Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specification

Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specification | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specification Alexander Maytum , View ORCID Profile Benjamin Edginton-White , View ORCID Profile Peter Keane , View ORCID Profile Peter N Cockerill , View ORCID Profile Jean-Baptiste Cazier , View ORCID Profile Constanze Bonifer doi: https://doi.org/10.1101/2023.08.30.555485 Alexander Maytum Institute for Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham , Birmingham B15 2TT, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Benjamin Edginton-White Institute for Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham , Birmingham B15 2TT, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Benjamin Edginton-White Peter Keane Institute for Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham , Birmingham B15 2TT, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Peter Keane Peter N Cockerill Institute for Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham , Birmingham B15 2TT, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Peter N Cockerill Jean-Baptiste Cazier Institute for Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham , Birmingham B15 2TT, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jean-Baptiste Cazier Constanze Bonifer Institute for Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham , Birmingham B15 2TT, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Constanze Bonifer For correspondence: c.bonifer{at}Bham.ac.uk Abstract Full Text Info/History Metrics Supplementary material Data/Code Preview PDF Abstract Tissue-specific gene regulation during development involves the interplay between transcription factors and epigenetic regulators binding to enhancer and promoter elements. The pattern of active enhancers defines the cellular differentiation state. However, developmental gene activation involves a previous step called chromatin priming which is not fully understood. We recently developed a genome-wide functional assay that allowed us to functionally identify enhancer elements integrated in chromatin regulating each of five stages spanning the in vitro differentiation of embryonic stem cells to blood. We also measured global chromatin accessibility, histone modifications and transcription factor binding. The integration of these data identified and characterised cis-regulatory elements which become activated prior to the onset of gene expression, some of which are primed in a signalling-dependent fashion. Deletion of such a priming element leads to a delay in the upregulation of its associated gene in development. Our work uncovers the details of a complex network of regulatory interactions with the dynamics of early chromatin opening being at the heart of dynamic tissue-specific gene expression control. Summary blurb In this manuscript, we exploited a new dataset of functionally characterised enhancer elements active at five stages of differentiation from mouse embryonic stem cells to blood to determine the developmental stages at which these elements are being activated. We show that many enhancer elements are activated at the level of chromatin prior to the activation of their associated genes (priming), which can be associated with signalling events. Elimination of priming elements within a gene locus leads to a delay in cellular development. Introduction The development of multicellular organisms requires the activation of different gene batteries which specify the identity of each individual cell type. Such shifts in cellular identity are driven by shifts in the gene regulatory network (GRN) consisting of transcription factors (TFs) binding to the enhancers and promoters of their target genes resulting in the alteration of gene expression ( Davidson et al., 2002 ). Such genes may again code for transcription factors, and thus a GRN comprises the sum of these regulatory interactions. Importantly, a GRN can be inferred from multi-omics data including chromatin immunoprecipitation (ChIP) assays, global gene expression and chromatin accessibility which together reaveal the TF motifs underlying gene regulation ( Assi et al., 2019 ; Bravo Gonzalez-Blas et al., 2023 ; Goode et al., 2016 ). During development, GRN shifts are initiated by the cellular signalling environment, arising from growth factors, cell-cell contacts and mechanical cues (reviewed in ( Edginton-White and Bonifer, 2021 ; Zaret, 2020 )) which activate intracellular transduction cascades that eventually change gene expression by regulating the activity of signalling-responsive transcription factors. However, development and GRN shifts are also a highly regulated multi-step processes that involve the generation of precursor cell types that further diversify until terminal differentiation is reached. In a similar vein, the actual activation of mRNA synthesis is not the first step in the activation of tissue-specifically expressed genes. The release of RNA Polymerase II from promoters is a multi-step process that requires the coordination of signalling processes, TF binding to enhancers and promoters, and the reorganisation and modification of chromatin to allow the assembly of multiprotein complexes and the interaction of these cis-regulatory elements in intranuclear space ( Jonkers and Lis, 2015 ). It is now well established that the chromatin structure of tissue-specifically expressed genes must first be rendered more accessible to allow full gene activation to occur, in a process called chromatin priming ( Bonifer and Cockerill, 2017 ; Hu et al., 1997 ). Chromatin priming at specific cis-regulatory elements was first observed in genes specific for terminally differentiated cells which are not expressed in multipotent blood progenitors (reviewed in ( Bonifer and Cockerill, 2017 )). Moreover, the opening up of chromatin in the absence of gene expression can serve as a molecular memory of a previous signalling event, allowing cells to reactivate genes more rapidly when receiving a second signal ( Bevington et al., 2017 ; Bevington et al., 2016 ). While the precise relationship between enhancer elements and primed elements, and whether they differ in their molecular features remains unclear, at least a subset of priming elements are devoid of enhancer activity when studied in isolation in reporter assays ( Bevington et al., 2016 ; Bonifer and Cockerill, 2017 ). We recently developed a global functional method that allowed us to assay enhancer activity of individual elements at five different stages during the in vitro differentiation of embryonic stem cells to blood ( Edginton-White et al., 2023 ). In the work presented here, we updated the coverage of our enhancer database and identified multiple cis-regulatory elements which are activated at the level of chromatin as a nuclease hypersensitive site prior to the onset of expression of the linked gene. We show (i) that with the exception of enhancer transcripts such elements do not have molecular or sequence features that distinguish them from enhancer elements, (ii) that primed sites are part of a wider gene regulatory network that prepares blood cell specific genes for expression, with many of them showing bona-fide enhancer activity at a later developmental stage. We studied one priming element in more detail and show that its elimination delays the activation of its associated gene, demonstrating a crucial influence of priming elements for the dynamics of gene expression control in development. Results Primed enhancers are part of large gene regulatory networks of developmentally regulated genes that only become expressed at a later differentiation stage In our previous work we used a mouse embryonic stem cell (ESC) based in vitro differentiation system spanning 5 different stages along the path to blood cell specification ( Edginton-White et al., 2023 ; Goode et al., 2016 ; Obier et al., 2016 ) (depicted in Fig 1A ): (1) ESCs, (2) FLK1+ hemangioblast cells (HB) which give rise to hematopoietic and endothelial cells, (3) the first stage of the hemogenic endothelium (HE1) which expresses a low level of the master regulator of hematopoiesis, RUNX1; (4) the second stage of the HE, HE2 where RUNX1 is upregulated and cells show full hematopoietic commitment; and (5) the final stage, hematopoietic progenitors (HP) which are cells budding off from the HE capable of forming mature blood cells. To identify functional enhancer elements, we isolated genomic fragments from open chromatin regions and re-integrated them into the genome at a safe habour reporter site embedded in the ES cell genome as depicted schematically in Fig 1B . These cells were then sequentially induced to differentiate, and cells were purified from the various stages using the surface markers depicted in Fig 1A . Cells harboring active enhancers were purified as YFP+ cells by flow-cytometry and the active integrated fragments were identified using next generation sequencing. For this work, we also resequenced the original transfection library to increase the number and coverage of elements (for details see Methods, data listed in Supplementary Datasets 1 and 2). After filtering ( Fig S1A ) our method identified thousands of open chromatin regions that were capable of driving reporter gene expression in a cell type specific fashion, many of which were distal elements, but also many promoters as previously discussed ( Fig S1B, C ) ( Maytum et al., 2023 ). Download figure Open in new tab Figure 1: Identification of primed enhancer elements A: Schematic of the in vitro ES cell differentiation system in serum and the cell types sorted for analysis. B: Depiction of the screening method using ATAC-Seq fragments from the five cell stages (ESCs, HB, HE1, HE2 and HP) shown in A. Bottom lower panel: FACS profile showing how high and low enhancer activity was defined. C: Diagrammatic representation of the chromatin state at a hypothetical cis-regulatory element becoming accessible at the HB cell stage prior to the onset of gene expression of the associated gene at the HE1 stage. D: Table of the number of cis-elements classified as primed for each of the changes of cell stages and the number of genes primed enhancers are associated with. ES>HB: elements with open chromatin and enhancer activity prior to the expression of their associated genes in HB. HB>HE and HE>HP: Transition later in development. E) Heatmap showing the median Z-score of gene expression values for genes associated to primed enhancers for each cell stage transition. F) Percentage of enhancer elements primed at the first stage of each transition that show enhancer activity at later stages. In this work we were interested in identifying regulatory elements which exist in open chromatin prior to the onset of expression of their linked gene (a hypothical example of priming in HB is depicted in Fig 1C ). The vast majority of these elements also showed enhancer activity in our assay. Because our initial analyses found little difference in stage-specific priming between HE1 and HE2, we only used the HE1 data set as HE for all subsequent analyses. These analyses identified (i) 330 enhancers that were active in ES linked to 221 genes that are activated later in HB (ES>HB), (ii) 294 enhancers that were active in HB linked to 174 genes that are activated later in HE (ES>HB), and (iii) 237 enhancers that were active in HE linked to 137 genes that are activated later in HP (HE>HP) ( Fig. 1D ). To show the overall trend of changes in transcriptional activity of these primed genes we also calculated the Z-score for the mRNA values for each subset and each of the four stages ( Fig. 1E ). We subdivided distal sites into those with low and high enhancer activity as measured by flow cytometry ( Fig 1B , bottom right panel, Fig S1D ). Additional analyses of enhancer activity in primed genes at the different stages of cell differentiation ( FigS1 E,F ) demonstrated a highly dynamic behaviour of the different elements. Roughly half of the priming enhancers identified maintained a similar level of enhancer activity at the next stage (High>High or Low>Low), about a quarter increased in activity (Low>High), while the remainder decreasing in activity (High>Low). Furthermore, many primed enhancers were active in more that one stage before the associated gene was expressed and/or remained active in more than one stage after activation ( Fig 1F ). This is particularly pronounced at the ES cell stage where 60% of all elements primed in ESCs (100%) stayed active at the HP stage, 80% of all elements primed at the HB stage stay active in HP cells, and 100% of all elements primed at the HE stage show enhancer activity at the HP stage. Whilst a subset of the ESC and HB active enhancer pattern is lost in HP, the hematopoietic HP program is already fully primed at the HE stage and thereby ready to go after the Endothelial-Haematopoietic Transition. We next asked the question of (i) which genes were associated with primed enhancers, and (ii) how these genes were organised within a wider network of expressed TF genes. To this end, we identified genes inactive at one developmental stage that were associated with primed enhancers and linked them to expressed TFs via their binding motifs as described in Fig 2A top panel. We also identified TF genes that contained primed enhancers (depicted in blue) that contain motifs for other TFs (incoming arrows) ( Fig 2B, C ). For the next differentiation stage, when these genes become active, we again linked their previously primed enhancers to the same TFs to examine, how the used motifs had changed (incoming links) and how the activation of expression of these TFs changed outgoing links ( Fig 2A , bottom panel). We performed this analysis for the ES to HB ( Fig 2B ), the HB to HE ( Fig S1 top panel) and the HE to HP transition ( Fig S2 , bottom panel). The results of these analyses provide a detailed picture of how one developmental stage of cell specification is anticipated in the previous stage. In ES cells the pluripotency signature was obvious with multiple motifs of OCT and SOX factors, but not NANOG, associated with primed enhancers. Moreover, ES cells contained the largest numbers of primed enhancers linked to TF encoding genes ( Fig2B , FigS3A ). Differentially regulated genes associated with enhancer priming often contained more than one primed enhancer and were mostly associated with different developmental processes ( Fig S3A , Fig S3B ). Download figure Open in new tab Figure 2: Primed enhancer elements form large gene regulatory networks that prime the next differentiation steps A: Schematic of Gene Regulatory Networks changing through differentiation. B: Schematic of gene regulatory networks (priming networks) formed by transcription factor encoding genes forming nodes (coloured circles) when their gene products (TFs) bind to other genes (outgoing arrows) which are not yet expressed, here for the transition from ESCs to HB. The analysis is based on the presence of binding motifs in the target genes, TFs are therefore listed as factor families capable of bindng the same motif. The node colour represents the gene expression value of a gene within the given cell type. Targets with incoming arrows are listed as individual genes. Details of which TF is associated with which gene can be seen using the following link: http://www.genomic-data.com/maytum2023 C: Number of genes encoding TFs with primed enhancers at each developmental stage. Motif use of primed enhancers changed during differentiation. For example, the RUNX1 locus (indicated by an arrow) was not expressed in ES cells, but was already primed by a cis-element containing a SMAD motif (note the arrow from SMAD to RUNX1 ). At the HB stage, Runx1 is barely expressed, but is now linked to genes activated by elements containing RUNX1 motifs. At the HB to HE and HE to HP transitions, Runx1 is linked to different primed genes which then become activated, some of them, such as GFI1, by the direct action of RUNX1 ( Lancrin et al., 2012 ). ETS factors, including ETV2, which has been shown to bind to hematopoietic genes prior to lineage committment ( Steimle et al., 2023 ) were widely used at each developmental stage. The gene encoding another important hematopoietic TF, TAL1, is primed in ESCs and then becomes upregulated and associated with enhancers at the HB stage as also schown by ChIP ( Goode et al., 2016 ). Towards the end of blood specification, the narrowing of developmental potential at the HE stage is associated with a near absence of primed TF genes, the extensive use of TFs known to drive hematopoiesis and the loss of links from specific TF families, such as TEAD, indicating that the enhancer code has changed and the respective motifs are not used anymore. Taken together, our analyses show in fine detail how the opening up of chromatin anticipates the further use of TFs expressed later in development. To be able to visualise the different connections, we have created a web resource that makes it possible to see the different connections within a high resolution image. The link is highlighted in the figure legend and the methods. Molecular features of primed enhancer elements We next investigated whether primed enhancers show distinct features as compared to active enhancer elements associated with active genes. It has been reported that active enhancers bind RNA Polymerase II and are transcribed to make eRNAs ( Lam et al., 2014 ). To examine, whether this was also true for primed enhancer elements, we measured nuclear RNA by RNA-Seq and correlated the presence of RNA sequences at intragenic sites which make up about half of all primed sites with the primed state ( Fig 3A ). We found a strong correlation for the presence of eRNAs at enhancers associated with active, but not with inactive genes, indicating that eRNA transcription is not associated with enhancer priming but gene activation. An example for such a non-transcribed primed element at the Bmper gene is shown in Fig 3B . This gene contains an enhancer that is primed in ES cells and becomes active in HB where gene activation is associated with a burst of non-coding transcription on the reverse strand. Download figure Open in new tab Figure 3: Primed enhancer elements are not transcribed but show the same molecular features as enhancers associated with active genes A: Heatmap showing the median Z-score, representing RNA-Seq tag counts at each intergenic primed enhancer across each stage of differentiation. This shows the dynamics of eRNA expression from primed enhancers. Bottom panel: Table of the number of intergenic and intragenic primed enhancers for each cell stage transition. B: Screenshot showing an enhancer (highlighted by a grey bar) primed in the HB for the Bmper locus with eRNA absent when enhancer is primed and present when the associated gene becomes active. C: Table of TF binding and chromatin features feeding into the analysis shown in G. Data from ( Gilmour et al., 2018 ; Goode et al., 2016 ; Obier et al., 2016 ). D-F: Open chromatin regions and histone modifications of primed enhancers throughout the different differentiation stages. For each transition pair, ATAC-Seq tag counts at primed sites were ranked. All other data were ranked alongside. G: Comparison of molecular features of priming elements and enhancers. Plot of proportion of features indicated in C at primed and active enhancer elements. The H3K27me3 mark in ESCs is highlighted. In our previous work, we used chromatin immunoprecipitation (ChIP) assays to measure TF binding and histone modifications at five stages of ES cell differentiation to blood ( Gilmour et al., 2018 ; Goode et al., 2016 ; Kellaway et al., 2021 ; Obier et al., 2016 ), listed in Fig 3C . Histone H3 lysine 27 trimethylation (H3K27me3) has previously been associated with poised chromatin waiting to be transcribed whereas histones flanking active enhancer elements become acetylated (Ac) at H3K27 ( Azuara et al., 2006 ). We therefore compared the presence of H3K27me3 and H3K27Ac at primed enhancers associated with inactive genes and enhancers associated with active genes ( Fig 3D-F ). Overall there was a decrease in H3K27me3 signal as elements transitioned from the primed to the active state, with more highly focussed signals at primed genes in ES, which was replaced by H3K27Ac in HB. We next asked the question of whether there were any features associated with primed enhancers which distinguished them from enhancers associated with active genes ( Fig 3G ). To this end we overlapped our enhancers and primed enhancers with histone and TF ChIP-Seq data and searched for a wide selection of TF motifs in each site. From these overlaps we produced a binary matrix and plotted the proportions of each feature in the enhancers versus primed enhancers. With the exception of H3K27me3 in ES cells, no other features distinguished primed enhancers from enhancers associated with active genes (data not shown). Taken together, our data show that (i) motif use of primed enhancers changes during differentiation, as it does for active enhancers, (ii) that eRNA presence is a hallmark of enhancers associated with active genes and (iii) that the polycomb-associated H3K27me3 mark is associated with the primed enhancer state only in ESCs but not in differentiating cells. VEGF signalling modulates enhancer priming In our previous work we used chromatin accessibility assays (ATAC-Seq) performed with cells isolated from a serum-free ES cell differentiation system which allowed us to examine the effect of specific cytokines on enhancer activation ( Edginton-White et al., 2023 ; Maytum et al., 2023 ; Pearson et al., 2008 ). We found that one cytokine, VEGF, was instrumental in activating enhancers driving the expression of endothelial genes, but then needed to be withdrawn to enable the activation of hematopoietic enhancers, notably those of Runx1 which is essential for the expression of blood cell specific genes such as SPI1 (PU.1) ( Huang et al., 2008 ). In turn, the presence of VEGF blocked the activation of Runx1 enhancers even when studied in isolation ( Edginton-White et al., 2023 ). We therefore examined our primed enhancer collection in HE cells (237 HE>HP elements, see Fig 1D ) to identify those responsive, i.e. being present or absent depending on the presence or absence of VEGF ( Fig 4A ), as outlined in the top panel of Fig 4B . Gene expression was measured by single cell RNA-Seq in HE and HP (all data from ( Edginton-White et al., 2023 )). 34 genes contained primed enhancers which were suppressed by the presence of VEGF and became activated in HE once VEGF was withdrawn and significantly increased gene expression in HP cells ( Fig 4B , bottom panel). Examples for such genes and elements are shown in Fig 4C-E , with primed enhancers being highlighted. The most important gene in this collection is the Spi1 locus which encodes the master regulator of myelopoiesis, PU.1 ( Fig4 C ). This gene is a direct target of RUNX1 which binds to an enhancer element at −14 kb upstream of the promoter (3’URE, ( Huang et al., 2008 )). This element is primed in the HE and in the presence of VEGF where the gene is silent / lowly expressed. Once VEGF is removed, RUNX1 is upregulated and together with PU.1 itself and other factors activates this and other enhancers within the locus and up-regulates PU.1 expression ( Lichtinger et al., 2012 ). Other genes associated with VEGF-responsive enhancers include the genes encoding TFs (TOX, BCL11a), multiple signalling proteins such as the hematopoietic cytokine receptors for CSF3 and CSF2, and cytokines such as SPP1 (Osteopontin). Download figure Open in new tab Figure 4: Primed enhancers can be established by signalling and can acquire enhancer activity when studied in isolation A: Table showing the number of primed enhancers predicted as being VEGF responsive to in the HE and HP cell types, i.e. being present or absent in the presence or absence of VEGF. B: Dot plot of differential gene expression analysis of genes linked to priming elements which are increased in the absence of VEGF from HE and HP. Dot colour shows the fold change in gene expression and dot size shows the Bonferroni corrected P Value. Top of panel shows a diagrammatic representation of the chromatin state of the genes associated enhancer elements and the gene expression of the genes in HE and HP. C-E: UCSC browser screenshots of ATAC data showing example priming elements for Spi1 ( PU.1 ), Nrros and Dok2. The black tracks represent ATAC-Seq data from cells grown in serum culture, the red tracks represent cells (HE and HP) in serum-free medium with and without VEGF. Violin plots showing the normalised average expression of each gene in the presence (+VEGF) and absence (-VEGF) of VEGF for HE and HP based on previously published single cell data ( Edginton-White et al., 2023 ). These experiments demonstrate that extracellular signalling acting on primed enhancer elements plays an important role in the up-regulation of hematopoietic genes. Tissue-specific gene regulatory networks regulate the priming and activation of single enhancers As seen in Fig S1E and F , the fact that a priming element is associated with an inactive gene does not mean that the element is unable to up-regulate the activity of a minimal promoter at this developmental stage, i.e. displaying functional enhancer activity. We therefore asked the question of how individual primed enhancer elements operate in isolation and within the context of an entire gene locus. To this end, we first cloned individual priming elements found in HE or HP-specifically expressed genes which were found to be organised in open chromatin prior to the onset of gene expression into our targeting site and measured their activity by flow cytometry ( Fig S4 ). We first investigated the Hand1 cardiovascular gene and the endothelial-specific gene Kdr encoding FLK1 (VEGF-receptor). Both genes are strongly upregulated at the HB stage, but the stimulatory activity of their priming enhancers in isolation at this stage is barely measurable ( Fig S4A,B ). Moreover, activity of these elements is repressed at later developmental stages (HP) when gene expression goes down. A similar pattern is seen at the Meis1 locus which is up-regulated from the HB stage onwards, and contains a primed element at −45 Kb. Here priming element activity does not represent the activity of the whole gene locus. A different pattern is seen with the −14kb Spi1 3’URE. Here enhancer activity is initially low, but then becomes strongly up-regulated at the HP stage when RUNX1 and C/EBPα are expressed and bind to this element ( Leddin et al., 2011 ), thus mirroring the activity profile of the whole gene. Another example of a priming element representing the activity of the whole locus is in Mecom which encodes the proto-oncogene EVI1 ( Fig 5A ) ( Ayoub et al., 2018 ). The gene is upregulated in HE1 but is then sharply down-regulated ( Fig 5A,B ). It has recently been shown to be essential for the development of endothelial cells ( Lv et al., 2023 ). It contains an enhancer located at +340 kb which is primed in HB but when examined in isolation does not show high enhancer activity in our reporter assay until the HE1 state ( Fig 5C ). Closer inspection of the fragments with enhancer activity showed a shift of the open chromatin region towards the 3’ end of the gene ( Fig S5A ). The analysis of the motif content shows that this enhancer is bimodal with a 3’ endothelial motif signature (RBPJ and AP-1), which functions as priming element and acquires HE-specific enhancer activity, and a 5’ hematopoietic signature (RUNX1, ETS, GATA/E-Box (TAL1)) which is associated with enhancer repression ( Fig S5B ). Closer inspection of its features using published data ( Edginton-White et al., 2023 ) revealed that this enhancer does not only represent a priming element, but is also VEGF responsive ( Fig S6A ) with an open chromatin region appearing in the HB and the HE under the All Cytokine condition, which then becomes more prominent when VEGF is withdrawn but then disappears at the HP stage. The examination of TF binding data from cultures containing serum ( Gilmour et al., 2018 ; Goode et al., 2016 ; Obier et al., 2016 ) shows that the primed enhancer is bound by LMO2 and TAL1 in the HB whilst the promoter is associated with bivalent chromatin. At the HE stage, when the enhancer is activated, occupancy shifts and the enhancer binds FLI1, LMO2 and TEAD4. At that stage, the promoter histones become acetylated to revert to the bivalent state at the HP state with loss of an open chromatin at the enhancer. Download figure Open in new tab Figure 5: The removal of a signalling-responsive primed enhancer element at the Mecom locus does not alter the differentiatin trajectory but reduces the number of hematopoietic cells UCSC Browser screenshot showing the Mecom locus. The +340kb priming enhancer is highlighted by a grey box. Distal cis-regulatory elements scoring positive in the enhancer screen are depicted as black vertical bars for each of the 5 cell types. The ATAC-Seq peaks for each of the 5 cell types shown. Bulk RNA-seq analysis showing the forward (Fwd) and reverse (Rev) reads for each cell type. B: Average gene expression value (Log2 counts per million) of Mecom in each of the 5 cell types. n=2 biologically independent replicates, whiskers show the value of each replicate, red dotted line shows the threshold value determined as being expressed. C: Activity profile of +340kb Mecom enhancer element in each of the 5 cell types (Error bars show the standard deviation from n=3 biologically independent replicates). Enhancer activity was normalised against the median FITC value of the minimal promoter (MP) control depicted by the red dotted line. n=3 biologically independent replicates, error bars show the standard deviation, Significant P Values shown, P Values were calculated using two-sided Student’s t -test. Presence or absence of an ATAC site at the 5 cell stages is expressed as a binary code (1= scoring positive; 0= scoring negative). D: Mecom gene expression, measured by qPCR, in cells carrying the wild type locus or a locus with a homozygous deletion of the +340 kb enhancer (CRSPR) in the indicated cell types and over a time course of blast culture (n=3 biologically independent replicates). E: Expression of CD41 on the surface of cells measured by flow cytometry (n=3 biologically independent replicates). F: Composition of cell types during the time course of blast culture as measured by flow cytometry (see Fig 1A ). n=3 biologically independent replicates. Taken together, this data confirms that in isolation, priming elements may have little enhancer activity by themselves, but can in some cases acquire high stimulatory activity at later developmental stages by binding additional TFs or by being repressed, indicating that a larger network of factors is modulating enhancer activity. Our data therefore provide a molecular explanation for the cell-stage specific sensitivity of gene expression to perturbation of indivdual enhancers within individual gene loci ( Luo et al., 2023 ). To address this issue in more detail in the context of the entire Mecom locus, we used CRISPR/Cas9 to remove the +340kb enhancer and measured gene expression during a time course (16hr, 40hr and 64hr) of blast culture differentiation from FLK1+ HB cells ( Fig 5D ) together with the expression of CD41 which is a direct RUNX1 target ( Fig 5E ). The development of the different precursor cell types was measured alongside ( Fig 5F ). In the HB the Mecom promoter is already active and organised in open chromatin, together with the priming element at +340 kb ( Fig.5A ), and the 5’ end of the locus is marked by a constitutive open chromatin region containing a CTCF motif which is part of the promoter. All other enhancers are still inactive. In the HE stage, multiple enhancers come on line which is associated with high level transcription ( Fig 3A ). Thereafter, at the HP stage Mecom is repressed and appears to be reverting to its primed state ( Fig 5C ). The removal of the +340 kb enhancer led to a complete collapse of gene activation in spite of the presence of multiple additional enhancer elements which are activated at the level of chromatin at the HE stage. Moreover, we noted a strong reduction in the development of HE cells expressing RUNX1 (CD41+ cells). However, the actual developmental trajectory is not affected as at later stages of differentiation the proportion of cells committed to the hematopoietic fate within the population slowly catches up once the other cis-elements become activated, and a threshold of activation is crossed. In summary, our data demonstrate the importance of a primed enhancer element for correct cell stage-specific gene activation. Discussion Our detailed analysis of the timing of gene activation at the level of chromatin highlights a number of important principles in how enhancer elements activate developmentally controlled genes, summarised in Figure 6 . Our updated enhancer database identifies hundreds of enhancer elements which exist as open chromatin regions prior to the onset of expression of cell stage-specifically expressed genes. These primed enhancer elements form a vast interconnected network of TF-bound cis-elements that open up the chromatin of precursor cells for the execution of following cell fate decisions but do not yet influence gene expression. Primed enhancers are associated mostly with genes specific for the next developmental stage and the architecture of loci associated with primed enhancers can involve an already set up promoter (as in RUNX1 or Mecom ) or a closed promoter (as in Dok2 ). When examined in isolation and during differentiation, priming enhancer elements show different activities with some having low or absent activities (as in KDR ), some having high activities that are then being repressed (as in Mecom ) and others aqcuiring strong enhancer activity at a late differentiation stage (such as Spi1 ). Download figure Open in new tab Figure 6: Model of enhancer priming through cell fate transitions. Nucleosomes are depicted as round shapes with DNA wrapped around them. Me: H3K4 mono- or tri methylation. Ac: H3 K27 or K9 acetylation. For model interpretation see the main text. The work described here also addressed the nature of the molecular difference between priming enhancers and enhancers associated with actively transcribed genes. Comparsons of multiple features of the two enhancer classes at different developmental stages revealed essentially no difference ( Fig 3C ): All elements were flanked by modified histones and bound TFs specific for the cell state of the respective cells - with one exception: ES cells. In these cells priming elements were abundant and were associated with the H3K27me3 mark. We believe that this feature is a hallmark of embryonic stem cells which are kept at a undifferentiated state ( Azuara et al., 2006 ; Rada-Iglesias et al., 2011 ) whereas cells purified from our in vitro differentiation system represent a dynamic cell population rapidly changing cell fate. Moreover, Polycomb group complexes complexes have mostly been associated with promoter elements ( Voigt et al., 2013 ). We have also shown that in HP cells, 25% of our functionally identified enhancer elements are bound by RNA-Polymerase II ( Edginton-White et al., 2023 ). Enhancer transcription has been shown to be important for the activity of entire gene loci (reviewed in ( Field and Adelman, 2020 )), most likely due to the fact that it is required for the establishment of enhancer-promoter interaction ( Fitz et al., 2020 ). We did not see enhancer transcription to be globaly associated with priming elements as it only seems to be associated with enhancers associated with active genes. However, note that some priming enhancers are paired with an already open, but inactive, promoter which could mean that an interacting complex has already been set up. We have previously shown that hundreds of enhancer elements respond to outside signals such as cytokines, with VEGF modulating the choice between endothelial and hematopietic fate ( Edginton-White et al., 2023 ; Maytum et al., 2023 ). An important finding from our study was therefore that this feature holds also true for priming elements. We identified multiple VEGF regulated priming elements associated with the activation of hematopoietic genes such as Spi1 (PU.1) C , sf3r or BC11a at the HP stage. An important VEGF-responsive gene is Mecom which is transcriptionally activated at the HE stage and is a major regulator for endothelial cell development( Lv et al., 2023 ). Our work shows that its +340 kb enhancer element which is primed at the HB stage is crucial for the tissue-specific activation of this gene. Therefore, one conclusion of our study is that not only does signalling contribute to regulating the activity of active enhancer elements in development, but also to the set-up of developmental programs that are executed later. It follows that, depending on whether a cell has seen a stimulus, TFs directing a specific cell fate will encounter a different chromatin landscape and the genomic response will be different. We could indeed show that the timing of withdrawal of VEGF is essential for the execution of the endothelial-hematopietic transition and for the binding of hematopoietic TFs ( Edginton-White et al., 2023 ). Another example of how signalling dependent chromatin is used to direct cell fates is seen in the neuronal development of C.Elegans where the priming of an early enhancer by Notch signalling leads to a difference in the up-regulation of a mi-RNA, and a difference in left–right asymmetry, depending on whether cells received the signal or not( Cochella and Hobert, 2012 ). This type of signalling dependent priming to drive developmental changes differs from that of molecular memory seen in the immune system: Here signalling activates previously inactive chromatin in naive cells that have not seen a stimulus before. Once the stimulus is gone, cells fall back into a quiescent state but maintain a memory of recent activation (( Bevington et al., 2016 ; Bonifer and Cockerill, 2017 ; Pascual-Garcia et al., 2022 ) and references therein). If a second stimulus arrives, the response is much more rapid but cells maintain their overall identity. An important feature of priming elements is the fact that deleting them affects the timing of cellular development, as demonstrated by deleting the +340kb Mecom enhancer. Here, the activation of gene expression at the HE1 stage is reduced until the GRN has passed a threshold that brings the other enhancers online and the proportion of HP cells within the population catches up (albeit at reduced numbers). It has been shown that Mecom expression is crucial for the expression of VEGFR2 which is a major receptor for VEGF signaling( Lv et al., 2023 ) thus setting up a feed forward loop that provides a molecular explanation for this result. A similar phenomenon was seen when the Spi1 (PU.1) −14 URE was mutated by eliminating a PU.1 autoregulatory binding site, upregulation of gene expression was delayed until additional enhancers were activated ( Lichtinger et al., 2012 ). These experiments demonstrate that removing or crippling cis-regulatory elements involved in priming from an endogenous gene locus leads to a profound difference in the kinetics of cell fate decisions in development, and it is this feature which is most likely be affected in elements that are affected by mutations or single nucleotide polymorphisms (SNPs) scoring in GWAS analyses ( Choudhuri et al., 2020 ). Chromatin priming and the precise timing of the activation of enhancer elements driving gene expression at the right time and in the right cell type is therefore at the very heart of all coordinated, synchronised cell differentiation processes that create fully developed multi-cellular organisms. Directed cell differentiation needs to take these processes into account. Our priming element resource adds an additional dimension to our ability to interrogate the fine details of hematopoietic specification from embryonic stem cells. Materials and Methods ES Cell Culture A HM-1 targeting ES cell line ( Magin et al., 1992 ) was cultured on gelatinised tissue culture plates in DMEM-ES media (DMEM (Merk.,D5796), 15% FSC, 1mM sodium pyruvate (Merck, S8636), 1x penicillin /Streptomycin (Merck, P4333), 1 × L-Glutamine (Merck, G7513), 1 × Non-Essential amino acids (Merck, M7145), 1000⍰U/ml ESGRO®LIF (Merck, ESG1107), 0.15⍰mM MTG and 25⍰mM Hepes buffer (Merck, H0887)) at 37⍰°C and 5% CO 2 . Every 48h cell colonies were disociated with TrypLE™ Express (ThermoFisher, 12605010) and replated onto gelatinised tissue culture plates at 1.2 ×10 4 per cm 2 . In vitro hematopoietic differentiation in serum Hematopoietic in vitro differentiation (I.V.D) using serum was performed as described in ( Obier et al., 2016 ) and ( Edginton-White et al., 2023 ). First, ES cell colonies being cultured on gelatinised plates were dissociated to form a single cell suspension using TrypLE™ Express (ThermoFisher, 12605010). DMEM-ES media was then added at a 1:1 ratio to stop the trypsin activity. The cells were then centrifuged at 300g for 5 minutes before being resuspended at 2.5⍰×⍰10 4 /ml in I.V.D media (IMDM (Merck, I3390), 15% FCS, 1 × Penicillin/Streptomycin (Merck, P4333), 1 × L-Glutamine (Merck, G7513), 0.15⍰mM MTG, 501µg/ml Ascorbic acid and 180⍰µg/ml Human transferrin (Merck, T8158)) and then plated onto non-adherent dishes (ThermoFisher, 501⍰V). he cells were then incubated at 37⍰°C, 5% CO 2 for 3 days to allow for the formation of floating embryoid bodies (EBs). The floating EBs were then transferred to 50 ml centrifuge tubes and the EBs were allowed to settle by gravity over 5 minutes. The EBs were then washed with PBS before being allowed to settle again over 5 minutes. The EBs were then dissociated with TrypLE™ Express (ThermoFisher, 12605010) with gentle pipetting. The dissociated cells were sorted for the FLK1 surface marker (forming the population referred to as the HB). The dissociated cells were incubated with a FLK1 biotin-coupled antibody (1:200) (eBioscience, 13-5821-82), and then with MACS anti-biotin beads (Miltenyi Biotec, 130-090,485). FLK1 expressing cells were sorted for by separation using a MACS LS column (Miltenyi Biotec, 130-042-401). FLK1 expressing HB cells were then taken for flow cytometry analysis and sequencing experiments as well as further differentiation in blast culture into HE1, HE2 and HP populations. To achieve this FLK1+ HB cells were plated onto gelatine coated tissue culture flasks at a concentration of 1.6⍰×⍰10 4 cells per cm 2 in Blast media (IMDM (Merck, I3390), 10% FCS, 1 × Penicillin/Streptomycin (Merck, P4333), 1 × L-Glutamine (Merck, G7513), 0.45⍰mM MTG, 25⍰µg/ml Ascorbic acid, 180⍰µg/ml Human transferrin (Merck, T8158), 20% D4T Conditioned Media, 5⍰ng/ml VEGF(PeproTech, 450-32), 10⍰ng/ml IL-6 (PeproTech, 216-16)) and were left to incubate for 2.5 days at 37⍰°C, 5% CO 2 . HE1, HE2 and HP populations were FACS sorted after incubation with KIT-APC (1:100)(BD Pharmingen, 553356), TIE2-PE (1:200)(eBioscience, 12-5987-82) and CD41-PECY7 (1:100)(eBioscience, 25-0411-82) antibodies into HE1 (KIT+, TIE2+, CD41-), HE2 (KIT+, TIE2+, CD41+) and HP (KIT+, TIE2-, CD41⍰+) populations. Enhancer reporter analysis We perfomed additional next generation sequencing on library material previously used in ( Edginton-White et al., 2023 ). Libraries were resequenced on an Illumina Nova-seq 6000 using an SP 200 cycle flow cell. The sequencing data was combined with the previously published data and analysed using the published pipeline with slight modification. Briefly reads were trimmed for quality and length using TrimGalore ( Krueger et al., 2021 ) with parameters --nextera --length 70 –paired. Trimmed reads were aligned to the mm10 genome using Bowtie2 (v2.3.5.1) (--very-sensitive --fr --no-discordant -X 600 --no-mixed) ( Doi, 1990 ) and the aligned reads were stringently filtered for unique high quality alignment (mapq 40) using Samtools. The resulting bam file was converted to a bedpe file using the bamtobed function in bedtools ( Quinlan and Hall, 2010 ) and then to a bed file by taking the first co-ordinate of read 1 and the final co-ordinate of read 2 for each pair. Duplicate fragments were then removed using the uniq function in the bed file in the shell. The enhancer screen fragments were then further filtered firstly against the negative control libraries (produced from WT cells with no enhancer reporter cassette integration) to remove PCR artefacts, then by the union of all plasmid library fragments to further remove PCR artefacts by ensuring the identical fragment was in the original plasmid libraries. Finally the fragments were filtered for their presence in open chromatin by filtering against ATAC-Seq peaks. ATAC-Seq peaks were then assigned enhancer positive status if they overlapped with at least 1 fragment from the enhancer screen positive libraries. Enhancer activity levels were assigned by counting the number of high and low activity fragments (based on FACS sorting) at each enhancer positive ATAC site, normalising against the total number of fragments and then assigning an actvitiy state based on the ratio of high to low fragments at each site. RNA-Seq Library Preparation Nucelar RNA enriched RNA-seq libraries were produced using RNA extracted with the Cytoplasmic and Nuclear RNA Purification kit (Norgen, 21000,37400) based on manufacturers instructions. RNA-Seq libraries were then prepared using the NEBNext® Ultra ™ II Directional RNA Library Prep Kit (NEB, E7760) total RNA with rRNA depletion protocol using 100 ng of input RNA. Libraries were sequenced using a Nova-Seq 6000 SP 200 cycle flow cell. RNA-Seq Data Analysis RNA-Seq reads were first filtered using RiboDetector (v0.2.7) ( Deng et al., 2022 )using options -t 70 -l 75 -e norrna --chunk_size 256 to remove any residual rRNA reads from the libraries. The reads were then filtered for quality and length using Trimmomatic ( Bolger et al., 2014 ) with options LEADING:3 TRAILING:3 SLIDINGWINDOW:4:20. The trimmed reads were aligned to the mouse genome (mm10) using Hisat2 (v2.2.1) ( Kim et al., 2019 ) using default options. Raw counts were obtained using featureCounts ( Liao et al., 2014 ) with gene models from (ensembl as the reference transcriptome. Counts were normalized using the edgeR package (v3.40.2)( Robinson et al., 2010 ) in R (v4.2.3), and differential gene expression analysis was carried out using the Limma-Voom (v3.17) ( Law et al., 2014 ) method. Primed Enhancer Identifcation To identify primed enahncers, distal ATAC sites (>1.5kb from a TSS) testing positive for enhancer activity were linked to genes using published Promoter capture HiC data from ES cells and HPC7 cell (accession numbers: GSM2753058, runs: SRR5972842, SRR5972842, SRR5972842, SRR5972842, SRR5972842) and from HPC7 from Comoglio et. al (accession numbers: GSM2702943 & GSM2702944, runs SRR5826938, SRR5826939) or where this was not possible, by closest gene, as previously published ( Edginton-White et al., 2023 ). The enhancers were then filtered into stage transitions, for example, all enhancers occurring in both the ES and HB stages. They were then further filtered by differential gene expression looking for enhancers associated with genes that had a significant (p-adjusted<0.05) 2 fold upregulation across the stages with enhancer activity and were not expressed in the initial stage (CPM<9). Gene ontogology analysis of genes with primed enhancers was carried out using DAVID (( Huang da et al., 2009 ; Sherman et al., 2022 ). CRISPR/Cas9 enhancer validation Validation of the Mecom primed enhancer by removal of the enhancer region by CRISPR/Cas9. A guide sequence was designed to target each end of the enhancer region (CACCGGAACAGTAGCCTATCTGTCC and CACCGGGAAACCTACTGTCCCAGGA) (chr3:30353652-30354669). The guide seqences were purchased as DNA oligos and cloned into the PX458 Cs9 ad sgRNA expression vector by digestion with the BbsI restriction enzyme (NEB) and ligation using T4 Ligase (NEB). (pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138; http://n2t.net/addgene:48138 ; RRID:Addgene_48138). HM-1 ES cells were transfected with the resulting vector using a Nucleofector®-4D (Lonza) with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT, GCTTTTTGCTGCTCTGCGTT). The positive clone was then confirmed by sanger sequencing showing removal of the intended enhancer region. Enhancer feature comparison To study the features associated with enhancer elements, we first performed a TF binding motif searching using Homer annotatePeaks.pl ( Heinz et al., 2010 ) with the -m option and using the set of Probability Weight Matrices (PWM) for TF’s published in ( Edginton-White et al., 2023 ). To then compare the features associated with all enhancers vs primed enhancers we created a binary matrix using pybedtools to overlap the enhancer sets with the output from the motif search and published ChIP-Seq data for a number of histone modifications and TFs (GSE69101, GSE143460, GSE126496 and GSE79320). The percentage contribution of each feature to each enhancer type was then calaculated and plotted. Network Analysis Gene regulatory networks were constructed as previously described using custom Python scripts, available from ( Coleman et al., 2023 ). In brief, networks of priming elements were made using the genomic coordinates of primed ehancers at each stage transition. The positions for each TF biniding motif were retreived from these peak sets using the annotatePeaks.pl function in Homer as described in the ‘Enhancer Feature Comparrsion’ method above. We then added coordinates for the promoters of a wide range of transcription factors as well as gene expression values for each differentiation stage obtained from RNA-Seq experiments. This data was then used to construct a network where transcription factor genes and their target genes are represented as nodes, with the presence of a TF binding motif in a primed enhancer targeting a gene shown as an edge. The resulting network, which shows which TFs have potential to regulate which primed enhancers (shown as their associated gene) was then plotted using Cytoscape ( Shannon et al., 2003 ). Data Availability The Genome-wide data generated in this study have been deposited in the Gene expression omnibus database under accession code GSE198775. The genome-wide data generated in this study have also been provided as a UCSC Genome Browser Track-Hub and interactive versions of the networks are available from http://www.genomic-data.com/maytum2023 Author contributions A.M. and B.E-W. performed experiments, generated and analysed data, P.K. analysed data, J.B. supervised data analysis and together with P.N.C. analysed data and helped writing the manuscript, C.B. conceived and directed the study and C.B., A.M. and B.E-W. wrote the manuscript Conflict of interest The Authors declare no competing interests. Legends of Supplementary Figures Download figure Open in new tab Supplementary Figure 1 (Related to Figure 1) A: Revised filtering pipeline to integrate additional enhancer elements into the data-set produced by Edginton-White, Maytum et al., ( Edginton-White et al., 2023 ). B: Updated list of fragments scoring positive (left panel) or negative (right panel) in our assay, and their association with promoter or enhancer sequences. C: Number of open chromatin (ATAC-Seq) regions scoring in our assay and their nature (Enhancer / promoter). D: Number of distal ATAC sites with low or high enhancer activity. E: Dynamic behaviour of priming elements in our enhancer assay during cell fate transitions. F: Percentage of priming elements in our enhancer assay during cell fate transitions showing the indicated behaviour. Download figure Open in new tab Supplementary Figure 2 (Related to Figure 2) Schematic of gene regulatory networks (priming networks) formed by transcription factor encoding genes forming nodes (coloured circles) when their gene products (TFs) bind to other genes (outgoing arrows) which are not yet expressed. A: Transition from HB to HE, B: transition from HE to HP. For all other features see legend of Figure 2 . Details of which TF is associated with which gene can be seen using the following link: http://www.genomic-data.com/maytum2023 . Download figure Open in new tab Supplementary Figure 3 (Related to Figure 3) A: Primed enhancers per gene for each of the three indicated transitions. B: Genes associated with 2 or more primed enhancer elements for the three indicted transitions, C: GO terms for all genes linked to primed enhancer elements and the number of genes within this group along with P values indicated on the right. Download figure Open in new tab Supplementary Figure 4 (Related to Figure 4) A-D): Screenshots of the indicated gene loci with priming elements highlighted by a grey box. ATAC-Seq profile for each of the 5 cell stages show along with the RNA-Seq forward (Fwd) and reverse (Rev) tag counts. Middle panel: Expression of the gene as measued by RNA-Seq of nuclear RNA with the dotted red line showing the threshold values determined as being expressed. Right panels: Activity of ATAC-Seq fragments scoring positive for enhancer activity at the different developmental stages. n=3 biologically independent replicates for Hand1, Meis1 and Spi1 , n=5 biologically independent replicates for Kdr . The presence or absence of an ATAC site is indicated as a binary code (1=scoring positive, 0=scoring negative). Error bars show the standard deviation. Significant P Values shown, P Vaues calculated using two-sided Students t -test. Download figure Open in new tab Supplementary Figure 5 (Related to Figure 5) A: UCSC Genome Browser screenshot showing a close-up of the Mecom +340kb enhancer with the distribution of cuts (ATAC-Seq) at the different developmental stages being indicated. B: Sequence of enhancer fragment with annotated transcription factor binding motifs. Download figure Open in new tab Supplementary Figure 6 (Related to Figure 5) Mecom enhancers are VEGF responsive. UCSC browser screenshot highlighting the position of the Mecom +340 kb enhancer and the promoter (grey boxes). A: ATAC-Seq profile at the 5 indicated developmental stages (black lanes), below (red) depiction of the ATAC-Seq profiles from a serum free cell culture in the presence (All Cytokines) or absence (-VEGF) of VEGF. data from ( Edginton-White et al., 2023 ). B: Transcription factor binding profile of the same region at the HB, HE and HP stage. Data from ( Gilmour et al., 2018 ; Goode et al., 2016 ; Obier et al., 2016 ). Acknowledgements This research was funded by a project grant from the Biotechnology and Biological Sciences Research Council (BBSRC) to C.B. and J.B. (BB/R014809/1), a BBSRC MiDTP studentship to C.B. for A.M., a BBSRC MIBTP studentship to A.M., as well as a grant from the Medical Research Council (MR/S021469/1) to CB and P.N.C. We thank Genomics Birmingham for expert sequencing services and the Birmingham Technology Hub and Mary Clarke for cell sorting facilities. Footnotes ↵ * Joint first http://www.genomic-data.com/maytum2023 References ↵ Assi , S.A. , Imperato , M.R. , Coleman , D.J.L. , Pickin , A. , Potluri , S. , Ptasinska , A. , Chin , P.S. , Blair , H. , Cauchy , P. , James , S.R. , et al. ( 2019 ). Subtype-specific regulatory network rewiring in acute myeloid leukemia . Nat Genet 51 , 151 – 162 . OpenUrl CrossRef ↵ Ayoub , E. , Wilson , M.P. , McGrath , K.E. , Li , A.J. , Frisch , B.J. , Palis , J. , Calvi , L.M. , Zhang , Y. , and Perkins , A.S . ( 2018 ). EVI1 overexpression reprograms hematopoiesis via upregulation of Spi1 transcription . Nat Commun 9 , 4239 . OpenUrl ↵ Azuara , V. , Perry , P. , Sauer , S. , Spivakov , M. , Jorgensen , H.F. , John , R.M. , Gouti , M. , Casanova , M. , Warnes , G. , Merkenschlager , M. , et al. ( 2006 ). Chromatin signatures of pluripotent cell lines . Nat Cell Biol 8 , 532 – 538 . OpenUrl CrossRef PubMed Web of Science ↵ Bevington , S.L. , Cauchy , P. , and Cockerill , P.N . ( 2017 ). Chromatin priming elements establish immunological memory in T cells without activating transcription: T cell memory is maintained by DNA elements which stably prime inducible genes without activating steady state transcription . Bioessays 39 . ↵ Bevington , S.L. , Cauchy , P. , Piper , J. , Bertrand , E. , Lalli , N. , Jarvis , R.C. , Gilding , L.N. , Ott , S. , Bonifer , C. , and Cockerill , P.N . ( 2016 ). Inducible chromatin priming is associated with the establishment of immunological memory in T cells . EMBO J 35 , 515 – 535 . OpenUrl Abstract / FREE Full Text ↵ Bolger , A.M. , Lohse , M. , and Usadel , B . ( 2014 ). Trimmomatic: a flexible trimmer for Illumina sequence data . Bioinformatics 30 , 2114 – 2120 . OpenUrl CrossRef PubMed Web of Science ↵ Bonifer , C. , and Cockerill , P.N . ( 2017 ). Chromatin priming of genes in development: Concepts, mechanisms and consequences . Exp Hematol 49 , 1 – 8 . OpenUrl CrossRef ↵ Bravo Gonzalez-Blas , C. , De Winter , S. , Hulselmans , G. , Hecker , N. , Matetovici , I. , Christiaens , V. , Poovathingal , S. , Wouters , J. , Aibar , S. , and Aerts , S. ( 2023 ). SCENIC+: single-cell multiomic inference of enhancers and gene regulatory networks . Nat Methods . ↵ Choudhuri , A. , Trompouki , E. , Abraham , B.J. , Colli , L.M. , Kock , K.H. , Mallard , W. , Yang , M.L. , Vinjamur , D.S. , Ghamari , A. , Sporrij , A. , et al. ( 2020 ). Common variants in signaling transcription-factor-binding sites drive phenotypic variability in red blood cell traits . Nat Genet 52 , 1333 – 1345 . OpenUrl CrossRef ↵ Cochella , L. , and Hobert , O . ( 2012 ). Embryonic priming of a miRNA locus predetermines postmitotic neuronal left/right asymmetry in C. elegans . Cell 151 , 1229 – 1242 . OpenUrl CrossRef PubMed ↵ Coleman , D.J.L. , Keane , P. , Luque-Martin , R. , Chin , P.S. , Blair , H. , Ames , L. , Kellaway , S.G. , Griffin , J. , Holmes , E. , Potluri , S. , et al. ( 2023 ). Gene regulatory network analysis predicts cooperating transcription factor regulons required for FLT3-ITD+ AML growth . bioRxiv , 2023.2007.2018.549495 . ↵ Davidson , E.H. , Rast , J.P. , Oliveri , P. , Ransick , A. , Calestani , C. , Yuh , C.H. , Minokawa , T. , Amore , G. , Hinman , V. , Arenas-Mena , C. , et al. ( 2002 ). A genomic regulatory network for development . Science 295 , 1669 – 1678 . OpenUrl Abstract / FREE Full Text ↵ Deng , Z.L. , Munch , P.C. , Mreches , R. , and McHardy , A.C . ( 2022 ). Rapid and accurate identification of ribosomal RNA sequences via deep learning . Nucleic Acids Res 50 , e60 . OpenUrl ↵ Doi , T. ( 1990 ). Introducing the concept of amae . P N G Med J 33 , 147 – 150 . OpenUrl PubMed ↵ Edginton-White , B. , and Bonifer , C . ( 2021 ). The transcriptional regulation of normal and malignant blood cell development . FEBS J . ↵ Edginton-White , B. , Maytum , A. , Kellaway , S.G. , Goode , D.K. , Keane , P. , Pagnuco , I. , Assi , S.A. , Ames , L. , Clarke , M. , Cockerill , P.N. , et al. ( 2023 ). A genome-wide relay of signalling-responsive enhancers drives hematopoietic specification . Nat Commun 14 , 267 . OpenUrl ↵ Field , A. , and Adelman , K . ( 2020 ). Evaluating Enhancer Function and Transcription . Annu Rev Biochem 89 , 213 – 234 . OpenUrl ↵ Fitz , J. , Neumann , T. , Steininger , M. , Wiedemann , E.M. , Garcia , A.C. , Athanasiadis , A. , Schoeberl , U.E. , and Pavri , R . ( 2020 ). Spt5-mediated enhancer transcription directly couples enhancer activation with physical promoter interaction . Nat Genet 52 , 505 – 515 . OpenUrl CrossRef ↵ Gilmour , J. , Assi , S.A. , Noailles , L. , Lichtinger , M. , Obier , N. , and Bonifer , C . ( 2018 ). The Co-operation of RUNX1 with LDB1, CDK9 and BRD4 Drives Transcription Factor Complex Relocation During Haematopoietic Specification . Sci Rep 8 , 10410 . OpenUrl CrossRef ↵ Goode , D.K. , Obier , N. , Vijayabaskar , M.S. , Lie , A.L.M. , Lilly , A.J. , Hannah , R. , Lichtinger , M. , Batta , K. , Florkowska , M. , Patel , R. , et al. ( 2016 ). Dynamic Gene Regulatory Networks Drive Hematopoietic Specification and Differentiation . Dev Cell 36 , 572 – 587 . OpenUrl CrossRef PubMed ↵ Heinz , S. , Benner , C. , Spann , N. , Bertolino , E. , Lin , Y.C. , Laslo , P. , Cheng , J.X. , Murre , C. , Singh , H. , and Glass , C.K . ( 2010 ). Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities . Molecular cell 38 , 576 – 589 . OpenUrl CrossRef PubMed Web of Science ↵ Hu , M. , Krause , D. , Greaves , M. , Sharkis , S. , Dexter , M. , Heyworth , C. , and Enver , T . ( 1997 ). Multilineage gene expression precedes commitment in the hemopoietic system . Genes Dev 11 , 774 – 785 . OpenUrl Abstract / FREE Full Text ↵ Huang da , W. , Sherman , B.T. , and Lempicki , R.A . ( 2009 ). Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources . Nat Protoc 4 , 44 – 57 . OpenUrl CrossRef PubMed Web of Science ↵ Huang , G. , Zhang , P. , Hirai , H. , Elf , S. , Yan , X. , Chen , Z. , Koschmieder , S. , Okuno , Y. , Dayaram , T. , Growney , J.D. , et al. ( 2008 ). PU.1 is a major downstream target of AML1 (RUNX1) in adult mouse hematopoiesis . Nat Genet 40 , 51 – 60 . OpenUrl CrossRef PubMed Web of Science ↵ Jonkers , I. , and Lis , J.T . ( 2015 ). Getting up to speed with transcription elongation by RNA polymerase II . Nat Rev Mol Cell Biol 16 , 167 – 177 . OpenUrl CrossRef PubMed ↵ Kellaway , S.G. , Keane , P. , Edginton-White , B. , Regha , K. , Kennett , E. , and Bonifer , C . ( 2021 ). Different mutant RUNX1 oncoproteins program alternate haematopoietic differentiation trajectories . Life Sci Alliance 4 . ↵ Kim , D. , Paggi , J.M. , Park , C. , Bennett , C. , and Salzberg , S.L . ( 2019 ). Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype . Nat Biotechnol 37 , 907 – 915 . OpenUrl CrossRef PubMed ↵ Krueger , F. , James , F. , Ewels , P. , Afyounian , E. , and Schuster-Boeckler , B. ( 2021 ). FelixKrueger/TrimGalore: v0.6.10 ( doi: 10.5281/zenodo.5127898 ). OpenUrl CrossRef ↵ Lam , M.T. , Li , W. , Rosenfeld , M.G. , and Glass , C.K . ( 2014 ). Enhancer RNAs and regulated transcriptional programs . Trends Biochem Sci 39 , 170 – 182 . OpenUrl CrossRef PubMed Web of Science ↵ Lancrin , C. , Mazan , M. , Stefanska , M. , Patel , R. , Lichtinger , M. , Costa , G. , Vargel , O. , Wilson , N.K. , Moroy , T. , Bonifer , C. , et al. ( 2012 ). GFI1 and GFI1B control the loss of endothelial identity of hemogenic endothelium during hematopoietic commitment . Blood 120 , 314 – 322 . OpenUrl Abstract / FREE Full Text ↵ Law , C.W. , Chen , Y. , Shi , W. , and Smyth , G.K . ( 2014 ). voom: Precision weights unlock linear model analysis tools for RNA-seq read counts . Genome Biol 15 , R29 . OpenUrl CrossRef PubMed ↵ Leddin , M. , Perrod , C. , Hoogenkamp , M. , Ghani , S. , Assi , S. , Heinz , S. , Wilson , N.K. , Follows , G. , Schonheit , J. , Vockentanz , L. , et al. ( 2011 ). Two distinct auto-regulatory loops operate at the PU.1 locus in B cells and myeloid cells . Blood 117 , 2827 – 2838 . OpenUrl Abstract / FREE Full Text ↵ Liao , Y. , Smyth , G.K. , and Shi , W . ( 2014 ). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features . Bioinformatics 30 , 923 – 930 . OpenUrl CrossRef PubMed Web of Science ↵ Lichtinger , M. , Ingram , R. , Hannah , R. , Muller , D. , Clarke , D. , Assi , S.A. , Lie , A.L.M. , Noailles , L. , Vijayabaskar , M.S. , Wu , M. , et al. ( 2012 ). RUNX1 reshapes the epigenetic landscape at the onset of haematopoiesis . EMBO J 31 , 4318 – 4333 . OpenUrl Abstract / FREE Full Text ↵ Luo , R. , Yan , J. , Oh , J.W. , Xi , W. , Shigaki , D. , Wong , W. , Cho , H.S. , Murphy , D. , Cutler , R. , Rosen , B.P. , et al. ( 2023 ). Dynamic network-guided CRISPRi screen identifies CTCF-loop-constrained nonlinear enhancer gene regulatory activity during cell state transitions . Nat Genet . ↵ Lv , J. , Meng , S. , Gu , Q. , Zheng , R. , Gao , X. , Kim , J.D. , Chen , M. , Xia , B. , Zuo , Y. , Zhu , S. , et al. ( 2023 ). Epigenetic landscape reveals MECOM as an endothelial lineage regulator . Nat Commun 14 , 2390 . OpenUrl ↵ Magin , T.M. , McWhir , J. , and Melton , D.W . ( 1992 ). A new mouse embryonic stem cell line with good germ line contribution and gene targeting frequency . Nucleic Acids Res 20 , 3795 – 3796 . OpenUrl CrossRef PubMed Web of Science ↵ Maytum , A. , Edginton-White , B. , and Bonifer , C . ( 2023 ). Identification and characterization of enhancer elements controlling cell type-specific and signalling dependent chromatin programming during hematopoietic development . Stem Cell Investig 10 , 14 . OpenUrl ↵ Obier , N. , Cauchy , P. , Assi , S.A. , Gilmour , J. , Lie , A.L.M. , Lichtinger , M. , Hoogenkamp , M. , Noailles , L. , Cockerill , P.N. , Lacaud , G. , et al. ( 2016 ). Cooperative binding of AP-1 and TEAD4 modulates the balance between vascular smooth muscle and hemogenic cell fate . Development 143 , 4324 – 4340 . OpenUrl Abstract / FREE Full Text ↵ Pascual-Garcia , P. , Little , S.C. , and Capelson , M . ( 2022 ). Nup98-dependent transcriptional memory is established independently of transcription . Elife 11 . ↵ Pearson , S. , Sroczynska , P. , Lacaud , G. , and Kouskoff , V . ( 2008 ). The stepwise specification of embryonic stem cells to hematopoietic fate is driven by sequential exposure to Bmp4, activin A, bFGF and VEGF . Development 135 , 1525 – 1535 . OpenUrl Abstract / FREE Full Text ↵ Quinlan , A.R. , and Hall , I.M . ( 2010 ). BEDTools: a flexible suite of utilities for comparing genomic features . Bioinformatics 26 , 841 – 842 . OpenUrl CrossRef PubMed Web of Science ↵ Rada-Iglesias , A. , Bajpai , R. , Swigut , T. , Brugmann , S.A. , Flynn , R.A. , and Wysocka , J . ( 2011 ). A unique chromatin signature uncovers early developmental enhancers in humans . Nature 470 , 279 – 283 . OpenUrl CrossRef PubMed Web of Science ↵ Robinson , M.D. , McCarthy , D.J. , and Smyth , G.K . ( 2010 ). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data . Bioinformatics 26 , 139 – 140 . OpenUrl CrossRef PubMed Web of Science ↵ Shannon , P. , Markiel , A. , Ozier , O. , Baliga , N.S. , Wang , J.T. , Ramage , D. , Amin , N. , Schwikowski , B. , and Ideker , T. ( 2003 ). Cytoscape: a software environment for integrated models of biomolecular interaction networks . Genome Res 13 , 2498 – 2504 . OpenUrl Abstract / FREE Full Text ↵ Sherman , B.T. , Hao , M. , Qiu , J. , Jiao , X. , Baseler , M.W. , Lane , H.C. , Imamichi , T. , and Chang , W . ( 2022 ). DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update) . Nucleic Acids Res 50 , W216 – W221 . OpenUrl CrossRef ↵ Steimle , J.D. , Kim , C. , Rowton , M. , Nadadur , R.D. , Wang , Z. , Stocker , M. , Hoffmann , A.D. , Hanson , E. , Kweon , J. , Sinha , T. , et al. ( 2023 ). ETV2 primes hematoendothelial gene enhancers prior to hematoendothelial fate commitment . Cell Rep 42 , 112665 . OpenUrl ↵ Voigt , P. , Tee , W.W. , and Reinberg , D . ( 2013 ). A double take on bivalent promoters . Genes Dev 27 , 1318 – 1338 . OpenUrl Abstract / FREE Full Text ↵ Zaret , K.S . ( 2020 ). Pioneer Transcription Factors Initiating Gene Network Changes . Annu Rev Genet 54 , 367 – 385 . OpenUrl Back to top Previous Next Posted September 01, 2023. Download PDF Supplementary Material Data/Code Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specification Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specification Alexander Maytum , Benjamin Edginton-White , Peter Keane , Peter N Cockerill , Jean-Baptiste Cazier , Constanze Bonifer bioRxiv 2023.08.30.555485; doi: https://doi.org/10.1101/2023.08.30.555485 Share This Article: Copy Citation Tools Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specification Alexander Maytum , Benjamin Edginton-White , Peter Keane , Peter N Cockerill , Jean-Baptiste Cazier , Constanze Bonifer bioRxiv 2023.08.30.555485; doi: https://doi.org/10.1101/2023.08.30.555485 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genomics Subject Areas All Articles Animal Behavior and Cognition (7978) Biochemistry (18681) Bioengineering (14801) Bioinformatics (44255) Biophysics (22524) Cancer Biology (19646) Cell Biology (26805) Clinical Trials (138) Developmental Biology (13914) Ecology (20922) Epidemiology (2067) Evolutionary Biology (25379) Genetics (16121) Genomics (23429) Immunology (18638) Microbiology (42321) Molecular Biology (17985) Neuroscience (93106) Paleontology (694) Pathology (2974) Pharmacology and Toxicology (5072) Physiology (8083) Plant Biology (15942) Scientific Communication and Education (2094) Synthetic Biology (4545) Systems Biology (10199) Zoology (2378) window.__CF$cv$params={r:'a3998d0a4b5ee72e',t:'MTc4OTE1OTg5MQ==',u:'01a0923d6cc17b42954849b6cb08f1f8',ut:'dEqUi33JISXKjGvOssasVrDBGCB3kxcWOqVbx5gnius-1789159894-1.2.1.1-M7bD0TR1uEuj0xoCNAVI3qhwjC7ewQx3EgO2q1npK6JTBuoWLlnoydbPSkIbo31IFAmRaf.YS4uZdBj8QrQPZtCljAEWNqQnOLREgCMbYVg',i:60};(function(){if(!document.body)return;var s=document.createElement('script');s.src='/cdn-cgi/challenge-platform/scripts/precursor/main.js';document.head.appendChild(s);})();