Epidemiological Characteristics of Severe Fever with Thrombocytopenia Syndrome collect from Yangzhou China in the year of 2024

Epidemiological Characteristics of Severe Fever with Thrombocytopenia Syndrome collect from Yangzhou China in the year of 2024 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Epidemiological Characteristics of Severe Fever with Thrombocytopenia Syndrome collect from Yangzhou China in the year of 2024 Zhang Chengcheng, Zhang Liutao, Huang Yao, Xu Chaojie, Yang Huimin, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7212366/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Severe Fever with Thrombocytopenia Syndrome (SFTS) is an emerging infectious disease that poses a significant threat to public health, given its high fatality rate and potential for person-to-person transmission. Caused by the SFTS virus (SFTSV), a novel bunyavirus first identified in central and eastern China, SFTS has drawn increasing attention in recent years. Methods To gain an updated and in-depth insight into the epidemiological features of SFTS in eastern China, this study collected all confirmed SFTS cases in the year of 2024 from Yangzhou, Jiangsu Province. A total of 33 laboratory-confirmed SFTS cases were included in the analysis; after obtaining their complete viral genome sequences through sequencing, an epidemiological investigation was conducted. Additionally, a phylogenetic tree was constructed using MEGA-X software. Results Our findings revealed that the number of SFTS cases in Yangzhou showed an overall upward trend over the study period, with only a slight decline in the past three years. The laboratory confirmation rate stood at approximately 64.4%. Most SFTS cases were sporadic rather than clustered. Notably, the mortality rate exhibited a positive correlation with age-rising as patients’ age increased. Conclusions In summary, this study systematically analyzed laboratory-confirmed SFTS cases in Yangzhou. The results suggest that the diagnostic and reporting criteria for SFTS need further optimization and standardization. Such improvements would facilitate a more accurate understanding of the disease’s epidemiological characteristics and provide scientific evidence to support SFTS prevention and control efforts. severe fever with thrombocytopenia syndrome epidemiological characteristics surveillance Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Severe Fever with Thrombocytopenia Syndrome (SFTS), induced by the SFTS virus (SFTSV), has emerged as a prominent infectious disease in Asian nations in recent years, characterized by a notably high case-fatality rate[1, 2]. Back in 2007, the first SFTS cases were detected in China, presenting symptoms that bore a resemblance to human granulocytic anaplasmosis (HGA)[3]. Then, in 2009, SFTSV began to show a widespread presence across 23 provinces in the country [4, 5]. Beyond China, reports of SFTS or SFTS-like cases have also surfaced in South Korea [6], Japan [7], Australia [8], and the United States[9], suggesting that SFTS and related diseases may have a global distribution potential. Along with the strengthening of surveillance measures, a new phlebovirus belonging to the Bunyaviridae family was successfully isolated and identified in 2010 [10]. SFTSV is classified as a tick-borne virus, and this classification is supported by evidence showing that the virus exists in two tick species: Haemaphysalis longicornis and Rhipicephalus microplus [4, 11]. Considering the lack of effective vaccines and therapeutic methods, its high mortality rate, and the risk of a global pandemic, SFTS was listed by the World Health Organization (WHO) as one of the top 10 priority infectious diseases in 2018[12]. Like other bunyaviruses, SFTSV particles exhibit a spherical shape with a diameter ranging from 80 to 100nm. They are enclosed by a unit membrane envelope, from which polypeptide spikes-5 to 10nm in length-project outward [13]. Currently, at least six distinct genotypes (A through F) of SFTSV have been identified, and their geographical distribution differs across various regions and countries [14]. The SFTSV genome is divided into three segments: large (L), medium (M), and small (S), with respective nucleotide lengths of 6368, 3378, and 1744. The S segment adopts a reverse-oriented coding strategy, producing both the viral nucleocapsid protein (NP) and nonstructural proteins (NSs). NP binds to the viral genomic RNA (vRNA) to form ribonucleoprotein complexes (RNPs), which serve to shield the vRNA from breakdown by either exogenous nucleases or the host’s immune defense mechanisms [15]. It has been established that the NP of phleboviruses folds into a tightly packed core domain with an elongated N-terminal arm [16], this structural feature enables the formation of higher-order oligomers-such as tetramers, pentamers, or hexamers-and thereby promotes SFTSV replication [17]. The L segment encodes the RNA-dependent RNA polymerase (RdRp), a key enzyme required for RNA transcription and replication. Meanwhile, the M segment contains a single open reading frame that generates a 1073-amino acid glycoprotein precursor. This glycoprotein is critical for multiple viral processes, including virion assembly, particle formation, and attachment to new host target cells. The clinical diagnosis of Severe Fever with Thrombocytopenia Syndrome (SFTS) often presents difficulties, primarily due to the highly non-specific nature of its symptoms. For this reason, laboratory-based tests are indispensable for verifying SFTSV infection. A range of diagnostic approaches have been established to date, such as virus isolation, detection of viral RNA, and identification of SFTSV-specific antibodies [18, 19]. Although virus isolation serves as a definitive means of confirming SFTSV infection, it is both time-intensive and demands high-level biosafety conditions (specifically, BSL-3). To accelerate the diagnostic process, various detection assays have been developed that target either viral RNA or serological markers associated with SFTSV. In this study, we present the separation of all laboratory-confirmed cases of SFTSV infection in Yangzhou, a city located in Jiangsu Province, China. All the viruses from these cases were isolated, and their full genome sequences were acquired using next-generation sequencing technology. Additionally, we conducted an analysis of the characteristics of all involved cases as well as the epidemiological traits of the isolated SFTSV strains. Materials and Methods Cell and virus culture The Vero cells were stored in our lab and cultrued in Dulbecco’s modified eagle’s medium (DMEM, Thermo Fisher Scientific) with 10% (v/v) fetal bovine serum (FBS, Gibco), 10 kU/ml penicillin 1%10 mg/ml streptomycinand 250 µg/ml amphotericin B(Sigma-Aldrich, Burlington, MA, USA) at 37 ℃ with 5% CO 2 [20]. In this study, the SFTSV virus we used was separated by ourselves in Yangzhou. RNA extraction and PCR assay The PCR assays used in the current study were performed as previously described [21]. Briefly, a total of 200 µl of serum was used for RNA extraction using TRIzol reagent (Invitrogen, 15596026). Two µg of RNA were reversely transcribed into cDNA using Super Scriptase (Invitrogen, 15596026) following the manufacturer’s instructions. The fulllength genes of SFTSV genome were amplified by PCR. The primer used is, SFTSV-F: GGCTGTTCATCATTATTGTC, SFTSV-R: CCTCAGCAAGCCCTATT. The PCR conditions were 98℃ 30 s, 50℃ for 10 min, followed by 30 cycles of 95℃ for 30 s, 56℃ for 30 s, and 72℃ for 35 s, with a final step of 72℃ for 5 min. The products of PCR were analyzed by agarose gel electrophoresis. Transmission electron microscopy To further confirmed we have separated the SFTSV virus in Vero cells, after subcultured three times consecutively in dish. The cells were washed three times with cold PBS and fixed with 2.5% glutaraldehyde at room temperature for 5 min. The cells were gently scraped in one direction and collected by centrifugation at 3000 rpm for 5 min. The cells were dehydrated with gradient concentrations of ethanol (50%, 70%, 80%, 90%, and 95%, respectively) and embedded in epoxy resin after being fixed with 1% osmium tetroxide for 2 h. Next, ultrathin sections were prepared, and granulate-like materials were observed using transmission electron microscopy after staining with 3% uranyl acetate and lead citrate[22]. Data Collection and Management In the present study, data on SFTS spanning from 2020 to 2024 were collected from the National Notifiable Disease Reporting System -a disease surveillance network in China that functions across administrative levels from counties up to provinces. With proper authorization, SFTS case-related information can be extracted from this system for in-depth analysis. The SFTS cases included in the analysis were all laboratory-confirmed. The case records retrieved for statistical assessment primarily covered indicators such as current residential address, age, gender, occupation, onset date, case classification, survival status, and other relevant metrics. All data extraction and utilization in this research were processed anonymously to safeguard patient privacy and ensure data confidentiality. Analysis of whole genome sequence of separated SFTSV viruses homology and evolution The nucleotide sequence homology analysis of the whole genome sequence between the isolates and the reference strains was conducted using software such as DNAstar or websites. The system evolutionary tree was constructed using MAGE-X software. Results Overview of SFTS in Yangzhou Jiangsu province China From 2010 to 2019, a total of 13,824 SFTS cases involving 8899 lab-confirmed cases and 4925 probable cases were reported in mainland China, with 713 deaths. From 2020 to 2024, a total of 1148 SFTS cases confirmed by laboratory in Jiangsu province China, with 149 deaths. Figure 1 shows the changing trend of the number of SFTS cases and the fatality rate in Jiangsu province from 2020 to 2024, with the average annual fatality rate being 12% in the province. The number of SFTS cases showed an increasing trend between 2020 (141 cases) and 2024 (422 cases), which then decreased to 136 cases in 2021. However, the annual fatality rate showed a significantly increased from 2020 (9.9%) to 2024 (17.5%). In 2024, Jiangsu Province reported 422 confirmed cases of fever, an increase of 79.6% (235 cases) compared with last year. There were 74 reported deaths, an increase of 184.6% (26 cases) compared with last year. Yangzhou is a prefecture-level city in Jiangsu Province, we collected the samples from hospital and finally confirmed 33 cases of SFTS in Yangzhou in the year of 2024. Shown as Fig. 2 , 28 of the 33 patients in whom SFTS was diagnosed were aged ≥ 50 years (Fig. 2 A) and came from western mountainous area of Yangzhou. Disease onset occurred in all patients between the months of April and September (Fig. 2 B). Eleven of the 33 cases were fatal. There was clear evidence of tick bite in 8 cases. Clinical Manifestation of 33 SFTS Patients The clinical manifestations observed in SFTS patients are summarized in Table 1. All patients exhibited nonspecific febrile symptoms accompanied by general fatigue, leukopenia, and thrombocytopenia-hallmark manifestations of SFTSV infection. Clinically, most cases presented with gastrointestinal symptoms, including nausea, vomiting, and diarrhea. In contrast, hemoptysis, bloody diarrhea, myalgia, and arthralgia were rarely observed. However, headache was reported in 18 out of 33 patients. Additionally, a confirmed tick bite within the preceding two weeks was documented in 8 cases. SFTSV isolation and identification Patients serum were used for virus isolation using Vero cells. After continuously passaged, cytopathic effect appeared in Vero cells (Shown as Fig. 3 A and 3 B). DNA amplified by conventional RT-PCR showed the expected sizes of 185bp in agarose-electrophoresis (Fig. 3 C). Furthermore, the inoculated Vero cells were detected by electron microscopy, enveloped and spherical virions with approximate diameters of 100 nm were detected (Fig. 3 D). The morphology of the virion is compatible with that of a bunyavirus. Analysis the Epidemiological Characteristics of SFTS separated in Yangzhou Many DNA fragments that were homologous to those of SFTSV were detected in the culture supernatant of the Vero cells inoculated in next-generation sequencing. Yangzhou isolates formed two clusters that was independent from Chinese isolates (Fig. 4 ), indicating that SFTSV has been circulating inYangzhou naturally for some time. The prevalence of SFTS in and around East Asia should be studied to clarify the nature of SFTS in the region. The recombination rate of SFTSV whole genome sequence was analyzed using RDP4 software Homologous recombination analysis was conducted using RDP4 software, comparing the two SFTSV sequences isolated in our study with those uploaded to the NCBI database. The results are presented in Fig. 5 . Specifically, recombination events were analyzed for three gene fragments of SFTSV: the L fragment analysis revealed recombination in 6 strains, the M fragment analysis identified recombination in 1 strain, and the S fragment analysis detected recombination in 3 strains. Discussion Between 2009 and 2010, Chinese researchers became the first to identify the SFTS virus through the application of molecular biology, virus isolation, serology, and other technical approaches [23]. This virus is responsible for an acute infectious disease characterized by a high fatality rate, with tick bites serving as its primary mode of transmission[24]. Drawing on early insights into SFTS, China initiated surveillance, reporting, prevention, and control measures targeting the virus. In accordance with relevant regulations, SFTS is classified as a notifiable Class B infectious disease, mandating its reporting. For the present study, we retrieved all SFTS case data from the NNDRS in Jiangsu Province spanning 2020 to 2024, and on this basis, conducted a systematic analysis of the epidemiological features at the provincial level. The accumulative number of provinces that reported SFTS cases increased from 5 to 25 from year of 2010 to 2019 in China. However, the SFTS cases were still mainly distributed in seven provinces located in central, eastern, and northeastern China. From 2020 to 2024, the total laboratory confirmation SFTSV infection cases is 1148 in Jiangsu province, and it shows an overall upward trend year by year. The highest was observed in 2024 (422 cases) and the lowest in 2021 (136 cases). In contrast, the annual mortality rate is also on the rise, especially in 2024, with a significant increase (Fig. 1 ). Specifically, we separated 33 strains of SFTSV virues in the year of 2024, as the Fig. 2 showns, most cases reported in the age of 50–79 (75.75%, 25/33). In terms of time, most cases mainly distributed between April and September (84.84%, 28/33) and peaked in May (Fig. 2 ). As the sequence analyse shown, the strain we isolated was not found in the parent strain. As the Fig. 5 A shown, there are six recombination events in the L sequence, the red box is the recombinant strain, and the two columns on the right indicate that the recombinant strain is recombination from these two strains. The blue triangle indicates that trees constructed at nucleotide positions 4500 to 5500 all have very similar branches, with less difference between phylogenetic trees (red-orange regions) constructed from similarly sized sequence sections sampled from elsewhere. As the Fig. 5 B shown, there is one recombination event in the M sequence, the red box is the recombinant strain, and the two columns on the right indicate that the recombinant strain is recombination from these two strains. The blue triangle indicates that trees constructed at nucleotide positions 250 to 900 all have very similar branches, with less difference between them than phylogenetic trees constructed with similarly sized sequence parts sampled from elsewhere (red-orange regions). As the Fig. 5 C shown, there are three recombination events in the S sequence, the red box is the recombinant strain, and the two columns on the right indicate that the recombinant strain is recombination from these two strains. The blue triangle indicates that trees constructed at nucleotide positions 600 to 800 all have very similar branches, with less difference between them than phylogenetic trees constructed with similarly sized sequence parts sampled from elsewhere (red-orange regions). These results indicated that the isolates had good uniqueness and sequence specificity (Figs. 4 and 5 ). Currently, the incidence of SFTS may be influenced by a multitude of factors. As a tick-borne zoonotic disease, SFTS sees its transmission and prevalence inevitably impacted by the distribution density of ticks. Consequently, any factor that affects the survival, development, reproduction, or behavior of vector ticks can directly or indirectly influence the prevalence of SFTS—this underscores the need to strengthen public awareness campaigns. For instance, temperature and precipitation can alter the life cycle and spatial distribution of ticks directly, thereby exerting an effect on the occurrence of SFTS[25, 26]. SFTS is an emerging hemorrhagic fever with a fatality rate of 5.2%, which is significantly higher than that of other viral hemorrhagic fevers in China, such as hemorrhagic fever with renal syndrome and dengue fever. It remains a critical public health concern in the country. Yearly reported fatal cases of SFTS have shown an upward trend. The fatality rate of SFTS is thought to be associated with factors including patient age, viral load at the time of infection, disease course, and local diagnostic and treatment capacities [27, 28]. Further research should focus on the variations in fatality rates across different high-risk regions. Notably, age-specific mortality exhibits a tendency to rise with increasing age-a pattern consistent with that observed between 2011 and 2014 [29]. In conclusion, SFTSV is prevalent in China. Yangzhou SFTSV strains have characteristics similar to those of Chinese isolates but an independent genotype, which indicates that SFTSV has been largely present in most part of China. Conclusions In this study, we conducted a systematic analysis of the epidemiological traits of all SFTS cases reported in Yangzhou, China, during 2024. The majority of these SFTS cases were middle-aged and elderly farmers. It is worth noting, however, that the regional spread of the disease showed a tendency to expand. In light of this, it is recommended that SFTS be given greater attention across the country. Additionally, diagnostic and reporting protocols should be revised based on more in-depth, detailed research. Such measures would help achieve a more comprehensive understanding of the disease’s epidemiological features and offer scientific evidence to support SFTS prevention and control efforts. Declarations Author Contributions Conceptualization, Zhang Chengcheng and Wang Yin; methodology, Zhang Liutao and Huang Yao; software, Xu Chaojie; validation, Yang Huimin; formal analysis, Zhang Chengcheng; writing original draft preparation, Zhang Liutao; writing—review and editing, Wang Yin; project administration and funding acquisition, Wang Yin. All authors have read and agreed to the published version of the manuscript. Funding This research was funded by the General Program of Jiangsu Preventive Medical Association [Grant Ym2023090], General Program of Yangzhou Health Commission [Grant 2023-2-34], Open Project Program of Jiangsu Key Laboratory of Zoonosis [Grant R2312], and ‘High-end talent support program’ of Yangzhou University and A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). Data Availability Statement All available data were presented in this study. Ethics approval and consent to participate This study was approved by the ethics committee of the National Institute for Viral Disease Control and Prevention, Chinese Yangzhou city Center for Disease Control and Prevention (KY2024007). Our study was adhered to the Declaration of Helsinke. Written informed consent was obtained from the study participants. Conflicts of Interest The authors declare no conflict of interest. References Bianli X, Licheng L, Xueyong H, Hong M, Yuan Z, Yanhua D, Pengzhi W, Xiaoyan T, Haifeng W, Kai K et al : Metagenomic analysis of fever, thrombocytopenia and leukopenia syndrome (FTLS) in Henan Province, China: discovery of a new bunyavirus . PLoS Pathog 2011, 7 (11). 10.1371/journal.ppat.1002369. Yasi T, Miao D, Xueying Z, Tianxin X, Daxian W: Dabie bandavirus and Mycoplasma pneumoniae co-infection: a case report . BMC Infect Dis 2025, 25 (1). 10.1186/s12879-024-10392-2. Chang-jun B, Xi-ling G, Xian Q, Jian-li H, Ming-hao Z, Jay K V, Lun-biao C, Hai-tao Y, Yong-jun J, John D K et al : A family cluster of infections by a newly recognized bunyavirus in eastern China, 2007: further evidence of person-to-person transmission . Clin Infect Dis 2011, 53 (12). 10.1093/cid/cir732. Xue-Jie Y, Mi-Fang L, Shou-Yin Z, Yan L, Jian-Dong L, Yu-Lan S, Lihong Z, Quan-Fu Z, Vsevolod L P, Chuan L et al : Fever with thrombocytopenia associated with a novel bunyavirus in China . N Engl J Med 2011, 364 (16). 10.1056/NEJMoa1010095. Shuyi L, Zhifeng L, Nan Z, Xiaochen W, Yuanfang Q, Wei X, Changjun B, Jianli H: Epidemiological and spatiotemporal analysis of severe fever with thrombocytopenia syndrome in Eastern China, 2011-2021 . BMC Public Health 2023, 23 (1). 10.1186/s12889-023-15379-3. Young Ree K, Yeojun Y, Seung Geon B, Dahee P, Suhyun K, Jae Myun L, Nam-Hyuk C, Yang Soo K, Keun Hwa L: Severe Fever with Thrombocytopenia Syndrome Virus Infection, South Korea, 2010 . Emerg Infect Dis 2018, 24 (11). 10.3201/eid2411.170756. Toru T, Ken M, Tadaki S, Aki I, Toru S, Takayuki T, Toshiaki K, Masahiro H, Daisuke N, Takenori S et al : The first identification and retrospective study of Severe Fever with Thrombocytopenia Syndrome in Japan . J Infect Dis 2013, 209 (6). 10.1093/infdis/jit603. Jianning W, Paul S, Meng Y, Wendy H, Chrissy R, Rosemary G, Terry W, Sandra C, Honglei C, Ivano B et al : Novel phlebovirus with zoonotic potential isolated from ticks, Australia . Emerg Infect Dis 2014, 20 (6). 10.3201/eid2006.140003. Laura K M, Scott M F, Aubree J K, Adam M, Cynthia S G, Maureen G M, Brigid C B, César G A, Sherif R Z, Pierre E R et al : A new phlebovirus associated with severe febrile illness in Missouri . N Engl J Med 2012, 367 (9). 10.1056/NEJMoa1203378. De-xin L: Fever with thrombocytopenia associated with a novel bunyavirus in China . Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 2011, 25 (2). Yong-Zhen Z, Dun-Jin Z, Xin-Cheng Q, Jun-Hua T, Yanwen X, Jian-Bo W, Xiao-Ping C, Dong-Ya G, Yong-Wen H, Dong J et al : The ecology, genetic diversity, and phylogeny of Huaiyangshan virus in China . J Virol 2011, 86 (5). 10.1128/jvi.06192-11. Jing L, Shen L, Li Y, Pengfei C, Jianhong L: Severe fever with thrombocytopenia syndrome virus: a highly lethal bunyavirus . Crit Rev Microbiol 2020, 47 (1). 10.1080/1040841x.2020.1847037. Yu-Chih C, Hiroshi S, Hsiao-Wei W, Ken M, Ching-Yu T, Ching-Hsiu T, Wei-Li H: Enhanced detection of Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV) antibodies in various animal species using oligomeric nucleocapsid protein-based diagnostics . Virol J 2025, 22 (1). 10.1186/s12985-025-02840-5. Yongfeng F, Shibo L, Zhao Z, Suqin M, Xueping L, Wenhong Z, Chiyu Z, Xunjia C: Phylogeographic analysis of severe fever with thrombocytopenia syndrome virus from Zhoushan Islands, China: implication for transmission across the ocean . Scientific reports 2016, 6 (0). 10.1038/srep19563. Sun Y, Guo Y, Lou Z: A versatile building block: the structures and functions of negative-sense single-stranded RNA virus nucleocapsid proteins . Protein & cell 2012, 3 (12):893-902. 10.1007/s13238-012-2087-5. Honggang Z, Yuna S, Ying W, Min L, Chao L, Wenming W, Xiang L, Le L, Fei D, Hualin W et al : The nucleoprotein of severe fever with thrombocytopenia syndrome virus processes a stable hexameric ring to facilitate RNA encapsidation . Protein Cell 2013, 4 (6). 10.1007/s13238-013-3901-4. Lianying J, Songying O, Mifang L, Fengfeng N, Neil S, Wei W, Wei D, Cong J, Yao P, Yanping Z et al : Structure of severe fever with thrombocytopenia syndrome virus nucleocapsid protein in complex with suramin reveals therapeutic potential . J Virol 2013, 87 (12). 10.1128/jvi.00672-13. Xiaoxia H, Shujun D, Xiaolin J, Bo P, Quanfu Z, Chuan L, Aqian L, Jiandong L, Mifang L, Shiwen W et al : Detection of SFTS virus RNA and antibodies in severe fever with thrombocytopenia syndrome surveillance cases in endemic areas of China . BMC Infect Dis 2019, 19 (1). 10.1186/s12879-019-4068-2. Tomoki Y, Shuetsu F, Hideki T, Aiko F, Satoshi T, Shoichi T, Yukie S, Koji Y, Toshiharu M, Katsuyuki A et al : Sensitive and specific PCR systems for detection of both Chinese and Japanese severe fever with thrombocytopenia syndrome virus strains and prediction of patient survival based on viral load . J Clin Microbiol 2014, 52 (9). 10.1128/jcm.00742-14. Hu X, Zhao R, Li W, Pan X, Dai Y, Wu H, Wu Y, Zhang C: Host protein PRPS2 interact with the non-structural protein p17 of Avian Reovirus and promote viral replication . Poult Sci 2024, 104 (1). 10.1016/j.psj.2024.104582. Zhang C, Liu X, Zhang Q, Sun J, Zhang X, Wu Y: PQBP1 regulates the cellular inflammation induced by avian reovirus and interacts with the viral p17 protein . Virus Res 2023, 332 :199119. 10.1016/j.virusres.2023.199119. Zhang C, Wang X, Sun J, Guo M, Zhang X, Wu Y: Autophagy Induced by the N-Terminus of the Classic Swine Fever Virus Nonstructural Protein 5A Protein Promotes Viral Replication . Front Microbiol 2021, 12 :733385. 10.3389/fmicb.2021.733385. Dexin L: A highly pathogenic new bunyavirus emerged in China . Emerg Microbes Infect 2013, 2 (1). 10.1038/emi.2013.1. Mee Soo C, Jun Hee W: Severe fever with thrombocytopenia syndrome: tick-mediated viral disease . J Korean Med Sci 2013, 28 (6). 10.3346/jkms.2013.28.6.795. Solveig J, Sophie O V, Hildegunn V, Ketil I, Anja B K, Zerai W, Bernt J, Edgar B, Hege B-H, Sebastian W et al : Climate and environmental change drives Ixodes ricinus geographical expansion at the northern range margin . Parasit Vectors 2014, 7 (0). 10.1186/1756-3305-7-11. Dong M, Ke D, Guo-Ping Z, Xin-Lou L, Wen-Qiang S, Jiu Song Z, Yang Y, Wei L, Li-Qun F: Mapping the global potential transmission hotspots for severe fever with thrombocytopenia syndrome by machine learning methods . Emerg Microbes Infect 2020, 9 (1). 10.1080/22221751.2020.1748521. Mianyu Y, Ming Y, Bingmei H, Lijuan Z, Jiling W, Zonghao Z: Analysis of early warning indicators of death in patients with severe fever with thrombocytopenia syndrome . BMC Infect Dis 2024, 24 (1). 10.1186/s12879-024-09599-0. Li S, Yingjie Z, Gang W, Deyu H, Lintao S: Analysis of risk factors associated with fatal outcome among severe fever with thrombocytopenia syndrome patients from 2015 to 2019 in Shandong, China . Eur J Clin Microbiol Infect Dis 2022, 41 (12). 10.1007/s10096-022-04506-4. Yu L, Hang Z, Di M, Wenwu Y, Hongjie Y: Epidemiological analysis on severe fever with thrombocytopenia syndrome under the national surveillance data from 2011 to 2014, China . Zhonghua Liu Xing Bing Xue Za Zhi 2015, 36 (6). Additional Declarations No competing interests reported. Supplementary Files Table1.tif Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7212366","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":518953574,"identity":"9a208446-56d5-426a-ae15-a36ccb6ea188","order_by":0,"name":"Zhang Chengcheng","email":"","orcid":"","institution":"Yangzhou University, Jiangsu Co-Innovation Center for the Prevention and Control of Important Animal Infectious Disease and Zoonoses","correspondingAuthor":false,"prefix":"","firstName":"Zhang","middleName":"","lastName":"Chengcheng","suffix":""},{"id":518953575,"identity":"7215350f-fd62-4726-8d96-a7af8736ba73","order_by":1,"name":"Zhang Liutao","email":"","orcid":"","institution":"Yangzhou University, Jiangsu Co-Innovation Center for the Prevention and Control of Important Animal Infectious Disease and Zoonoses","correspondingAuthor":false,"prefix":"","firstName":"Zhang","middleName":"","lastName":"Liutao","suffix":""},{"id":518953576,"identity":"fbca29ba-08ca-4b1c-a6ea-e0dcf9044862","order_by":2,"name":"Huang Yao","email":"","orcid":"","institution":"Yangzhou Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Huang","middleName":"","lastName":"Yao","suffix":""},{"id":518953577,"identity":"9810b7fd-59be-45eb-9363-b84e3d3a8f75","order_by":3,"name":"Xu Chaojie","email":"","orcid":"","institution":"Yangzhou Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Xu","middleName":"","lastName":"Chaojie","suffix":""},{"id":518953578,"identity":"069b709b-4297-4080-8f43-d070119ad2a1","order_by":4,"name":"Yang Huimin","email":"","orcid":"","institution":"Yangzhou Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Huimin","suffix":""},{"id":518953579,"identity":"3afb5103-9ce8-444c-806b-9f1943384325","order_by":5,"name":"Wang Yin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuklEQVRIie3PMQqDMBTG8RcCujzb1YDQHkFwldqjCA861bVzQHDqAVp6j84RoV1EV6FjL6C7Q+MNXrdC84cHGb7fEACX6zcjeymuff0dOUTqbPhE2mvSeNgz93Fv3klQ9QgDiHE6cogxREH1QnHTUl3vHFJragpLZGQ8GbBIAwvp0AtzLnkAUVEZRDZRLVAyd4Qh1iXvL6u+JXU57bLsWdbjxCFbgzkIb3kKzdjbNto3ADNv7HK5XH/aB64DNxjPO9tPAAAAAElFTkSuQmCC","orcid":"","institution":"Yangzhou Center for Disease Control and Prevention","correspondingAuthor":true,"prefix":"","firstName":"Wang","middleName":"","lastName":"Yin","suffix":""}],"badges":[],"createdAt":"2025-07-25 08:53:56","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7212366/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7212366/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92010539,"identity":"f6e2c371-6c4f-4166-a8ac-d99a50808e8c","added_by":"auto","created_at":"2025-09-23 15:40:35","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10569140,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/34f8b1c862b209aed1e8ed74.tif"},{"id":92008737,"identity":"e0386ebc-c22a-4740-abae-53262af553ac","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":52065,"visible":true,"origin":"","legend":"","description":"","filename":"RevisedManuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/c179d9e1c36f1aad4880e541.docx"},{"id":92008748,"identity":"4656588e-ffba-46bd-b472-02722d6c883f","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12829976,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/dfe2593b93d70b45dd089900.tif"},{"id":92011716,"identity":"41b51d60-1314-44ac-a121-24e839bfd05d","added_by":"auto","created_at":"2025-09-23 15:48:36","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15354252,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/8dd201880ca47a0222d2496d.tif"},{"id":92011720,"identity":"fb577627-db16-4466-a452-cef575da294b","added_by":"auto","created_at":"2025-09-23 15:48:36","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18259716,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/e0b7ad6ea1ee549e4e2e3fe3.tif"},{"id":92008755,"identity":"34030edc-4c62-4a80-bdc3-7ef21c6fb356","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21357884,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/1d0464023eb624f57ca9bf49.tif"},{"id":92012790,"identity":"8812d373-ae8d-44b6-9bd7-05516858c8fa","added_by":"auto","created_at":"2025-09-23 15:56:36","extension":"json","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7506,"visible":true,"origin":"","legend":"","description":"","filename":"8711f798a17c4081989b253cc06ca561.json","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/ca1cea5e81e6784df230f407.json"},{"id":92008745,"identity":"eeebcbc6-0fb3-4f90-8f46-098eb3373c4b","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"xml","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":50656,"visible":true,"origin":"","legend":"","description":"","filename":"8711f798a17c4081989b253cc06ca5611enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/f51dc71b43a890c5313c41d3.xml"},{"id":92010552,"identity":"bb2303ff-640d-4d5c-ada8-270536f92028","added_by":"auto","created_at":"2025-09-23 15:40:36","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10569140,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/06634edda2c4c286872bf4b3.tif"},{"id":92008751,"identity":"5afe210f-1716-4c29-849d-bdb3faa855b0","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12829976,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/ed9eb432a2d000f44d3c2ea5.tif"},{"id":92008760,"identity":"c5f11950-5f04-41cb-aa2e-dbf048b3bf49","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15354252,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/88507be724a81a3345fe7ead.tif"},{"id":92008758,"identity":"0f7b6a09-98b7-44e9-a051-90248e6761e9","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18259716,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/de68467457553f52460fb8ba.tif"},{"id":92008763,"identity":"2d53a43e-8926-45bd-81cf-b34e43321e96","added_by":"auto","created_at":"2025-09-23 15:32:36","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21357884,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/6ec153e0b0e203a94dc0a364.tif"},{"id":92008746,"identity":"779dcf36-d7b0-42b0-bfb1-143bdddfb203","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":52863,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/f2fd78b912120edcb8026f99.png"},{"id":92010545,"identity":"1bfa487c-63d7-46b4-bd11-480489600025","added_by":"auto","created_at":"2025-09-23 15:40:35","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":42054,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/fedb59fbf3731c42e00ca5a0.png"},{"id":92008757,"identity":"059d3a61-1143-4c34-9605-7c8bd2d53a70","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":527335,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/4ee380782673ac681f1e9d67.png"},{"id":92008749,"identity":"be3d1ec3-ad04-4e4c-ab96-9621094c87bb","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":224686,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/b54c2466938df81ea68da0ed.png"},{"id":92008754,"identity":"3593414f-c2cc-4924-b4b9-0f0ba6b7826d","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":602503,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/5900da6c7c7627a91caa7fbf.png"},{"id":92011715,"identity":"236adf8c-ed20-4bb2-9741-081842774731","added_by":"auto","created_at":"2025-09-23 15:48:35","extension":"xml","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":49469,"visible":true,"origin":"","legend":"","description":"","filename":"8711f798a17c4081989b253cc06ca5611structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/6828f8e0dc1890cb6d94a81f.xml"},{"id":92010548,"identity":"e164b842-7691-4898-8a59-7e2e96865a9a","added_by":"auto","created_at":"2025-09-23 15:40:36","extension":"html","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":60833,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/b85b171846c2d115882ea7bd.html"},{"id":92010529,"identity":"b804de61-f613-47a2-b4d2-f33c5673ef63","added_by":"auto","created_at":"2025-09-23 15:40:35","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":534831,"visible":true,"origin":"","legend":"\u003cp\u003eThe number of confirmed severe fever with thrombocytopenia syndrome cases and the fatality rate from 2020 to 2024 in Jiangsu province China.\u003c/p\u003e","description":"","filename":"Figure1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/12ed552ed34c43b2f370e04c.jpg"},{"id":92010531,"identity":"8e5b780c-9254-48c8-bbdd-212ff38d5d6f","added_by":"auto","created_at":"2025-09-23 15:40:35","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":495987,"visible":true,"origin":"","legend":"\u003cp\u003eThe result of detect severe fever with thrombocytopenia syndrome virus in the sera samples. A, The mock infected with SFTSV of Vero cells under hematoxylin-eosin staining. B, Infected with SFTSV of Vero cells under hematoxylin-eosin staining. C, The results of PCR detect the SFTSV in the sera samples. D, Virions in the culture supernatant detected by electron microscopy (bar in the image indicates the length of 100 nm).\u003c/p\u003e","description":"","filename":"Figure2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/0c3ab5e8417e790d06aeeef9.jpg"},{"id":92008743,"identity":"f054d01b-7f30-4024-af13-dfc80e8a4b11","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1777030,"visible":true,"origin":"","legend":"\u003cp\u003eAge-based (A), and seasonal (B), of patients detected infection with severe fever with thrombocytopenia syndrome in Yizhen Jiangsu province.\u003c/p\u003e","description":"","filename":"Figure3.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/2c7ef58d17bc599783eacd77.jpg"},{"id":92008740,"identity":"c7958a38-df6e-4e00-a8b0-605cc5de2c4a","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1327017,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic trees showing the phylogenetic positions of severe fever with thrombocytopenia syndrome virus strains in Yangzhou, compared with other known strains. Trees are based on the L segment (A; left panel), M segment (B; middle panel), and S segment (C; right panel).\u003c/p\u003e","description":"","filename":"Figure4.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/db356f1ed0a32cec7fe1f641.jpg"},{"id":92008741,"identity":"5883c496-61cd-44f3-81e6-f3a793ff1d12","added_by":"auto","created_at":"2025-09-23 15:32:35","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2302188,"visible":true,"origin":"","legend":"\u003cp\u003eThe recombination patterns in SFTSV full genomes analysis with RDP4 software. A. There are six recombination events in the L sequence. B. There is one recombination event in the M sequence. C. There are three recombination events in the S sequence.\u003c/p\u003e","description":"","filename":"Figure5.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/0af25f3ab0c96994b2ea29ee.jpg"},{"id":97141447,"identity":"e6cc18a3-0773-4f3e-9bbb-7c122459c9ce","added_by":"auto","created_at":"2025-12-01 10:06:42","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8199836,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/decd027c-a654-431b-863a-f118fa67fd43.pdf"},{"id":92012789,"identity":"c22b8055-278f-4f3f-a63e-62118168a627","added_by":"auto","created_at":"2025-09-23 15:56:35","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":8067244,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7212366/v1/8a503a61d20bafa5c564fbfd.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Epidemiological Characteristics of Severe Fever with Thrombocytopenia Syndrome collect from Yangzhou China in the year of 2024","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSevere Fever with Thrombocytopenia Syndrome (SFTS), induced by the SFTS virus (SFTSV), has emerged as a prominent infectious disease in Asian nations in recent years, characterized by a notably high case-fatality rate[1, 2]. Back in 2007, the first SFTS cases were detected in China, presenting symptoms that bore a resemblance to human granulocytic anaplasmosis (HGA)[3]. Then, in 2009, SFTSV began to show a widespread presence across 23 provinces in the country [4, 5]. Beyond China, reports of SFTS or SFTS-like cases have also surfaced in South Korea [6], Japan [7], Australia [8], and the United States[9], suggesting that SFTS and related diseases may have a global distribution potential. Along with the strengthening of surveillance measures, a new phlebovirus belonging to the Bunyaviridae family was successfully isolated and identified in 2010 [10]. SFTSV is classified as a tick-borne virus, and this classification is supported by evidence showing that the virus exists in two tick species: \u003cem\u003eHaemaphysalis longicornis\u003c/em\u003e and \u003cem\u003eRhipicephalus microplus\u003c/em\u003e[4, 11]. Considering the lack of effective vaccines and therapeutic methods, its high mortality rate, and the risk of a global pandemic, SFTS was listed by the World Health Organization (WHO) as one of the top 10 priority infectious diseases in 2018[12].\u003c/p\u003e\u003cp\u003eLike other bunyaviruses, SFTSV particles exhibit a spherical shape with a diameter ranging from 80 to 100nm. They are enclosed by a unit membrane envelope, from which polypeptide spikes-5 to 10nm in length-project outward [13]. Currently, at least six distinct genotypes (A through F) of SFTSV have been identified, and their geographical distribution differs across various regions and countries [14]. The SFTSV genome is divided into three segments: large (L), medium (M), and small (S), with respective nucleotide lengths of 6368, 3378, and 1744. The S segment adopts a reverse-oriented coding strategy, producing both the viral nucleocapsid protein (NP) and nonstructural proteins (NSs). NP binds to the viral genomic RNA (vRNA) to form ribonucleoprotein complexes (RNPs), which serve to shield the vRNA from breakdown by either exogenous nucleases or the host\u0026rsquo;s immune defense mechanisms [15]. It has been established that the NP of phleboviruses folds into a tightly packed core domain with an elongated N-terminal arm [16], this structural feature enables the formation of higher-order oligomers-such as tetramers, pentamers, or hexamers-and thereby promotes SFTSV replication [17]. The L segment encodes the RNA-dependent RNA polymerase (RdRp), a key enzyme required for RNA transcription and replication. Meanwhile, the M segment contains a single open reading frame that generates a 1073-amino acid glycoprotein precursor. This glycoprotein is critical for multiple viral processes, including virion assembly, particle formation, and attachment to new host target cells.\u003c/p\u003e\u003cp\u003eThe clinical diagnosis of Severe Fever with Thrombocytopenia Syndrome (SFTS) often presents difficulties, primarily due to the highly non-specific nature of its symptoms. For this reason, laboratory-based tests are indispensable for verifying SFTSV infection. A range of diagnostic approaches have been established to date, such as virus isolation, detection of viral RNA, and identification of SFTSV-specific antibodies [18, 19]. Although virus isolation serves as a definitive means of confirming SFTSV infection, it is both time-intensive and demands high-level biosafety conditions (specifically, BSL-3). To accelerate the diagnostic process, various detection assays have been developed that target either viral RNA or serological markers associated with SFTSV.\u003c/p\u003e\u003cp\u003eIn this study, we present the separation of all laboratory-confirmed cases of SFTSV infection in Yangzhou, a city located in Jiangsu Province, China. All the viruses from these cases were isolated, and their full genome sequences were acquired using next-generation sequencing technology. Additionally, we conducted an analysis of the characteristics of all involved cases as well as the epidemiological traits of the isolated SFTSV strains.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eCell and virus culture\u003c/p\u003e\u003cp\u003eThe Vero cells were stored in our lab and cultrued in Dulbecco\u0026rsquo;s modified eagle\u0026rsquo;s medium (DMEM, Thermo Fisher Scientific) with 10% (v/v) fetal bovine serum (FBS, Gibco), 10 kU/ml penicillin 1%10 mg/ml streptomycinand 250 \u0026micro;g/ml amphotericin B(Sigma-Aldrich, Burlington, MA, USA) at 37 ℃ with 5% CO\u003csub\u003e2\u003c/sub\u003e[20]. In this study, the SFTSV virus we used was separated by ourselves in Yangzhou.\u003c/p\u003e\u003cp\u003eRNA extraction and PCR assay\u003c/p\u003e\u003cp\u003eThe PCR assays used in the current study were performed as previously described [21]. Briefly, a total of 200 \u0026micro;l of serum was used for RNA extraction using TRIzol reagent (Invitrogen, 15596026). Two \u0026micro;g of RNA were reversely transcribed into cDNA using Super Scriptase (Invitrogen, 15596026) following the manufacturer\u0026rsquo;s instructions. The fulllength genes of SFTSV genome were amplified by PCR. The primer used is, SFTSV-F: GGCTGTTCATCATTATTGTC, SFTSV-R: CCTCAGCAAGCCCTATT. The PCR conditions were 98℃ 30 s, 50℃ for 10 min, followed by 30 cycles of 95℃ for 30 s, 56℃ for 30 s, and 72℃ for 35 s, with a final step of 72℃ for 5 min. The products of PCR were analyzed by agarose gel electrophoresis.\u003c/p\u003e\u003cp\u003eTransmission electron microscopy\u003c/p\u003e\u003cp\u003eTo further confirmed we have separated the SFTSV virus in Vero cells, after subcultured three times consecutively in dish. The cells were washed three times with cold PBS and fixed with 2.5% glutaraldehyde at room temperature for 5 min. The cells were gently scraped in one direction and collected by centrifugation at 3000 rpm for 5 min. The cells were dehydrated with gradient concentrations of ethanol (50%, 70%, 80%, 90%, and 95%, respectively) and embedded in epoxy resin after being fixed with 1% osmium tetroxide for 2 h. Next, ultrathin sections were prepared, and granulate-like materials were observed using transmission electron microscopy after staining with 3% uranyl acetate and lead citrate[22].\u003c/p\u003e\u003cp\u003eData Collection and Management\u003c/p\u003e\u003cp\u003eIn the present study, data on SFTS spanning from 2020 to 2024 were collected from the National Notifiable Disease Reporting System -a disease surveillance network in China that functions across administrative levels from counties up to provinces. With proper authorization, SFTS case-related information can be extracted from this system for in-depth analysis. The SFTS cases included in the analysis were all laboratory-confirmed. The case records retrieved for statistical assessment primarily covered indicators such as current residential address, age, gender, occupation, onset date, case classification, survival status, and other relevant metrics. All data extraction and utilization in this research were processed anonymously to safeguard patient privacy and ensure data confidentiality.\u003c/p\u003e\u003cp\u003eAnalysis of whole genome sequence of separated SFTSV viruses homology and evolution\u003c/p\u003e\u003cp\u003eThe nucleotide sequence homology analysis of the whole genome sequence between the isolates and the reference strains was conducted using software such as DNAstar or websites. The system evolutionary tree was constructed using MAGE-X software.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eOverview of SFTS in Yangzhou Jiangsu province China\u003c/p\u003e\u003cp\u003eFrom 2010 to 2019, a total of 13,824 SFTS cases involving 8899 lab-confirmed cases and 4925 probable cases were reported in mainland China, with 713 deaths. From 2020 to 2024, a total of 1148 SFTS cases confirmed by laboratory in Jiangsu province China, with 149 deaths. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e shows the changing trend of the number of SFTS cases and the fatality rate in Jiangsu province from 2020 to 2024, with the average annual fatality rate being 12% in the province. The number of SFTS cases showed an increasing trend between 2020 (141 cases) and 2024 (422 cases), which then decreased to 136 cases in 2021. However, the annual fatality rate showed a significantly increased from 2020 (9.9%) to 2024 (17.5%).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn 2024, Jiangsu Province reported 422 confirmed cases of fever, an increase of 79.6% (235 cases) compared with last year. There were 74 reported deaths, an increase of 184.6% (26 cases) compared with last year. Yangzhou is a prefecture-level city in Jiangsu Province, we collected the samples from hospital and finally confirmed 33 cases of SFTS in Yangzhou in the year of 2024. Shown as Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, 28 of the 33 patients in whom SFTS was diagnosed were aged\u0026thinsp;\u0026ge;\u0026thinsp;50 years (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) and came from western mountainous area of Yangzhou. Disease onset occurred in all patients between the months of April and September (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Eleven of the 33 cases were fatal. There was clear evidence of tick bite in 8 cases.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eClinical Manifestation of 33 SFTS Patients\u003c/p\u003e\u003cp\u003eThe clinical manifestations observed in SFTS patients are summarized in Table\u0026nbsp;1. All patients exhibited nonspecific febrile symptoms accompanied by general fatigue, leukopenia, and thrombocytopenia-hallmark manifestations of SFTSV infection. Clinically, most cases presented with gastrointestinal symptoms, including nausea, vomiting, and diarrhea. In contrast, hemoptysis, bloody diarrhea, myalgia, and arthralgia were rarely observed. However, headache was reported in 18 out of 33 patients. Additionally, a confirmed tick bite within the preceding two weeks was documented in 8 cases.\u003c/p\u003e\u003cp\u003eSFTSV isolation and identification\u003c/p\u003e\u003cp\u003ePatients serum were used for virus isolation using Vero cells. After continuously passaged, cytopathic effect appeared in Vero cells (Shown as Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eDNA amplified by conventional RT-PCR showed the expected sizes of 185bp in agarose-electrophoresis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Furthermore, the inoculated Vero cells were detected by electron microscopy, enveloped and spherical virions with approximate diameters of 100 nm were detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). The morphology of the virion is compatible with that of a bunyavirus.\u003c/p\u003e\u003cp\u003eAnalysis the Epidemiological Characteristics of SFTS separated in Yangzhou\u003c/p\u003e\u003cp\u003eMany DNA fragments that were homologous to those of SFTSV were detected in the culture supernatant of the Vero cells inoculated in next-generation sequencing. Yangzhou isolates formed two clusters that was independent from Chinese isolates (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e), indicating that SFTSV has been circulating inYangzhou naturally for some time. The prevalence of SFTS in and around East Asia should be studied to clarify the nature of SFTS in the region.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe recombination rate of SFTSV whole genome sequence was analyzed using RDP4 software\u003c/p\u003e\u003cp\u003eHomologous recombination analysis was conducted using RDP4 software, comparing the two SFTSV sequences isolated in our study with those uploaded to the NCBI database. The results are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. Specifically, recombination events were analyzed for three gene fragments of SFTSV: the L fragment analysis revealed recombination in 6 strains, the M fragment analysis identified recombination in 1 strain, and the S fragment analysis detected recombination in 3 strains.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eBetween 2009 and 2010, Chinese researchers became the first to identify the SFTS virus through the application of molecular biology, virus isolation, serology, and other technical approaches [23]. This virus is responsible for an acute infectious disease characterized by a high fatality rate, with tick bites serving as its primary mode of transmission[24]. Drawing on early insights into SFTS, China initiated surveillance, reporting, prevention, and control measures targeting the virus. In accordance with relevant regulations, SFTS is classified as a notifiable Class B infectious disease, mandating its reporting. For the present study, we retrieved all SFTS case data from the NNDRS in Jiangsu Province spanning 2020 to 2024, and on this basis, conducted a systematic analysis of the epidemiological features at the provincial level.\u003c/p\u003e\u003cp\u003eThe accumulative number of provinces that reported SFTS cases increased from 5 to 25 from year of 2010 to 2019 in China. However, the SFTS cases were still mainly distributed in seven provinces located in central, eastern, and northeastern China. From 2020 to 2024, the total laboratory confirmation SFTSV infection cases is 1148 in Jiangsu province, and it shows an overall upward trend year by year. The highest was observed in 2024 (422 cases) and the lowest in 2021 (136 cases). In contrast, the annual mortality rate is also on the rise, especially in 2024, with a significant increase (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Specifically, we separated 33 strains of SFTSV virues in the year of 2024, as the Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e showns, most cases reported in the age of 50\u0026ndash;79 (75.75%, 25/33). In terms of time, most cases mainly distributed between April and September (84.84%, 28/33) and peaked in May (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). As the sequence analyse shown, the strain we isolated was not found in the parent strain.\u003c/p\u003e\u003cp\u003eAs the Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA shown, there are six recombination events in the L sequence, the red box is the recombinant strain, and the two columns on the right indicate that the recombinant strain is recombination from these two strains. The blue triangle indicates that trees constructed at nucleotide positions 4500 to 5500 all have very similar branches, with less difference between phylogenetic trees (red-orange regions) constructed from similarly sized sequence sections sampled from elsewhere. As the Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB shown, there is one recombination event in the M sequence, the red box is the recombinant strain, and the two columns on the right indicate that the recombinant strain is recombination from these two strains. The blue triangle indicates that trees constructed at nucleotide positions 250 to 900 all have very similar branches, with less difference between them than phylogenetic trees constructed with similarly sized sequence parts sampled from elsewhere (red-orange regions). As the Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC shown, there are three recombination events in the S sequence, the red box is the recombinant strain, and the two columns on the right indicate that the recombinant strain is recombination from these two strains. The blue triangle indicates that trees constructed at nucleotide positions 600 to 800 all have very similar branches, with less difference between them than phylogenetic trees constructed with similarly sized sequence parts sampled from elsewhere (red-orange regions). These results indicated that the isolates had good uniqueness and sequence specificity (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eCurrently, the incidence of SFTS may be influenced by a multitude of factors. As a tick-borne zoonotic disease, SFTS sees its transmission and prevalence inevitably impacted by the distribution density of ticks. Consequently, any factor that affects the survival, development, reproduction, or behavior of vector ticks can directly or indirectly influence the prevalence of SFTS\u0026mdash;this underscores the need to strengthen public awareness campaigns. For instance, temperature and precipitation can alter the life cycle and spatial distribution of ticks directly, thereby exerting an effect on the occurrence of SFTS[25, 26]. SFTS is an emerging hemorrhagic fever with a fatality rate of 5.2%, which is significantly higher than that of other viral hemorrhagic fevers in China, such as hemorrhagic fever with renal syndrome and dengue fever. It remains a critical public health concern in the country. Yearly reported fatal cases of SFTS have shown an upward trend. The fatality rate of SFTS is thought to be associated with factors including patient age, viral load at the time of infection, disease course, and local diagnostic and treatment capacities [27, 28]. Further research should focus on the variations in fatality rates across different high-risk regions. Notably, age-specific mortality exhibits a tendency to rise with increasing age-a pattern consistent with that observed between 2011 and 2014 [29].\u003c/p\u003e\u003cp\u003eIn conclusion, SFTSV is prevalent in China. Yangzhou SFTSV strains have characteristics similar to those of Chinese isolates but an independent genotype, which indicates that SFTSV has been largely present in most part of China.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, we conducted a systematic analysis of the epidemiological traits of all SFTS cases reported in Yangzhou, China, during 2024. The majority of these SFTS cases were middle-aged and elderly farmers. It is worth noting, however, that the regional spread of the disease showed a tendency to expand. In light of this, it is recommended that SFTS be given greater attention across the country. Additionally, diagnostic and reporting protocols should be revised based on more in-depth, detailed research. Such measures would help achieve a more comprehensive understanding of the disease\u0026rsquo;s epidemiological features and offer scientific evidence to support SFTS prevention and control efforts.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, Zhang Chengcheng and Wang Yin; methodology, Zhang Liutao and Huang Yao; software, Xu Chaojie; validation, Yang Huimin; formal analysis, Zhang Chengcheng; writing original draft preparation, Zhang Liutao; writing\u0026mdash;review and editing, Wang Yin; project administration and funding acquisition, Wang Yin. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by the General Program of Jiangsu Preventive Medical Association [Grant Ym2023090], General Program of Yangzhou Health Commission [Grant 2023-2-34], Open Project Program of Jiangsu Key Laboratory of Zoonosis [Grant R2312], and\u0026nbsp;\u0026lsquo;High-end talent support program\u0026rsquo; of Yangzhou University and A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll available data were presented in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the ethics committee of the National Institute for Viral Disease Control and Prevention, Chinese Yangzhou city Center for Disease Control and Prevention (KY2024007). Our study was adhered to the Declaration of Helsinke. Written informed consent was obtained from the study participants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBianli X, Licheng L, Xueyong H, Hong M, Yuan Z, Yanhua D, Pengzhi W, Xiaoyan T, Haifeng W, Kai K\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eMetagenomic analysis of fever, thrombocytopenia and leukopenia syndrome (FTLS) in Henan Province, China: discovery of a new bunyavirus\u003c/strong\u003e. \u003cem\u003ePLoS Pathog \u003c/em\u003e2011, \u003cstrong\u003e7\u003c/strong\u003e(11). 10.1371/journal.ppat.1002369.\u003c/li\u003e\n\u003cli\u003eYasi T, Miao D, Xueying Z, Tianxin X, Daxian W: \u003cstrong\u003eDabie bandavirus and Mycoplasma pneumoniae co-infection: a case report\u003c/strong\u003e. \u003cem\u003eBMC Infect Dis \u003c/em\u003e2025, \u003cstrong\u003e25\u003c/strong\u003e(1). 10.1186/s12879-024-10392-2.\u003c/li\u003e\n\u003cli\u003eChang-jun B, Xi-ling G, Xian Q, Jian-li H, Ming-hao Z, Jay K V, Lun-biao C, Hai-tao Y, Yong-jun J, John D K\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eA family cluster of infections by a newly recognized bunyavirus in eastern China, 2007: further evidence of person-to-person transmission\u003c/strong\u003e. \u003cem\u003eClin Infect Dis \u003c/em\u003e2011, \u003cstrong\u003e53\u003c/strong\u003e(12). 10.1093/cid/cir732.\u003c/li\u003e\n\u003cli\u003eXue-Jie Y, Mi-Fang L, Shou-Yin Z, Yan L, Jian-Dong L, Yu-Lan S, Lihong Z, Quan-Fu Z, Vsevolod L P, Chuan L\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eFever with thrombocytopenia associated with a novel bunyavirus in China\u003c/strong\u003e. \u003cem\u003eN Engl J Med \u003c/em\u003e2011, \u003cstrong\u003e364\u003c/strong\u003e(16). 10.1056/NEJMoa1010095.\u003c/li\u003e\n\u003cli\u003eShuyi L, Zhifeng L, Nan Z, Xiaochen W, Yuanfang Q, Wei X, Changjun B, Jianli H: \u003cstrong\u003eEpidemiological and spatiotemporal analysis of severe fever with thrombocytopenia syndrome in Eastern China, 2011-2021\u003c/strong\u003e. \u003cem\u003eBMC Public Health \u003c/em\u003e2023, \u003cstrong\u003e23\u003c/strong\u003e(1). 10.1186/s12889-023-15379-3.\u003c/li\u003e\n\u003cli\u003eYoung Ree K, Yeojun Y, Seung Geon B, Dahee P, Suhyun K, Jae Myun L, Nam-Hyuk C, Yang Soo K, Keun Hwa L: \u003cstrong\u003eSevere Fever with Thrombocytopenia Syndrome Virus Infection, South Korea, 2010\u003c/strong\u003e. \u003cem\u003eEmerg Infect Dis \u003c/em\u003e2018, \u003cstrong\u003e24\u003c/strong\u003e(11). 10.3201/eid2411.170756.\u003c/li\u003e\n\u003cli\u003eToru T, Ken M, Tadaki S, Aki I, Toru S, Takayuki T, Toshiaki K, Masahiro H, Daisuke N, Takenori S\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eThe first identification and retrospective study of Severe Fever with Thrombocytopenia Syndrome in Japan\u003c/strong\u003e. \u003cem\u003eJ Infect Dis \u003c/em\u003e2013, \u003cstrong\u003e209\u003c/strong\u003e(6). 10.1093/infdis/jit603.\u003c/li\u003e\n\u003cli\u003eJianning W, Paul S, Meng Y, Wendy H, Chrissy R, Rosemary G, Terry W, Sandra C, Honglei C, Ivano B\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eNovel phlebovirus with zoonotic potential isolated from ticks, Australia\u003c/strong\u003e. \u003cem\u003eEmerg Infect Dis \u003c/em\u003e2014, \u003cstrong\u003e20\u003c/strong\u003e(6). 10.3201/eid2006.140003.\u003c/li\u003e\n\u003cli\u003eLaura K M, Scott M F, Aubree J K, Adam M, Cynthia S G, Maureen G M, Brigid C B, C\u0026eacute;sar G A, Sherif R Z, Pierre E R\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eA new phlebovirus associated with severe febrile illness in Missouri\u003c/strong\u003e. \u003cem\u003eN Engl J Med \u003c/em\u003e2012, \u003cstrong\u003e367\u003c/strong\u003e(9). 10.1056/NEJMoa1203378.\u003c/li\u003e\n\u003cli\u003eDe-xin L: \u003cstrong\u003eFever with thrombocytopenia associated with a novel bunyavirus in China\u003c/strong\u003e. \u003cem\u003eZhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi \u003c/em\u003e2011, \u003cstrong\u003e25\u003c/strong\u003e(2). \u003c/li\u003e\n\u003cli\u003eYong-Zhen Z, Dun-Jin Z, Xin-Cheng Q, Jun-Hua T, Yanwen X, Jian-Bo W, Xiao-Ping C, Dong-Ya G, Yong-Wen H, Dong J\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eThe ecology, genetic diversity, and phylogeny of Huaiyangshan virus in China\u003c/strong\u003e. \u003cem\u003eJ Virol \u003c/em\u003e2011, \u003cstrong\u003e86\u003c/strong\u003e(5). 10.1128/jvi.06192-11.\u003c/li\u003e\n\u003cli\u003eJing L, Shen L, Li Y, Pengfei C, Jianhong L: \u003cstrong\u003eSevere fever with thrombocytopenia syndrome virus: a highly lethal bunyavirus\u003c/strong\u003e. \u003cem\u003eCrit Rev Microbiol \u003c/em\u003e2020, \u003cstrong\u003e47\u003c/strong\u003e(1). 10.1080/1040841x.2020.1847037.\u003c/li\u003e\n\u003cli\u003eYu-Chih C, Hiroshi S, Hsiao-Wei W, Ken M, Ching-Yu T, Ching-Hsiu T, Wei-Li H: \u003cstrong\u003eEnhanced detection of Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV) antibodies in various animal species using oligomeric nucleocapsid protein-based diagnostics\u003c/strong\u003e. \u003cem\u003eVirol J \u003c/em\u003e2025, \u003cstrong\u003e22\u003c/strong\u003e(1). 10.1186/s12985-025-02840-5.\u003c/li\u003e\n\u003cli\u003eYongfeng F, Shibo L, Zhao Z, Suqin M, Xueping L, Wenhong Z, Chiyu Z, Xunjia C: \u003cstrong\u003ePhylogeographic analysis of severe fever with thrombocytopenia syndrome virus from Zhoushan Islands, China: implication for transmission across the ocean\u003c/strong\u003e. \u003cem\u003eScientific reports \u003c/em\u003e2016, \u003cstrong\u003e6\u003c/strong\u003e(0). 10.1038/srep19563.\u003c/li\u003e\n\u003cli\u003eSun Y, Guo Y, Lou Z: \u003cstrong\u003eA versatile building block: the structures and functions of negative-sense single-stranded RNA virus nucleocapsid proteins\u003c/strong\u003e. \u003cem\u003eProtein \u0026amp; cell \u003c/em\u003e2012, \u003cstrong\u003e3\u003c/strong\u003e(12):893-902. 10.1007/s13238-012-2087-5.\u003c/li\u003e\n\u003cli\u003eHonggang Z, Yuna S, Ying W, Min L, Chao L, Wenming W, Xiang L, Le L, Fei D, Hualin W\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eThe nucleoprotein of severe fever with thrombocytopenia syndrome virus processes a stable hexameric ring to facilitate RNA encapsidation\u003c/strong\u003e. \u003cem\u003eProtein Cell \u003c/em\u003e2013, \u003cstrong\u003e4\u003c/strong\u003e(6). 10.1007/s13238-013-3901-4.\u003c/li\u003e\n\u003cli\u003eLianying J, Songying O, Mifang L, Fengfeng N, Neil S, Wei W, Wei D, Cong J, Yao P, Yanping Z\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eStructure of severe fever with thrombocytopenia syndrome virus nucleocapsid protein in complex with suramin reveals therapeutic potential\u003c/strong\u003e. \u003cem\u003eJ Virol \u003c/em\u003e2013, \u003cstrong\u003e87\u003c/strong\u003e(12). 10.1128/jvi.00672-13.\u003c/li\u003e\n\u003cli\u003eXiaoxia H, Shujun D, Xiaolin J, Bo P, Quanfu Z, Chuan L, Aqian L, Jiandong L, Mifang L, Shiwen W\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eDetection of SFTS virus RNA and antibodies in severe fever with thrombocytopenia syndrome surveillance cases in endemic areas of China\u003c/strong\u003e. \u003cem\u003eBMC Infect Dis \u003c/em\u003e2019, \u003cstrong\u003e19\u003c/strong\u003e(1). 10.1186/s12879-019-4068-2.\u003c/li\u003e\n\u003cli\u003eTomoki Y, Shuetsu F, Hideki T, Aiko F, Satoshi T, Shoichi T, Yukie S, Koji Y, Toshiharu M, Katsuyuki A\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eSensitive and specific PCR systems for detection of both Chinese and Japanese severe fever with thrombocytopenia syndrome virus strains and prediction of patient survival based on viral load\u003c/strong\u003e. \u003cem\u003eJ Clin Microbiol \u003c/em\u003e2014, \u003cstrong\u003e52\u003c/strong\u003e(9). 10.1128/jcm.00742-14.\u003c/li\u003e\n\u003cli\u003eHu X, Zhao R, Li W, Pan X, Dai Y, Wu H, Wu Y, Zhang C: \u003cstrong\u003eHost protein PRPS2 interact with the non-structural protein p17 of Avian Reovirus and promote viral replication\u003c/strong\u003e. \u003cem\u003ePoult Sci \u003c/em\u003e2024, \u003cstrong\u003e104\u003c/strong\u003e(1). 10.1016/j.psj.2024.104582.\u003c/li\u003e\n\u003cli\u003eZhang C, Liu X, Zhang Q, Sun J, Zhang X, Wu Y: \u003cstrong\u003ePQBP1 regulates the cellular inflammation induced by avian reovirus and interacts with the viral p17 protein\u003c/strong\u003e. \u003cem\u003eVirus Res \u003c/em\u003e2023, \u003cstrong\u003e332\u003c/strong\u003e:199119. 10.1016/j.virusres.2023.199119.\u003c/li\u003e\n\u003cli\u003eZhang C, Wang X, Sun J, Guo M, Zhang X, Wu Y: \u003cstrong\u003eAutophagy Induced by the N-Terminus of the Classic Swine Fever Virus Nonstructural Protein 5A Protein Promotes Viral Replication\u003c/strong\u003e. \u003cem\u003eFront Microbiol \u003c/em\u003e2021, \u003cstrong\u003e12\u003c/strong\u003e:733385. 10.3389/fmicb.2021.733385.\u003c/li\u003e\n\u003cli\u003eDexin L: \u003cstrong\u003eA highly pathogenic new bunyavirus emerged in China\u003c/strong\u003e. \u003cem\u003eEmerg Microbes Infect \u003c/em\u003e2013, \u003cstrong\u003e2\u003c/strong\u003e(1). 10.1038/emi.2013.1.\u003c/li\u003e\n\u003cli\u003eMee Soo C, Jun Hee W: \u003cstrong\u003eSevere fever with thrombocytopenia syndrome: tick-mediated viral disease\u003c/strong\u003e. \u003cem\u003eJ Korean Med Sci \u003c/em\u003e2013, \u003cstrong\u003e28\u003c/strong\u003e(6). 10.3346/jkms.2013.28.6.795.\u003c/li\u003e\n\u003cli\u003eSolveig J, Sophie O V, Hildegunn V, Ketil I, Anja B K, Zerai W, Bernt J, Edgar B, Hege B-H, Sebastian W\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eClimate and environmental change drives Ixodes ricinus geographical expansion at the northern range margin\u003c/strong\u003e. \u003cem\u003eParasit Vectors \u003c/em\u003e2014, \u003cstrong\u003e7\u003c/strong\u003e(0). 10.1186/1756-3305-7-11.\u003c/li\u003e\n\u003cli\u003eDong M, Ke D, Guo-Ping Z, Xin-Lou L, Wen-Qiang S, Jiu Song Z, Yang Y, Wei L, Li-Qun F: \u003cstrong\u003eMapping the global potential transmission hotspots for severe fever with thrombocytopenia syndrome by machine learning methods\u003c/strong\u003e. \u003cem\u003eEmerg Microbes Infect \u003c/em\u003e2020, \u003cstrong\u003e9\u003c/strong\u003e(1). 10.1080/22221751.2020.1748521.\u003c/li\u003e\n\u003cli\u003eMianyu Y, Ming Y, Bingmei H, Lijuan Z, Jiling W, Zonghao Z: \u003cstrong\u003eAnalysis of early warning indicators of death in patients with severe fever with thrombocytopenia syndrome\u003c/strong\u003e. \u003cem\u003eBMC Infect Dis \u003c/em\u003e2024, \u003cstrong\u003e24\u003c/strong\u003e(1). 10.1186/s12879-024-09599-0.\u003c/li\u003e\n\u003cli\u003eLi S, Yingjie Z, Gang W, Deyu H, Lintao S: \u003cstrong\u003eAnalysis of risk factors associated with fatal outcome among severe fever with thrombocytopenia syndrome patients from 2015 to 2019 in Shandong, China\u003c/strong\u003e. \u003cem\u003eEur J Clin Microbiol Infect Dis \u003c/em\u003e2022, \u003cstrong\u003e41\u003c/strong\u003e(12). 10.1007/s10096-022-04506-4.\u003c/li\u003e\n\u003cli\u003eYu L, Hang Z, Di M, Wenwu Y, Hongjie Y: \u003cstrong\u003eEpidemiological analysis on severe fever with thrombocytopenia syndrome under the national surveillance data from 2011 to 2014, China\u003c/strong\u003e. \u003cem\u003eZhonghua Liu Xing Bing Xue Za Zhi \u003c/em\u003e2015, \u003cstrong\u003e36\u003c/strong\u003e(6). \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"severe fever with thrombocytopenia syndrome, epidemiological characteristics, surveillance","lastPublishedDoi":"10.21203/rs.3.rs-7212366/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7212366/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eSevere Fever with Thrombocytopenia Syndrome (SFTS) is an emerging infectious disease that poses a significant threat to public health, given its high fatality rate and potential for person-to-person transmission. Caused by the SFTS virus (SFTSV), a novel bunyavirus first identified in central and eastern China, SFTS has drawn increasing attention in recent years.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eTo gain an updated and in-depth insight into the epidemiological features of SFTS in eastern China, this study collected all confirmed SFTS cases in the year of 2024 from Yangzhou, Jiangsu Province. A total of 33 laboratory-confirmed SFTS cases were included in the analysis; after obtaining their complete viral genome sequences through sequencing, an epidemiological investigation was conducted. Additionally, a phylogenetic tree was constructed using MEGA-X software.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eOur findings revealed that the number of SFTS cases in Yangzhou showed an overall upward trend over the study period, with only a slight decline in the past three years. The laboratory confirmation rate stood at approximately 64.4%. Most SFTS cases were sporadic rather than clustered. Notably, the mortality rate exhibited a positive correlation with age-rising as patients\u0026rsquo; age increased.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eIn summary, this study systematically analyzed laboratory-confirmed SFTS cases in Yangzhou. The results suggest that the diagnostic and reporting criteria for SFTS need further optimization and standardization. Such improvements would facilitate a more accurate understanding of the disease\u0026rsquo;s epidemiological characteristics and provide scientific evidence to support SFTS prevention and control efforts.\u003c/p\u003e","manuscriptTitle":"Epidemiological Characteristics of Severe Fever with Thrombocytopenia Syndrome collect from Yangzhou China in the year of 2024","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-23 15:32:30","doi":"10.21203/rs.3.rs-7212366/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cd62bb51-bd2a-4ef0-93ad-18a407df27fc","owner":[],"postedDate":"September 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-12-01T05:08:39+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-23 15:32:30","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7212366","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7212366","identity":"rs-7212366","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}