":28507647,"name":"Biological sciences/Genetics"}],"tags":[],"updatedAt":"2024-04-18T09:42:48+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-02 15:27:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3880113","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3880113","identity":"rs-3880113","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00