Restricted Feeding Regimens Improve White Striping Associated Muscular Defects In Broiler Chickens | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Restricted Feeding Regimens Improve White Striping Associated Muscular Defects In Broiler Chickens Hammed Ayansola, Xiaoxiao Yu, Jiaqi Lei, Chaoyong Liao, Yuming Guo, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1194475/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Ad libitum (AD) feeding is crucial to profitable commercial broiler chicken production. However, it partly disrupts muscle development, causing myopathies like white striping in broilers’ breast meat. For this reason, this study investigated the impacts of intermittent feeding (IF) and fasting strategies as potential alternatives to AD feeding. A total of 384 one-day-old broilers were randomly allotted into 4 groups - ad libitum , 1h-IF group (4 times/day, 1 hour each time), 1.5h-IF (4 times/day, 1.5hrs each time), and acute fasting (1-day acute fasting, 6-days free access to feed). Feed intake, weight gain, muscle structure, differential genes, and protein expressions were assessed in the broiler breast muscles. Results: IF and fasting significantly reduced ectopic fat deposit and muscle fiber size (p < 0.05). Notably, 1.5h-IF promoted PAX7 + satellite cell proliferation supporting muscle growth and repair activities in fast-growth broiler chickens. Consistently, the restricted regimens downregulated the collagen protein synthesis of skeletal muscle-specific E3 ubiquitin ligases (TRIM63 and MAFBX) in 42 – days old breast muscle samples (p < 0.05), especially in the 1.5h-IF group. Compared to AD-fed birds, 1.5h-IF and fasting feeding significantly decreased white striping scores in the breast meat muscle (p < 0.05). Conclusion Chronic IF or acute fasting improved muscle health of broiler chickens without significant compromise on growth rate and feed efficiency compared to AD feeding. Therefore, this study presents potential feeding frequencies relevant for optimal growth pace while alleviating the occurrence of myopathic pathophysiology in broiler chickens. Animal Science Biotechnology and Bioengineering intermittent feeding meat physiology broiler chickens white striping muscle myopathy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1.0 Introduction Ad libitum (AD) feed consumption exacerbates metabolic perturbations in broiler chickens ( 1 ). For example, excess energy consumed by broilers during unrestricted access to feed is converted into visceral and ectopic fats, which are harmful to health and meat quality ( 2 , 3 ). As a result, researchers are currently considering alternative feeding strategies to alleviate meat defects in commercial broiler chicken production ( 4 , 5 ). Therefore, it is pertinent to investigate effective feeding strategies that can optimize the lean meat qualities of broiler chickens. Meat quality characteristics are a major concern for consumers of broiler’s carcass. Previous findings revealed that increased growth rate, as seen in AD-fed birds, results in higher degrees of meat myopathies ( 6 – 9 ). Specifically, in past studies, muscular myopathies arise from lipidosis and collagen accretion, purportedly linked with AD feeding ( 10 , 11 ). In support of this assumption, findings revealed that breast muscle myopathies, including white striping (WS) and wooden breast (WB) ( 4 , 8 ), occur due to muscle hypertrophy resulting from the fast growth in birds with unstrained access to feeds ( 12 ). This voluntary feed consumption leads to excess ectopic fat deposit and enlarged muscle fiber sizes that disrupt muscular compositions and decrease vascular density in the breast muscle region ( 13 ). Notably, these muscular defects contribute to the etiologies of WS-affected broiler’s meat quality ( 14 , 15 ). To solve growth-related muscular myodegeneration, Velleman and colleagues altered the timing of feeding to elucidate the fate of fat deposit and adipogenic transcription factors expression in pectoralis major muscle ( 3 ). Their result revealed that 20% feed restriction during week 2 eliminated excess fat deposit, and they concluded that appropriate feed restriction strategies could positively improve the ratio of fat to lean meat and expression of adipogenic genes. To date, there are limited studies that have investigated the intermittent feeding strategies effects on meat quality features of broiler chickens. This is based on the assumption that restricted feeding will reduce growth performance which is the primary goal of broiler producers. However, Fondevilla et al. ( 16 ) reported that broilers restricted from eating for less than 6 hours per day showed similar body weight gain compared with those birds fed ad libitum. Likewise, Fargly et al. ( 17 ) previously demonstrated that 4 hours of intermittent feeding does not decrease broiler growth performance at the end of the experimental study. The prominent argument for these results is that broilers are likely to adapt quickly during restricted feeding regimens over a prolonged period, thereby attaining full compensatory growth performance ( 16 ). In addition to improved metabolic activities, we could deduce that intermittent feeding might produce similar growth performances like AD feeding in broiler chickens if designed appropriately. Therefore, the current study investigated the impacts of intermittent feeding frequencies and acute fasting on broiler’s breast muscle physiology, focusing on histomorphology, muscle growth and differentiation markers, and protein expression related to muscular defects. The findings in the current study provide relevant information to poultry farmers, meat scientists, and potential consumers about the benefits of alternative feeding strategies on the muscular health of broiler chickens. 2.0 Materials And Methods 2.1 Experimental Design and management The research was conducted at the poultry Unit, Zhuozhou research center, China Agricultural University. All experimental procedures followed the guidelines approved by the China Agricultural University Laboratory animal welfare and experimental ethical committee. For this research, a total of 384 1-day male old chicks were brooded and acclimatized for eight days. The chicks were raised in a controlled environment with 24 hrs light supply, and the room temperature was periodically adjusted to ensure optimum room temperature for brooding purposes. During this period, ad libitum feed and clean water were supplied 24 hours a day. The birds were randomly distributed using a completely randomized experimental design into four groups with eight replicates that contained 12 birds each as ad libitum (AD), 1h-IF, 1.5h-IF, and fasting groups, respectively. During the experiment periods, AD feeding served as the control diet, while alternative feeding techniques comprised (1h-IF) intermittent 1-hour, (1.5h-IF) intermittent 1-hour 30 min, and 6:1-day fasting schedules (skip a day fasting). The 1h-IF and 1.5h-IF groups were subjected to 4 times daily intermittent feeding schedules as follow: 07.00-08.00, 12.30-13.30, 17.30-18.30, 22.30 until the light was switched off at 00.00 midnight, and 07.00-08.30, 12.30-14.00, 17.30-19.00, 22.30 until the light was switched off at 00.00 respectively. All birds were fed a standard commercial diet throughout the experiment based on the National Research Council (NRC) recommendations for broiler chickens (Table 1 ). The data recorded during the rearing period include daily and weekly growth performance data such as daily feed intake, weekly feed intake, body weight, and weight gain, and feed conversion rate for all groups. Table 1 Composition of Experimental diets and nutrient contents INGREDIENTS g/100g day 1 – 21 day 22 – 42 Corn 57.50 60.00 Wheat offal 1.00 0.0 Soybean meal 33.21 27.85 Cottonseed meal 2.00 2.50 Corn gluten meal 0.00 2.00 Soybean oil 2.00 4.0 Methionine 0.27 0.18 Lysine 0.50 0.28 98.5 L-Threonine 0.20 0.07 Calcium Hydrogen Phosphate 1.40 1.10 Limestone 1.20 1.30 50% Choline 0.10 0.10 Vitamin premix * 0.05 0.05 Mineral supplement ** 0.20 0.20 Salt 0.30 0.30 Phytase 0.02 0.02 Santoquin 0.03 0.03 Antioxidant 0.02 0.02 Total 100 100 Nutrient content Energy AME (Mcal/kg) 2.88 3.04 Crude protein (%) 20.11 18.99 Lysine (%) 1.48 1.19 Methionine (%) 0.58 0.48 Ca (%) 0.89 0.84 Available Phosphorus (%) 0.39 0.33 The following supplements are included/kg in diet: *Vitamin premix provides following per kg diet: Vit. A, 9500 IU; Vit. D3, 62.5 ug; Vit. E, 30 IU; Vit. K3, 2.65 mg; Vit. B1, 2 mg; Vit B6, 2 mg; Vit. B12, 0.025 mg; Biotin, 0.0325 mg; Folic Acid, 1.25 mg; Pantothenic Acid, 12 mg; Nicotinic Acid, 50 mg. ** Mineral premix - Cu, 8 mg (CuSO 4 ·5H 2 O); Fe, 80 mg (FeSO 4 ); Mn, 100 mg (MnSO 4 · H 2 O); Se, 0.15 mg (Na 2 SeO 3 ); I, 0.35 mg (KI). The feeds were formulated based on the recommendation by the NRC (1994) 2.2 Sample collections Before tissue sample collections, two birds per replicates were fasted overnight, selected based on average body weight from each cage, tagged, and weighed individually. On days 21 and 42, the selected birds fasted overnight were slaughtered for sample collection, including blood, leg muscle, thymus, gizzard, glandular stomach, spleen, bursa of fabricus, abdominal fat, and breast muscles. The samples were frozen with liquid nitrogen and stored at -80 0 C for real-time PCR assay or in 4% paraffin solution for histomorphometry indices used for further experimental analysis. In addition, on day 42, we took images of sampled broiler breast fillets for further visual white striping scoring in accordance to Kuttappan et al. ( 6 ) with adjustments such that the grading scale adopted here represented normal (0-1), mild ( 2 – 3 ), moderate ( 3 – 4 ), and severe scores ( 5 ). 2.3 RNA extraction and Real-Time quantitative PCR According to (Invitrogen Life Technologies, Carlsbad, CA, USA) protocol, the tissue samples stored in -80 0 C were homogenized for total mRNA isolation in Trizol reagent; subsequently, the mRNA concentration and quality were measured with a Nano-300 spectrophotometer. The total mRNA (~1000 ng) was reverse transcribed using the Beyotime biotechnology cDNA synthesis kit. Finally, the MyIQ2 real-time PCR machine was carried out using SYBR – Green Supermix from Beyotime using GAPDH as the reference gene. The relative expressions of the targeted genes were calculated in fold changes to the AD group ( 18 ), while the gene primer sequences designed with Primer-BLAST are provided in Table 2 . Table 2 List of primer sequences for quantitative real-time PCR Gene names Primer ID Primer Sequence (5’ – 3’) MYOD NM_204214.2 F : CACGGAATCACCAAATGACCCA R : GCAGTTGGTGGGGGAAGGAAT MYF5 NM_204184.1 F : CTCCGATGTGATGGCGGACT R : TCCACGATGCTGGAGAGGCA MYOG NM_204184.1 F : ACCACAACCTGCTGCACCCA R : TCCACGATGGAGGAGAGCGA PAX7 NM_205065.1 F : TCAGCTACCGGACACGAGAGA R : GGGTGGACACTTCCAAAGGGA HIF-A NM_204297.1 F : ACCAGCAGTTCCTCATGCAATA R : CATCTTTGGCCGGCGGTAGT EGF NM_001001292.1 F : CCCGTTGCTTTCTTGCCAGT R : GGAATGGTGCAGGGTCATTTACG VEGFR-1 NM_204252.1 F : TTTTCCTTGGGCGCCTCTCC R : CTTGCCTTCCTGTTGCACGC IL1B NM_204524.1 F : TGCCTGCAGAAGAAGCCTCG R : TCGAAGGACTGTGAGCGGGT IL18 NM_204608.1 F : ATGAGCTGGAATGCGATGCCT R : TGAAGGCGCGGTGGTTTTGT IL6 NM_204628.1 F : GCTGCAGGACGAGATGTGCAA R : TCTGAAAGGCGAACAGGCCG FABP4 NM_204290.1 F : ATATGAAAGAGCTGGGTGTGGGG R : CTGCTTCAGTGTGCCACTGTCT CEBPα NM_001031459.1 F : TCGGCGACATCTGCGAGAAC R : CGTGCATGCCGTGGAAATCG CEBPβ NM_205253.2 F : CAGTAGCGGCGGCCAAGATT R : TCTCGAAGACCGGCTCCACT ZNF423 XM_025154318.1 F : GACAGCAGTGCTCCCAAGTGT R : CTCCCAGGCCACCTGATTGA PDGFR-α NM_204749.2 F : GCGCGTTATAAAGGAGGAGCTGT R : GGCCACTGTTGTTCTCCTCGT PPAR-γ XM_015292931.2 F : AGGGAACAGTTTCTCCGGCTG R : GCTCCATTTTGATTGCACTTTGGC GAPDH NM_204305.1 F : TGACGTGCAGCAGGAACACTA R : GCGGCCAATACGGCCAAATC 2.3 Histomorphology and Immunohistochemistry The fixated breast muscles were subsequently embedded in paraffin wax, cut at 5µm using Leica microtome, then mounted on slides. Next, the mounted tissue slides were dewaxed, dehydrated, stained with Hematoxylin and Eosin for H&E staining (histology composition and structure image) ( 19 ) or in Picrosirius red solution for collagen fiber evaluations ( 20 ), then dehydrated, and cleared in xylene and subsequently quantified using ImageJ software. Immunohistochemistry staining was used for PAX7 + density in the breast muscle tissues ( 21 ). Briefly, after deparaffinization, sectioned tissues were blocked in 10% goat serum in TBST containing 0.5% Triton X-100. The blocked tissues were incubated overnight at 4 0 C with anti-PAX7 + antibody (1:40, Developmental Studies Hybridoma Banks) and subsequently counterstained with corresponding secondary antibody for 1hr at room temperature. Finally, sections were mounted in a fluoroshield mounting medium with DAPI (Cat No: C1002, Beyotime Biotechnology, China), then immediately viewed using an EVOS enabled fluorescence microscope (ECHO model: RVL-100-G). 2.4 Triglyceride assay The triglyceride ( 18 ) content levels in the frozen breast samples were used as a marker to measure ectopic fat deposits in the chicken breast using the Folch extraction method ( 22 ). In summary, the breast muscle tissue samples (~ 50 mg) were homogenized in 2:1 chloroform: methanol solution, centrifuged at 7,000 rpm, 4 0 C for 10 min, washed in 0.9% NaCl solution, then centrifuged again at low speed (2000 rpm) to separate into 2 phases – upper salt and methanol layer, while the lower phase contains the chloroform. The chloroform layer containing the lipid content was freeze-dried, resuspended in ACS-graded 2-propanol, followed by absorbance reading at 540 nm using Dongou TG reagent kit (Cat No: A0-10017). 2.5 Protein expression using the Western blotting technique The protein content in the breast muscle was quantified according to western blot protocol. Briefly, the protein was digested using a lysis buffer containing RIPA, protease, and phosphatase inhibitors. The extracted protein lysate was separated by 10% SDS page and electroporated onto the nitrocellulose membrane. This is followed by blocking in 5% Milkfat: TBST solution for an hour and subsequently incubated in primary antibodies at 4°C overnight, including β-TUBULIN (Cat No: AF1216), NF-KB (AF5243), and CASPASE-3 (Cat No: AC030-1), purchased from Beyotime Biotechnology, while TRIM63 (Cat No: A3101), and FBXO32 (Cat No: A3193) were purchased from ABclonal Biotechnology. The membrane was washed with TBST buffer (137 mM Sodium chloride, 2.7 mM Potassium chloride, 50 mM Tris-HCl, and 0.1% Tween 20) before being incubated with HRP-labeled secondary antibody (1:5000, Shanghai Beyotime, Shanghai, China). The blotting bands were developed using a Super Enhanced Chemiluminescence (Shanghai Beyotime, Shanghai, China) and quantified using ImageJ software (NIH, USA). 2.6 Statistical Analysis The data using one – way ANOVA tool of SPSS v20.0 software are presented as means and standard error of the mean. Duncan’s test compared the statistical differences among individual means at p < 0.05 as the significance level. The graphical representations were designed with GraphPad Prism 8.0.2 software package. 3.0 Results 3.1 Intermittent feeding and fasting reduced white striping of chicken breast without affecting growth performance Unsurprisingly, intermittent and fasting groups significantly decreased the average daily feed intake consumed during weeks 2 – 5 compared to the ad libitum (AD) group (Table 3 , p 0.05) or feed conversion ratio (Table 4 , p > 0.05) of birds when compared to the AD feeding. Overall, the data revealed that the alternative feeding strategies had statistically similar effects on growth and weight gain on broiler chickens. Table 3 Effects of intermittent feedings and fasting on feed intake levels in broiler chickens (g/b/d) Ad libitum 1Hour 1.5Hour Fasting SEM p-value week 1 20.32 19.68 20.12 20.19 0.26 0.843 week 2 52.66 a 45.22 b 45.14 b 51.49 a 0.82 <0.001 week 3 79.35 a 74.19 b 75.04 b 73.34 b 0.78 0.028 week 4 124.75 a 112.56 b 110.18 b 111.04 b 1.46 <0.001 Week 5 158.70 a 149.63 b 149.02 b 138.68 c 1.89 0.001 Week 6 159.15 146.33 152.19 150.14 2.27 0.231 Means in the same row with different superscript letters differ significantly (p < 0.05, n = 8, mean ± SEM; g/b/d – gram/bird/day). Table 4 Feed conversation ratio of broiler chickens fed different feeding strategies Ad libitum 1Hour 1.5Hour Fasting SEM p-value Week 1 1.24 1.19 1.22 1.25 0..02 0.444 Week 2 1.26 1.20 1.17 1.24 0..01 0.134 Week 3 1.68 1.72 1.76 1.80 0.03 0.577 Week 4 1.43 1.34 1.30 1.45 0.03 0.137 Week 5 1.64 1.62 1.76 1.63 0.04 0.628 Week 6 1.70 1.82 1.78 1.89 0.20 0.299 Means in the same row with different superscript letters differ significantly (p < 0.05, n = 8, mean ± SEM) Foremost, no differences were observed in the weight of tissues or organs, including leg muscle, thymus, gizzard, glandular stomach, spleen, and bursa of fabricus at 21 or 42 days old (Table 5 , p > 0.05). However, 1h-IF and fasting significantly reduced abdominal fat of 21-days old birds (Table 5 , p < 0.05). While the breast muscle mass of 1h-IF, 1.5h-IF, and fasting birds was smaller than that of the AD birds on day 21 (Figure 1 C, p 0.05). Using phenotypic scoring metrics for white striping (WS), only I.5-h IF and fasting significantly reduced the WS appearance on the breast muscle fillets (Figure 1 E and F, p 0.05). Table 5 Intermittent feeding and fasting effects on carcass and organs of broiler chickens 21 days (g/kg) Ad libitum 1Hour 1.5Hour Fasting SEM p-value leg muscle 67.48 74.94 68.78 68.22 1.30 0.169 thymus 1.20 1.13 1.18 1.12 0.05 0.938 gizzard 15.91 15.63 14.61 16.07 0.28 0.266 glandular stomach 5.07 4.36 4.67 4.87 0.13 0.219 abdominal fat 10.10 a 7.08 c 10.47 a 7.64 bc 0.49 0.017 spleen 1.70 1.40 1.49 1.23 0.08 0.170 bursa of fabricus 1.11 1.15 1.13 0.99 0.05 0.747 42 days (g/kg) leg muscle 72.61 71.42 69.30 73.53 1.69 0.858 thymus 1.27 1.48 1.36 1.37 0.06 0.643 spleen 1.06 1.24 1.23 1.20 0.05 0.453 gizzard 10.27 11.04 9.99 9.44 0.25 0.152 abdominal fat 14.07 12.73 10.38 11.52 0.60 0.141 glandular stomach 3.32 3.84 3.08 3.76 0.14 0.183 bursa of fabricus 0.45 0.49 0.48 0.42 0.02 0.726 Means in the same rows with different superscript letters differ significantly – p < 0.05 mean ± SEM 3.2 Intermittent feeding and fasting effect on broiler chickens muscle development and growth To understand the effect of the feeding regimens on muscle structure, the H&E staining and frequency distribution data revealed that the breast muscle samples from the AD group had the largest fiber diameter size than the rest of the trial feeding strategies (Figure 2 A - C). Specifically, 1.5h-IF significantly decreased the percentage frequency distribution of larger fiber sizes compared to the AD group (Figure 2 B and C, p < 0.05). Thus, the alternative feedings could reduce breast muscular hypertrophy in broiler chickens. Subsequently, expressions of myogenic marker genes suggest that the 1.5h-IF strategy promotes higher myogenic capacity in broiler breast muscle. The quantifications of qPCR differential expressions data (Figure 2 D), including MYOD, MYF5, MYOG, HIF-1a, EGF , and VEGFR-1 , showed that 1.5h-IF-strategy significantly upregulated MYF5 and MYOD genes compared to the ad libitum group in the day 21 breast muscle samples. Similarly, angiogenic markers in the breast muscle showed that both HIF1A and VEGFR-1 genes were significantly upregulated by intermittent feeding in the 1.5hour group (p < 0.05), while only the EGF gene recorded no significant differences on day 21 across the group. In contrast, no significant differences in the myo-genes expressed on day 42 in the breast muscle samples (Figure 2 E, p > 0.05). However, by using immunohistochemistry staining for day 42 breast muscle samples, the result revealed that 1.5h-IF increased PAX7 + satellite cells, demonstrating improved myogenesis rather than hypertrophic muscles observed in the AD group (Figure 3 A and B, p < 0.05). 3.3 Intermittent feeding mitigated ectopic fat deposit in breast muscle of broiler chickens Most significantly, the effects of intermittent feeding on TG as an indicator of lipid fractions in the breast muscle are shown in Figure 4 A. The data revealed that AD feeding significantly increased TG concentration than intermittent and fasting feeding strategies in the pectoralis major region (Figure 4 A, p < 0.05). The breast muscle samples of 1.5h-IF had the lowest TG concentration (mg/g). As presented further in Figure 4 B, it was observed that lipid metabolism marker genes, including FABP4, C/EBP-A, C/EBP-B , are not differentially expressed in 42-day old breast muscle samples (p > 0.05). Also, only ZNF423 and PDGFR-A involved adipogenesis were significantly downregulated in the 42-day old breast muscle samples of both 1h-IF and fasting birds (Figure 4 B, p < 0.05). 3.4 Intermittent feeding and fasting alleviated muscle degradation and myofibrosis As a result of the overwhelming fast growth in broiler chickens, there is a tendency for the poor repair of tissue damages, leading to cell death. The histomorphological area covered by collagen using picrosirius red staining data showed that both chronic intermittent feeding and fasting strategies alleviated collagen accretion compared to AD feeding (Figure 5 A and B, p < 0.05). To validate the collagen staining data, the western blot protein fold changes depicted that fibrotic-related protein markers, including TRIM63 and MAFBX, were significantly decreased in the 42-day old breast muscle samples of 1h-IF, 1.5h-IF, and fasting group (Figure 5 C-F, p < 0.05). Also, an elevated CASPASE 3 synthesis – a protein marker for apoptosis – indicates protein degradation activities in AD-fed birds, while significantly suppressed by fasting and slightly decreased by IF regimens (Figure 5 G, p < 0.05). As such, the current data demonstrate that the alternative feeding strategies significantly reduced collagen fiber accretion in breast muscle, thereby improving the meat fillet qualities of broiler chickens. 4.0 Discussion Feed restriction strategies are common management practices in broiler breeders ( 4 ), but there are variations in their effects in broiler chicken productions ( 4 , 16 , 23 ). On this account, the current study clarifies the discrepancies of intermittent feeding effects on broiler chickens for commercial production purposes. Specifically, this study explores the impacts of intermittent feedings and fasting strategies on broiler chickens’ growth indices, histological and molecular mechanisms linked with WS phenotype in breast muscle meats. The feed intake data obtained in the current study are consistent with previous research suggesting that restricted feeding may suppress feed consumption levels in broiler chickens ( 24 , 25 ). Despite the reduced feed intake observed in our study, the alternative feeding strategies did not impair growth indices. During the feed restriction period, birds could easily adjust to changes in feeding patterns by temporarily storing feeds in the crop and subsequently prolonging digestion in the proximal region of the intestine ( 26 , 27 ). These results could be attributed to an adaptive mechanism deployed over time by birds fed the alternative feeding strategies, which show improved performance than Velele ( 23 ) study that reported stunted growth in restricted fed broilers. Previous findings have also suggested the possibility of compensatory growth rate reprogramming during restricted feeding strategies in broilers production over a long period ( 28 – 30 ). Consistently, our results further reveal that intermittent feedings did not significantly decrease the breast meat yield at the market age, i.e., 42 days of age, even though the AD feeding had the highest weight for breast meat. This observation, in fact, corresponds with the final body weight across the groups and also aligns with Jahanpour et al. ( 31 ) that previously suggested that up to 75% of restricted feed regimens had a neutral or non-detrimental effect on broiler’s breast meat yield. More importantly, consumers are concerned about breast meat quality, accounting for more than 67% of broiler carcass parts. Thus, the current study focuses on the impacts of chronic IF on breast meat quality related to the WS-associated myodegeneration ( 32 , 33 ). Enlarged breast muscle fiber size, one of the precursors of WS development, has previously been linked with meat hardness and muscular defects such as fibrosis ( 34 , 35 ). Several researchers agree with this proposition as observed in the AD group ( 36 , 37 ). On this premise, this study shows that 1.5h-IF reduced the fiber diameter in the breast muscle region, which aligns with the meat quality criterion for improved meat tenderness. The idea has been that enlarged fiber size predisposes the breast muscle region to poor vascularization and lipidosis, consequently leading to metabolic disorders that characterize severe hypertrophic muscle in broiler pectoralis major ( 14 ). The reduced muscle fiber diameter in the 1.5h-IF group could promote vascular tone and ensure proper muscular development by increasing interstitial space for vascular tissues without significantly affecting relative breast weight in broiler chickens ( 38 , 39 ). Larger fiber sizes attributed to AD feeding predispose muscles to myodegeneration ( 32 , 33 ). In the current study, the molecular analysis further supports the beneficial effects of intermittent feeding on meat quality compared to AD feeding. The analyses elucidated their roles on myogenic regulatory factors and inflammatory cytokines. The gene expression data revealed no significant differences among all the feeding strategies. These results suggest that chronic intermittent feeding had a similar regulatory effect on myogenic markers such as MYF5, MYOD , and PAX7 gene expressions ( 40 ). Both MYF5 and MYOD are involved in muscular cell growth and development ( 41 ), whereas PAX7 , a skeletal muscle satellite cell, supports continuous cell proliferation for protein turnover in the pectoralis major region ( 42 , 43 ). As revealed by the immunohistochemistry staining, PAX7 + proliferation density was significantly compromised by AD feeding. With this data, we could extrapolate that decreased PAX7 + density resulted in poor muscular differentiation and repair activities during the later phase of AD birds that caused hypertrophic muscle defects ( 41 , 44 ). From the histology standpoint, IF might contribute to normal muscle growth essential for optimal muscular cell proliferation, maintenance, and repair during broiler production. Moreover, the myogenic markers examined in this research prove that, despite the lower feeding rate, chronic IF strategies had comparable effects on myogenesis ( 45 ). To understand the effects on fat deposits, lipid metabolic markers were examined in the breast muscle samples. As reported by Papah et al. ( 46 ), functional analysis revealed that lipid metabolism-related genes are elevated in the myopathic tissues of broiler chickens. Though the lipid uptake and transport-related genes, including PABP4, C/REP-A , and C/REP-B , were not significantly altered in the current study. However, the relative upregulations of the adiposis-related genes ( ZNF423 and PDGFR-A ) in AD birds compared to 1h-IF and fasting birds align with a previous whole-genome sequencing that reported a potential higher degree of intermuscular fat in the pectoralis major samples of fast growth broiler chickens ( 47 ). ZNF423 and PDGFR-A gene expressions increased pre-adipocyte cells, contributing to muscular adiposity development during muscular disruption as detected in the current study ( 27 , 48 , 49 ). Consistently, the results here also reveal that both chronic intermittent feedings and fasting feeding decreased the TG level – a metabolic indicator of ectopic fat deposit in the breast muscle samples. The excess TG accumulation could exacerbate lipotoxicity in the breast muscle, which is composed mainly of Type IIB non-oxidative muscle ( 46 , 50 ). From the intramuscular energy supply standpoint, decreased intramuscular TG levels in IF and fasting birds were likely mobilized to provide energy for muscular activities during the restricted feeding period ( 51 ). Note, excess TG accumulation causes lipid peroxidation in meat fillets leading to oxidative stress ( 52 ) in relation to the etiology of myopathic lesion development ( 11 , 53 , 54 ). These observations, therefore, corroborate lipid-laden perturbation in WS and WB-affected muscle during severe conditions ( 55 ). In light of this understanding, we suggest that the IF regimens used in the current study could alleviate lipid spoilage in broiler breast meat. Besides, collagen accretion in the breast muscle indicates poor cell repair activities that cannot sustain the fast growth rate associated with AD feeding. Interestingly, our results show that IF and fasting feeding significantly decreased TRIM63 and MAFBX protein expressions. These atrophic proteins are responsible for muscular degradation, causing tissue fibrosis and muscle wasting during chronic muscular stress related to hypertrophy in fast-growing broiler chickens ( 48 , 53 ). Moreover, birds fed restricted feeding regimens showed lower apoptotic activities, demonstrating relieved muscular repair processes. It is likely that the higher muscle protein breakdown in the AD group triggers the increased abundance of CASPASE 3, which might aggravate muscular damage in severe conditions, as reported in a previous study that provided evidence of apoptotic liver damage of birds affected by WB myopathy ( 56 ). This means that the enhanced protein degradations in the AD group profoundly contribute to higher collagen aggregate than alternative feeding regimens. Within this context, we could infer that intermittent feeding and fasting improves muscle growth and repair processes in the pectoralis major of broiler chickens ( 53 , 57 ). This proposition agrees with previous findings that demonstrated timing schedules alleviate collagen modifications and fibrotic myopathy affecting abnormal breast muscles ( 35 , 58 , 59 ). Although 1h-IF had an insignificant effect on the WS scoring in the current study, both 1.5h-IF and fasting strategies alleviated the WS appearance significantly compared to AD feeding. As generally believed, the fast growth rate is potentially recognized as the fundamental cause of WS ( 8 , 53 ). In the past, feeding strategies such as lowering energy in diets ( 6 ), 85% ad libitum feed restriction ( 60 ), and 8 hours daily feed restrictions ( 61 ) have alleviated WS phenotype at the end of the studies ( 62 ). These previous findings further support why the alternative feeding strategies investigated in this study could produce breast meat fillets with improved muscular conditions. To sum it all, when applied appropriately, chronic IF could potentially solve myopathies associated with fast growth muscle hypertrophy in the future. Conclusion The current study demonstrates that ad libitum feeding has greater detrimental effects on breast meat quality because it partly contributes to higher ectopic fat deposit and exacerbates fibrotic tissue development, potentially leading to WS myodegeneration in the pectoralis major of fast growth broiler chickens. Contrarily, the chronic intermittent feeding strategies, especially the 1.5h-IF, could serve as an alternative feeding approach to AD feeding when breast meats with less ectopic fat and softer steak are considered. Although AD had numerically higher weight gain values, the 1.5-hour IF strategy had statistically similar feed efficiency, final body weight, and relative breast muscle carcass cut at a decreased feed consumption rate. For these reasons, this study suggests that the 1.5h-IF could alleviate production concerns, particularly broiler’s meat quality caused by AD feeding in broiler chickens. Hence, the results presented here would serve as a reference for future researches. Accordingly, further studies should explore the modulatory effect of 1.5h-IF with or without slight changes in nutritional diets fed to the chickens. In line with these propositions, subsequent researches should focus on elucidating the 1.5hour intermittent feeding effects at the metabolomic and proteomic levels for in-depth knowledge. Abbreviations AD: Ad libitum WS: White striping WB: Wooden breast IF: Intermittent feeding TG: Triglycerides Declarations Ethics approval and consent to participate All experimental procedures, including animal management, housing, slaughtering, and laboratory analysis, followed the guidelines approved by the China Agricultural University Laboratory animal welfare and experimental ethical committee. Consent for publication Not applicable Availability of data and materials All data supporting our findings are included in the manuscript. Competing interests The authors declare that there are no conflicts of interest. Funding This research study was financially supported by the National Key R&D Program of China and (2018YFE0127300) and the Young Talent Supporting Program Funding of the College of Animal Science and Technology, China Agricultural University Education Foundation Grant (2017DKA002). The funders had no roles in the study design, data collection, and analysis. Author contributions Hammed Ayansola and Wang Bo conceptualized the study idea and experimental design. Hammed Ayansola and Jiaqi Lei conducted the animal experiment. Hammed Ayansola, Xiaoxiao Yu, and Wang Bo carried out molecular experiments. Hammed Ayansola and Wang Bo analyzed the result data. Hammed Ayansola and Wang Bo prepared the flow and structure of the figures. Hammed Ayansola wrote the original draft. Chaoyong Liao, Yuming Guo, Bingkun Zhang, and Wang Bo commented and revised the draft. Wang Bo and Bingkun Zhang provided the research funding. Wang Bo supervised the project, edited and proofread the final draft. All authors made significant contributions to the work, read and approved the final version of the manuscript. Acknowledgment The authors wish to appreciate the support from the National Key R&D Program of China and the Young Talent Supporting Program Funding of the College of Animal Science and Technology, China Agricultural University Education Foundation Grant. Authors’ information a State Key Laboratory of Animal Nutrition, Department of Animal Nutrition and Feed Science, College of Animal Science and Technology, China Agricultural University, Beijing, 100193, China References Khurshid A, Khan AA, Banday MT, Ganai AM, Khan HM, Choudhary AR, et al. Effect of feed restriction on performance of broiler chicken. J Entomol Zool Stud. 2019;7:1054–6. Mir NA, Rafiq A, Kumar F, Singh V, Shukla V. Determinants of broiler chicken meat quality and factors affecting them: a review. J Food Sci Technol. 2017;54(10):2997–3009. Velleman SG, Coy CS, Emmerson DA. Effect of the timing of posthatch feed restrictions on the deposition of fat during broiler breast muscle development. Poult Sci. 2014;93(10):2622–7. Arrazola A, Mosco E, Widowski TM, Guerin MT, Kiarie EG, Torrey S. The effect of alternative feeding strategies for broiler breeder pullets: 1. Welfare and performance during rearing. Poultry science. 2019;98(9):3377–90. Tallentire CW, Leinonen I, Kyriazakis I. Artificial selection for improved energy efficiency is reaching its limits in broiler chickens. Sci Rep. 2018;8(1):1168. Kuttappan V, Brewer V, Apple J, Waldroup P, Owens C. Influence of growth rate on the occurrence of white striping in broiler breast fillets. Poult Sci. 2012;91(10):2677–85. Lake JA, Dekkers JCM, Abasht B. Genetic basis and identification of candidate genes for wooden breast and white striping in commercial broiler chickens. Sci Rep. 2021;11(1):1–13. Bordini M, Zappaterra M, Soglia F, Petracci M, Davoli R. Weighted gene co-expression network analysis identifies molecular pathways and hub genes involved in broiler White Striping and Wooden Breast myopathies. Sci Rep. 2021;11(1):1776. Prisco F, De Biase D, Piegari G, d’Aquino I, Lama A, Comella F, et al. Pathologic characterization of white striping myopathy in broiler chickens. Poult Sci. 2021;100(7):101150. Petracci M, Mudalal S, Bonfiglio A, Cavani C. Occurrence of white striping under commercial conditions and its impact on breast meat quality in broiler chickens. Poult Sci. 2013;92(6):1670–5. Dalle Zotte A, Tasoniero G, Puolanne E, Remignon H, Cecchinato M, Catelli E, et al. Effect of “Wooden Breast” appearance on poultry meat quality, histological traits, and lesions characterization. Czech Journal of Animal Science. 2017;62(2):51–7. Petracci M, Mudalal S, Soglia F, Cavani C. Meat quality in fast-growing broiler chickens. World’s Poultry Science Journal. 2015;71(2):363–74. Mazzoni M, Petracci M, Meluzzi A, Cavani C, Clavenzani P, Sirri F. Relationship between pectoralis major muscle histology and quality traits of chicken meat. Poult Sci. 2015;94(1):123–30. Ayansola H, Liao C, Dong Y, Yu X, Zhang B, Wang B. Prospect of early vascular tone and satellite cell modulations on white striping muscle myopathy. Poult Sci. 2021;100(3):100945. Sihvo HK, Immonen K, Puolanne E. Myodegeneration with fibrosis and regeneration in the pectoralis major muscle of broilers. Vet Pathol. 2014;51(3):619–23. Fondevila G, Archs JL, Camara L, de Juan AF, Mateos GG. The length of the feed restriction period affects eating behavior, growth performance, and the development of the proximal part of the gastrointestinal tract of young broilers. Poult Sci. 2020;99(2):1010–8. Farghly MF, Mahrose KM, Ahmad EAM, Rehman ZU, Yu S. Implementation of different feeding regimes and flashing light in broiler chicks. Poult Sci. 2019;98(5):2034–42. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. He Y, Yang Y, Dong Y, Yan C, Zhang B. The Effects of Flavomycin and Colistin Sulfate Pre-Treatment on Ileal Bacterial Community Composition, the Response to Salmonella typhimurium and Host Gene Expression in Broiler Chickens. Microorganisms. 2019;7(11):574. Sanden KW, Böcker U, Ofstad R, Pedersen ME, Høst V, Afseth NK, et al. Characterization of Collagen Structure in Normal, Wooden Breast and Spaghetti Meat Chicken Fillets by FTIR Microspectroscopy and Histology. 2021;10(3):548. Bandín S, Morona R, López JM, Moreno N, González A. Immunohistochemical analysis of Pax6 and Pax7 expression in the CNS of adult Xenopus laevis. J Chem Neuroanat. 2014;57-58:24–41. Folch J, Lees M, Sloane Stanley GH. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem. 1957;226(1):497–509. Velele S. The effect of quantitative feed restriction on growth performance, carcass characteristics. Alice: University of Forte Hare; 2017. Dissanayake D, David L. Effects of quantitative feed restriction on the performance of broiler chickens. 2017. van der Klein SA, Silva FA, Kwakkel RP, Zuidhof MJ. The effect of quantitative feed restriction on allometric growth in broilers. Poult Sci. 2017;96(1):118–26. Azis A, Berliana B, Afriani A. Effects of feeding time restriction during the whole rearing period on the growth performance of broiler chickens. International Journal of Poultry Science. 2019;18(1):14–20. Svihus B, Lund VB, Borjgen B, Bedford MR, Bakken M. Effect of intermittent feeding, structural components and phytase on performance and behaviour of broiler chickens. Br Poult Sci. 2013;54(2):222–30. Benyi K, Acheampong-Boateng O, Norris D, Ligaraba TJ. Response of Ross 308 and Hubbard broiler chickens to feed removal for different durations during the day. Trop Anim Health Prod. 2010;42(7):1421–6. Ghazanfari S, Kermanshahi H, Nassiry MR, Golian A, Moussavi ARH, Salehi A. Effect of feed restriction and different energy and protein levels of the diet on growth performance and growth hormone in broiler chickens. Journal of Biological Sciences. 2010;10(1):25–30. Khetani TL, Nkukwana TT, Chimonyo M, Muchenje V. Effect of quantitative feed restriction on broiler performance. Trop Anim Health Prod. 2009;41(3):379–84. Jahanpour H, Seidavi A, Qotbi AAA, Van Den Hoven R, Rocha e Silva S, Laudadio V, et al. Effects of the level and duration of feeding restriction on carcass components of broilers. Archives Animal Breeding. 2015;58(1):99–105. Livingston M, Ferket P, Brake J, Livingston K. Dietary amino acids under hypoxic conditions exacerbates muscle myopathies including wooden breast and white stripping. Poultry science. 2018;98(3):1517–27. Mudalal S, Lorenzi M, Soglia F, Cavani C, Petracci M. Implications of white striping and wooden breast abnormalities on quality traits of raw and marinated chicken meat. Animal. 2015;9(4):728–34. Ismail I, Joo ST. Poultry Meat Quality in Relation to Muscle Growth and Muscle Fiber Characteristics. Korean J Food Sci Anim Resour. 2017;37(6):873–83. Velleman SG. Pectoralis Major (Breast) Muscle Extracellular Matrix Fibrillar Collagen Modifications Associated With the Wooden Breast Fibrotic Myopathy in Broilers. Front Physiol. 2020;11:461. Dransfield E, Sosnicki A. Relationship between muscle growth and poultry meat quality. Poultry science. 1999;78(5):743–6. Huang X, Ahn DU. The Incidence of Muscle Abnormalities in Broiler Breast Meat - A Review. Korean J Food Sci Anim Resour. 2018;38(5):835–50. Kawasaki T, Iwasaki T, Yamada M, Yoshida T, Watanabe T. Rapid growth rate results in remarkably hardened breast in broilers during the middle stage of rearing: A biochemical and histopathological study. PLoS One. 2018;13(2):e0193307. MacRae VE, Mahon M, Gilpin S, Sandercock DA, Mitchell MA. Skeletal muscle fibre growth and growth associated myopathy in the domestic chicken (Gallus domesticus). Br Poult Sci. 2006;47(3):264–72. Wen C, Jiang X, Ding L, Wang T, Zhou Y. Effects of dietary methionine on breast muscle growth, myogenic gene expression and IGF-I signaling in fast- and slow-growing broilers. Sci Rep. 2017;7(1):1924. Meloche KJ, Dozier WA 3rd, Brandebourg TD, Starkey JD. Skeletal muscle growth characteristics and myogenic stem cell activity in broiler chickens affected by wooden breast. Poult Sci. 2018;97(12):4401–14. Mohammadabadi M, Bordbar F, Jensen J, Du M, Guo W. Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals. Animals (Basel). 2021;11(3):835. Relaix F, Rocancourt D, Mansouri A, Buckingham M. A Pax3/Pax7-dependent population of skeletal muscle progenitor cells. Nature. 2005;435(7044):948–53. Ferreira TZ, Kindlein L, Flees JJ, Shortnacy LK, Vieira SL, Nascimento VP, et al. Characterization of Pectoralis Major Muscle Satellite Cell Population Heterogeneity, Macrophage Density, and Collagen Infiltration in Broiler Chickens Affected by Wooden Breast. Front Physiol. 2020;11:529-. Gratta F, Birolo M, Sacchetto R, Radaelli G, Xiccato G, Ballarin C, et al. Effect of feed restriction timing on live performance, breast myopathy occurrence, and muscle fiber degeneration in 2 broiler chicken genetic lines. Poult Sci. 2019;98(11):5465–76. Papah MB, Brannick EM, Schmidt CJ, Abasht B. Gene expression profiling of the early pathogenesis of wooden breast disease in commercial broiler chickens using RNA-sequencing. PLoS One. 2018;13(12):e0207346. Marchesi JAP, Ibelli AMG, Peixoto JO, Cantao ME, Pandolfi JRC, Marciano CMM, et al. Whole transcriptome analysis of the pectoralis major muscle reveals molecular mechanisms involved with white striping in broiler chickens. Poult Sci. 2019;98(2):590–601. Praud C, Jimenez J, Pampouille E, Couroussé N, Godet E, Le Bihan-Duval E, et al. Molecular Phenotyping of White Striping and Wooden Breast Myopathies in Chicken. Front Physiol. 2020;11:633. Kuttappan V, Shivaprasad H, Shaw D, Valentine B, Hargis B, Clark F, et al. Pathological changes associated with white striping in broiler breast muscles. Poult Sci. 2013;92(2):331–8. Zambonelli P, Zappaterra M, Soglia F, Petracci M, Sirri F, Cavani C, et al. Detection of differentially expressed genes in broiler pectoralis major muscle affected by White Striping–Wooden Breast myopathies. Poultry science. 2016;95(12):2771–85. Zhan XA, Wang M, Ren H, Zhao RQ, Li JX, Tan ZL. Effect of early feed restriction on metabolic programming and compensatory growth in broiler chickens. Poult Sci. 2007;86(4):654–60. Salles GBC, Boiago MM, Silva AD, Morsch VM, Gris A, Mendes RE, et al. Lipid peroxidation and protein oxidation in broiler breast fillets with white striping myopathy. J Food Biochem. 2019;43(4):e12792. Soglia F, Petracci M, Davoli R, Zappaterra M. A critical review of the mechanisms involved in the occurrence of growth-related abnormalities affecting broiler chicken breast muscles. Poult Sci. 2021;100(6):101180. Papah MB, Brannick EM, Schmidt CJ, Abasht B. Evidence and role of phlebitis and lipid infiltration in the onset and pathogenesis of Wooden Breast Disease in modern broiler chickens. Avian Pathol. 2017;46(6):623–43. Sihvo HK, Linden J, Airas N, Immonen K, Valaja J, Puolanne E. Wooden Breast Myodegeneration of Pectoralis Major Muscle Over the Growth Period in Broilers. Vet Pathol. 2017;54(1):119–28. Xing T, Pan X, Zhang L, Gao F. Hepatic Oxidative Stress, Apoptosis, and Inflammation in Broiler Chickens With Wooden Breast Myopathy. Front Physiol. 2021;12:659777-. Griffin JR, Moraes L, Wick M, Lilburn MS. Onset of white striping and progression into wooden breast as defined by myopathic changes underlying Pectoralis major growth. Estimation of growth parameters as predictors for stage of myopathy progression. Avian pathology. 2018;47(1):2–13. Orlowski SK, Dridi S, Greene ES, Coy CS, Velleman SG, Anthony NB. Histological Analysis and Gene Expression of Satellite Cell Markers in the Pectoralis Major Muscle in Broiler Lines Divergently Selected for Percent 4-Day Breast Yield. Front Physiol. 2021;12:1248. Velleman SG, Clark DL. Histopathologic and Myogenic Gene Expression Changes Associated with Wooden Breast in Broiler Breast Muscles. Avian Dis. 2015;59(3):410–8. Meloche KJ, Fancher BI, Emmerson DA, Bilgili SF, Dozier WA. 3rd. Effects of quantitative nutrient allocation on myopathies of the Pectoralis major muscles in broiler chickens at 32, 43, and 50 days of age. Poult Sci. 2018;97(5):1786–93. Livingston ML, Landon C, Barnes H, Brake J. White striping and wooden breast myopathies of broiler breast muscle is affected by time-limited feeding, genetic background, and egg storage. J Poultry science. 2019;98(1):217–26. Gratta F, Birolo M, Sacchetto R, Radaelli G, Xiccato G, Ballarin C, et al. Effect of feed restriction timing on live performance, breast myopathy occurrence, and muscle fiber degeneration in 2 broiler chicken genetic lines. Poult Sci. 2019;98(11):5465–76. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1194475","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":73438534,"identity":"a0a68d79-c890-41f1-b878-e8948b7867cc","order_by":0,"name":"Hammed Ayansola","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABC0lEQVRIiWNgGAWjYBACAwbmAwcSKmp4GJsZGwwkKiCiEvi1sCU+eHDmmBxze/OBAoszRGnhMTZ82MZszN5zLOFDZRsxWvgPmEkktrEl9s7IMdxwc56dvMEB5oO3eRjs8nBqkUhIk0g4J5M4c0aOseHMbcmGGw6wJVvzMCQX49bCcEwioYwtceOMHDNjyW0HGDcc4DGT5mE4kNiA02EH2yQS2JgT99/IMf/9d84B+w0H+L/h18KQzGyQAPQ+I9D7BpINBxKBtrDh1yKRxvggARjIjMBANpA4lpw88zCbseUcg2ScWuz7z384+AMelTV2tn3Hmx/eeFNhh1MLFsAMcfAoGAWjYBSMAgoAAI+/XdSmOo7DAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-9932-654X","institution":"China Agricultural University College of Animal Science and Technology","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Hammed","middleName":"","lastName":"Ayansola","suffix":""},{"id":73438535,"identity":"8108330c-938a-4fb7-815f-1a119d935571","order_by":1,"name":"Xiaoxiao Yu","email":"","orcid":"","institution":"China Agricultural University College of Animal Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaoxiao","middleName":"","lastName":"Yu","suffix":""},{"id":73438536,"identity":"e726424a-f388-49a7-808b-08e3221dff7c","order_by":2,"name":"Jiaqi Lei","email":"","orcid":"","institution":"China Agricultural University College of Animal Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jiaqi","middleName":"","lastName":"Lei","suffix":""},{"id":73438537,"identity":"4a2f4437-0676-4fd9-b004-fc1128b5e677","order_by":3,"name":"Chaoyong Liao","email":"","orcid":"","institution":"China Agricultural University College of Animal Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chaoyong","middleName":"","lastName":"Liao","suffix":""},{"id":73438538,"identity":"de6d1763-d0d4-4d96-9eb4-f93f5847284a","order_by":4,"name":"Yuming Guo","email":"","orcid":"","institution":"China Agricultural University College of Animal Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuming","middleName":"","lastName":"Guo","suffix":""},{"id":73438539,"identity":"b1327be5-4820-4505-be0f-8f08c5d8aa1a","order_by":5,"name":"Bingkun Zhang","email":"","orcid":"","institution":"China Agricultural University College of Animal Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bingkun","middleName":"","lastName":"Zhang","suffix":""},{"id":73438540,"identity":"dee646c3-0978-4744-b7bb-a8894aaa7c58","order_by":6,"name":"Bo Wang","email":"","orcid":"https://orcid.org/0000-0003-0604-1607","institution":"China Agricultural University College of Animal Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2021-12-22 06:36:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1194475/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1194475/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":16949846,"identity":"17ad352a-3510-4e28-8d3a-1810e9554bae","added_by":"auto","created_at":"2022-01-03 21:23:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":671507,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRestricted feeding regimens effect on breast muscle characteristics in broiler chickens.\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Representative graph for growth curve \u003cstrong\u003e(B)\u003c/strong\u003e relative weight gain, g/b/w – gram/bird/week \u003cstrong\u003e(C)\u003c/strong\u003e 21 days old relative breast weight \u003cstrong\u003e(D)\u003c/strong\u003e 42 days old relative breast weight, \u003cstrong\u003e(E)\u003c/strong\u003e represents the phenotypic appearance of pectoralis major muscle of 42 days old broiler chickens and (\u003cstrong\u003eF)\u003c/strong\u003e WS – white striping scores in 42 days old breast fillets. g/kg – gram/kilogram. (*\u003cstrong\u003e - \u003c/strong\u003ep \u0026lt; 0.05, n = 8, data representatives are means ± SEM).\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-1194475/v1/5c732eb8c473079db8970f78.png"},{"id":16949850,"identity":"bc253081-360e-4d6c-8fb4-f1fd16928621","added_by":"auto","created_at":"2022-01-03 21:23:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":970127,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntermittent feeding improves breast muscle features in broiler chickens.\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e The H\u0026amp;E staining depicts 42 days old pectoralis major samples (scale bar = \u003cstrong\u003e100 µm)\u003c/strong\u003e, showing hypertrophic muscle laden with adiposity in \u003cem\u003eAd libitum \u003c/em\u003egroup \u003cstrong\u003e(B)\u003c/strong\u003e Fiber diameter of breast muscle \u003cstrong\u003e(C)\u003c/strong\u003e percentage distributions of breast muscle fiber sizes \u003cstrong\u003e(D)\u003c/strong\u003e \u003cem\u003eMYOD, MYF5, MYOG, PAX7,\u003c/em\u003e \u003cem\u003eHIF-1A, EGF, \u003c/em\u003eand \u003cem\u003eVEGFR-1\u003c/em\u003e mRNA levels in 21 days old pectoralis major muscle \u003cstrong\u003e(E)\u003c/strong\u003e \u003cem\u003eMYF5, MYOD, PAX7, IL1B, IL18, \u003c/em\u003eand \u003cem\u003eIL6\u003c/em\u003e mRNA levels in 42 days old pectoralis major muscle. (*\u003cstrong\u003e - \u003c/strong\u003ep \u0026lt; 0.05, n = 8, data representatives are means ± SEM).\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-1194475/v1/799c4f66cc711a608ac3498d.png"},{"id":16950057,"identity":"ba80af02-c102-4ae9-9cff-e557024177cf","added_by":"auto","created_at":"2022-01-03 21:26:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":524783,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntermittent feeding promotes PAX7\u003c/strong\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e\u003cstrong\u003e proliferations in pectoralis major of broiler chickens. \u003c/strong\u003e\u003c/p\u003e\u003cp\u003e(A) IHC -immunohistochemistry staining of broiler breast muscles (scale bar = \u003cstrong\u003e100 µm)\u003c/strong\u003e (B) is the quantifications of PAX7\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e/nuclei % using ImageJ (* p \u0026lt; 0.05, data representatives are means ± SEM)\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-1194475/v1/71ee644d0dc9982877e1081b.png"},{"id":16949848,"identity":"d07f6dc0-ec39-45f0-8cc1-6352df848cd0","added_by":"auto","created_at":"2022-01-03 21:23:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":131436,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRestricted feeding regimens reduce ectopic fat deposits in broiler chickens\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Folch extraction graph for TG- Triglyceride content of 42 days old breast muscles \u003cstrong\u003e(B)\u003c/strong\u003e graph represents lipogenic, pre-adipocyte and adipocyte differentiation mRNA genes expressed in 42 days old breast muscle samples: including \u003cem\u003eFABP4,\u003c/em\u003e \u003cem\u003eC/EBP\u003c/em\u003eβ, and \u003cem\u003eC/EBP\u003c/em\u003eα mRNA levels involved in lipid transport and uptake, \u003cem\u003eZNF423, PDGFR\u003c/em\u003eα\u003cem\u003e, \u003c/em\u003eand \u003cem\u003ePPAR\u003c/em\u003eγ\u003cem\u003e \u003c/em\u003emRNA levels involved in pre-adipocyte and adipocyte respectively.\u003cstrong\u003e \u003c/strong\u003e(*\u003cstrong\u003e - \u003c/strong\u003ep \u0026lt; 0.05, data representatives are means ± SEM).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-1194475/v1/1e64cfe3d07b7132258baa71.png"},{"id":16949849,"identity":"5f81f92d-c1c5-4f42-a7a4-2d69dd57bd0d","added_by":"auto","created_at":"2022-01-03 21:23:44","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":974582,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRestricted feeding regimens alleviate collagen accumulation in pectoralis major of broiler chickens. \u003c/strong\u003e\u003c/p\u003e\u003cp\u003e(A) Picro-Sirius red staining of collagen in broiler breast muscles (scale bar = 1\u003cstrong\u003e00 µm)\u003c/strong\u003e (B) is the quantifications of % area of collagen fiber using ImageJ (C) represents different protein bands in broiler breast muscles using Western blot analysis (D-G) quantification data results of\u003cem\u003e \u003c/em\u003eNFκB, MAFBX, TRIM63, and CASPASE-3 protein band sizes. (* p \u0026lt; 0.05, n = 6, data representatives are means ± SEM)\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-1194475/v1/35a63eb2f7ada34284fde718.png"},{"id":19849364,"identity":"923791a2-fb23-4522-a626-eb410c94c753","added_by":"auto","created_at":"2022-04-01 07:37:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3078916,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1194475/v1/4eb55e1f-7197-4868-9d81-d82d4b3d3619.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eRestricted Feeding Regimens Improve White Striping Associated Muscular Defects In Broiler Chickens\u003c/p\u003e","fulltext":[{"header":"1.0 Introduction","content":"\u003cp\u003e \u003cem\u003eAd libitum\u003c/em\u003e (AD) feed consumption exacerbates metabolic perturbations in broiler chickens (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). For example, excess energy consumed by broilers during unrestricted access to feed is converted into visceral and ectopic fats, which are harmful to health and meat quality (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). As a result, researchers are currently considering alternative feeding strategies to alleviate meat defects in commercial broiler chicken production (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Therefore, it is pertinent to investigate effective feeding strategies that can optimize the lean meat qualities of broiler chickens.\u003c/p\u003e \u003cp\u003eMeat quality characteristics are a major concern for consumers of broiler\u0026rsquo;s carcass. Previous findings revealed that increased growth rate, as seen in AD-fed birds, results in higher degrees of meat myopathies (\u003cspan additionalcitationids=\"CR7 CR8\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Specifically, in past studies, muscular myopathies arise from lipidosis and collagen accretion, purportedly linked with AD feeding (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). In support of this assumption, findings revealed that breast muscle myopathies, including white striping (WS) and wooden breast (WB) (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e), occur due to muscle hypertrophy resulting from the fast growth in birds with unstrained access to feeds (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). This voluntary feed consumption leads to excess ectopic fat deposit and enlarged muscle fiber sizes that disrupt muscular compositions and decrease vascular density in the breast muscle region (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Notably, these muscular defects contribute to the etiologies of WS-affected broiler\u0026rsquo;s meat quality (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). To solve growth-related muscular myodegeneration, Velleman and colleagues altered the timing of feeding to elucidate the fate of fat deposit and adipogenic transcription factors expression in pectoralis major muscle (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Their result revealed that 20% feed restriction during week 2 eliminated excess fat deposit, and they concluded that appropriate feed restriction strategies could positively improve the ratio of fat to lean meat and expression of adipogenic genes.\u003c/p\u003e \u003cp\u003eTo date, there are limited studies that have investigated the intermittent feeding strategies effects on meat quality features of broiler chickens. This is based on the assumption that restricted feeding will reduce growth performance which is the primary goal of broiler producers. However, Fondevilla et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e) reported that broilers restricted from eating for less than 6 hours per day showed similar body weight gain compared with those birds fed \u003cem\u003ead libitum.\u003c/em\u003e Likewise, Fargly et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e) previously demonstrated that 4 hours of intermittent feeding does not decrease broiler growth performance at the end of the experimental study. The prominent argument for these results is that broilers are likely to adapt quickly during restricted feeding regimens over a prolonged period, thereby attaining full compensatory growth performance (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn addition to improved metabolic activities, we could deduce that intermittent feeding might produce similar growth performances like AD feeding in broiler chickens if designed appropriately. Therefore, the current study investigated the impacts of intermittent feeding frequencies and acute fasting on broiler\u0026rsquo;s breast muscle physiology, focusing on histomorphology, muscle growth and differentiation markers, and protein expression related to muscular defects. The findings in the current study provide relevant information to poultry farmers, meat scientists, and potential consumers about the benefits of alternative feeding strategies on the muscular health of broiler chickens.\u003c/p\u003e"},{"header":"2.0 Materials And Methods","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003e2.1 Experimental Design and management\u003c/h2\u003e\n \u003cp\u003eThe research was conducted at the poultry Unit, Zhuozhou research center, China Agricultural University. All experimental procedures followed the guidelines approved by the China Agricultural University Laboratory animal welfare and experimental ethical committee.\u003c/p\u003e\n \u003cp\u003eFor this research, a total of 384 1-day male old chicks were brooded and acclimatized for eight days. The chicks were raised in a controlled environment with 24 hrs light supply, and the room temperature was periodically adjusted to ensure optimum room temperature for brooding purposes. During this period, \u003cem\u003ead libitum\u003c/em\u003e feed and clean water were supplied 24 hours a day.\u003c/p\u003e\n \u003cp\u003eThe birds were randomly distributed using a completely randomized experimental design into four groups with eight replicates that contained 12 birds each as \u003cem\u003ead libitum\u003c/em\u003e (AD), 1h-IF, 1.5h-IF, and fasting groups, respectively. During the experiment periods, AD feeding served as the control diet, while alternative feeding techniques comprised (1h-IF) intermittent 1-hour, (1.5h-IF) intermittent 1-hour 30 min, and 6:1-day fasting schedules (skip a day fasting). The 1h-IF and 1.5h-IF groups were subjected to 4 times daily intermittent feeding schedules as follow: 07.00-08.00, 12.30-13.30, 17.30-18.30, 22.30 until the light was switched off at 00.00 midnight, and 07.00-08.30, 12.30-14.00, 17.30-19.00, 22.30 until the light was switched off at 00.00 respectively. All birds were fed a standard commercial diet throughout the experiment based on the National Research Council (NRC) recommendations for broiler chickens (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The data recorded during the rearing period include daily and weekly growth performance data such as daily feed intake, weekly feed intake, body weight, and weight gain, and feed conversion rate for all groups.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u003ctable border=\"1\" id=\"Tab1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eComposition of Experimental diets and nutrient contents\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eINGREDIENTS g/100g\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eday 1 \u0026ndash; 21\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eday 22 \u0026ndash; 42\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCorn\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e57.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e60.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWheat offal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSoybean meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e33.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e27.85\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCottonseed meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCorn gluten meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSoybean oil\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMethionine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLysine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.28\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e98.5 L-Threonine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.07\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCalcium Hydrogen Phosphate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLimestone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.30\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e50% Choline\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVitamin premix\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMineral supplement\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSalt\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.30\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePhytase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSantoquin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAntioxidant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e100\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e100\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNutrient content\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEnergy AME (Mcal/kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.88\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCrude protein (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18.99\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLysine (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.19\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMethionine (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCa (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.89\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.84\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAvailable Phosphorus (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\"\u003eThe following supplements are included/kg in diet: *Vitamin premix provides following per kg diet: Vit. A, 9500 IU; Vit. D3, 62.5 ug; Vit. E, 30 IU; Vit. K3, 2.65 mg; Vit. B1, 2 mg; Vit B6, 2 mg; Vit. B12, 0.025 mg; Biotin, 0.0325 mg; Folic Acid, 1.25 mg; Pantothenic Acid, 12 mg; Nicotinic Acid, 50 mg. \u003csup\u003e**\u003c/sup\u003eMineral premix - Cu, 8 mg (CuSO\u003csub\u003e4\u003c/sub\u003e\u0026middot;5H\u003csub\u003e2\u003c/sub\u003eO); Fe, 80 mg (FeSO\u003csub\u003e4\u003c/sub\u003e); Mn, 100 mg (MnSO\u003csub\u003e4\u003c/sub\u003e\u0026middot; H\u003csub\u003e2\u003c/sub\u003eO); Se, 0.15 mg (Na\u003csub\u003e2\u003c/sub\u003eSeO\u003csub\u003e3\u003c/sub\u003e); I, 0.35 mg (KI). The feeds were formulated based on the recommendation by the NRC (1994)\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec4\"\u003e\n \u003ch2\u003e2.2 Sample collections\u003c/h2\u003e\n \u003cp\u003eBefore tissue sample collections, two birds per replicates were fasted overnight, selected based on average body weight from each cage, tagged, and weighed individually. On days 21 and 42, the selected birds fasted overnight were slaughtered for sample collection, including blood, leg muscle, thymus, gizzard, glandular stomach, spleen, bursa of fabricus, abdominal fat, and breast muscles. The samples were frozen with liquid nitrogen and stored at -80 \u003csup\u003e0\u003c/sup\u003eC for real-time PCR assay or in 4% paraffin solution for histomorphometry indices used for further experimental analysis. In addition, on day 42, we took images of sampled broiler breast fillets for further visual white striping scoring in accordance to Kuttappan et al. (\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e) with adjustments such that the grading scale adopted here represented normal (0-1), mild (\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e), moderate (\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e), and severe scores (\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec5\"\u003e\n \u003ch2\u003e2.3 RNA extraction and Real-Time quantitative PCR\u003c/h2\u003e\n \u003cp\u003eAccording to (Invitrogen Life Technologies, Carlsbad, CA, USA) protocol, the tissue samples stored in -80 \u003csup\u003e0\u003c/sup\u003eC were homogenized for total mRNA isolation in Trizol reagent; subsequently, the mRNA concentration and quality were measured with a Nano-300 spectrophotometer. The total mRNA (~1000 ng) was reverse transcribed using the Beyotime biotechnology cDNA synthesis kit. Finally, the MyIQ2 real-time PCR machine was carried out using SYBR \u0026ndash; Green Supermix from Beyotime using \u003cem\u003eGAPDH\u003c/em\u003e as the reference gene. The relative expressions of the targeted genes were calculated in fold changes to the AD group (\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e), while the gene primer sequences designed with Primer-BLAST are provided in Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u003ctable border=\"1\" id=\"Tab2\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eList of primer sequences for quantitative real-time PCR\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene names\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer ID\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003ePrimer Sequence (5\u0026rsquo; \u0026ndash; 3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eMYOD\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_204214.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: CACGGAATCACCAAATGACCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: GCAGTTGGTGGGGGAAGGAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eMYF5\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_204184.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: CTCCGATGTGATGGCGGACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: TCCACGATGCTGGAGAGGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eMYOG\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_204184.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: ACCACAACCTGCTGCACCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: TCCACGATGGAGGAGAGCGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003ePAX7\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_205065.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: TCAGCTACCGGACACGAGAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: GGGTGGACACTTCCAAAGGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eHIF-A\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_204297.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: ACCAGCAGTTCCTCATGCAATA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: CATCTTTGGCCGGCGGTAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eEGF\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_001001292.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: CCCGTTGCTTTCTTGCCAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: GGAATGGTGCAGGGTCATTTACG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eVEGFR-1\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_204252.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: TTTTCCTTGGGCGCCTCTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: CTTGCCTTCCTGTTGCACGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eIL1B\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_204524.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: TGCCTGCAGAAGAAGCCTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: TCGAAGGACTGTGAGCGGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eIL18\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_204608.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: ATGAGCTGGAATGCGATGCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: TGAAGGCGCGGTGGTTTTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eIL6\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_204628.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: GCTGCAGGACGAGATGTGCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: TCTGAAAGGCGAACAGGCCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eFABP4\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_204290.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: ATATGAAAGAGCTGGGTGTGGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: CTGCTTCAGTGTGCCACTGTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eCEBP\u0026alpha;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_001031459.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: TCGGCGACATCTGCGAGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: CGTGCATGCCGTGGAAATCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eCEBP\u0026beta;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_205253.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: CAGTAGCGGCGGCCAAGATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: TCTCGAAGACCGGCTCCACT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eZNF423\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXM_025154318.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: GACAGCAGTGCTCCCAAGTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: CTCCCAGGCCACCTGATTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003ePDGFR-\u0026alpha;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_204749.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: GCGCGTTATAAAGGAGGAGCTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: GGCCACTGTTGTTCTCCTCGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003ePPAR-\u0026gamma;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXM_015292931.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: AGGGAACAGTTTCTCCGGCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: GCTCCATTTTGATTGCACTTTGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eGAPDH\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNM_204305.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e: TGACGTGCAGCAGGAACACTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eR\u003c/strong\u003e: GCGGCCAATACGGCCAAATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec6\"\u003e\n \u003ch2\u003e2.3 Histomorphology and Immunohistochemistry\u003c/h2\u003e\n \u003cp\u003eThe fixated breast muscles were subsequently embedded in paraffin wax, cut at 5\u0026micro;m using Leica microtome, then mounted on slides. Next, the mounted tissue slides were dewaxed, dehydrated, stained with Hematoxylin and Eosin for H\u0026amp;E staining (histology composition and structure image) (\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e) or in Picrosirius red solution for collagen fiber evaluations (\u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e), then dehydrated, and cleared in xylene and subsequently quantified using ImageJ software. Immunohistochemistry staining was used for PAX7\u003csup\u003e+\u003c/sup\u003e density in the breast muscle tissues (\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e). Briefly, after deparaffinization, sectioned tissues were blocked in 10% goat serum in TBST containing 0.5% Triton X-100. The blocked tissues were incubated overnight at 4 \u003csup\u003e0\u003c/sup\u003eC with anti-PAX7\u003csup\u003e+\u003c/sup\u003e antibody (1:40, Developmental Studies Hybridoma Banks) and subsequently counterstained with corresponding secondary antibody for 1hr at room temperature. Finally, sections were mounted in a fluoroshield mounting medium with DAPI (Cat No: C1002, Beyotime Biotechnology, China), then immediately viewed using an EVOS enabled fluorescence microscope (ECHO model: RVL-100-G).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec7\"\u003e\n \u003ch2\u003e2.4 Triglyceride assay\u003c/h2\u003e\n \u003cp\u003eThe triglyceride (\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e) content levels in the frozen breast samples were used as a marker to measure ectopic fat deposits in the chicken breast using the Folch extraction method (\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e). In summary, the breast muscle tissue samples (~ 50 mg) were homogenized in 2:1 chloroform: methanol solution, centrifuged at 7,000 rpm, 4 \u003csup\u003e0\u003c/sup\u003eC for 10 min, washed in 0.9% NaCl solution, then centrifuged again at low speed (2000 rpm) to separate into 2 phases \u0026ndash; upper salt and methanol layer, while the lower phase contains the chloroform. The chloroform layer containing the lipid content was freeze-dried, resuspended in ACS-graded 2-propanol, followed by absorbance reading at 540 nm using Dongou TG reagent kit (Cat No: A0-10017).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec8\"\u003e\n \u003ch2\u003e2.5 Protein expression using the Western blotting technique\u003c/h2\u003e\n \u003cp\u003eThe protein content in the breast muscle was quantified according to western blot protocol. Briefly, the protein was digested using a lysis buffer containing RIPA, protease, and phosphatase inhibitors. The extracted protein lysate was separated by 10% SDS page and electroporated onto the nitrocellulose membrane. This is followed by blocking in 5% Milkfat: TBST solution for an hour and subsequently incubated in primary antibodies at 4\u0026deg;C overnight, including \u0026beta;-TUBULIN (Cat No: AF1216), NF-KB (AF5243), and CASPASE-3 (Cat No: AC030-1), purchased from Beyotime Biotechnology, while TRIM63 (Cat No: A3101), and FBXO32 (Cat No: A3193) were purchased from ABclonal Biotechnology. The membrane was washed with TBST buffer (137 mM Sodium chloride, 2.7 mM Potassium chloride, 50 mM Tris-HCl, and 0.1% Tween 20) before being incubated with HRP-labeled secondary antibody (1:5000, Shanghai Beyotime, Shanghai, China). The blotting bands were developed using a Super Enhanced Chemiluminescence (Shanghai Beyotime, Shanghai, China) and quantified using ImageJ software (NIH, USA).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec9\"\u003e\n \u003ch2\u003e2.6 Statistical Analysis\u003c/h2\u003e\n \u003cp\u003eThe data using one \u0026ndash; way ANOVA tool of SPSS v20.0 software are presented as means and standard error of the mean. Duncan\u0026rsquo;s test compared the statistical differences among individual means at p \u0026lt; 0.05 as the significance level. The graphical representations were designed with GraphPad Prism 8.0.2 software package.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3.0 Results","content":"\u003cdiv class=\"Section2\" id=\"Sec11\"\u003e\n \u003ch2\u003e3.1 Intermittent feeding and fasting reduced white striping of chicken breast without affecting growth performance\u003c/h2\u003e\n \u003cp\u003eUnsurprisingly, intermittent and fasting groups significantly decreased the average daily feed intake consumed during weeks 2 \u0026ndash; 5 compared to the \u003cem\u003ead libitum\u003c/em\u003e (AD) group (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, p \u0026lt; 0.05). Despite that, alternative feeding strategies did not impair the growth (Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA and B, p \u0026gt; 0.05) or feed conversion ratio (Table \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, p \u0026gt; 0.05) of birds when compared to the AD feeding. Overall, the data revealed that the alternative feeding strategies had statistically similar effects on growth and weight gain on broiler chickens.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u003ctable border=\"1\" id=\"Tab3\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eEffects of intermittent feedings and fasting on feed intake levels in broiler chickens\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"7\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e(g/b/d)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAd libitum\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e1Hour\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e1.5Hour\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eFasting\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSEM\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ep-value\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eweek 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e19.68\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.843\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eweek 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e52.66\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e45.22\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e45.14\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e51.49\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.82\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eweek 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e79.35\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e74.19\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e75.04\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e73.34\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.78\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.028\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eweek 4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e124.75\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e112.56\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e110.18\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e111.04\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeek 5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e158.70\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e149.63\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e149.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e138.68\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.89\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeek 6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e159.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e146.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e152.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e150.14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.231\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\"\u003eMeans in the same row with different superscript letters differ significantly (p \u0026lt; 0.05, n = 8, mean \u0026plusmn; SEM; g/b/d \u0026ndash; gram/bird/day).\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cdiv class=\"gridtable\"\u003e\u003ctable border=\"1\" id=\"Tab4\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eFeed conversation ratio of broiler chickens fed different feeding strategies\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"7\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAd libitum\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e1Hour\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e1.5Hour\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eFasting\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSEM\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ep-value\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeek 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0..02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.444\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeek 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0..01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.134\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeek 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.68\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.577\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeek 4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.137\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeek 5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.628\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeek 6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.82\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.78\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.89\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.299\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\"\u003eMeans in the same row with different superscript letters differ significantly (p \u0026lt; 0.05, n = 8, mean \u0026plusmn; SEM)\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eForemost, no differences were observed in the weight of tissues or organs, including leg muscle, thymus, gizzard, glandular stomach, spleen, and bursa of fabricus at 21 or 42 days old (Table \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, p \u0026gt; 0.05). However, 1h-IF and fasting significantly reduced abdominal fat of 21-days old birds (Table \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, p \u0026lt; 0.05). While the breast muscle mass of 1h-IF, 1.5h-IF, and fasting birds was smaller than that of the AD birds on day 21 (Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC, p \u0026lt; 0.05), there were no differences in day 42 samples (Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD, p \u0026gt; 0.05). Using phenotypic scoring metrics for white striping (WS), only I.5-h IF and fasting significantly reduced the WS appearance on the breast muscle fillets (Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eE and F, p \u0026lt; 0.05). Though 1h-IF reduced the WS scores numerically, the changes were insignificant compared to the AD birds (Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eF, p \u0026gt; 0.05).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u003ctable border=\"1\" id=\"Tab5\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eIntermittent feeding and fasting effects on carcass and organs of broiler chickens\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"7\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e21 days (g/kg)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAd libitum\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e1Hour\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e1.5Hour\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eFasting\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSEM\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ep-value\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eleg muscle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e67.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e74.94\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e68.78\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e68.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.169\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ethymus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.938\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003egizzard\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e15.91\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e15.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14.61\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.266\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eglandular stomach\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.219\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eabdominal fat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.10\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.08\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.47\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.64\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.017\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.170\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ebursa of fabricus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.99\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.747\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e42 days (g/kg)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eleg muscle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e72.61\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e71.42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e69.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e73.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.858\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ethymus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.643\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.453\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003egizzard\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9.99\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9.44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.152\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eabdominal fat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.141\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eglandular stomach\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.84\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.183\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ebursa of fabricus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.726\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\"\u003eMeans in the same rows with different superscript letters differ significantly \u0026ndash; p \u0026lt; 0.05 mean \u0026plusmn; SEM\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec12\"\u003e\n \u003ch2\u003e3.2 Intermittent feeding and fasting effect on broiler chickens muscle development and growth\u003c/h2\u003e\n \u003cp\u003eTo understand the effect of the feeding regimens on muscle structure, the H\u0026amp;E staining and frequency distribution data revealed that the breast muscle samples from the AD group had the largest fiber diameter size than the rest of the trial feeding strategies (Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA - C). Specifically, 1.5h-IF significantly decreased the percentage frequency distribution of larger fiber sizes compared to the AD group (Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB and C, p \u0026lt; 0.05). Thus, the alternative feedings could reduce breast muscular hypertrophy in broiler chickens.\u003c/p\u003e\n \u003cp\u003eSubsequently, expressions of myogenic marker genes suggest that the 1.5h-IF strategy promotes higher myogenic capacity in broiler breast muscle. The quantifications of qPCR differential expressions data (Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD), including \u003cem\u003eMYOD, MYF5, MYOG, HIF-1a, EGF\u003c/em\u003e, and \u003cem\u003eVEGFR-1\u003c/em\u003e, showed that 1.5h-IF-strategy significantly upregulated \u003cem\u003eMYF5\u003c/em\u003e and \u003cem\u003eMYOD\u003c/em\u003e genes compared to the \u003cem\u003ead libitum\u003c/em\u003e group in the day 21 breast muscle samples. Similarly, angiogenic markers in the breast muscle showed that both \u003cem\u003eHIF1A\u003c/em\u003e and \u003cem\u003eVEGFR-1\u003c/em\u003e genes were significantly upregulated by intermittent feeding in the 1.5hour group (p \u0026lt; 0.05), while only the EGF gene recorded no significant differences on day 21 across the group. In contrast, no significant differences in the myo-genes expressed on day 42 in the breast muscle samples (Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eE, p \u0026gt; 0.05). However, by using immunohistochemistry staining for day 42 breast muscle samples, the result revealed that 1.5h-IF increased \u003cem\u003ePAX7\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e satellite cells, demonstrating improved myogenesis rather than hypertrophic muscles observed in the AD group (Figure \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA and B, p \u0026lt; 0.05).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec13\"\u003e\n \u003ch2\u003e3.3 Intermittent feeding mitigated ectopic fat deposit in breast muscle of broiler chickens\u003c/h2\u003e\n \u003cp\u003eMost significantly, the effects of intermittent feeding on TG as an indicator of lipid fractions in the breast muscle are shown in Figure \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA. The data revealed that AD feeding significantly increased TG concentration than intermittent and fasting feeding strategies in the pectoralis major region (Figure \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA, p \u0026lt; 0.05). The breast muscle samples of 1.5h-IF had the lowest TG concentration (mg/g). As presented further in Figure \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB, it was observed that lipid metabolism marker genes, including \u003cem\u003eFABP4, C/EBP-A, C/EBP-B\u003c/em\u003e, are not differentially expressed in 42-day old breast muscle samples (p \u0026gt; 0.05). Also, only \u003cem\u003eZNF423\u003c/em\u003e and \u003cem\u003ePDGFR-A\u003c/em\u003e involved adipogenesis were significantly downregulated in the 42-day old breast muscle samples of both 1h-IF and fasting birds (Figure \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB, p \u0026lt; 0.05).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec14\"\u003e\n \u003ch2\u003e3.4 Intermittent feeding and fasting alleviated muscle degradation and myofibrosis\u003c/h2\u003e\n \u003cp\u003eAs a result of the overwhelming fast growth in broiler chickens, there is a tendency for the poor repair of tissue damages, leading to cell death. The histomorphological area covered by collagen using picrosirius red staining data showed that both chronic intermittent feeding and fasting strategies alleviated collagen accretion compared to AD feeding (Figure \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA and B, p \u0026lt; 0.05). To validate the collagen staining data, the western blot protein fold changes depicted that fibrotic-related protein markers, including TRIM63 and MAFBX, were significantly decreased in the 42-day old breast muscle samples of 1h-IF, 1.5h-IF, and fasting group (Figure \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC-F, p \u0026lt; 0.05). Also, an elevated CASPASE 3 synthesis \u0026ndash; a protein marker for apoptosis \u0026ndash; indicates protein degradation activities in AD-fed birds, while significantly suppressed by fasting and slightly decreased by IF regimens (Figure \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eG, p \u0026lt; 0.05). As such, the current data demonstrate that the alternative feeding strategies significantly reduced collagen fiber accretion in breast muscle, thereby improving the meat fillet qualities of broiler chickens.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4.0 Discussion","content":"\u003cp\u003eFeed restriction strategies are common management practices in broiler breeders (\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e), but there are variations in their effects in broiler chicken productions (\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e). On this account, the current study clarifies the discrepancies of intermittent feeding effects on broiler chickens for commercial production purposes. Specifically, this study explores the impacts of intermittent feedings and fasting strategies on broiler chickens\u0026rsquo; growth indices, histological and molecular mechanisms linked with WS phenotype in breast muscle meats.\u003c/p\u003e\n\u003cp\u003eThe feed intake data obtained in the current study are consistent with previous research suggesting that restricted feeding may suppress feed consumption levels in broiler chickens (\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e). Despite the reduced feed intake observed in our study, the alternative feeding strategies did not impair growth indices. During the feed restriction period, birds could easily adjust to changes in feeding patterns by temporarily storing feeds in the crop and subsequently prolonging digestion in the proximal region of the intestine (\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e). These results could be attributed to an adaptive mechanism deployed over time by birds fed the alternative feeding strategies, which show improved performance than Velele (\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e) study that reported stunted growth in restricted fed broilers. Previous findings have also suggested the possibility of compensatory growth rate reprogramming during restricted feeding strategies in broilers production over a long period (\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e). Consistently, our results further reveal that intermittent feedings did not significantly decrease the breast meat yield at the market age, i.e., 42 days of age, even though the AD feeding had the highest weight for breast meat. This observation, in fact, corresponds with the final body weight across the groups and also aligns with Jahanpour et al. (\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e) that previously suggested that up to 75% of restricted feed regimens had a neutral or non-detrimental effect on broiler\u0026rsquo;s breast meat yield.\u003c/p\u003e\n\u003cp\u003eMore importantly, consumers are concerned about breast meat quality, accounting for more than 67% of broiler carcass parts. Thus, the current study focuses on the impacts of chronic IF on breast meat quality related to the WS-associated myodegeneration (\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e). Enlarged breast muscle fiber size, one of the precursors of WS development, has previously been linked with meat hardness and muscular defects such as fibrosis (\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e). Several researchers agree with this proposition as observed in the AD group (\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e). On this premise, this study shows that 1.5h-IF reduced the fiber diameter in the breast muscle region, which aligns with the meat quality criterion for improved meat tenderness. The idea has been that enlarged fiber size predisposes the breast muscle region to poor vascularization and lipidosis, consequently leading to metabolic disorders that characterize severe hypertrophic muscle in broiler pectoralis major (\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e). The reduced muscle fiber diameter in the 1.5h-IF group could promote vascular tone and ensure proper muscular development by increasing interstitial space for vascular tissues without significantly affecting relative breast weight in broiler chickens (\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eLarger fiber sizes attributed to AD feeding predispose muscles to myodegeneration (\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e). In the current study, the molecular analysis further supports the beneficial effects of intermittent feeding on meat quality compared to AD feeding. The analyses elucidated their roles on myogenic regulatory factors and inflammatory cytokines. The gene expression data revealed no significant differences among all the feeding strategies. These results suggest that chronic intermittent feeding had a similar regulatory effect on myogenic markers such as \u003cem\u003eMYF5, MYOD\u003c/em\u003e, and \u003cem\u003ePAX7\u003c/em\u003e gene expressions (\u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e). Both \u003cem\u003eMYF5\u003c/em\u003e and \u003cem\u003eMYOD\u003c/em\u003e are involved in muscular cell growth and development (\u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e), whereas \u003cem\u003ePAX7\u003c/em\u003e, a skeletal muscle satellite cell, supports continuous cell proliferation for protein turnover in the pectoralis major region (\u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e43\u003c/span\u003e). As revealed by the immunohistochemistry staining, \u003cem\u003ePAX7\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e proliferation density was significantly compromised by AD feeding. With this data, we could extrapolate that decreased \u003cem\u003ePAX7\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e density resulted in poor muscular differentiation and repair activities during the later phase of AD birds that caused hypertrophic muscle defects (\u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e44\u003c/span\u003e). From the histology standpoint, IF might contribute to normal muscle growth essential for optimal muscular cell proliferation, maintenance, and repair during broiler production. Moreover, the myogenic markers examined in this research prove that, despite the lower feeding rate, chronic IF strategies had comparable effects on myogenesis (\u003cspan class=\"CitationRef\"\u003e45\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eTo understand the effects on fat deposits, lipid metabolic markers were examined in the breast muscle samples. As reported by Papah et al. (\u003cspan class=\"CitationRef\"\u003e46\u003c/span\u003e), functional analysis revealed that lipid metabolism-related genes are elevated in the myopathic tissues of broiler chickens. Though the lipid uptake and transport-related genes, including \u003cem\u003ePABP4, C/REP-A\u003c/em\u003e, and \u003cem\u003eC/REP-B\u003c/em\u003e, were not significantly altered in the current study. However, the relative upregulations of the adiposis-related genes (\u003cem\u003eZNF423\u003c/em\u003e and \u003cem\u003ePDGFR-A\u003c/em\u003e) in AD birds compared to 1h-IF and fasting birds align with a previous whole-genome sequencing that reported a potential higher degree of intermuscular fat in the pectoralis major samples of fast growth broiler chickens (\u003cspan class=\"CitationRef\"\u003e47\u003c/span\u003e). \u003cem\u003eZNF423\u003c/em\u003e and \u003cem\u003ePDGFR-A\u003c/em\u003e gene expressions increased pre-adipocyte cells, contributing to muscular adiposity development during muscular disruption as detected in the current study (\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e49\u003c/span\u003e). Consistently, the results here also reveal that both chronic intermittent feedings and fasting feeding decreased the TG level \u0026ndash; a metabolic indicator of ectopic fat deposit in the breast muscle samples. The excess TG accumulation could exacerbate lipotoxicity in the breast muscle, which is composed mainly of Type IIB non-oxidative muscle (\u003cspan class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e50\u003c/span\u003e). From the intramuscular energy supply standpoint, decreased intramuscular TG levels in IF and fasting birds were likely mobilized to provide energy for muscular activities during the restricted feeding period (\u003cspan class=\"CitationRef\"\u003e51\u003c/span\u003e). Note, excess TG accumulation causes lipid peroxidation in meat fillets leading to oxidative stress (\u003cspan class=\"CitationRef\"\u003e52\u003c/span\u003e) in relation to the etiology of myopathic lesion development (\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e54\u003c/span\u003e). These observations, therefore, corroborate lipid-laden perturbation in WS and WB-affected muscle during severe conditions (\u003cspan class=\"CitationRef\"\u003e55\u003c/span\u003e). In light of this understanding, we suggest that the IF regimens used in the current study could alleviate lipid spoilage in broiler breast meat.\u003c/p\u003e\n\u003cp\u003eBesides, collagen accretion in the breast muscle indicates poor cell repair activities that cannot sustain the fast growth rate associated with AD feeding. Interestingly, our results show that IF and fasting feeding significantly decreased TRIM63 and MAFBX protein expressions. These atrophic proteins are responsible for muscular degradation, causing tissue fibrosis and muscle wasting during chronic muscular stress related to hypertrophy in fast-growing broiler chickens (\u003cspan class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e53\u003c/span\u003e). Moreover, birds fed restricted feeding regimens showed lower apoptotic activities, demonstrating relieved muscular repair processes. It is likely that the higher muscle protein breakdown in the AD group triggers the increased abundance of CASPASE 3, which might aggravate muscular damage in severe conditions, as reported in a previous study that provided evidence of apoptotic liver damage of birds affected by WB myopathy (\u003cspan class=\"CitationRef\"\u003e56\u003c/span\u003e). This means that the enhanced protein degradations in the AD group profoundly contribute to higher collagen aggregate than alternative feeding regimens. Within this context, we could infer that intermittent feeding and fasting improves muscle growth and repair processes in the pectoralis major of broiler chickens (\u003cspan class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e57\u003c/span\u003e). This proposition agrees with previous findings that demonstrated timing schedules alleviate collagen modifications and fibrotic myopathy affecting abnormal breast muscles (\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e59\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eAlthough 1h-IF had an insignificant effect on the WS scoring in the current study, both 1.5h-IF and fasting strategies alleviated the WS appearance significantly compared to AD feeding. As generally believed, the fast growth rate is potentially recognized as the fundamental cause of WS (\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e53\u003c/span\u003e). In the past, feeding strategies such as lowering energy in diets (\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e), 85% \u003cem\u003ead libitum\u003c/em\u003e feed restriction (\u003cspan class=\"CitationRef\"\u003e60\u003c/span\u003e), and 8 hours daily feed restrictions (\u003cspan class=\"CitationRef\"\u003e61\u003c/span\u003e) have alleviated WS phenotype at the end of the studies (\u003cspan class=\"CitationRef\"\u003e62\u003c/span\u003e). These previous findings further support why the alternative feeding strategies investigated in this study could produce breast meat fillets with improved muscular conditions. To sum it all, when applied appropriately, chronic IF could potentially solve myopathies associated with fast growth muscle hypertrophy in the future.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe current study demonstrates that \u003cem\u003ead libitum\u003c/em\u003e feeding has greater detrimental effects on breast meat quality because it partly contributes to higher ectopic fat deposit and exacerbates fibrotic tissue development, potentially leading to WS myodegeneration in the pectoralis major of fast growth broiler chickens. Contrarily, the chronic intermittent feeding strategies, especially the 1.5h-IF, could serve as an alternative feeding approach to AD feeding when breast meats with less ectopic fat and softer steak are considered. Although AD had numerically higher weight gain values, the 1.5-hour IF strategy had statistically similar feed efficiency, final body weight, and relative breast muscle carcass cut at a decreased feed consumption rate. For these reasons, this study suggests that the 1.5h-IF could alleviate production concerns, particularly broiler\u0026rsquo;s meat quality caused by AD feeding in broiler chickens. Hence, the results presented here would serve as a reference for future researches. Accordingly, further studies should explore the modulatory effect of 1.5h-IF with or without slight changes in nutritional diets fed to the chickens. In line with these propositions, subsequent researches should focus on elucidating the 1.5hour intermittent feeding effects at the metabolomic and proteomic levels for in-depth knowledge.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAD: \u003cem\u003eAd libitum\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWS: White striping\u003c/p\u003e\n\u003cp\u003eWB: Wooden breast\u003c/p\u003e\n\u003cp\u003eIF: Intermittent feeding\u003c/p\u003e\n\u003cp\u003eTG: Triglycerides\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experimental procedures, including animal management, housing, slaughtering, and laboratory analysis, followed the guidelines approved by the China Agricultural University Laboratory animal welfare and experimental ethical committee.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data supporting our findings are included in the manuscript.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that there are no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research study was financially supported by the National Key R\u0026amp;D Program of China and (2018YFE0127300) and the Young Talent Supporting Program Funding of the College of Animal Science and Technology, China Agricultural University Education Foundation Grant (2017DKA002). The funders had no roles in the study design, data collection, and analysis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHammed Ayansola and Wang Bo conceptualized the study idea and experimental design. Hammed Ayansola and Jiaqi Lei conducted the animal experiment. Hammed Ayansola, Xiaoxiao Yu, and Wang Bo carried out molecular experiments. Hammed Ayansola and Wang Bo analyzed the result data. Hammed Ayansola and Wang Bo prepared the flow and structure of the figures. Hammed Ayansola wrote the original draft. Chaoyong Liao, Yuming Guo, Bingkun Zhang, and Wang Bo commented and revised the draft. Wang Bo and Bingkun Zhang provided the research funding. Wang Bo supervised the project, edited and proofread the final draft. All authors made significant contributions to the work, read and approved the final version of the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors wish to appreciate the support from the National Key R\u0026amp;D Program of China and the Young Talent Supporting Program Funding of the College of Animal Science and Technology, China Agricultural University Education Foundation Grant.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; information\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003ea\u003c/sup\u003e State Key Laboratory of Animal Nutrition, Department of Animal Nutrition and Feed Science, College of Animal Science and Technology, China Agricultural University, Beijing, 100193, China\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKhurshid A, Khan AA, Banday MT, Ganai AM, Khan HM, Choudhary AR, et al. Effect of feed restriction on performance of broiler chicken. J Entomol Zool Stud. 2019;7:1054\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMir NA, Rafiq A, Kumar F, Singh V, Shukla V. Determinants of broiler chicken meat quality and factors affecting them: a review. J Food Sci Technol. 2017;54(10):2997\u0026ndash;3009.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVelleman SG, Coy CS, Emmerson DA. Effect of the timing of posthatch feed restrictions on the deposition of fat during broiler breast muscle development. Poult Sci. 2014;93(10):2622\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArrazola A, Mosco E, Widowski TM, Guerin MT, Kiarie EG, Torrey S. The effect of alternative feeding strategies for broiler breeder pullets: 1. Welfare and performance during rearing. Poultry science. 2019;98(9):3377\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTallentire CW, Leinonen I, Kyriazakis I. Artificial selection for improved energy efficiency is reaching its limits in broiler chickens. Sci Rep. 2018;8(1):1168.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuttappan V, Brewer V, Apple J, Waldroup P, Owens C. Influence of growth rate on the occurrence of white striping in broiler breast fillets. Poult Sci. 2012;91(10):2677\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLake JA, Dekkers JCM, Abasht B. Genetic basis and identification of candidate genes for wooden breast and white striping in commercial broiler chickens. Sci Rep. 2021;11(1):1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBordini M, Zappaterra M, Soglia F, Petracci M, Davoli R. Weighted gene co-expression network analysis identifies molecular pathways and hub genes involved in broiler White Striping and Wooden Breast myopathies. Sci Rep. 2021;11(1):1776.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrisco F, De Biase D, Piegari G, d\u0026rsquo;Aquino I, Lama A, Comella F, et al. Pathologic characterization of white striping myopathy in broiler chickens. Poult Sci. 2021;100(7):101150.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetracci M, Mudalal S, Bonfiglio A, Cavani C. Occurrence of white striping under commercial conditions and its impact on breast meat quality in broiler chickens. Poult Sci. 2013;92(6):1670\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDalle Zotte A, Tasoniero G, Puolanne E, Remignon H, Cecchinato M, Catelli E, et al. Effect of \u0026ldquo;Wooden Breast\u0026rdquo; appearance on poultry meat quality, histological traits, and lesions characterization. Czech Journal of Animal Science. 2017;62(2):51\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetracci M, Mudalal S, Soglia F, Cavani C. Meat quality in fast-growing broiler chickens. World\u0026rsquo;s Poultry Science Journal. 2015;71(2):363\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMazzoni M, Petracci M, Meluzzi A, Cavani C, Clavenzani P, Sirri F. Relationship between pectoralis major muscle histology and quality traits of chicken meat. Poult Sci. 2015;94(1):123\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAyansola H, Liao C, Dong Y, Yu X, Zhang B, Wang B. Prospect of early vascular tone and satellite cell modulations on white striping muscle myopathy. Poult Sci. 2021;100(3):100945.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSihvo HK, Immonen K, Puolanne E. Myodegeneration with fibrosis and regeneration in the pectoralis major muscle of broilers. Vet Pathol. 2014;51(3):619\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFondevila G, Archs JL, Camara L, de Juan AF, Mateos GG. The length of the feed restriction period affects eating behavior, growth performance, and the development of the proximal part of the gastrointestinal tract of young broilers. Poult Sci. 2020;99(2):1010\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarghly MF, Mahrose KM, Ahmad EAM, Rehman ZU, Yu S. Implementation of different feeding regimes and flashing light in broiler chicks. Poult Sci. 2019;98(5):2034\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe Y, Yang Y, Dong Y, Yan C, Zhang B. The Effects of Flavomycin and Colistin Sulfate Pre-Treatment on Ileal Bacterial Community Composition, the Response to Salmonella typhimurium and Host Gene Expression in Broiler Chickens. Microorganisms. 2019;7(11):574.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanden KW, B\u0026ouml;cker U, Ofstad R, Pedersen ME, H\u0026oslash;st V, Afseth NK, et al. Characterization of Collagen Structure in Normal, Wooden Breast and Spaghetti Meat Chicken Fillets by FTIR Microspectroscopy and Histology. 2021;10(3):548.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBand\u0026iacute;n S, Morona R, L\u0026oacute;pez JM, Moreno N, Gonz\u0026aacute;lez A. Immunohistochemical analysis of Pax6 and Pax7 expression in the CNS of adult Xenopus laevis. J Chem Neuroanat. 2014;57-58:24\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFolch J, Lees M, Sloane Stanley GH. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem. 1957;226(1):497\u0026ndash;509.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVelele S. The effect of quantitative feed restriction on growth performance, carcass characteristics. Alice: University of Forte Hare; 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDissanayake D, David L. Effects of quantitative feed restriction on the performance of broiler chickens. 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan der Klein SA, Silva FA, Kwakkel RP, Zuidhof MJ. The effect of quantitative feed restriction on allometric growth in broilers. Poult Sci. 2017;96(1):118\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAzis A, Berliana B, Afriani A. Effects of feeding time restriction during the whole rearing period on the growth performance of broiler chickens. International Journal of Poultry Science. 2019;18(1):14\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSvihus B, Lund VB, Borjgen B, Bedford MR, Bakken M. Effect of intermittent feeding, structural components and phytase on performance and behaviour of broiler chickens. Br Poult Sci. 2013;54(2):222\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBenyi K, Acheampong-Boateng O, Norris D, Ligaraba TJ. Response of Ross 308 and Hubbard broiler chickens to feed removal for different durations during the day. Trop Anim Health Prod. 2010;42(7):1421\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhazanfari S, Kermanshahi H, Nassiry MR, Golian A, Moussavi ARH, Salehi A. Effect of feed restriction and different energy and protein levels of the diet on growth performance and growth hormone in broiler chickens. Journal of Biological Sciences. 2010;10(1):25\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhetani TL, Nkukwana TT, Chimonyo M, Muchenje V. Effect of quantitative feed restriction on broiler performance. Trop Anim Health Prod. 2009;41(3):379\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJahanpour H, Seidavi A, Qotbi AAA, Van Den Hoven R, Rocha e Silva S, Laudadio V, et al. Effects of the level and duration of feeding restriction on carcass components of broilers. Archives Animal Breeding. 2015;58(1):99\u0026ndash;105.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivingston M, Ferket P, Brake J, Livingston K. Dietary amino acids under hypoxic conditions exacerbates muscle myopathies including wooden breast and white stripping. Poultry science. 2018;98(3):1517\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMudalal S, Lorenzi M, Soglia F, Cavani C, Petracci M. Implications of white striping and wooden breast abnormalities on quality traits of raw and marinated chicken meat. Animal. 2015;9(4):728\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsmail I, Joo ST. Poultry Meat Quality in Relation to Muscle Growth and Muscle Fiber Characteristics. Korean J Food Sci Anim Resour. 2017;37(6):873\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVelleman SG. Pectoralis Major (Breast) Muscle Extracellular Matrix Fibrillar Collagen Modifications Associated With the Wooden Breast Fibrotic Myopathy in Broilers. Front Physiol. 2020;11:461.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDransfield E, Sosnicki A. Relationship between muscle growth and poultry meat quality. Poultry science. 1999;78(5):743\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang X, Ahn DU. The Incidence of Muscle Abnormalities in Broiler Breast Meat - A Review. Korean J Food Sci Anim Resour. 2018;38(5):835\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKawasaki T, Iwasaki T, Yamada M, Yoshida T, Watanabe T. Rapid growth rate results in remarkably hardened breast in broilers during the middle stage of rearing: A biochemical and histopathological study. PLoS One. 2018;13(2):e0193307.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMacRae VE, Mahon M, Gilpin S, Sandercock DA, Mitchell MA. Skeletal muscle fibre growth and growth associated myopathy in the domestic chicken (Gallus domesticus). Br Poult Sci. 2006;47(3):264\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWen C, Jiang X, Ding L, Wang T, Zhou Y. Effects of dietary methionine on breast muscle growth, myogenic gene expression and IGF-I signaling in fast- and slow-growing broilers. Sci Rep. 2017;7(1):1924.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeloche KJ, Dozier WA 3rd, Brandebourg TD, Starkey JD. Skeletal muscle growth characteristics and myogenic stem cell activity in broiler chickens affected by wooden breast. Poult Sci. 2018;97(12):4401\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohammadabadi M, Bordbar F, Jensen J, Du M, Guo W. Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals. Animals (Basel). 2021;11(3):835.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRelaix F, Rocancourt D, Mansouri A, Buckingham M. A Pax3/Pax7-dependent population of skeletal muscle progenitor cells. Nature. 2005;435(7044):948\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerreira TZ, Kindlein L, Flees JJ, Shortnacy LK, Vieira SL, Nascimento VP, et al. Characterization of Pectoralis Major Muscle Satellite Cell Population Heterogeneity, Macrophage Density, and Collagen Infiltration in Broiler Chickens Affected by Wooden Breast. Front Physiol. 2020;11:529-.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGratta F, Birolo M, Sacchetto R, Radaelli G, Xiccato G, Ballarin C, et al. Effect of feed restriction timing on live performance, breast myopathy occurrence, and muscle fiber degeneration in 2 broiler chicken genetic lines. Poult Sci. 2019;98(11):5465\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePapah MB, Brannick EM, Schmidt CJ, Abasht B. Gene expression profiling of the early pathogenesis of wooden breast disease in commercial broiler chickens using RNA-sequencing. PLoS One. 2018;13(12):e0207346.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarchesi JAP, Ibelli AMG, Peixoto JO, Cantao ME, Pandolfi JRC, Marciano CMM, et al. Whole transcriptome analysis of the pectoralis major muscle reveals molecular mechanisms involved with white striping in broiler chickens. Poult Sci. 2019;98(2):590\u0026ndash;601.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePraud C, Jimenez J, Pampouille E, Courouss\u0026eacute; N, Godet E, Le Bihan-Duval E, et al. Molecular Phenotyping of White Striping and Wooden Breast Myopathies in Chicken. Front Physiol. 2020;11:633.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuttappan V, Shivaprasad H, Shaw D, Valentine B, Hargis B, Clark F, et al. Pathological changes associated with white striping in broiler breast muscles. Poult Sci. 2013;92(2):331\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZambonelli P, Zappaterra M, Soglia F, Petracci M, Sirri F, Cavani C, et al. Detection of differentially expressed genes in broiler pectoralis major muscle affected by White Striping\u0026ndash;Wooden Breast myopathies. Poultry science. 2016;95(12):2771\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhan XA, Wang M, Ren H, Zhao RQ, Li JX, Tan ZL. Effect of early feed restriction on metabolic programming and compensatory growth in broiler chickens. Poult Sci. 2007;86(4):654\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalles GBC, Boiago MM, Silva AD, Morsch VM, Gris A, Mendes RE, et al. Lipid peroxidation and protein oxidation in broiler breast fillets with white striping myopathy. J Food Biochem. 2019;43(4):e12792.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoglia F, Petracci M, Davoli R, Zappaterra M. A critical review of the mechanisms involved in the occurrence of growth-related abnormalities affecting broiler chicken breast muscles. Poult Sci. 2021;100(6):101180.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePapah MB, Brannick EM, Schmidt CJ, Abasht B. Evidence and role of phlebitis and lipid infiltration in the onset and pathogenesis of Wooden Breast Disease in modern broiler chickens. Avian Pathol. 2017;46(6):623\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSihvo HK, Linden J, Airas N, Immonen K, Valaja J, Puolanne E. Wooden Breast Myodegeneration of Pectoralis Major Muscle Over the Growth Period in Broilers. Vet Pathol. 2017;54(1):119\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXing T, Pan X, Zhang L, Gao F. Hepatic Oxidative Stress, Apoptosis, and Inflammation in Broiler Chickens With Wooden Breast Myopathy. Front Physiol. 2021;12:659777-.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGriffin JR, Moraes L, Wick M, Lilburn MS. Onset of white striping and progression into wooden breast as defined by myopathic changes underlying Pectoralis major growth. Estimation of growth parameters as predictors for stage of myopathy progression. Avian pathology. 2018;47(1):2\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOrlowski SK, Dridi S, Greene ES, Coy CS, Velleman SG, Anthony NB. Histological Analysis and Gene Expression of Satellite Cell Markers in the Pectoralis Major Muscle in Broiler Lines Divergently Selected for Percent 4-Day Breast Yield. Front Physiol. 2021;12:1248.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVelleman SG, Clark DL. Histopathologic and Myogenic Gene Expression Changes Associated with Wooden Breast in Broiler Breast Muscles. Avian Dis. 2015;59(3):410\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeloche KJ, Fancher BI, Emmerson DA, Bilgili SF, Dozier WA. 3rd. Effects of quantitative nutrient allocation on myopathies of the Pectoralis major muscles in broiler chickens at 32, 43, and 50 days of age. Poult Sci. 2018;97(5):1786\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivingston ML, Landon C, Barnes H, Brake J. White striping and wooden breast myopathies of broiler breast muscle is affected by time-limited feeding, genetic background, and egg storage. J Poultry science. 2019;98(1):217\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGratta F, Birolo M, Sacchetto R, Radaelli G, Xiccato G, Ballarin C, et al. Effect of feed restriction timing on live performance, breast myopathy occurrence, and muscle fiber degeneration in 2 broiler chicken genetic lines. Poult Sci. 2019;98(11):5465\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"intermittent feeding, meat physiology, broiler chickens, white striping, muscle myopathy","lastPublishedDoi":"10.21203/rs.3.rs-1194475/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1194475/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: \u003c/p\u003e\u003cp\u003e\u003cem\u003eAd libitum \u003c/em\u003e(AD) feeding is crucial to profitable commercial broiler chicken production. However, it partly disrupts muscle development, causing myopathies like white striping in broilers’ breast meat. For this reason, this study investigated the impacts of intermittent feeding (IF) and fasting strategies as potential alternatives to AD feeding. A total of 384 one-day-old broilers were randomly allotted into 4 groups - \u003cem\u003ead libitum\u003c/em\u003e, 1h-IF group (4 times/day, 1 hour each time), 1.5h-IF (4 times/day, 1.5hrs each time), and acute fasting (1-day acute fasting, 6-days free access to feed). Feed intake, weight gain, muscle structure, differential genes, and protein expressions were assessed in the broiler breast muscles. \u003c/p\u003e\u003cp\u003eResults: \u003c/p\u003e\u003cp\u003eIF and fasting significantly reduced ectopic fat deposit and muscle fiber size (p \u0026lt; 0.05). Notably, 1.5h-IF promoted PAX7\u003csup\u003e+\u003c/sup\u003e satellite cell proliferation supporting muscle growth and repair activities in fast-growth broiler chickens. Consistently, the restricted regimens downregulated the collagen protein synthesis of skeletal muscle-specific E3 ubiquitin ligases (TRIM63 and MAFBX) in 42 – days old breast muscle samples (p \u0026lt; 0.05), especially in the 1.5h-IF group. Compared to AD-fed birds, 1.5h-IF and fasting feeding significantly decreased white striping scores in the breast meat muscle (p \u0026lt; 0.05). \u003c/p\u003e\u003cp\u003eConclusion\u003c/p\u003e\u003cp\u003eChronic IF or acute fasting improved muscle health of broiler chickens without significant compromise on growth rate and feed efficiency compared to AD\u003cem\u003e \u003c/em\u003efeeding. Therefore, this study presents potential feeding frequencies relevant for optimal growth pace while alleviating the occurrence of myopathic pathophysiology in broiler chickens.\u003c/p\u003e","manuscriptTitle":"Restricted Feeding Regimens Improve White Striping Associated Muscular Defects In Broiler Chickens","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-01-03 21:23:42","doi":"10.21203/rs.3.rs-1194475/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7d2e94da-0c0b-4f47-9380-19507472629a","owner":[],"postedDate":"January 3rd, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":9489407,"name":"Animal Science"},{"id":9489408,"name":"Biotechnology and Bioengineering"}],"tags":[],"updatedAt":"2022-04-01T07:37:31+00:00","versionOfRecord":[],"versionCreatedAt":"2022-01-03 21:23:42","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1194475","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1194475","identity":"rs-1194475","version":["v1"]},"buildId":"GqpaHPwrfC8PjnIFayRh5","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.