Impact of combined tranexamic acid and vancomycin treatment on osteogenic differentiated human bone marrow-derived mesenchymal stromal cells (hBMSCs) in vitro

Impact of combined tranexamic acid and vancomycin treatment on osteogenic differentiated human bone marrow-derived mesenchymal stromal cells (hBMSCs) in vitro | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Impact of combined tranexamic acid and vancomycin treatment on osteogenic differentiated human bone marrow-derived mesenchymal stromal cells (hBMSCs) in vitro Manuel Weißenberger, Mike Wagenbrenner, Tizian Heinz, Axel Jakuscheit, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4020647/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background In our current study, we investigated the impact of tranexamic acid (TXA) and vancomycin powder (VP) on osteogenic differentiated human bone-marrow derived mesenchymal stromal cells (hBMSCs) in vitro . Although topical application of TXA and VP is widely used to prevent post-operative blood loss and perioperative joint infection (PJI) in total joint replacements, the effects of both substances on periarticular tissues are not fully understood. Methods hBMSCs were isolated and multiplied in monolayer cell cultures before osteogenic differentiation was induced for 21 days. ATP assays were used to analyze cell proliferation and Annexin 5 assays were used to analyze cell viability and apoptosis. Expression levels of osteogenic marker genes were measured using semiquantitative RT-PCR. Results Combined treatment with TXA and VP for 96 hours (h) led to significantly decreased cell proliferation rates and decreased cell viability independent of the concentrations used. When using high concentrations of VP (50 mg/mL) this trend was visible after 48 h. In addition, combined treatment with TXA and VP negatively impacted Alizarin Red S staining in a dose-dependent manner. Conclusions Therefore, combined topical application of TXA and VP could be safe when limiting exposure to a maximum of 24 h and using low concentrations. Further in vitro and in vivo research is necessary to fully determine the effects on articular and periarticular tissues. tranexamic acid vancomycin powder hBMSCs osteoarthritis total joint replacements toxicity viability Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Background In recent years orthopedic surgeons have strived to minimize the perioperative risks, improve surgical outcomes and to enhance patient satisfaction in joint replacement surgery. Total joint replacements are of particular interest in orthopedic surgery, as data from the Organization for Economic Co-operation and Development (OECD) reveals that total knee arthroplasty (TKA) and total hip arthroplasty (THA) were among the most prevalent orthopedic surgeries in Germany in 2017, with rates of 223 and 309 per 100,000 individuals [1]. The lifetime risk for receiving joint replacement surgery in European countries may currently exceed 10%, with numbers projected to rise even further in the near future [2–5]. Accompanying this steep increase in primary procedures, a logical substantial increase of up to 90% in replacement procedures is anticipated by 2050 [4, 5]. Two major complications of TKA and THA that are of particular concern due to their impact on overall health, hospital stays, treatment costs, and quality of life are excessive blood loss and periprosthetic joint infections (PJIs) [4, 6, 7]. These complications not only contribute significantly to the need for revision surgery in TKA and THA but also occur more frequently during revision procedures [5, 7–10]. As a result, there is a strong focus on exploring interventions, both topical and systemic, to prevent perioperative blood loss and PJIs in primary and also revision arthroplasty. Previous studies have demonstrated that the use of tranexamic acid (TXA), a synthetic derivative of the essential amino acid lysine, either systemically or topically, can significantly reduce blood loss during TKA and THA [11–14]. TXA works by inhibiting the conversion of plasminogen to plasmin, thereby limiting the fibrinolytic effects of plasmin through the blocking of the lysine binding site on plasmin [11]. While systemic administration is generally considered safe, topical intraarticular application is commonly preferred for patients at high risk of cardiovascular or thromboembolic events [13, 15]. Similarly, the topical application of vancomycin powder (VP), although subject to controversy, has been suggested to decrease the risk of PJIs following primary and revision procedures [16–19]. Consequently, there is a growing trend toward using Vancomycin either topically or in a bone cement mixture to prevent or treat PJIs [18, 20]. Vancomycin, an antibiotic, functions by inhibiting the formation of bacterial cell walls and affecting the permeability of the bacterial cell membrane [16–19]. However, concerns have been raised regarding the safety of intraarticular administration of VP and TXA due to potential toxic effects on periarticular cells such as osteocytes, chondrocytes, or tenocytes [21–31]. Previous research has predominantly focused on separately investigating the cytotoxic effects of TXA and VP on osteocytes and chondrocytes in vitro, considering dose and time dependence. However, there is limited research on the combined effects of these substances on critical intra- and periarticular cell types. It is important to note that TXA and VP are often used in combination during revision procedures, which raises the possibility of detrimental effects on healthy remaining cells, including chondrocytes or mesenchymal stromal cells (MSCs) residing in the bone marrow. Any negative impact on the viability and function of human bone marrow-derived (hBMSCs) would be particularly detrimental given their crucial role in preventing aseptic implant loosening [32–34]. Therefore, this study aimed to examine and compare the combined effects of various combinations of VP (3 mg/mL, 12 mg/mL, 50 mg/mL) and TXA (10 mg/mL, 50 mg/mL) on osteogenic differentiated hBMSCs in vitro in dependance of varying exposure times (2 hours (h), 24 h, 48 h, 96 h). To do so we examined effects on cell viability and the expression of osteogenic marker genes. This information helps to further determine safe limits for the topical application of TXA and VP in vivo and further understand the effects of these agents on articular and periarticular tissues. 2. Methods 2.1. Isolation and culture of hBMSCs As described in our earlier studies, after informed and written consent and as approved by the University of Wuerzburg's institutional review board (186/18) bone marrow for the isolation of hBMSCs was harvested from five patients (n = 5) aged 61 to 66 that all underwent THA (mean age 63,1 years) [35, 36]. hBMSCs were isolated from the femoral reaming. In order to isolate MSCs from bone marrow, tissue samples were washed in DMEM/Ham’s F12. Suspended cells were then spun, resuspended and seeded in 175 cm 2 plastic cell culture flasks (Greiner Bio-One GmbH). hBMSCs were grown in standard culture medium until reaching confluency after a single passage (all Life Technologies, Thermo Fischer Scientific, Dreieich, Germany). 2.2. Osteogenic differentiation of hBMSCs After reaching 70% confluence hBMSCs were trypsinated, spun and counted. hBMSCs for histological and molecularbiological assessments were then seeded in six-well plates at a density of 3 x 10 3 cells per cm 2 . Cells were cultured at 37°C, 5% CO 2 and medium changes were performed every 3 to 4 days (d). After a single passage and reaching confluency osteogenesis was induced for a duration of 21 d using a osteogenic differentiation medium supplemented with 100 nM dexamethasone, 50 µg/mL ascorbate and 10 mM β-glycerophosphate as described in our earlier studies [37, 38]. Simultaneously controls were grown in standard cell culture medium that lacked the mentioned osteogenic supplements for the same duration of time. 2.3. Treatment of osteogenic differentiated hBMSCs with Tranexamic acid and Vancomycin powder Following osteogenic differentiation for 21 d differentiated cells were exposed to a single shot of different combined concentrations of TXA (Carinopharm GmbH, Elze, Germany; 10 mg/mL, 50 mg/mL) and VP (Eberth Arzneimittel GmbH, Ursensollen, Germany; 3 mg/mL, 12 mg/mL and 50 mg/mL) for 2 h, 24 h, 48 h and 96 h (Table 1 ). Untreated cultures remained as controls. Table 1 Concentration combinations of TXA and VP used for treatment of osteogenic differentiated hBMSCs. VP concentration (mg/mL) TXA concentration (mg/mL) Abbreviation 3 10 VP3TXA10 12 10 VP12TXA10 50 10 VP50TXA10 3 50 VP3TXA50 12 50 VP12TXA50 50 50 VP50TXA50 The standard cellular medium was used to dissolve the stock solution of TXA (100 mg/mL) and VP (200 mg/mL), whereas the negative control for differentiated cultures consisted of solely the standard cell culture medium. Sequential treatment was applied to the cell cultures with VP and TXA, following a predetermined schedule for exposure. This ensured that the cultures could be collectively analyzed at the conclusion of the experiment. Subsequent to the TXA and VP treatment, cells were rinsed with phosphate buffered saline (PBS) and prepared for subsequent analysis. 2.4. Histological staining The standard cellular medium was used to dissolve the stock solution of TXA (100 mg/mL) and VP (200 mg/mL), whereas the negative control for differentiated cultures consisted of solely the standard cell culture medium. Sequential treatment was applied to the cell cultures with VP and TXA, following a predetermined schedule for exposure. This ensured that the cultures could be collectively analyzed at the conclusion of the experiment. Subsequent to the TXA and VP treatment, cells were rinsed with phosphate buffered saline (PBS) and prepared for subsequent quantification-analysis as described in previously [35, 36]. 2.5. Biochemical Assays Adenosine 5'-triphosphate (ATP) assays were performed to assess cell viability in monolayer cultures of osteogenic differentiated hBMSCs using the CellTiter-Glo® Luminescent Cell Viability Assay (Promega GmbH, Mannheim, Germany) as previously described earlier. Cell viability was measured after the respective treatment with varying concentration combinations of TXA and VP (VP3TXA10, VP12TXA10, VP50TXA10, VP3TXA50, VP12TXA50, VP50TXA50) and following an effective treatment time of 2 h, 24 h, 48 h and 96 h using the CellTiter-Glo® Luminescent Cell Viability Assay (Promega GmbH, Mannheim, Germany) as previously described [36, 39, 40]. After the treatment with TXA and VP monolayer cultures that were used for biochemical investigations were trypsinated and seeded in new 96-well-plates (Greiner Bio-One GmbH) at a density of 3 x 103 cells per cm2. ATP assays were performed after 2h, 24h, 48 h and 96 h. According to the user's guide the cells were mixed with 100 µL of CellTiter-Glo® (Promega GmbH, Mannheim, Germany) reagent, a composition of CellTiter-Glo® substrate with CellTiter-Glo® buffer. Cells were incubated in this reagent for 10 minutes before luminescence was measured using a plate-reading luminometer (Promega GmbH). 2.6. Annexin 5 Assay Annexin 5 expression was assessed as a marker of apoptosis as described previously and as directed by the supplier (Sigma Aldrich, St. Louis, United States of America) [39, 41]. Briefly, the test uses double-labelling with the red fluorochrome Cy3.18/Annexin 5-Cy3 that binds to early apoptotic cells and conversion of 6-carboxyfluorescein diacetate (nonfluorescent) to 6-carboxyfluorescein (green fluorescent) by living cells. Following incubation with double-labelling staining solution for 10 minutes, osteogenic differentiated hBMSC cultures derived from five donors (n = 5) were washed and fixed in 4% paraformaldehyde. Evaluation of living and apoptotic cells was performed on representative sections using a fluorescence microscope (Thermo Fischer Scientific GmbH) and the appropriate green and red filters. 2.7. RNA isolation and semiquantitative RT-PCR The gene expression levels of the tissue specific osteogenic marker genes collagen type I alpha 2 chain (COL1A2), collagen X alpha 1 chain (COL10A1), alkaline phosphatase (ALP) and osteocalcin (OC) in osteogenic differentiated hBMSC-cultures derived from five donors (n = 5) was examined using semiquantitative RT-PCR. Trizol reagent (Invitrogen, Waltham, United States of America) and other purification steps such as DNAse treatment were used to isolate RNA from osteogenic differentiated hBMSCs following treatment with TXA and VP. All steps were performed as described in the user's manual of the NucleoSpin® RNA II kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany). For the synthesis of cDNA 1 µg of isolated RNA was combined with random hexamer primers (Thermo Fischer Scientific, Waltham, United States of America) and Promega® M-MLV reverse transcriptase (Promega GmbH). Following this step 1 µL of cDNA was used as a template of amplification in a 30 µL reaction volume consisting of forward and reverse gene-specific primers (5 pmol each) and GoTaq® DNA polymerase (Promega GmbH). Primer sequences, annealing temperatures and cycle numbers for RT-PCR are listed in Table 1 . As pointed out in our previous studies Elongation factor 1α (EEF1A1) was used as the housekeeping gene [38–40]. The final products of RT-PCR were split up using gel electrophoresis on 2% agarose (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) gels including 5 µL per 100 mL GelRed® (Biotium, Fremont, USA). The final products of RT-PCR were used for gel electrophoresis on 2% agarose gels (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) containing 5 µL per 100 mL GelRed® (Biotium, Fremont, CA, USA). The relative expression of the mentioned osteogenic marker genes was examined by measuring the band densities for all the tested genes in comparison to the expression of the housekeeping gene EEF1A1. Table 2 Primer sequences and product sizes, for semiquantitative RT-PCR. Gene Primer sequences (5'-3') Annealing temperature (°C) Product size (base pairs) Cycles MgCl 2 housekeeping gene for internal control EEF1A1 Sense: AGGTGATTATCCTGAACCATCC Antisense: AAAGGTGGATAGTCTGAGAAGC 54.0 234 21 1 x osteogenic marker genes COL1A2 Sense: GGACACAATGGATTGCAAGG Antisense: TAACCACTGCTCCACTCTGG 55.0 461 22 2x COL10A1 Sense: CCCTTTTTGCTGCTAGTATCC Antisense: CTGTTGTCCAGGTTTTCCTGGCAC 54.0 468 40 1x ALP Sense: TGGAGCTTCAGAAGCTCAACACCA Antisense: ATCTCGTTGTCTGAGTACCAGTCC 51.0 454 33 1x OC Sense: ATGAGAGCCCTCACACTCCTC Antisense: GCCGTAGAAGCGCCGATAGGC 62.0 293 35 2x 2.8. Statistical analysis Numeric data from Alizarin Red S staining quantification, ATP assays and semiquantitative RT-PCR were expressed as bar charts presenting mean values and standard deviations. ATP assays and Alizarin Red S staining quantifications were performed in triplicate (n = 3) and repeated on osteogenic differentiated hBMSCs isolated from a total of 5 different patients (n = 5). RT-PCR was performed in triplicate (n = 3) and repeated on 5 different osteogenic differentiated hBMSC cultures from 5 different patients (n = 5). Data were checked for normal distribution using the Kolmogorov-Smirnov and Shapiro-Wilk test. Statistically significant differences between varying concentrations combinations of TXA and VP (VP3TX10, VP12TX10, VP50TX10, VP3TX50, VP12TX50, VP50TX50) as well as varying exposure times were assessed using a multiple paired T-test or the Wilcoxon signed-rank test. P-values < 0.05 were considered statistically significant. 3. Results 3.1. Alizarin Red S staining of osteogenic differentiated hBMSCs After 21 d of osteogenic differentiation hBMSCs were treated with different concentrations of VP and TXA (VP3TX10, VP12TX10, VP50TX10, VP3TX50, VP12TX50, VP50TX50) for 24 h and 48 h to examine the effects of combined treatment of TXA and VP on matrix mineralization at these two exemplary chosen time points. After this treatment Alizarin Red S staining was performed on exemplary cultures treated with the lowest (VP3TXA10) and highest (VP50TXA50) concentration combinations for 24 h and 48 h, to examine osteogenesis in differentiated hBMSCs (Fig. 1 , a). Untreated (Fig. 1 , a, no treatm.) and undifferentiated negative controls (Fig. 1 , a, undiff.) were maintained for comparison. Undifferentiated control samples showed no positive Alizarin Red S staining (Fig. 1 , a, undiff.) while all osteogenically differentiated samples showed positive Alizarin Red S staining after 21 d independent of the exposure time and treatment with VP and TXA (Fig. 1 , a, no treatm., 24 h, 48 h). Furthermore, no visible changes regarding the Alizarin Red S staining intensity could be observed in dependence of the varying concentration combinations of VP and TXA and the examined exposure time, in osteogenic differentiated hBMSCs derived from all five patient samples (Fig. 1 , a, 24 h, 48 h). When comparing cell cultures treated with VP and TXA to untreated control cultures and undifferentiated cultures no alteration of cell size was observed (Fig. 1 , a) The calculation of the Alizarin Red S standard curve revealed a high coefficient of determination R 2 (Fig. 1 , b). Quantifications of Alizarin Red S staining showed low concentrations of Alizarin Red S in undifferentiated cultures (Fig. 1 , c, undiff.) in comparison to osteogenic differentiated cultures independent of treatment with VP and TXA (Fig. 1 , c, control, VP3TX10, VP50TXA50). Although there was a non-significant trend towards lower Alizarin Red S concentrations in cultures treated with rising concentrations of VP and TXA (Fig. 1 , c, VP3TXA10, VP50TXA50) compared to untreated control groups (Fig. 1 , c, control), this trend was non-significant. 3.1. ATP Assays of osteogenic differentiated hBMSCs hBMSCs were seeded in monolayer cultures and were exposed to an osteogenic differentiated medium. Following osteogenic differentiation for 21 d cells were exposed to different concentration combinations of TXA and VP (VP3TX10, VP12TX10, VP50TX10, VP3TX50, VP12TX50, VP50TX50) for 2 h, 24 h, 48 h and 96 h. We examined the effects of the combined treatment with VP and TXA on cell proliferation rates using the ATP Assay (Fig. 2 ), while untreated osteogenic differentiated cultures were maintained as negative control groups (Fig. 2 , control). Bar charts were used to show the mean values with the corresponding standard deviations. Following 2 h of treatment with varying concentration combinations of TXA and VP no effects on proliferation rate in monolayer cultures was observed in comparison to control cultures (Fig. 1 , 2 h). After increasing exposure time to 24 h proliferation rate was lowered significantly in cultures treated with VP50TX10 (Fig. 2 , 24h, VP50TX10). In addition, in cultures treated for 24 h there was a non-significant trend towards a lower proliferation rate in almost all other cultures (Fig. 2 , 24h). Following 48 h and 96 h of exposure to varying concentration combinations of VP and TXA there was a clear trend towards a dose and exposure time-dependent effect on proliferation rate in examined cultures (Fig. 2 , 24h, 48h, 96h). Proliferation rates in comparison to untreated control groups were significantly lower in cultures exposed to concentration combinations containing 50 mg/mL of VP after 48 h (Fig. 2 , 48h, VP50TX10, VP50TX50). After 96 h of exposure to VP and TXA significant reductions in proliferation rate were also visible in all other cultures exposed to VP and TXA, except those treated with the lowest concentration combination of VP3TX10 (Fig. 2 , 96h). 3. 2. Annexin 5 assays of osteogenic differentiated hBMSCs Cell viability and apoptosis of osteogenic differentiated MSC cultures, derived from two randomly chosen donors, following treatment with different concentration combinations of VP and TXA (VP3TX10, VP12TX10, VP50TX10, VP3TX50, VP12TX50, VP50TX50) was examined using double fluorescence staining with Annexin 5 (dead cells) -Cy3/6-carboxyfluorescein diacetate (living cells) (Fig. 3 ). Untreated cultures were used as negative controls (Fig. 3 , untreated controls). Exposure time varied between 2 h, 24 h, 48 h and 96 h. The control groups as well as osteogenic differentiated cultures treated with different combinations of VP and TXA for up to 24 h mostly showed a distinct green fluorescence marking viable cells (Fig. 2 , untreated controls, 2 h, 24 h). Although viable cells were also visible in cultures treated with VP and TXA for at least 48 h (Fig. 3 , 48h, 96h), these were reduced in number. In addition, the apoptosis detection assay revealed that cultures treated with varying combinations of VP and TXA for 48 h or 96 h reacted more heavily Annexin 5-positive than control cultures or those treated for a maximum of 24 h, resulting in a clear red fluorescence (Fig. 2 , 48h, 96h). When comparing cultures treated for 48 h, there was also a trend towards less green, viable cells and a more intense red staining in osteogenic differentiated cultures treated with higher concentrations of VP (Fig. 3 , 48h, VP50TXA10, VP50TXA50). The control groups as well as cultures treated with different combinations of VP and TXA for up to 24 h mostly showed a distinct green fluorescence marking viable cells (Fig. 2 , untreated controls, 2 h, 24 h). Although viable cells were also visible in cultures treated with VP and TXA for at least 48 h (Fig. 3 , 48h, 96h), these were clearly reduced in number. In addition, the apoptosis detection assay revealed that cultures treated with varying combinations of VP and TXA for 48 h or 96 h reacted more heavily Annexin 5-positive than control cultures or those treated for a maximum of 24 h, resulting in a clear red fluorescence (Fig. 2 , 48h, 96h). When comparing cultures treated for 48 h, there was also a trend towards less green, viable cells and a more intense red staining in osteogenic differentiated cultures treated with higher concentrations of VP (Fig. 3 , 48h, VP50TXA10, VP50TXA50). 3. 4. Expression of osteogenic marker genes RT-PCR was performed to evaluate changes in the relative expression of osteogenic marker genes in osteogenic differentiated monolayer cultures derived from five different donors (n = 5) after treatment with different combinations of VP and TXA (VP3TX10, VP12TX10, VP50TX10, VP3TX50, VP12TX50, VP50TX50) for varying exposure times (2 h, 24 h, 48 h, 96 h) in comparison to untreated negative controls (Fig. 4 ). There was no significant impact of treatment with varying concentration combinations of VP and TXA on the expression of examined osteogenic marker genes COL1A2, COL10A1, ALP and OC in cultures independent of the assessed exposure time (Fig. 4 ). However, there was a non-significant trend towards a declining relative expression of the osteogenic marker genes COL1A2, COL10A1 and ALP depending on the exposure time (Fig. 4 , a-c). This non-significant decline of the relative expression of respective osteogenic marker genes was evident after 48 h, continued over the exposure period of 96 h and was independent of examined concentration combinations (Fig. 4 , a-c, 48 h, 96 h). This non-significant exposure time-dependent effect of VP and TXA on the relative expression of osteogenic marker genes was not observed for OC (Fig. 4 , d). In addition, no clear differences regarding the impact of varying concentration combinations on the relative expression of osteogenic marker genes was observed for the examined exposure times (Fig. 4 ). 4. Discussion Both TXA and VP exhibit promising potential in mitigating some of the most prevalent perioperative complications in revision arthroplasty: TXA's antifibrinolytic properties reduce the risk of perioperative blood loss, and its topical application may contribute to decreased postoperative swelling [11–14, 16–18]. Similarly, VP's topical treatment shows potential in diminishing the likelihood of post-joint arthroplasty PJIs in both primary and revision cases [11–14, 16–18]. Notably, TXA could also play a role in reducing infection rates by minimizing the formation of localized hematoma-like hyaluronic acid [33]. Due to their established clinical safety profiles and minimal systemic side effects during topical use, their popularity has surged for application during joint arthroplasty revision procedures [16, 18, 42]. Nonetheless, recent research has raised concerns about potential toxicity towards osteocytes, chondrocytes, fibroblasts, and other periarticular tissues, with effects potentially varying based on dosage and exposure time [21–31]. Numerous studies have deemed concentrations of TXA up to 20 mg/mL and VP up to 5 mg/mL safe for crucial periarticular cell types in vitro [23]. Although the evidence is inconsistent, higher concentrations have shown to negatively impact cell viability and cell morphology in various cell types derived from periarticular tissues. TXA [23]. Studies examining the exact mechanics behind these effects found that treatment with TXA for more than 24 h may negatively impact the cell cycle and cause cytotoxicity through activating caspase-3-dependant apoptotic mechanisms [26, 27, 40]. Accordingly, McLean et al. identified increased amounts of apoptotic proteins in cells treated with TXA. However, tissue quality seemed to be unaffected, when limiting exposure time to clinically appropriate length [43]. Similar to TXA, Vancomycin has shown to affect cell viability in a time and concentration dependent manner. These effects could be partially explained by the increased production of reactive oxygen species (ROS), the expression of pro-inflammatory cytokines as well as the upregulation of cell receptors associated with inflammatory responses, after exposure to VP, potentially leading to ROS-induced cell death [44]. Further, the combined use of Vancomycin with other medications has shown to alter effects on cytotoxicity when applying medication via an infusion [45] Since existing research lacks consistency regarding the safety of both substances and their combined effects on periarticular tissues in vitro , which prompted our current investigation. Typical effective dosages for TXA's topical administration typically span 250 mg to 3 g, resulting in intraarticular concentrations ranging from 15 mg/mL to 100 mg/mL [26, 42, 46]. TXA is thought to rapidly diffuse into synovial fluid until its concentrations align with plasma levels [26, 47]. For VP's topical application, dosages generally range from 0.5 g to 4 g, and anticipated intraarticular concentrations are notably lower, with higher doses potentially reaching up to 10 mg/mL [18, 48]. Nevertheless, immediate peak tissue concentrations might fluctuate following the topical administration of VP and TXA [18, 48]. In our present in vitro study we found that combined treatment with TXA and VP has a significant negative effect on proliferation rate and cell viability on osteogenic differentiated hBMSCs. This effect can be seen after only 24 h when using high concentrations of VP (50 mg/mL) or at the latest after 96 h independent of the concentration combinations used. Limiting exposure time to 2 h or 24 h and using low concentrations of VP (3 mg/mL, 12 mg/mL) may help to prevent these effects in vitro. ATP assays showed a clear time and dose-dependent effect of combined treatment with VP and TXA on proliferation rate in osteogenic differentiated hBMSCs. A significant decrease of proliferation rate was detectable after 24 h after treatment with VP50TXA10 and after 48 h after treatment with 50 mg/mL independent of TXA concentrations. After 96 h significant effects on the cell proliferation rates in comparison to control groups were visible in all differentiated cultures. These results are in line with Annexin 5 assays which showed a clear increase in apoptotic cells and a decrease in viable cells after 96 h of treatment within all differentiated hBMSCs cultures treated with VP and TXA. In cultures treated with high concentrations of VP (50 mg/mL) effects were also visible after 48 h. Alhough we found no visible effects on Alizarin Red S stainings, quantification of Alizarin Red S staining revealed a non-siginificant, dose-dependent, negative trend of combined treatment with TXA and VP on mineralization in osteogenic differentiated hBMSCs. Finally, no clear effects of combined treatment with VP and TXA on osteogenic marker gene expression were visible. Although this study is the first examining the combined impact of TXA and VP on osteogenic differentiated hBMSCs in vitro , the effect of single TXA treatment on multiple periarticular cell types is well researched. However, most of these studies focus on the effects of both substances on chondrocytes. Even here, there is still no clear consensus regarding cytotoxic effects [11, 22–24, 26, 40]. Matching the results of our current study, we previously found that prolonged exposure of osteogenic differentiated hBMSCs to 50 mg/mL of TXA for 48 h led to a significant decrease in cell viability [40]. Further, TXA affected the expression of osteogenic marker genes in a dose-dependent but non-significant manner [40]. McLean et al. underlined that TXA may induce caspase-3-dependent mechanisms which may mediate these universal negative effects of TXA on cell proliferation and viability in multiple cell types [27]. Bolam et al. found that treatment of osteoblast-like cells derived from trabecular bone explants with high concentrations of TXA (50 mg/mL) for only 3 h led to a significant decrease in cell numbers and that this effect was also visible when using lower concentrations (20 mg/mL) while increasing the exposure time to 24 h [49]. Interestingly, Bolam et al. also pointed out that TXA may negatively influence cell functionality by decreasing collagen deposition [49]. Other researchers examined the isolated of topical VP treatment on osteogenic differentiated hBMSCs or osteoblasts in vitro [30, 31, 50, 51]. Braun et al. showed that VP significantly decreased cell viability in osteoblasts in a dose- and exposure time-dependent manner [30]. Matching our current findings even minimal concentrations of VP may negatively affected cell viability when increasing exposure time to multiple days [30]. Hanson et al. examined further confirmed the negative effects of low concentrations of VP up to 4 mg/mL on bone marrow-derived mesenchymal stromal cell (BMSC)-viability during osteogenic differentiation [31]. In line with our current findings Hanson et al. also showed negative effects of VP treatment on Alizarin Red S staining quantification [31]. Bariteau showed comparable effects on cell viability and Alizarin Red S staining when treating BMSCs with VP concentrations of up to 5 mg/mL [50]. In contrast, low concentrations of VP do not seem to impair cell viability or osteogenic differentiation potential in BMSCs [31, 50, 51]. In summary, our current study adds to the existing evidence which shows that topical treatment of osteogenic differentiated hBMSC with high concentrations of VP and TXA may significantly impact cell viability, cell proliferation and osteogenic differentiation capacity in BMSCs. These findings have previously led to researchers assuming topical application of VP may impact bone healing or bone fusion following spinal arthrodesis [31]. Other studies have also found that impaired osteogenic differentiation capacity of hBMSCs may lead to osteolysis and therefore may play an important role in aseptic loosening of joint implants [34]. Limitations of our study encompass the constrained size of the examined sample, which curtails the statistical significance of our findings. Additionally, cells derived from osteoarthritic joints or post-revision arthroplasty may exhibit diminished proliferation capacity unrelated to TXA treatment [52, 53]. Further, the presented data solely examines in vitro effects and may not translate into adverse clinical outcomes or recommendations for safe dosages. Previously, researchers pointed out that the three-dimensional cell models mimicking the extracellular matrix of bone tissue or hyaline cartilage in vivo might display heightened resistance to topical treatment with cytotoxic drugs [24]. In addition, the pharmacokinetics of medications like TXA or VP in vivo could be influenced by tissues beyond those tested in our study, potentially complicating the interpretation of our current in vitro investigation [26]. As there is currently no in vitro data examining the combined effects of topical treatment with TXA and VP on osteocytes, chondrocytes or other periarticular cell types, our aim in regard to translational research was to provide first in vitro results before these are tested in future in vivo studies. Also further exploration concerning more lifelike tissue models and potential impacts of TXA and VP on other functional cell types is imperative to fully apprehend the consequences of topical treatment on periarticular tissues. 5. Conclusion In summary, our current results strengthen existing evidence and add new evidence that limiting exposure time of topical treatment with VP and TXA to 24 h may provide a safe setting, even if topical treatment consists of both VP and TXA. This is especially the case when adhering to low concentrations of TXA (10 mg/mL) and VP (3 mg/mL). Prolonged exposure times of up to 96 h have a significant negative impact on cell viability of osteogenic differentiated hBMSCs independent of the concentration combinations used. Abbreviations ATP Adenosine 5'-triphosphate CFDA 6-carboxyfluorescein diacetate COMP cartilage oligomeric matrix protein COL2A1 collagen type II alpha 1 chain ACAN aggrecan d days DMEM Dulbecco's Modified Eagle Medium EEF1A1 Elongation factor 1α FBS fetal bovine serum h hours hBMSCs human bone marrow-derived mesenchymal stromal cells MSCs mesenchymal stromal cell OECD Organisation for Economic Co-operation and Development PS penicillin/streptomycin PJI perioperative joint infection PBS phosphate buffered saline SOX9 sex-determining region Y-box 9 TKA Total knee arthroplasty TXA Tranexamic acid VP Vancomycin powder Declarations Acknowledgments : We are grateful to Beate Geyer for her excellent technical assistance. Authors' contributions: Conceptualization, Ma.W. and J.A.; Methodology, Ma.W. and B.M.H; Software, Mi.W.; Validation, Ma.W. and B.M.H.; Formal Analysis, Ma.W. and Mi.W.; Investigation, Ma.W.; Resources, Mi.W.; Data Curation, Mi.W., A.J. and T.H.; Writing – Original Draft Preparation, Mi.W. and Ma.W.; Writing – Review & Editing, Ma.W., Mi.W., K.H., S.M.-W., A.J., D.D., T.H., M.R., B.M.H. and J.A.; Visualization, Mi.W. and Ma.W.; Supervision, Ma.W. and J.A.; Project Administration, B.M.H. and Ma.W.; Funding Acquisition, B.M.H. and M.R. Funding: This publication was funded by the University of Wuerzburg in the funding program Open Access Publishing. Availability of data and materials : The datasets used and analyzed during the current study are available from the corresponding author on reasonable request. Ethics approval and consent to participate: The study design and experiments were approved by University of Wuerzburg‘s institutional review board (186/18). Informed consent was obtained from all subjects and/or their legal guardian(s) Competing interests: The authors declare they have no competing interests. References Health at a Glance 2019 OECD Indicators: OECD Indicators : OECD Publishing; 2019. Culliford DJ, Maskell J, Kiran A, Judge A, Javaid MK, Cooper C, Arden NK: The lifetime risk of total hip and knee arthroplasty: results from the UK general practice research database . Osteoarthritis Cartilage 2012, 20 (6):519-524. Jonsson H, Olafsdottir S, Sigurdardottir S, Aspelund T, Eiriksdottir G, Sigurdsson S, Harris TB, Launer L, Gudnason V: Incidence and prevalence of total joint replacements due to osteoarthritis in the elderly: risk factors and factors associated with late life prevalence in the AGES-Reykjavik Study . BMC musculoskeletal disorders 2016, 17 :14. Klug A, Gramlich Y, Rudert M, Drees P, Hoffmann R, Weißenberger M, Kutzner KP: The projected volume of primary and revision total knee arthroplasty will place an immense burden on future health care systems over the next 30 years . Knee surgery, sports traumatology, arthroscopy : official journal of the ESSKA 2020:1-12. Ulrich SD, Seyler TM, Bennett D, Delanois RE, Saleh KJ, Thongtrangan I, Kuskowski M, Cheng EY, Sharkey PF, Parvizi J et al : Total hip arthroplasties: what are the reasons for revision? International orthopaedics 2008, 32 (5):597-604. Postler A, Lützner C, Beyer F, Tille E, Lützner J: Analysis of Total Knee Arthroplasty revision causes . BMC musculoskeletal disorders 2018, 19 (1):55. Evangelopoulos DS, Ahmad SS, Krismer AM, Albers CE, Hoppe S, Kleer B, Kohl S, Ateschrang A: Periprosthetic Infection: Major Cause of Early Failure of Primary and Revision Total Knee Arthroplasty . J Knee Surg 2019, 32 (10):941-946. Klasan A, Gerber F, Schermuksnies A, Putnis SE, Neri T, Heyse TJ: Blood loss after revision knee arthroplasty is 1.38- to 2.17-fold higher than after primary knee arthroplasty: A retrospective analysis of 898 cases . Orthop Traumatol Surg Res 2021, 107 (3):102856. Hu Y, Li Q, Wei BG, Zhang XS, Torsha TT, Xiao J, Shi ZJ: Blood loss of total knee arthroplasty in osteoarthritis: an analysis of influential factors . J Orthop Surg Res 2018, 13 (1):325. Rosso F, Cottino U, Dettoni F, Bruzzone M, Bonasia DE, Rossi R: Revision total knee arthroplasty (TKA): mid-term outcomes and bone loss/quality evaluation and treatment . J Orthop Surg Res 2019, 14 (1):280. Jacob B, Kloss N, Böhle S, Kirschberg J, Zippelius T, Heinecke M, Matziolis G, Röhner E: Tranexamic acid is toxic on human chondrocytes, in vitro . J Orthop 2020, 20 :1-5. Zhang H, Chen J, Chen F, Que W: The effect of tranexamic acid on blood loss and use of blood products in total knee arthroplasty: a meta-analysis . Knee surgery, sports traumatology, arthroscopy : official journal of the ESSKA 2012, 20 (9):1742-1752. Oremus K: Tranexamic acid for the reduction of blood loss in total knee arthroplasty . Ann Transl Med 2015, 3 (Suppl 1):S40. Sassoon A, Nam D, Jackups R, Johnson SR, Nunley RM, Barrack RL: Tranexamic acid: optimal blood loss management in surface replacement arthroplasty . Bone Joint J 2016, 98-b (2):173-178. Yuan ZF, Yin H, Ma WP, Xing DL: The combined effect of administration of intravenous and topical tranexamic acid on blood loss and transfusion rate in total knee arthroplasty: Combined tranexamic acid for TKA . Bone & joint research 2016, 5 (8):353-361. Liao S, Yang Z, Li X, Chen J, Liu JG: Effects of different doses of vancomycin powder in total knee and hip arthroplasty on the periprosthetic joint infection rate: a systematic review and meta-analysis . J Orthop Surg Res 2022, 17 (1):546. Hanada M, Nishikino S, Hotta K, Furuhashi H, Hoshino H, Matsuyama Y: Intrawound vancomycin powder increases post-operative wound complications and does not decrease periprosthetic joint infection in primary total and unicompartmental knee arthroplasties . Knee surgery, sports traumatology, arthroscopy : official journal of the ESSKA 2019, 27 (7):2322-2327. Peng Z, Lin X, Kuang X, Teng Z, Lu S: The application of topical vancomycin powder for the prevention of surgical site infections in primary total hip and knee arthroplasty: A meta-analysis . Orthop Traumatol Surg Res 2021, 107 (4):102741. Dial BL, Lampley AJ, Green CL, Hallows R: Intrawound Vancomycin Powder in Primary Total Hip Arthroplasty Increases Rate of Sterile Wound Complications . Hip Pelvis 2018, 30 (1):37-44. Iarikov D, Demian H, Rubin D, Alexander J, Nambiar S: Choice and doses of antibacterial agents for cement spacers in treatment of prosthetic joint infections: review of published studies . Clin Infect Dis 2012, 55 (11):1474-1480. Ambra LF, de Girolamo L, Niu W, Phan A, Spector M, Gomoll AH: No effect of topical application of tranexamic acid on articular cartilage . Knee surgery, sports traumatology, arthroscopy : official journal of the ESSKA 2019, 27 (3):931-935. Marmotti A, Mattia S, Mangiavini L, Bonasia DE, Bruzzone M, Dettoni F, Rosso F, Blonna D, Rossi R, Castoldi F et al : Tranexamic acid effects on cartilage and synovial tissue: an in vitro study for a possible safe intra-articular use . J Biol Regul Homeost Agents 2016, 30 (4 Suppl 1):33-40. Bolam SM, O'Regan-Brown A, Paul Monk A, Musson DS, Cornish J, Munro JT: Toxicity of tranexamic acid (TXA) to intra-articular tissue in orthopaedic surgery: a scoping review . Knee surgery, sports traumatology, arthroscopy : official journal of the ESSKA 2020. Tuttle JR, Feltman PR, Ritterman SA, Ehrlich MG: Effects of Tranexamic Acid Cytotoxicity on In Vitro Chondrocytes . Am J Orthop (Belle Mead NJ) 2015, 44 (12):E497-502. Parker JD, Lim KS, Kieser DC, Woodfield TBF, Hooper GJ: Is tranexamic acid toxic to articular cartilage when administered topically? What is the safe dose? Bone Joint J 2018, 100-b (3):404-412. Goderecci R, Giusti I, Necozione S, Cinque B, D'Ascenzo S, Dolo V, Calvisi V: Short exposure to tranexamic acid does not affect, in vitro, the viability of human chondrocytes . Eur J Med Res 2019, 24 (1):15. McLean M, McCall K, Smith IDM, Blyth M, Kitson SM, Crowe LAN, Leach WJ, Rooney BP, Spencer SJ, Mullen M et al : Tranexamic acid toxicity in human periarticular tissues . Bone & joint research 2019, 8 (1):11-18. Röhner E, Zippelius T, Böhle S, Rohe S, Matziolis G, Jacob B: Vancomycin is toxic to human chondrocytes in vitro . Archives of orthopaedic and trauma surgery 2021, 141 (3):375-381. Shaw KA, Eichinger JK, Nadig N, Parada SA: In Vitro Effect of Vancomycin on the Viability of Articular Chondrocytes . J Orthop Trauma 2018, 32 (3):148-153. Braun J, Eckes S, Rommens PM, Schmitz K, Nickel D, Ritz U: Toxic Effect of Vancomycin on Viability and Functionality of Different Cells Involved in Tissue Regeneration . Antibiotics (Basel) 2020, 9 (5). Hanson K, Isder C, Shogren K, Mikula AL, Lu L, Yaszemski MJ, Elder BD: The inhibitory effects of vancomycin on rat bone marrow-derived mesenchymal stem cell differentiation . J Neurosurg Spine 2021:1-5. Koutalos AA, Drakos A, Fyllos A, Doxariotis N, Varitimidis S, Malizos KN: Does Intra-Wound Vancomycin Powder Affect the Action of Intra-Articular Tranexamic Acid in Total Joint Replacement? Microorganisms 2020, 8 (5). Benjumea A, Díaz-Navarro M, Hafian R, Cercenado E, Sánchez-Somolinos M, Vaquero J, Chana F, Muñoz P, Guembe M: Tranexamic Acid in Combination With Vancomycin or Gentamicin Has a Synergistic Effect Against Staphylococci . Front Microbiol 2022, 13 :935646. Pajarinen J, Lin TH, Nabeshima A, Jämsen E, Lu L, Nathan K, Yao Z, Goodman SB: Mesenchymal stem cells in the aseptic loosening of total joint replacements . Journal of biomedical materials research Part A 2017, 105 (4):1195-1207. Noth U, Tuli R, Osyczka AM, Danielson KG, Tuan RS: In vitro engineered cartilage constructs produced by press-coating biodegradable polymer with human mesenchymal stem cells . Tissue engineering 2002, 8 (1):131-144. Steinert AF, Proffen B, Kunz M, Hendrich C, Ghivizzani SC, Noth U, Rethwilm A, Eulert J, Evans CH: Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer . Arthritis Res Ther 2009, 11 (5):R148. Reichert JC, Schmalzl J, Prager P, Gilbert F, Quent VM, Steinert AF, Rudert M, Noth U: Synergistic effect of Indian hedgehog and bone morphogenetic protein-2 gene transfer to increase the osteogenic potential of human mesenchymal stem cells . Stem Cell Res Ther 2013, 4 (5):105. Steinert AF, Kunz M, Prager P, Barthel T, Jakob F, Noth U, Murray MM, Evans CH, Porter RM: Mesenchymal stem cell characteristics of human anterior cruciate ligament outgrowth cells . Tissue Eng Part A 2011, 17 (9-10):1375-1388. Steinert AF, Weissenberger M, Kunz M, Gilbert F, Ghivizzani SC, Gobel S, Jakob F, Noth U, Rudert M: Indian hedgehog gene transfer is a chondrogenic inducer of human mesenchymal stem cells . Arthritis Res Ther 2012, 14 (4):R168. Wagenbrenner M, Heinz T, Horas K, Jakuscheit A, Arnholdt J, Mayer-Wagner S, Rudert M, Holzapfel BM, Weißenberger M: Impact of Tranexamic Acid on Chondrocytes and Osteogenically Differentiated Human Mesenchymal Stromal Cells (hMSCs) In Vitro . J Clin Med 2020, 9 (12). Weissenberger M, Weissenberger MH, Gilbert F, Groll J, Evans CH, Steinert AF: Reduced hypertrophy in vitro after chondrogenic differentiation of adult human mesenchymal stem cells following adenoviral SOX9 gene delivery . BMC musculoskeletal disorders 2020, 21 (1):109. Alshryda S, Sukeik M, Sarda P, Blenkinsopp J, Haddad FS, Mason JM: A systematic review and meta-analysis of the topical administration of tranexamic acid in total hip and knee replacement . Bone Joint J 2014, 96-b (8):1005-1015. Gkiatas I, Kontokostopoulos AP, Tsirigkakis SE, Kostas-Agnantis I, Gelalis I, Korompilias A, Pakos E: Topical use of tranexamic acid: Are there concerns for cytotoxicity? World journal of orthopedics 2022, 13 (6):555-563. Sakamoto Y, Yano T, Hanada Y, Takeshita A, Inagaki F, Masuda S, Matsunaga N, Koyanagi S, Ohdo S: Vancomycin induces reactive oxygen species-dependent apoptosis via mitochondrial cardiolipin peroxidation in renal tubular epithelial cells . Eur J Pharmacol 2017, 800 :48-56. Drouet M, Chai F, Barthélémy C, Lebuffe G, Debaene B, Décaudin B, Odou P: Endothelial Cell Toxicity of Vancomycin Infusion Combined with Other Antibiotics . Antimicrob Agents Chemother 2015, 59 (8):4901-4906. Kim TK, Chang CB, Koh IJ: Practical issues for the use of tranexamic acid in total knee arthroplasty: a systematic review . Knee surgery, sports traumatology, arthroscopy : official journal of the ESSKA 2014, 22 (8):1849-1858. Barrett CD, Moore HB, Kong YW, Chapman MP, Sriram G, Lim D, Moore EE, Yaffe MB: Tranexamic acid mediates proinflammatory and anti-inflammatory signaling via complement C5a regulation in a plasminogen activator-dependent manner . The journal of trauma and acute care surgery 2019, 86 (1):101-107. Lawrie CM, Kazarian GS, Barrack T, Nunley RM, Barrack RL: Intra-articular administration of vancomycin and tobramycin during primary cementless total knee arthroplasty : determination of intra-articular and serum elution profiles . Bone Joint J 2021, 103-b (11):1702-1708. Bolam SM, O'Regan-Brown A, Konar S, Callon KE, Coleman B, Dalbeth N, Monk AP, Musson DS, Cornish J, Munro JT: Cytotoxicity of tranexamic acid to tendon and bone in vitro: Is there a safe dosage? J Orthop Surg Res 2022, 17 (1):273. Bariteau JT, Kadakia RJ, Traub BC, Viggeswarapu M, Willett NJ: Impact of Vancomycin Treatment on Human Mesenchymal Stromal Cells During Osteogenic Differentiation . Foot Ankle Int 2018, 39 (8):954-959. Booysen E, Sadie-Van Gijsen H, Deane SM, Ferris W, Dicks LMT: The Effect of Vancomycin on the Viability and Osteogenic Potential of Bone-Derived Mesenchymal Stem Cells . Probiotics Antimicrob Proteins 2019, 11 (3):1009-1014. Yang KG, Saris DB, Geuze RE, van Rijen MH, van der Helm YJ, Verbout AJ, Creemers LB, Dhert WJ: Altered in vitro chondrogenic properties of chondrocytes harvested from unaffected cartilage in osteoarthritic joints . Osteoarthritis Cartilage 2006, 14 (6):561-570. Ebert R, Weissenberger M, Braun C, Wagenbrenner M, Herrmann M, Müller-Deubert S, Krug M, Jakob F, Rudert M: Impaired regenerative capacity and senescence-associated secretory phenotype in mesenchymal stromal cells from samples of patients with aseptic joint arthroplasty loosening . Journal of orthopaedic research : official publication of the Orthopaedic Research Society 2022, 40 (2):513-523. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure1BMCMSD.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4020647","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":280956636,"identity":"80b7d7d4-1993-4ece-a40d-96f55d87281b","order_by":0,"name":"Manuel Weißenberger","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABYUlEQVRIie2RMWvCQBSAXzhIliu3nij6CwoXAmkFt/4RQyGTKY7dFIRkqNY10qFD/4DdulU4apeIa0S3QCaHFKGkJYVetC2pWroWmg/ucRzvu3f3HkBOzp+lKRZa70abgygNShrY8X6FbSmSC58njP6sQEZB+EuBHeXQmYxpxMDoK0oQPd0tykf9m/Gq9lorV07QwzBuUiDORT2j6N6ZWXCFMuhgvTDwQq3kh6dX1qWpqVw2Z13xMOpNhlll1NCLmIE15FhGBzY3XOppyOpy41Zc4mOhMGp9U6ZLvZgI5Z4rwerN5i2XTleoulbI8yzZo/iiCqRVELCiZPM6JV2EIObGNcLyfF8Vf6lVxYNbLhd/6dmh6lJZk3ptU2NI1uclRvH2X6YN1Y/PaxrpPwbRi72oUMIDiBPRMacTzpZiQ5xeVvkg23wqOirZYlibGQHeTd+GpKkJQKX9e25OTk7Ov+AdinF9hVvq4QIAAAAASUVORK5CYII=","orcid":"","institution":"University of Wuerzburg","correspondingAuthor":true,"prefix":"","firstName":"Manuel","middleName":"","lastName":"Weißenberger","suffix":""},{"id":280956637,"identity":"fb9112c4-1be7-4292-baa8-cf5e7ec0a3f9","order_by":1,"name":"Mike Wagenbrenner","email":"","orcid":"","institution":"University of Wuerzburg","correspondingAuthor":false,"prefix":"","firstName":"Mike","middleName":"","lastName":"Wagenbrenner","suffix":""},{"id":280956638,"identity":"b428aa40-c5e5-4b92-b993-9e9f00a537fe","order_by":2,"name":"Tizian Heinz","email":"","orcid":"","institution":"University of Wuerzburg","correspondingAuthor":false,"prefix":"","firstName":"Tizian","middleName":"","lastName":"Heinz","suffix":""},{"id":280956639,"identity":"5b56b61f-277f-402c-afc7-0f1d1370797b","order_by":3,"name":"Axel Jakuscheit","email":"","orcid":"","institution":"University of Wuerzburg","correspondingAuthor":false,"prefix":"","firstName":"Axel","middleName":"","lastName":"Jakuscheit","suffix":""},{"id":280956640,"identity":"576330eb-3936-4592-bbba-7766609d1d7f","order_by":4,"name":"Konstantin Horas","email":"","orcid":"","institution":"University of Wuerzburg","correspondingAuthor":false,"prefix":"","firstName":"Konstantin","middleName":"","lastName":"Horas","suffix":""},{"id":280956641,"identity":"eb7b6ab9-2296-4d2d-bc66-ad90dcdf8816","order_by":5,"name":"Denitsa Docheva","email":"","orcid":"","institution":"University of Wuerzburg","correspondingAuthor":false,"prefix":"","firstName":"Denitsa","middleName":"","lastName":"Docheva","suffix":""},{"id":280956642,"identity":"c4b6dd53-51fd-476a-926d-52e83e9aef87","order_by":6,"name":"Maximilian Rudert","email":"","orcid":"","institution":"University of Wuerzburg","correspondingAuthor":false,"prefix":"","firstName":"Maximilian","middleName":"","lastName":"Rudert","suffix":""},{"id":280956643,"identity":"19b461a3-cb86-4ff6-bfee-9c953dfa518b","order_by":7,"name":"Susanne Mayer-Wagner","email":"","orcid":"","institution":"University Hospital, LMU Munich","correspondingAuthor":false,"prefix":"","firstName":"Susanne","middleName":"","lastName":"Mayer-Wagner","suffix":""},{"id":280956644,"identity":"dd4d5bfb-e81a-4711-af85-470dec11174a","order_by":8,"name":"Boris M. Holzapfel","email":"","orcid":"","institution":"University Hospital, LMU Munich","correspondingAuthor":false,"prefix":"","firstName":"Boris","middleName":"M.","lastName":"Holzapfel","suffix":""},{"id":280956645,"identity":"182a7ec6-3cc2-4e2a-9f18-eb7a7ae44450","order_by":9,"name":"Jörg Arnholdt","email":"","orcid":"","institution":"University Hospital, LMU Munich","correspondingAuthor":false,"prefix":"","firstName":"Jörg","middleName":"","lastName":"Arnholdt","suffix":""}],"badges":[],"createdAt":"2024-03-06 11:21:58","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4020647/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4020647/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52971938,"identity":"4040145d-4dca-4679-adae-e684c8df98a3","added_by":"auto","created_at":"2024-03-19 08:31:04","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5046296,"visible":true,"origin":"","legend":"\u003cp\u003eAlizarin Red S staining quantification following osteogenic differentiation of human bone marrow-derived mesenchymal stromal cells and treatment with varying concentrations of Tranexamic acid and Vancomycin powder for different exposure times. Primary human bone marrow-derived mesenchymal stromal cells (hBMSCs) were harvested from the bone marrow reaming of three separate patients that underwent total hip arthroplasty. Osteogenic differentiation was induced in hBMSCs using an osteogenic differentiation medium for 21 days. Histological analysis (a) of osteogenesis in hBMSCs was performed after treatment of differentiated cultures with either 10 mg/mL or 50 mg/mL of Tranexamic acid (TXA) combined with 3 mg/mL, 12 mg/mL or 50 mg/mL of Vancomycin powder (VP) (VP3TXA10, VP3TXA50, VP12TXA10, VP12TXA50, VP50TXA10, VP50TXA50). The exposure time varied between 24 h and 48 h. Undifferentiated control samples (undiff.) and untreated osteogenic differentiated samples (no treatm.) were maintained for comparison. Alizarin Red S staining was performed to detect extracellular calcium deposits shown as red stainings. Representative samples from three different donors were captured at low (100x; black bar = 200 μm) magnification. The Alizarin Red S standard curve was calculated with the quantification assay of Alizarin Red S stainings (b). Quantitative measurements of Alizarin Red S stainings (c) were performed in undifferentiated control samples (undiff.), differentiated hMSCs (no TXA) as well as differentiated hBMSCs after treatment with 50 mg/ml of TXA for 24 h (24 h TXA). Results were pictured as mean values with error bars indicating the standard deviation. hMSCs, human mesenchymal stromal cells; TXA, tranexamic acid; min, minutes; d, days; h, hours.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4020647/v1/37d2228536a5be50b2e25b48.png"},{"id":52971936,"identity":"a476cb22-e24e-43a7-9b9c-913ab9609480","added_by":"auto","created_at":"2024-03-19 08:31:03","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":105946,"visible":true,"origin":"","legend":"\u003cp\u003eViability analysis of hBMSCs following osteogenic differentiation and treatment with varying concentration combinations of Tranexamic acid and Vancomycin powder for different exposure times. Osteogenic differentiation was induced in primary hBMSCs harvested from five different donors (n=5) using an osteogenic differentiation medium for 21 d. Untreated differentiated control samples (control) were maintained for comparison. After osteogenic differentiation cells were exposed to either 10 mg/mL or 50 mg/mL of Tranexamic acid (TXA) combined with 3 mg/mL, 12 mg/mL or 50 mg/mL of Vancomycin powder (VP) (VP3TXA10, VP3TXA50, VP12TXA10, VP12TXA50, VP50TXA10, VP50TXA50). The exposure time varied between 2 h, 24 h, 48 h and 96 h. Cell proliferation was evaluated using the ATP Assay. Each bar represents the mean value measured for all five donor samples treated with the respective combination of TXA and VP for the described exposure time and the respective standard deviation. *Significant difference (P \u0026lt; 0.05) compared to untreated differentiated hBMSC cultures. d, days; hBMSCs, human bone marrow-derived mesenchymal stromal cells; TXA, tranexamic acid; VP, vancomycin powder; h, hours.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4020647/v1/3492283366b56a48ef8819a9.png"},{"id":52971937,"identity":"26fbb878-794b-478b-a007-ea8333f89fe0","added_by":"auto","created_at":"2024-03-19 08:31:03","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":779463,"visible":true,"origin":"","legend":"\u003cp\u003eCell apoptosis within osteogenic differentiated hBMSC monolayer cultures after treatment with varying concentration combinations of Tranexamic acid and Vancomycin powder for different exposure times. Osteogenic differentiation was induced in primary hBMSCs harvested from two different donors (n=2) using an osteogenic differentiation medium for 21 d. Untreated differentiated control samples (untreated controls) were maintained for comparison. After osteogenic differentiation cells were exposed to either 10 mg/mL or 50 mg/mL of Tranexamic acid (TXA) combined with 3 mg/mL, 12 mg/mL or 50 mg/mL of Vancomycin powder (VP) (VP3TXA10, VP3TXA50, VP12TXA10, VP12TXA50, VP50TXA10, VP50TXA50). The exposure time varied between 2 h, 24 h, 48 h and 96 h. After treatment with TXA and VP cultures were double-stained with 6-carboxyfluorescein diacetate (CFDA) and Annexin 5. Representative fluorescence microscopy images are shown. Note that living cells are stained green with CFDA, late apoptotic cells red with Annexin 5-Cy3, while early apoptotic cells stained for both CFDA and Annexin 5. Representative images are shown (100× bar = 200 μm) magnification as indicated. d, days; hBMSCs, human bone marrow-derived mesenchymal stromal cells; CFDA, 6-carboxyfluorescein diacetate; TXA, tranexamic acid; VP, vancomycin powder; h, hours.\u003c/p\u003e","description":"","filename":"floatimage3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4020647/v1/79f93fa48c4df882f98381a4.jpg"},{"id":52971940,"identity":"13b7916d-5473-4bcb-ac42-5986c98c9ff9","added_by":"auto","created_at":"2024-03-19 08:31:04","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":262050,"visible":true,"origin":"","legend":"\u003cp\u003eRelative changes in the expression of osteogenic marker genes measured by semiquantitative RT-PCR after treatment of osteogenic differentiated hBMSC cultures derived from five different donors (n=5) with different concentration combinations of Tranexamic acid and Vancomycin powder for different exposure times. Osteogenic differentiation was induced in primary hBMSCs harvested from five different donors using an osteogenic differentiation medium for 21 d. Untreated differentiated control samples maintained for comparison. Cells were exposed to either 10 mg/mL or 50 mg/mL of Tranexamic acid (TXA) combined with 3 mg/mL, 12 mg/mL or 50 mg/mL of Vancomycin powder (VP) (VP3TXA10, VP3TXA50, VP12TXA10, VP12TXA50, VP50TXA10, VP50TXA50). The exposure time varied between 2 h, 24 h, 48 h and 96 h. Relative gene expression in all five donor samples was measured for collagen type I alpha 2 chain (COL1A2; a), collagen type X alpha 1 chain (COLXA1; b), alkaline phosphatase (ALP; c) and osteocalcin (OC); d) and pictured as bar charts representing mean values and standard deviation. Eukaryotic elongation factor 1α (EEF1A1) was used as the housekeeping gene and for internal controls. Primer details are illustrated in Table 2. ALP, alkaline phosphatase; COL1A2; collagen type I alpha 2 chain; COL10A1, collagen type X alpha 1 chain; hBMSCs, human bone marrow-derived mesenchymal stromal cells; d, days; OC, osteocalcin; TXA, tranexamic acid; VP, Vancomycin powder; h, hours.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4020647/v1/68c366ca35f4f054b0c8af69.png"},{"id":65334973,"identity":"26966a4e-4143-4adb-8b64-d92bc4177ccd","added_by":"auto","created_at":"2024-09-26 07:54:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9123933,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4020647/v1/add6812b-522e-44e2-a97b-30863251767c.pdf"},{"id":52971939,"identity":"ae42a81b-ef90-4b4c-b7e6-1e87640dc8a6","added_by":"auto","created_at":"2024-03-19 08:31:04","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3419062,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure1BMCMSD.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4020647/v1/438e5f5aa8c9dfd1341a8870.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Impact of combined tranexamic acid and vancomycin treatment on osteogenic differentiated human bone marrow-derived mesenchymal stromal cells (hBMSCs) in vitro","fulltext":[{"header":"1. Background","content":"\u003cp\u003eIn recent years orthopedic surgeons have strived to minimize the perioperative risks, improve surgical outcomes and to enhance patient satisfaction in joint replacement surgery. Total joint replacements are of particular interest in orthopedic surgery, as data from the Organization for Economic Co-operation and Development (OECD) reveals that total knee arthroplasty (TKA) and total hip arthroplasty (THA) were among the most prevalent orthopedic surgeries in Germany in 2017, with rates of 223 and 309 per 100,000 individuals [1]. The lifetime risk for receiving joint replacement surgery in European countries may currently exceed 10%, with numbers projected to rise even further in the near future [2\u0026ndash;5]. Accompanying this steep increase in primary procedures, a logical substantial increase of up to 90% in replacement procedures is anticipated by 2050 [4, 5].\u003c/p\u003e \u003cp\u003eTwo major complications of TKA and THA that are of particular concern due to their impact on overall health, hospital stays, treatment costs, and quality of life are excessive blood loss and periprosthetic joint infections (PJIs) [4, 6, 7]. These complications not only contribute significantly to the need for revision surgery in TKA and THA but also occur more frequently during revision procedures [5, 7\u0026ndash;10]. As a result, there is a strong focus on exploring interventions, both topical and systemic, to prevent perioperative blood loss and PJIs in primary and also revision arthroplasty.\u003c/p\u003e \u003cp\u003ePrevious studies have demonstrated that the use of tranexamic acid (TXA), a synthetic derivative of the essential amino acid lysine, either systemically or topically, can significantly reduce blood loss during TKA and THA [11\u0026ndash;14]. TXA works by inhibiting the conversion of plasminogen to plasmin, thereby limiting the fibrinolytic effects of plasmin through the blocking of the lysine binding site on plasmin [11]. While systemic administration is generally considered safe, topical intraarticular application is commonly preferred for patients at high risk of cardiovascular or thromboembolic events [13, 15]. Similarly, the topical application of vancomycin powder (VP), although subject to controversy, has been suggested to decrease the risk of PJIs following primary and revision procedures [16\u0026ndash;19]. Consequently, there is a growing trend toward using Vancomycin either topically or in a bone cement mixture to prevent or treat PJIs [18, 20]. Vancomycin, an antibiotic, functions by inhibiting the formation of bacterial cell walls and affecting the permeability of the bacterial cell membrane [16\u0026ndash;19].\u003c/p\u003e \u003cp\u003eHowever, concerns have been raised regarding the safety of intraarticular administration of VP and TXA due to potential toxic effects on periarticular cells such as osteocytes, chondrocytes, or tenocytes [21\u0026ndash;31]. Previous research has predominantly focused on separately investigating the cytotoxic effects of TXA and VP on osteocytes and chondrocytes in vitro, considering dose and time dependence. However, there is limited research on the combined effects of these substances on critical intra- and periarticular cell types. It is important to note that TXA and VP are often used in combination during revision procedures, which raises the possibility of detrimental effects on healthy remaining cells, including chondrocytes or mesenchymal stromal cells (MSCs) residing in the bone marrow. Any negative impact on the viability and function of human bone marrow-derived (hBMSCs) would be particularly detrimental given their crucial role in preventing aseptic implant loosening [32\u0026ndash;34].\u003c/p\u003e \u003cp\u003eTherefore, this study aimed to examine and compare the combined effects of various combinations of VP (3 mg/mL, 12 mg/mL, 50 mg/mL) and TXA (10 mg/mL, 50 mg/mL) on osteogenic differentiated hBMSCs \u003cem\u003ein vitro\u003c/em\u003e in dependance of varying exposure times (2 hours (h), 24 h, 48 h, 96 h). To do so we examined effects on cell viability and the expression of osteogenic marker genes. This information helps to further determine safe limits for the topical application of TXA and VP \u003cem\u003ein vivo\u003c/em\u003e and further understand the effects of these agents on articular and periarticular tissues.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Isolation and culture of hBMSCs\u003c/h2\u003e \u003cp\u003eAs described in our earlier studies, after informed and written consent and as approved by the University of Wuerzburg's institutional review board (186/18) bone marrow for the isolation of hBMSCs was harvested from five patients (n\u0026thinsp;=\u0026thinsp;5) aged 61 to 66 that all underwent THA (mean age 63,1 years) [35, 36].\u003c/p\u003e \u003cp\u003ehBMSCs were isolated from the femoral reaming. In order to isolate MSCs from bone marrow, tissue samples were washed in DMEM/Ham\u0026rsquo;s F12. Suspended cells were then spun, resuspended and seeded in 175 cm\u003csup\u003e2\u003c/sup\u003e plastic cell culture flasks (Greiner Bio-One GmbH). hBMSCs were grown in standard culture medium until reaching confluency after a single passage (all Life Technologies, Thermo Fischer Scientific, Dreieich, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Osteogenic differentiation of hBMSCs\u003c/h2\u003e \u003cp\u003eAfter reaching 70% confluence hBMSCs were trypsinated, spun and counted. hBMSCs for histological and molecularbiological assessments were then seeded in six-well plates at a density of 3 x 10\u003csup\u003e3\u003c/sup\u003e cells per cm\u003csup\u003e2\u003c/sup\u003e. Cells were cultured at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e and medium changes were performed every 3 to 4 days (d).\u003c/p\u003e \u003cp\u003eAfter a single passage and reaching confluency osteogenesis was induced for a duration of 21 d using a osteogenic differentiation medium supplemented with 100 nM dexamethasone, 50 \u0026micro;g/mL ascorbate and 10 mM β-glycerophosphate as described in our earlier studies [37, 38]. Simultaneously controls were grown in standard cell culture medium that lacked the mentioned osteogenic supplements for the same duration of time.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Treatment of osteogenic differentiated hBMSCs with Tranexamic acid and Vancomycin powder\u003c/h2\u003e \u003cp\u003eFollowing osteogenic differentiation for 21 d differentiated cells were exposed to a single shot of different combined concentrations of TXA (Carinopharm GmbH, Elze, Germany; 10 mg/mL, 50 mg/mL) and VP (Eberth Arzneimittel GmbH, Ursensollen, Germany; 3 mg/mL, 12 mg/mL and 50 mg/mL) for 2 h, 24 h, 48 h and 96 h (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Untreated cultures remained as controls.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eConcentration combinations of TXA and VP used for treatment of osteogenic differentiated hBMSCs.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVP concentration (mg/mL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTXA concentration (mg/mL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAbbreviation\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVP3TXA10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVP12TXA10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVP50TXA10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVP3TXA50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVP12TXA50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVP50TXA50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe standard cellular medium was used to dissolve the stock solution of TXA (100 mg/mL) and VP (200 mg/mL), whereas the negative control for differentiated cultures consisted of solely the standard cell culture medium. Sequential treatment was applied to the cell cultures with VP and TXA, following a predetermined schedule for exposure. This ensured that the cultures could be collectively analyzed at the conclusion of the experiment. Subsequent to the TXA and VP treatment, cells were rinsed with phosphate buffered saline (PBS) and prepared for subsequent analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Histological staining\u003c/h2\u003e \u003cp\u003eThe standard cellular medium was used to dissolve the stock solution of TXA (100 mg/mL) and VP (200 mg/mL), whereas the negative control for differentiated cultures consisted of solely the standard cell culture medium. Sequential treatment was applied to the cell cultures with VP and TXA, following a predetermined schedule for exposure. This ensured that the cultures could be collectively analyzed at the conclusion of the experiment. Subsequent to the TXA and VP treatment, cells were rinsed with phosphate buffered saline (PBS) and prepared for subsequent quantification-analysis as described in previously [35, 36].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Biochemical Assays\u003c/h2\u003e \u003cp\u003eAdenosine 5'-triphosphate (ATP) assays were performed to assess cell viability in monolayer cultures of osteogenic differentiated hBMSCs using the CellTiter-Glo\u0026reg; Luminescent Cell Viability Assay (Promega GmbH, Mannheim, Germany) as previously described earlier. Cell viability was measured after the respective treatment with varying concentration combinations of TXA and VP (VP3TXA10, VP12TXA10, VP50TXA10, VP3TXA50, VP12TXA50, VP50TXA50) and following an effective treatment time of 2 h, 24 h, 48 h and 96 h using the CellTiter-Glo\u0026reg; Luminescent Cell Viability Assay (Promega GmbH, Mannheim, Germany) as previously described [36, 39, 40].\u003c/p\u003e \u003cp\u003eAfter the treatment with TXA and VP monolayer cultures that were used for biochemical investigations were trypsinated and seeded in new 96-well-plates (Greiner Bio-One GmbH) at a density of 3 x 103 cells per cm2. ATP assays were performed after 2h, 24h, 48 h and 96 h. According to the user's guide the cells were mixed with 100 \u0026micro;L of CellTiter-Glo\u0026reg; (Promega GmbH, Mannheim, Germany) reagent, a composition of CellTiter-Glo\u0026reg; substrate with CellTiter-Glo\u0026reg; buffer. Cells were incubated in this reagent for 10 minutes before luminescence was measured using a plate-reading luminometer (Promega GmbH).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Annexin 5 Assay\u003c/h2\u003e \u003cp\u003eAnnexin 5 expression was assessed as a marker of apoptosis as described previously and as directed by the supplier (Sigma Aldrich, St. Louis, United States of America) [39, 41]. Briefly, the test uses double-labelling with the red fluorochrome Cy3.18/Annexin 5-Cy3 that binds to early apoptotic cells and conversion of 6-carboxyfluorescein diacetate (nonfluorescent) to 6-carboxyfluorescein (green fluorescent) by living cells. Following incubation with double-labelling staining solution for 10 minutes, osteogenic differentiated hBMSC cultures derived from five donors (n\u0026thinsp;=\u0026thinsp;5) were washed and fixed in 4% paraformaldehyde. Evaluation of living and apoptotic cells was performed on representative sections using a fluorescence microscope (Thermo Fischer Scientific GmbH) and the appropriate green and red filters.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. RNA isolation and semiquantitative RT-PCR\u003c/h2\u003e \u003cp\u003eThe gene expression levels of the tissue specific osteogenic marker genes collagen type I alpha 2 chain (COL1A2), collagen X alpha 1 chain (COL10A1), alkaline phosphatase (ALP) and osteocalcin (OC) in osteogenic differentiated hBMSC-cultures derived from five donors (n\u0026thinsp;=\u0026thinsp;5) was examined using semiquantitative RT-PCR.\u003c/p\u003e \u003cp\u003eTrizol reagent (Invitrogen, Waltham, United States of America) and other purification steps such as DNAse treatment were used to isolate RNA from osteogenic differentiated hBMSCs following treatment with TXA and VP. All steps were performed as described in the user's manual of the NucleoSpin\u0026reg; RNA II kit (Macherey-Nagel GmbH \u0026amp; Co. KG, D\u0026uuml;ren, Germany).\u003c/p\u003e \u003cp\u003eFor the synthesis of cDNA 1 \u0026micro;g of isolated RNA was combined with random hexamer primers (Thermo Fischer Scientific, Waltham, United States of America) and Promega\u0026reg; M-MLV reverse transcriptase (Promega GmbH).\u003c/p\u003e \u003cp\u003eFollowing this step 1 \u0026micro;L of cDNA was used as a template of amplification in a 30 \u0026micro;L reaction volume consisting of forward and reverse gene-specific primers (5 pmol each) and GoTaq\u0026reg; DNA polymerase (Promega GmbH). Primer sequences, annealing temperatures and cycle numbers for RT-PCR are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. As pointed out in our previous studies Elongation factor 1α (EEF1A1) was used as the housekeeping gene [38\u0026ndash;40].\u003c/p\u003e \u003cp\u003eThe final products of RT-PCR were split up using gel electrophoresis on 2% agarose (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) gels including 5 \u0026micro;L per 100 mL GelRed\u0026reg; (Biotium, Fremont, USA). The final products of RT-PCR were used for gel electrophoresis on 2% agarose gels (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) containing 5 \u0026micro;L per 100 mL GelRed\u0026reg; (Biotium, Fremont, CA, USA). The relative expression of the mentioned osteogenic marker genes was examined by measuring the band densities for all the tested genes in comparison to the expression of the housekeeping gene EEF1A1.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences and product sizes, for semiquantitative RT-PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAnnealing temperature (\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProduct size (base pairs)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCycles\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMgCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ehousekeeping gene for internal control\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEEF1A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense: AGGTGATTATCCTGAACCATCC\u003c/p\u003e \u003cp\u003eAntisense: AAAGGTGGATAGTCTGAGAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e54.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e234\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1 x\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eosteogenic marker genes\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOL1A2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense:\u003c/p\u003e \u003cp\u003eGGACACAATGGATTGCAAGG\u003c/p\u003e \u003cp\u003eAntisense:\u003c/p\u003e \u003cp\u003eTAACCACTGCTCCACTCTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e55.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e461\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2x\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOL10A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense:\u003c/p\u003e \u003cp\u003eCCCTTTTTGCTGCTAGTATCC\u003c/p\u003e \u003cp\u003eAntisense:\u003c/p\u003e \u003cp\u003eCTGTTGTCCAGGTTTTCCTGGCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e54.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e468\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1x\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense:\u003c/p\u003e \u003cp\u003eTGGAGCTTCAGAAGCTCAACACCA\u003c/p\u003e \u003cp\u003eAntisense:\u003c/p\u003e \u003cp\u003eATCTCGTTGTCTGAGTACCAGTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e51.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e454\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1x\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense:\u003c/p\u003e \u003cp\u003eATGAGAGCCCTCACACTCCTC\u003c/p\u003e \u003cp\u003eAntisense:\u003c/p\u003e \u003cp\u003eGCCGTAGAAGCGCCGATAGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e62.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e293\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2x\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Statistical analysis\u003c/h2\u003e \u003cp\u003eNumeric data from Alizarin Red S staining quantification, ATP assays and semiquantitative RT-PCR were expressed as bar charts presenting mean values and standard deviations. ATP assays and Alizarin Red S staining quantifications were performed in triplicate (n\u0026thinsp;=\u0026thinsp;3) and repeated on osteogenic differentiated hBMSCs isolated from a total of 5 different patients (n\u0026thinsp;=\u0026thinsp;5). RT-PCR was performed in triplicate (n\u0026thinsp;=\u0026thinsp;3) and repeated on 5 different osteogenic differentiated hBMSC cultures from 5 different patients (n\u0026thinsp;=\u0026thinsp;5). Data were checked for normal distribution using the Kolmogorov-Smirnov and Shapiro-Wilk test. Statistically significant differences between varying concentrations combinations of TXA and VP (VP3TX10, VP12TX10, VP50TX10, VP3TX50, VP12TX50, VP50TX50) as well as varying exposure times were assessed using a multiple paired T-test or the Wilcoxon signed-rank test. P-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Alizarin Red S staining of osteogenic differentiated hBMSCs\u003c/h2\u003e \u003cp\u003eAfter 21 d of osteogenic differentiation hBMSCs were treated with different concentrations of VP and TXA (VP3TX10, VP12TX10, VP50TX10, VP3TX50, VP12TX50, VP50TX50) for 24 h and 48 h to examine the effects of combined treatment of TXA and VP on matrix mineralization at these two exemplary chosen time points. After this treatment Alizarin Red S staining was performed on exemplary cultures treated with the lowest (VP3TXA10) and highest (VP50TXA50) concentration combinations for 24 h and 48 h, to examine osteogenesis in differentiated hBMSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, a). Untreated (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, a, no treatm.) and undifferentiated negative controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, a, undiff.) were maintained for comparison.\u003c/p\u003e\u003cp\u003eUndifferentiated control samples showed no positive Alizarin Red S staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, a, undiff.) while all osteogenically differentiated samples showed positive Alizarin Red S staining after 21 d independent of the exposure time and treatment with VP and TXA (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, a, no treatm., 24 h, 48 h).\u003c/p\u003e \u003cp\u003eFurthermore, no visible changes regarding the Alizarin Red S staining intensity could be observed in dependence of the varying concentration combinations of VP and TXA and the examined exposure time, in osteogenic differentiated hBMSCs derived from all five patient samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, a, 24 h, 48 h). When comparing cell cultures treated with VP and TXA to untreated control cultures and undifferentiated cultures no alteration of cell size was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, a)\u003c/p\u003e \u003cp\u003eThe calculation of the Alizarin Red S standard curve revealed a high coefficient of determination R\u003csup\u003e2\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, b). Quantifications of Alizarin Red S staining showed low concentrations of Alizarin Red S in undifferentiated cultures (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, c, undiff.) in comparison to osteogenic differentiated cultures independent of treatment with VP and TXA (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, c, control, VP3TX10, VP50TXA50). Although there was a non-significant trend towards lower Alizarin Red S concentrations in cultures treated with rising concentrations of VP and TXA (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, c, VP3TXA10, VP50TXA50) compared to untreated control groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, c, control), this trend was non-significant.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.1. ATP Assays of osteogenic differentiated hBMSCs\u003c/h2\u003e \u003cp\u003ehBMSCs were seeded in monolayer cultures and were exposed to an osteogenic differentiated medium. Following osteogenic differentiation for 21 d cells were exposed to different concentration combinations of TXA and VP (VP3TX10, VP12TX10, VP50TX10, VP3TX50, VP12TX50, VP50TX50) for 2 h, 24 h, 48 h and 96 h. We examined the effects of the combined treatment with VP and TXA on cell proliferation rates using the ATP Assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), while untreated osteogenic differentiated cultures were maintained as negative control groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, control). Bar charts were used to show the mean values with the corresponding standard deviations.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFollowing 2 h of treatment with varying concentration combinations of TXA and VP no effects on proliferation rate in monolayer cultures was observed in comparison to control cultures (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eh). After increasing exposure time to 24 h proliferation rate was lowered significantly in cultures treated with VP50TX10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, 24h, VP50TX10). In addition, in cultures treated for 24 h there was a non-significant trend towards a lower proliferation rate in almost all other cultures (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, 24h).\u003c/p\u003e \u003cp\u003eFollowing 48 h and 96 h of exposure to varying concentration combinations of VP and TXA there was a clear trend towards a dose and exposure time-dependent effect on proliferation rate in examined cultures (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, 24h, 48h, 96h). Proliferation rates in comparison to untreated control groups were significantly lower in cultures exposed to concentration combinations containing 50 mg/mL of VP after 48 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, 48h, VP50TX10, VP50TX50). After 96 h of exposure to VP and TXA significant reductions in proliferation rate were also visible in all other cultures exposed to VP and TXA, except those treated with the lowest concentration combination of VP3TX10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, 96h).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e3. 2. Annexin 5 assays of osteogenic differentiated hBMSCs\u003c/h3\u003e\n\u003cp\u003eCell viability and apoptosis of osteogenic differentiated MSC cultures, derived from two randomly chosen donors, following treatment with different concentration combinations of VP and TXA (VP3TX10, VP12TX10, VP50TX10, VP3TX50, VP12TX50, VP50TX50) was examined using double fluorescence staining with Annexin 5 (dead cells) -Cy3/6-carboxyfluorescein diacetate (living cells) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Untreated cultures were used as negative controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, untreated controls). Exposure time varied between 2 h, 24 h, 48 h and 96 h.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe control groups as well as osteogenic differentiated cultures treated with different combinations of VP and TXA for up to 24 h mostly showed a distinct green fluorescence marking viable cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, untreated controls, 2 h, 24 h).\u003c/p\u003e \u003cp\u003eAlthough viable cells were also visible in cultures treated with VP and TXA for at least 48 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, 48h, 96h), these were reduced in number. In addition, the apoptosis detection assay revealed that cultures treated with varying combinations of VP and TXA for 48 h or 96 h reacted more heavily Annexin 5-positive than control cultures or those treated for a maximum of 24 h, resulting in a clear red fluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, 48h, 96h).\u003c/p\u003e \u003cp\u003eWhen comparing cultures treated for 48 h, there was also a trend towards less green, viable cells and a more intense red staining in osteogenic differentiated cultures treated with higher concentrations of VP (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, 48h, VP50TXA10, VP50TXA50).\u003c/p\u003e \u003cp\u003eThe control groups as well as cultures treated with different combinations of VP and TXA for up to 24 h mostly showed a distinct green fluorescence marking viable cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, untreated controls, 2 h, 24 h).\u003c/p\u003e \u003cp\u003eAlthough viable cells were also visible in cultures treated with VP and TXA for at least 48 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, 48h, 96h), these were clearly reduced in number. In addition, the apoptosis detection assay revealed that cultures treated with varying combinations of VP and TXA for 48 h or 96 h reacted more heavily Annexin 5-positive than control cultures or those treated for a maximum of 24 h, resulting in a clear red fluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, 48h, 96h).\u003c/p\u003e \u003cp\u003eWhen comparing cultures treated for 48 h, there was also a trend towards less green, viable cells and a more intense red staining in osteogenic differentiated cultures treated with higher concentrations of VP (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, 48h, VP50TXA10, VP50TXA50).\u003c/p\u003e\n\u003ch3\u003e3. 4. Expression of osteogenic marker genes\u003c/h3\u003e\n\u003cp\u003eRT-PCR was performed to evaluate changes in the relative expression of osteogenic marker genes in osteogenic differentiated monolayer cultures derived from five different donors (n\u0026thinsp;=\u0026thinsp;5) after treatment with different combinations of VP and TXA (VP3TX10, VP12TX10, VP50TX10, VP3TX50, VP12TX50, VP50TX50) for varying exposure times (2 h, 24 h, 48 h, 96 h) in comparison to untreated negative controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThere was no significant impact of treatment with varying concentration combinations of VP and TXA on the expression of examined osteogenic marker genes COL1A2, COL10A1, ALP and OC in cultures independent of the assessed exposure time (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHowever, there was a non-significant trend towards a declining relative expression of the osteogenic marker genes COL1A2, COL10A1 and ALP depending on the exposure time (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, a-c). This non-significant decline of the relative expression of respective osteogenic marker genes was evident after 48 h, continued over the exposure period of 96 h and was independent of examined concentration combinations (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, a-c, 48 h, 96 h). This non-significant exposure time-dependent effect of VP and TXA on the relative expression of osteogenic marker genes was not observed for OC (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, d).\u003c/p\u003e \u003cp\u003eIn addition, no clear differences regarding the impact of varying concentration combinations on the relative expression of osteogenic marker genes was observed for the examined exposure times (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eBoth TXA and VP exhibit promising potential in mitigating some of the most prevalent perioperative complications in revision arthroplasty: TXA's antifibrinolytic properties reduce the risk of perioperative blood loss, and its topical application may contribute to decreased postoperative swelling [11\u0026ndash;14, 16\u0026ndash;18]. Similarly, VP's topical treatment shows potential in diminishing the likelihood of post-joint arthroplasty PJIs in both primary and revision cases [11\u0026ndash;14, 16\u0026ndash;18]. Notably, TXA could also play a role in reducing infection rates by minimizing the formation of localized hematoma-like hyaluronic acid [33]. Due to their established clinical safety profiles and minimal systemic side effects during topical use, their popularity has surged for application during joint arthroplasty revision procedures [16, 18, 42]. Nonetheless, recent research has raised concerns about potential toxicity towards osteocytes, chondrocytes, fibroblasts, and other periarticular tissues, with effects potentially varying based on dosage and exposure time [21\u0026ndash;31].\u003c/p\u003e \u003cp\u003eNumerous studies have deemed concentrations of TXA up to 20 mg/mL and VP up to 5 mg/mL safe for crucial periarticular cell types \u003cem\u003ein vitro\u003c/em\u003e [23]. Although the evidence is inconsistent, higher concentrations have shown to negatively impact cell viability and cell morphology in various cell types derived from periarticular tissues. TXA [23]. Studies examining the exact mechanics behind these effects found that treatment with TXA for more than 24 h may negatively impact the cell cycle and cause cytotoxicity through activating caspase-3-dependant apoptotic mechanisms [26, 27, 40]. Accordingly, McLean et al. identified increased amounts of apoptotic proteins in cells treated with TXA. However, tissue quality seemed to be unaffected, when limiting exposure time to clinically appropriate length [43]. Similar to TXA, Vancomycin has shown to affect cell viability in a time and concentration dependent manner. These effects could be partially explained by the increased production of reactive oxygen species (ROS), the expression of pro-inflammatory cytokines as well as the upregulation of cell receptors associated with inflammatory responses, after exposure to VP, potentially leading to ROS-induced cell death [44]. Further, the combined use of Vancomycin with other medications has shown to alter effects on cytotoxicity when applying medication via an infusion [45] Since existing research lacks consistency regarding the safety of both substances and their combined effects on periarticular tissues \u003cem\u003ein vitro\u003c/em\u003e, which prompted our current investigation.\u003c/p\u003e \u003cp\u003eTypical effective dosages for TXA's topical administration typically span 250 mg to 3 g, resulting in intraarticular concentrations ranging from 15 mg/mL to 100 mg/mL [26, 42, 46]. TXA is thought to rapidly diffuse into synovial fluid until its concentrations align with plasma levels [26, 47]. For VP's topical application, dosages generally range from 0.5 g to 4 g, and anticipated intraarticular concentrations are notably lower, with higher doses potentially reaching up to 10 mg/mL [18, 48]. Nevertheless, immediate peak tissue concentrations might fluctuate following the topical administration of VP and TXA [18, 48].\u003c/p\u003e \u003cp\u003eIn our present \u003cem\u003ein vitro\u003c/em\u003e study we found that combined treatment with TXA and VP has a significant negative effect on proliferation rate and cell viability on osteogenic differentiated hBMSCs. This effect can be seen after only 24 h when using high concentrations of VP (50 mg/mL) or at the latest after 96 h independent of the concentration combinations used. Limiting exposure time to 2 h or 24 h and using low concentrations of VP (3 mg/mL, 12 mg/mL) may help to prevent these effects \u003cem\u003ein vitro.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eATP assays showed a clear time and dose-dependent effect of combined treatment with VP and TXA on proliferation rate in osteogenic differentiated hBMSCs. A significant decrease of proliferation rate was detectable after 24 h after treatment with VP50TXA10 and after 48 h after treatment with 50 mg/mL independent of TXA concentrations. After 96 h significant effects on the cell proliferation rates in comparison to control groups were visible in all differentiated cultures. These results are in line with Annexin 5 assays which showed a clear increase in apoptotic cells and a decrease in viable cells after 96 h of treatment within all differentiated hBMSCs cultures treated with VP and TXA. In cultures treated with high concentrations of VP (50 mg/mL) effects were also visible after 48 h. Alhough we found no visible effects on Alizarin Red S stainings, quantification of Alizarin Red S staining revealed a non-siginificant, dose-dependent, negative trend of combined treatment with TXA and VP on mineralization in osteogenic differentiated hBMSCs. Finally, no clear effects of combined treatment with VP and TXA on osteogenic marker gene expression were visible.\u003c/p\u003e \u003cp\u003eAlthough this study is the first examining the combined impact of TXA and VP on osteogenic differentiated hBMSCs \u003cem\u003ein vitro\u003c/em\u003e, the effect of single TXA treatment on multiple periarticular cell types is well researched. However, most of these studies focus on the effects of both substances on chondrocytes. Even here, there is still no clear consensus regarding cytotoxic effects [11, 22\u0026ndash;24, 26, 40]. Matching the results of our current study, we previously found that prolonged exposure of osteogenic differentiated hBMSCs to 50 mg/mL of TXA for 48 h led to a significant decrease in cell viability [40]. Further, TXA affected the expression of osteogenic marker genes in a dose-dependent but non-significant manner [40]. McLean et al. underlined that TXA may induce caspase-3-dependent mechanisms which may mediate these universal negative effects of TXA on cell proliferation and viability in multiple cell types [27]. Bolam et al. found that treatment of osteoblast-like cells derived from trabecular bone explants with high concentrations of TXA (50 mg/mL) for only 3 h led to a significant decrease in cell numbers and that this effect was also visible when using lower concentrations (20 mg/mL) while increasing the exposure time to 24 h [49]. Interestingly, Bolam et al. also pointed out that TXA may negatively influence cell functionality by decreasing collagen deposition [49].\u003c/p\u003e \u003cp\u003eOther researchers examined the isolated of topical VP treatment on osteogenic differentiated hBMSCs or osteoblasts \u003cem\u003ein vitro\u003c/em\u003e [30, 31, 50, 51]. Braun et al. showed that VP significantly decreased cell viability in osteoblasts in a dose- and exposure time-dependent manner [30]. Matching our current findings even minimal concentrations of VP may negatively affected cell viability when increasing exposure time to multiple days [30]. Hanson et al. examined further confirmed the negative effects of low concentrations of VP up to 4 mg/mL on bone marrow-derived mesenchymal stromal cell (BMSC)-viability during osteogenic differentiation [31]. In line with our current findings Hanson et al. also showed negative effects of VP treatment on Alizarin Red S staining quantification [31]. Bariteau showed comparable effects on cell viability and Alizarin Red S staining when treating BMSCs with VP concentrations of up to 5 mg/mL [50]. In contrast, low concentrations of VP do not seem to impair cell viability or osteogenic differentiation potential in BMSCs [31, 50, 51].\u003c/p\u003e \u003cp\u003eIn summary, our current study adds to the existing evidence which shows that topical treatment of osteogenic differentiated hBMSC with high concentrations of VP and TXA may significantly impact cell viability, cell proliferation and osteogenic differentiation capacity in BMSCs. These findings have previously led to researchers assuming topical application of VP may impact bone healing or bone fusion following spinal arthrodesis [31]. Other studies have also found that impaired osteogenic differentiation capacity of hBMSCs may lead to osteolysis and therefore may play an important role in aseptic loosening of joint implants [34].\u003c/p\u003e \u003cp\u003eLimitations of our study encompass the constrained size of the examined sample, which curtails the statistical significance of our findings. Additionally, cells derived from osteoarthritic joints or post-revision arthroplasty may exhibit diminished proliferation capacity unrelated to TXA treatment [52, 53]. Further, the presented data solely examines \u003cem\u003ein vitro\u003c/em\u003e effects and may not translate into adverse clinical outcomes or recommendations for safe dosages. Previously, researchers pointed out that the three-dimensional cell models mimicking the extracellular matrix of bone tissue or hyaline cartilage \u003cem\u003ein vivo\u003c/em\u003e might display heightened resistance to topical treatment with cytotoxic drugs [24]. In addition, the pharmacokinetics of medications like TXA or VP \u003cem\u003ein vivo\u003c/em\u003e could be influenced by tissues beyond those tested in our study, potentially complicating the interpretation of our current in vitro investigation [26]. As there is currently no \u003cem\u003ein vitro\u003c/em\u003e data examining the combined effects of topical treatment with TXA and VP on osteocytes, chondrocytes or other periarticular cell types, our aim in regard to translational research was to provide first \u003cem\u003ein vitro\u003c/em\u003e results before these are tested in future \u003cem\u003ein vivo\u003c/em\u003e studies. Also further exploration concerning more lifelike tissue models and potential impacts of TXA and VP on other functional cell types is imperative to fully apprehend the consequences of topical treatment on periarticular tissues.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn summary, our current results strengthen existing evidence and add new evidence that limiting exposure time of topical treatment with VP and TXA to 24 h may provide a safe setting, even if topical treatment consists of both VP and TXA. This is especially the case when adhering to low concentrations of TXA (10 mg/mL) and VP (3 mg/mL). Prolonged exposure times of up to 96 h have a significant negative impact on cell viability of osteogenic differentiated hBMSCs independent of the concentration combinations used.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eATP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAdenosine 5'-triphosphate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCFDA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e6-carboxyfluorescein diacetate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCOMP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecartilage oligomeric matrix protein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCOL2A1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecollagen type II alpha 1 chain\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eACAN\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eaggrecan\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ed\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edays\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDMEM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDulbecco's Modified Eagle Medium\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eEEF1A1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eElongation factor 1α\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFBS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efetal bovine serum\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eh\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehours\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ehBMSCs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ehuman bone marrow-derived mesenchymal stromal cells\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMSCs mesenchymal stromal cell\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eOECD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eOrganisation for Economic Co-operation and Development\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003epenicillin/streptomycin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePJI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eperioperative joint infection\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePBS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ephosphate buffered saline\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSOX9\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003esex-determining region Y-box 9\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTKA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTotal knee arthroplasty\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTXA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTranexamic acid\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eVP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eVancomycin powder\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e:\u0026nbsp;We are grateful to Beate Geyer for her excellent technical assistance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions:\u003c/strong\u003eConceptualization, Ma.W. and J.A.; Methodology, Ma.W. and B.M.H; Software, Mi.W.; Validation, Ma.W. and B.M.H.; Formal Analysis, Ma.W. and Mi.W.; Investigation, Ma.W.; Resources, Mi.W.; Data Curation, Mi.W., A.J. and T.H.; Writing – Original Draft Preparation, Mi.W. and Ma.W.; Writing – Review \u0026amp; Editing, Ma.W., Mi.W., K.H., S.M.-W., A.J., D.D., T.H., M.R., B.M.H. and J.A.; Visualization, Mi.W. and Ma.W.; Supervision, Ma.W. and J.A.; Project Administration, B.M.H. and Ma.W.; Funding Acquisition, B.M.H. and M.R.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e This publication was funded by the University of Wuerzburg in the funding program Open Access Publishing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e:\u0026nbsp;The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u003c/strong\u003e The study design and experiments were approved by University of Wuerzburg‘s institutional review board (186/18). Informed consent was obtained from all subjects and/or their legal guardian(s)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u0026nbsp;\u003c/strong\u003eThe authors declare they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003e\u003cstrong\u003eHealth at a Glance 2019 OECD Indicators: OECD Indicators\u003c/strong\u003e: OECD Publishing; 2019.\u003c/li\u003e\n\u003cli\u003eCulliford DJ, Maskell J, Kiran A, Judge A, Javaid MK, Cooper C, Arden NK: \u003cstrong\u003eThe lifetime risk of total hip and knee arthroplasty: results from the UK general practice research database\u003c/strong\u003e. \u003cem\u003eOsteoarthritis Cartilage \u003c/em\u003e2012, \u003cstrong\u003e20\u003c/strong\u003e(6):519-524.\u003c/li\u003e\n\u003cli\u003eJonsson H, Olafsdottir S, Sigurdardottir S, Aspelund T, Eiriksdottir G, Sigurdsson S, Harris TB, Launer L, Gudnason V: \u003cstrong\u003eIncidence and prevalence of total joint replacements due to osteoarthritis in the elderly: risk factors and factors associated with late life prevalence in the AGES-Reykjavik Study\u003c/strong\u003e. \u003cem\u003eBMC musculoskeletal disorders \u003c/em\u003e2016, \u003cstrong\u003e17\u003c/strong\u003e:14.\u003c/li\u003e\n\u003cli\u003eKlug A, Gramlich Y, Rudert M, Drees P, Hoffmann R, Wei\u0026szlig;enberger M, Kutzner KP: \u003cstrong\u003eThe projected volume of primary and revision total knee arthroplasty will place an immense burden on future health care systems over the next 30 years\u003c/strong\u003e. \u003cem\u003eKnee surgery, sports traumatology, arthroscopy : official journal of the ESSKA \u003c/em\u003e2020:1-12.\u003c/li\u003e\n\u003cli\u003eUlrich SD, Seyler TM, Bennett D, Delanois RE, Saleh KJ, Thongtrangan I, Kuskowski M, Cheng EY, Sharkey PF, Parvizi J\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTotal hip arthroplasties: what are the reasons for revision?\u003c/strong\u003e \u003cem\u003eInternational orthopaedics \u003c/em\u003e2008, \u003cstrong\u003e32\u003c/strong\u003e(5):597-604.\u003c/li\u003e\n\u003cli\u003ePostler A, L\u0026uuml;tzner C, Beyer F, Tille E, L\u0026uuml;tzner J: \u003cstrong\u003eAnalysis of Total Knee Arthroplasty revision causes\u003c/strong\u003e. \u003cem\u003eBMC musculoskeletal disorders \u003c/em\u003e2018, \u003cstrong\u003e19\u003c/strong\u003e(1):55.\u003c/li\u003e\n\u003cli\u003eEvangelopoulos DS, Ahmad SS, Krismer AM, Albers CE, Hoppe S, Kleer B, Kohl S, Ateschrang A: \u003cstrong\u003ePeriprosthetic Infection: Major Cause of Early Failure of Primary and Revision Total Knee Arthroplasty\u003c/strong\u003e. \u003cem\u003eJ Knee Surg \u003c/em\u003e2019, \u003cstrong\u003e32\u003c/strong\u003e(10):941-946.\u003c/li\u003e\n\u003cli\u003eKlasan A, Gerber F, Schermuksnies A, Putnis SE, Neri T, Heyse TJ: \u003cstrong\u003eBlood loss after revision knee arthroplasty is 1.38- to 2.17-fold higher than after primary knee arthroplasty: A retrospective analysis of 898 cases\u003c/strong\u003e. \u003cem\u003eOrthop Traumatol Surg Res \u003c/em\u003e2021, \u003cstrong\u003e107\u003c/strong\u003e(3):102856.\u003c/li\u003e\n\u003cli\u003eHu Y, Li Q, Wei BG, Zhang XS, Torsha TT, Xiao J, Shi ZJ: \u003cstrong\u003eBlood loss of total knee arthroplasty in osteoarthritis: an analysis of influential factors\u003c/strong\u003e. \u003cem\u003eJ Orthop Surg Res \u003c/em\u003e2018, \u003cstrong\u003e13\u003c/strong\u003e(1):325.\u003c/li\u003e\n\u003cli\u003eRosso F, Cottino U, Dettoni F, Bruzzone M, Bonasia DE, Rossi R: \u003cstrong\u003eRevision total knee arthroplasty (TKA): mid-term outcomes and bone loss/quality evaluation and treatment\u003c/strong\u003e. \u003cem\u003eJ Orthop Surg Res \u003c/em\u003e2019, \u003cstrong\u003e14\u003c/strong\u003e(1):280.\u003c/li\u003e\n\u003cli\u003eJacob B, Kloss N, B\u0026ouml;hle S, Kirschberg J, Zippelius T, Heinecke M, Matziolis G, R\u0026ouml;hner E: \u003cstrong\u003eTranexamic acid is toxic on human chondrocytes, in vitro\u003c/strong\u003e. \u003cem\u003eJ Orthop \u003c/em\u003e2020, \u003cstrong\u003e20\u003c/strong\u003e:1-5.\u003c/li\u003e\n\u003cli\u003eZhang H, Chen J, Chen F, Que W: \u003cstrong\u003eThe effect of tranexamic acid on blood loss and use of blood products in total knee arthroplasty: a meta-analysis\u003c/strong\u003e. \u003cem\u003eKnee surgery, sports traumatology, arthroscopy : official journal of the ESSKA \u003c/em\u003e2012, \u003cstrong\u003e20\u003c/strong\u003e(9):1742-1752.\u003c/li\u003e\n\u003cli\u003eOremus K: \u003cstrong\u003eTranexamic acid for the reduction of blood loss in total knee arthroplasty\u003c/strong\u003e. \u003cem\u003eAnn Transl Med \u003c/em\u003e2015, \u003cstrong\u003e3\u003c/strong\u003e(Suppl 1):S40.\u003c/li\u003e\n\u003cli\u003eSassoon A, Nam D, Jackups R, Johnson SR, Nunley RM, Barrack RL: \u003cstrong\u003eTranexamic acid: optimal blood loss management in surface replacement arthroplasty\u003c/strong\u003e. \u003cem\u003eBone Joint J \u003c/em\u003e2016, \u003cstrong\u003e98-b\u003c/strong\u003e(2):173-178.\u003c/li\u003e\n\u003cli\u003eYuan ZF, Yin H, Ma WP, Xing DL: \u003cstrong\u003eThe combined effect of administration of intravenous and topical tranexamic acid on blood loss and transfusion rate in total knee arthroplasty: Combined tranexamic acid for TKA\u003c/strong\u003e. \u003cem\u003eBone \u0026amp; joint research \u003c/em\u003e2016, \u003cstrong\u003e5\u003c/strong\u003e(8):353-361.\u003c/li\u003e\n\u003cli\u003eLiao S, Yang Z, Li X, Chen J, Liu JG: \u003cstrong\u003eEffects of different doses of vancomycin powder in total knee and hip arthroplasty on the periprosthetic joint infection rate: a systematic review and meta-analysis\u003c/strong\u003e. \u003cem\u003eJ Orthop Surg Res \u003c/em\u003e2022, \u003cstrong\u003e17\u003c/strong\u003e(1):546.\u003c/li\u003e\n\u003cli\u003eHanada M, Nishikino S, Hotta K, Furuhashi H, Hoshino H, Matsuyama Y: \u003cstrong\u003eIntrawound vancomycin powder increases post-operative wound complications and does not decrease periprosthetic joint infection in primary total and unicompartmental knee arthroplasties\u003c/strong\u003e. \u003cem\u003eKnee surgery, sports traumatology, arthroscopy : official journal of the ESSKA \u003c/em\u003e2019, \u003cstrong\u003e27\u003c/strong\u003e(7):2322-2327.\u003c/li\u003e\n\u003cli\u003ePeng Z, Lin X, Kuang X, Teng Z, Lu S: \u003cstrong\u003eThe application of topical vancomycin powder for the prevention of surgical site infections in primary total hip and knee arthroplasty: A meta-analysis\u003c/strong\u003e. \u003cem\u003eOrthop Traumatol Surg Res \u003c/em\u003e2021, \u003cstrong\u003e107\u003c/strong\u003e(4):102741.\u003c/li\u003e\n\u003cli\u003eDial BL, Lampley AJ, Green CL, Hallows R: \u003cstrong\u003eIntrawound Vancomycin Powder in Primary Total Hip Arthroplasty Increases Rate of Sterile Wound Complications\u003c/strong\u003e. \u003cem\u003eHip Pelvis \u003c/em\u003e2018, \u003cstrong\u003e30\u003c/strong\u003e(1):37-44.\u003c/li\u003e\n\u003cli\u003eIarikov D, Demian H, Rubin D, Alexander J, Nambiar S: \u003cstrong\u003eChoice and doses of antibacterial agents for cement spacers in treatment of prosthetic joint infections: review of published studies\u003c/strong\u003e. \u003cem\u003eClin Infect Dis \u003c/em\u003e2012, \u003cstrong\u003e55\u003c/strong\u003e(11):1474-1480.\u003c/li\u003e\n\u003cli\u003eAmbra LF, de Girolamo L, Niu W, Phan A, Spector M, Gomoll AH: \u003cstrong\u003eNo effect of topical application of tranexamic acid on articular cartilage\u003c/strong\u003e. \u003cem\u003eKnee surgery, sports traumatology, arthroscopy : official journal of the ESSKA \u003c/em\u003e2019, \u003cstrong\u003e27\u003c/strong\u003e(3):931-935.\u003c/li\u003e\n\u003cli\u003eMarmotti A, Mattia S, Mangiavini L, Bonasia DE, Bruzzone M, Dettoni F, Rosso F, Blonna D, Rossi R, Castoldi F\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTranexamic acid effects on cartilage and synovial tissue: an in vitro study for a possible safe intra-articular use\u003c/strong\u003e. \u003cem\u003eJ Biol Regul Homeost Agents \u003c/em\u003e2016, \u003cstrong\u003e30\u003c/strong\u003e(4 Suppl 1):33-40.\u003c/li\u003e\n\u003cli\u003eBolam SM, O\u0026apos;Regan-Brown A, Paul Monk A, Musson DS, Cornish J, Munro JT: \u003cstrong\u003eToxicity of tranexamic acid (TXA) to intra-articular tissue in orthopaedic surgery: a scoping review\u003c/strong\u003e. \u003cem\u003eKnee surgery, sports traumatology, arthroscopy : official journal of the ESSKA \u003c/em\u003e2020.\u003c/li\u003e\n\u003cli\u003eTuttle JR, Feltman PR, Ritterman SA, Ehrlich MG: \u003cstrong\u003eEffects of Tranexamic Acid Cytotoxicity on In Vitro Chondrocytes\u003c/strong\u003e. \u003cem\u003eAm J Orthop (Belle Mead NJ) \u003c/em\u003e2015, \u003cstrong\u003e44\u003c/strong\u003e(12):E497-502.\u003c/li\u003e\n\u003cli\u003eParker JD, Lim KS, Kieser DC, Woodfield TBF, Hooper GJ: \u003cstrong\u003eIs tranexamic acid toxic to articular cartilage when administered topically? What is the safe dose?\u003c/strong\u003e \u003cem\u003eBone Joint J \u003c/em\u003e2018, \u003cstrong\u003e100-b\u003c/strong\u003e(3):404-412.\u003c/li\u003e\n\u003cli\u003eGoderecci R, Giusti I, Necozione S, Cinque B, D\u0026apos;Ascenzo S, Dolo V, Calvisi V: \u003cstrong\u003eShort exposure to tranexamic acid does not affect, in vitro, the viability of human chondrocytes\u003c/strong\u003e. \u003cem\u003eEur J Med Res \u003c/em\u003e2019, \u003cstrong\u003e24\u003c/strong\u003e(1):15.\u003c/li\u003e\n\u003cli\u003eMcLean M, McCall K, Smith IDM, Blyth M, Kitson SM, Crowe LAN, Leach WJ, Rooney BP, Spencer SJ, Mullen M\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTranexamic acid toxicity in human periarticular tissues\u003c/strong\u003e. \u003cem\u003eBone \u0026amp; joint research \u003c/em\u003e2019, \u003cstrong\u003e8\u003c/strong\u003e(1):11-18.\u003c/li\u003e\n\u003cli\u003eR\u0026ouml;hner E, Zippelius T, B\u0026ouml;hle S, Rohe S, Matziolis G, Jacob B: \u003cstrong\u003eVancomycin is toxic to human chondrocytes in vitro\u003c/strong\u003e. \u003cem\u003eArchives of orthopaedic and trauma surgery \u003c/em\u003e2021, \u003cstrong\u003e141\u003c/strong\u003e(3):375-381.\u003c/li\u003e\n\u003cli\u003eShaw KA, Eichinger JK, Nadig N, Parada SA: \u003cstrong\u003eIn Vitro Effect of Vancomycin on the Viability of Articular Chondrocytes\u003c/strong\u003e. \u003cem\u003eJ Orthop Trauma \u003c/em\u003e2018, \u003cstrong\u003e32\u003c/strong\u003e(3):148-153.\u003c/li\u003e\n\u003cli\u003eBraun J, Eckes S, Rommens PM, Schmitz K, Nickel D, Ritz U: \u003cstrong\u003eToxic Effect of Vancomycin on Viability and Functionality of Different Cells Involved in Tissue Regeneration\u003c/strong\u003e. \u003cem\u003eAntibiotics (Basel) \u003c/em\u003e2020, \u003cstrong\u003e9\u003c/strong\u003e(5).\u003c/li\u003e\n\u003cli\u003eHanson K, Isder C, Shogren K, Mikula AL, Lu L, Yaszemski MJ, Elder BD: \u003cstrong\u003eThe inhibitory effects of vancomycin on rat bone marrow-derived mesenchymal stem cell differentiation\u003c/strong\u003e. \u003cem\u003eJ Neurosurg Spine \u003c/em\u003e2021:1-5.\u003c/li\u003e\n\u003cli\u003eKoutalos AA, Drakos A, Fyllos A, Doxariotis N, Varitimidis S, Malizos KN: \u003cstrong\u003eDoes Intra-Wound Vancomycin Powder Affect the Action of Intra-Articular Tranexamic Acid in Total Joint Replacement?\u003c/strong\u003e \u003cem\u003eMicroorganisms \u003c/em\u003e2020, \u003cstrong\u003e8\u003c/strong\u003e(5).\u003c/li\u003e\n\u003cli\u003eBenjumea A, D\u0026iacute;az-Navarro M, Hafian R, Cercenado E, S\u0026aacute;nchez-Somolinos M, Vaquero J, Chana F, Mu\u0026ntilde;oz P, Guembe M: \u003cstrong\u003eTranexamic Acid in Combination With Vancomycin or Gentamicin Has a Synergistic Effect Against Staphylococci\u003c/strong\u003e. \u003cem\u003eFront Microbiol \u003c/em\u003e2022, \u003cstrong\u003e13\u003c/strong\u003e:935646.\u003c/li\u003e\n\u003cli\u003ePajarinen J, Lin TH, Nabeshima A, J\u0026auml;msen E, Lu L, Nathan K, Yao Z, Goodman SB: \u003cstrong\u003eMesenchymal stem cells in the aseptic loosening of total joint replacements\u003c/strong\u003e. \u003cem\u003eJournal of biomedical materials research Part A \u003c/em\u003e2017, \u003cstrong\u003e105\u003c/strong\u003e(4):1195-1207.\u003c/li\u003e\n\u003cli\u003eNoth U, Tuli R, Osyczka AM, Danielson KG, Tuan RS: \u003cstrong\u003eIn vitro engineered cartilage constructs produced by press-coating biodegradable polymer with human mesenchymal stem cells\u003c/strong\u003e. \u003cem\u003eTissue engineering \u003c/em\u003e2002, \u003cstrong\u003e8\u003c/strong\u003e(1):131-144.\u003c/li\u003e\n\u003cli\u003eSteinert AF, Proffen B, Kunz M, Hendrich C, Ghivizzani SC, Noth U, Rethwilm A, Eulert J, Evans CH: \u003cstrong\u003eHypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer\u003c/strong\u003e. \u003cem\u003eArthritis Res Ther \u003c/em\u003e2009, \u003cstrong\u003e11\u003c/strong\u003e(5):R148.\u003c/li\u003e\n\u003cli\u003eReichert JC, Schmalzl J, Prager P, Gilbert F, Quent VM, Steinert AF, Rudert M, Noth U: \u003cstrong\u003eSynergistic effect of Indian hedgehog and bone morphogenetic protein-2 gene transfer to increase the osteogenic potential of human mesenchymal stem cells\u003c/strong\u003e. \u003cem\u003eStem Cell Res Ther \u003c/em\u003e2013, \u003cstrong\u003e4\u003c/strong\u003e(5):105.\u003c/li\u003e\n\u003cli\u003eSteinert AF, Kunz M, Prager P, Barthel T, Jakob F, Noth U, Murray MM, Evans CH, Porter RM: \u003cstrong\u003eMesenchymal stem cell characteristics of human anterior cruciate ligament outgrowth cells\u003c/strong\u003e. \u003cem\u003eTissue Eng Part A \u003c/em\u003e2011, \u003cstrong\u003e17\u003c/strong\u003e(9-10):1375-1388.\u003c/li\u003e\n\u003cli\u003eSteinert AF, Weissenberger M, Kunz M, Gilbert F, Ghivizzani SC, Gobel S, Jakob F, Noth U, Rudert M: \u003cstrong\u003eIndian hedgehog gene transfer is a chondrogenic inducer of human mesenchymal stem cells\u003c/strong\u003e. \u003cem\u003eArthritis Res Ther \u003c/em\u003e2012, \u003cstrong\u003e14\u003c/strong\u003e(4):R168.\u003c/li\u003e\n\u003cli\u003eWagenbrenner M, Heinz T, Horas K, Jakuscheit A, Arnholdt J, Mayer-Wagner S, Rudert M, Holzapfel BM, Wei\u0026szlig;enberger M: \u003cstrong\u003eImpact of Tranexamic Acid on Chondrocytes and Osteogenically Differentiated Human Mesenchymal Stromal Cells (hMSCs) In Vitro\u003c/strong\u003e. \u003cem\u003eJ Clin Med \u003c/em\u003e2020, \u003cstrong\u003e9\u003c/strong\u003e(12).\u003c/li\u003e\n\u003cli\u003eWeissenberger M, Weissenberger MH, Gilbert F, Groll J, Evans CH, Steinert AF: \u003cstrong\u003eReduced hypertrophy in vitro after chondrogenic differentiation of adult human mesenchymal stem cells following adenoviral SOX9 gene delivery\u003c/strong\u003e. \u003cem\u003eBMC musculoskeletal disorders \u003c/em\u003e2020, \u003cstrong\u003e21\u003c/strong\u003e(1):109.\u003c/li\u003e\n\u003cli\u003eAlshryda S, Sukeik M, Sarda P, Blenkinsopp J, Haddad FS, Mason JM: \u003cstrong\u003eA systematic review and meta-analysis of the topical administration of tranexamic acid in total hip and knee replacement\u003c/strong\u003e. \u003cem\u003eBone Joint J \u003c/em\u003e2014, \u003cstrong\u003e96-b\u003c/strong\u003e(8):1005-1015.\u003c/li\u003e\n\u003cli\u003eGkiatas I, Kontokostopoulos AP, Tsirigkakis SE, Kostas-Agnantis I, Gelalis I, Korompilias A, Pakos E: \u003cstrong\u003eTopical use of tranexamic acid: Are there concerns for cytotoxicity?\u003c/strong\u003e \u003cem\u003eWorld journal of orthopedics \u003c/em\u003e2022, \u003cstrong\u003e13\u003c/strong\u003e(6):555-563.\u003c/li\u003e\n\u003cli\u003eSakamoto Y, Yano T, Hanada Y, Takeshita A, Inagaki F, Masuda S, Matsunaga N, Koyanagi S, Ohdo S: \u003cstrong\u003eVancomycin induces reactive oxygen species-dependent apoptosis via mitochondrial cardiolipin peroxidation in renal tubular epithelial cells\u003c/strong\u003e. \u003cem\u003eEur J Pharmacol \u003c/em\u003e2017, \u003cstrong\u003e800\u003c/strong\u003e:48-56.\u003c/li\u003e\n\u003cli\u003eDrouet M, Chai F, Barth\u0026eacute;l\u0026eacute;my C, Lebuffe G, Debaene B, D\u0026eacute;caudin B, Odou P: \u003cstrong\u003eEndothelial Cell Toxicity of Vancomycin Infusion Combined with Other Antibiotics\u003c/strong\u003e. \u003cem\u003eAntimicrob Agents Chemother \u003c/em\u003e2015, \u003cstrong\u003e59\u003c/strong\u003e(8):4901-4906.\u003c/li\u003e\n\u003cli\u003eKim TK, Chang CB, Koh IJ: \u003cstrong\u003ePractical issues for the use of tranexamic acid in total knee arthroplasty: a systematic review\u003c/strong\u003e. \u003cem\u003eKnee surgery, sports traumatology, arthroscopy : official journal of the ESSKA \u003c/em\u003e2014, \u003cstrong\u003e22\u003c/strong\u003e(8):1849-1858.\u003c/li\u003e\n\u003cli\u003eBarrett CD, Moore HB, Kong YW, Chapman MP, Sriram G, Lim D, Moore EE, Yaffe MB: \u003cstrong\u003eTranexamic acid mediates proinflammatory and anti-inflammatory signaling via complement C5a regulation in a plasminogen activator-dependent manner\u003c/strong\u003e. \u003cem\u003eThe journal of trauma and acute care surgery \u003c/em\u003e2019, \u003cstrong\u003e86\u003c/strong\u003e(1):101-107.\u003c/li\u003e\n\u003cli\u003eLawrie CM, Kazarian GS, Barrack T, Nunley RM, Barrack RL: \u003cstrong\u003eIntra-articular administration of vancomycin and tobramycin during primary cementless total knee arthroplasty : determination of intra-articular and serum elution profiles\u003c/strong\u003e. \u003cem\u003eBone Joint J \u003c/em\u003e2021, \u003cstrong\u003e103-b\u003c/strong\u003e(11):1702-1708.\u003c/li\u003e\n\u003cli\u003eBolam SM, O\u0026apos;Regan-Brown A, Konar S, Callon KE, Coleman B, Dalbeth N, Monk AP, Musson DS, Cornish J, Munro JT: \u003cstrong\u003eCytotoxicity of tranexamic acid to tendon and bone in vitro: Is there a safe dosage?\u003c/strong\u003e \u003cem\u003eJ Orthop Surg Res \u003c/em\u003e2022, \u003cstrong\u003e17\u003c/strong\u003e(1):273.\u003c/li\u003e\n\u003cli\u003eBariteau JT, Kadakia RJ, Traub BC, Viggeswarapu M, Willett NJ: \u003cstrong\u003eImpact of Vancomycin Treatment on Human Mesenchymal Stromal Cells During Osteogenic Differentiation\u003c/strong\u003e. \u003cem\u003eFoot Ankle Int \u003c/em\u003e2018, \u003cstrong\u003e39\u003c/strong\u003e(8):954-959.\u003c/li\u003e\n\u003cli\u003eBooysen E, Sadie-Van Gijsen H, Deane SM, Ferris W, Dicks LMT: \u003cstrong\u003eThe Effect of Vancomycin on the Viability and Osteogenic Potential of Bone-Derived Mesenchymal Stem Cells\u003c/strong\u003e. \u003cem\u003eProbiotics Antimicrob Proteins \u003c/em\u003e2019, \u003cstrong\u003e11\u003c/strong\u003e(3):1009-1014.\u003c/li\u003e\n\u003cli\u003eYang KG, Saris DB, Geuze RE, van Rijen MH, van der Helm YJ, Verbout AJ, Creemers LB, Dhert WJ: \u003cstrong\u003eAltered in vitro chondrogenic properties of chondrocytes harvested from unaffected cartilage in osteoarthritic joints\u003c/strong\u003e. \u003cem\u003eOsteoarthritis Cartilage \u003c/em\u003e2006, \u003cstrong\u003e14\u003c/strong\u003e(6):561-570.\u003c/li\u003e\n\u003cli\u003eEbert R, Weissenberger M, Braun C, Wagenbrenner M, Herrmann M, M\u0026uuml;ller-Deubert S, Krug M, Jakob F, Rudert M: \u003cstrong\u003eImpaired regenerative capacity and senescence-associated secretory phenotype in mesenchymal stromal cells from samples of patients with aseptic joint arthroplasty loosening\u003c/strong\u003e. \u003cem\u003eJournal of orthopaedic research : official publication of the Orthopaedic Research Society \u003c/em\u003e2022, \u003cstrong\u003e40\u003c/strong\u003e(2):513-523.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"tranexamic acid, vancomycin powder, hBMSCs, osteoarthritis, total joint replacements, toxicity, viability","lastPublishedDoi":"10.21203/rs.3.rs-4020647/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4020647/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eIn our current study, we investigated the impact of tranexamic acid (TXA) and vancomycin powder (VP) on osteogenic differentiated human bone-marrow derived mesenchymal stromal cells (hBMSCs) \u003cem\u003ein vitro\u003c/em\u003e. Although topical application of TXA and VP is widely used to prevent post-operative blood loss and perioperative joint infection (PJI) in total joint replacements, the effects of both substances on periarticular tissues are not fully understood.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003ehBMSCs were isolated and multiplied in monolayer cell cultures before osteogenic differentiation was induced for 21 days. ATP assays were used to analyze cell proliferation and Annexin 5 assays were used to analyze cell viability and apoptosis. Expression levels of osteogenic marker genes were measured using semiquantitative RT-PCR.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eCombined treatment with TXA and VP for 96 hours (h) led to significantly decreased cell proliferation rates and decreased cell viability independent of the concentrations used. When using high concentrations of VP (50 mg/mL) this trend was visible after 48 h. In addition, combined treatment with TXA and VP negatively impacted Alizarin Red S staining in a dose-dependent manner.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eTherefore, combined topical application of TXA and VP could be safe when limiting exposure to a maximum of 24 h and using low concentrations. Further \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e research is necessary to fully determine the effects on articular and periarticular tissues.\u003c/p\u003e","manuscriptTitle":"Impact of combined tranexamic acid and vancomycin treatment on osteogenic differentiated human bone marrow-derived mesenchymal stromal cells (hBMSCs) in vitro","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-19 08:30:58","doi":"10.21203/rs.3.rs-4020647/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6775d8cc-d0e7-4f04-989f-14c03d042520","owner":[],"postedDate":"March 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-09-26T07:53:22+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-19 08:30:58","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4020647","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4020647","identity":"rs-4020647","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}