Full text
45,743 characters
· extracted from
preprint-html
· click to expand
Identification of a novel mosaic MTOR variant in purified neuronal DNA from depth electrodes in a patient with focal cortical dysplasia | medRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-P4HH5NV'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search Identification of a novel mosaic MTOR variant in purified neuronal DNA from depth electrodes in a patient with focal cortical dysplasia View ORCID Profile Karl Martin Klein , Rumika Mascarenhas , Daria Merrikh , Maryam Khanbabaei , View ORCID Profile Tatiana Maroilley , Navprabhjot Kaur , Yiping Liu , Tyler Soule , Minette Manalo , Goichiro Tamura , Julia Jacobs , Walter Hader , Gerald Pfeffer , View ORCID Profile Maja Tarailo-Graovac doi: https://doi.org/10.1101/2024.01.18.24301006 Karl Martin Klein 1 Department of Clinical Neurosciences, University of Calgary , Calgary, AB, Canada 2 Department of Medical Genetics, Cumming School of Medicine, University of Calgary , Calgary, AB, Canada 3 Department of Community Health Sciences, University of Calgary , Calgary, AB, Canada 4 Alberta Children’s Hospital Research Institute, University of Calgary , Calgary, AB, Canada 5 Hotchkiss Brain Institute, University of Calgary , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Karl Martin Klein For correspondence: karl.klein{at}ucalgary.ca Rumika Mascarenhas 1 Department of Clinical Neurosciences, University of Calgary , Calgary, AB, Canada 4 Alberta Children’s Hospital Research Institute, University of Calgary , Calgary, AB, Canada 5 Hotchkiss Brain Institute, University of Calgary , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Daria Merrikh 1 Department of Clinical Neurosciences, University of Calgary , Calgary, AB, Canada 4 Alberta Children’s Hospital Research Institute, University of Calgary , Calgary, AB, Canada 5 Hotchkiss Brain Institute, University of Calgary , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Maryam Khanbabaei 1 Department of Clinical Neurosciences, University of Calgary , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Tatiana Maroilley 2 Department of Medical Genetics, Cumming School of Medicine, University of Calgary , Calgary, AB, Canada 4 Alberta Children’s Hospital Research Institute, University of Calgary , Calgary, AB, Canada 6 Department of Biochemistry and Molecular Biology, Cumming School of Medicine, University of Calgary , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Tatiana Maroilley Navprabhjot Kaur 1 Department of Clinical Neurosciences, University of Calgary , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yiping Liu 7 Flow Cytometry Core Facility, University of Calgary , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Tyler Soule 1 Department of Clinical Neurosciences, University of Calgary , Calgary, AB, Canada 5 Hotchkiss Brain Institute, University of Calgary , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Minette Manalo 8 Department of Pediatrics, University of Calgary, Alberta Children’s Hospital , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Goichiro Tamura 1 Department of Clinical Neurosciences, University of Calgary , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Julia Jacobs 4 Alberta Children’s Hospital Research Institute, University of Calgary , Calgary, AB, Canada 5 Hotchkiss Brain Institute, University of Calgary , Calgary, AB, Canada 8 Department of Pediatrics, University of Calgary, Alberta Children’s Hospital , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Walter Hader 1 Department of Clinical Neurosciences, University of Calgary , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Gerald Pfeffer 1 Department of Clinical Neurosciences, University of Calgary , Calgary, AB, Canada 2 Department of Medical Genetics, Cumming School of Medicine, University of Calgary , Calgary, AB, Canada 5 Hotchkiss Brain Institute, University of Calgary , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Maja Tarailo-Graovac 2 Department of Medical Genetics, Cumming School of Medicine, University of Calgary , Calgary, AB, Canada 4 Alberta Children’s Hospital Research Institute, University of Calgary , Calgary, AB, Canada 6 Department of Biochemistry and Molecular Biology, Cumming School of Medicine, University of Calgary , Calgary, AB, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Maja Tarailo-Graovac Abstract Full Text Info/History Metrics Data/Code Preview PDF Abstract Background Recent studies have identified brain somatic variants as a cause of focal epilepsy. These studies relied on resected tissue from epilepsy surgery which is not available in most patients. The use of trace tissue adherent to depth electrodes used for stereo electroencephalography (stereo EEG) has been proposed as an alternative but is hampered by the low cell quality and contamination by non-brain cells. Here, we use our improved depth electrode harvesting technique that purifies neuronal nuclei to achieve molecular diagnosis in a patient with focal cortical dysplasia (FCD). Methods Depth electrode tips were collected, pooled by brain region and seizure onset zone, nuclei isolated and sorted using fluorescence-activated nuclei sorting (FANS). Somatic DNA was amplified from neuronal and astrocyte nuclei using primary template amplification followed by exome sequencing of neuronal DNA from the affected pool, unaffected pool, and saliva. The identified variant was validated using droplet digital PCR. Results An adolescent male with drug-resistant genetic-structural epilepsy due to left anterior insula FCD had daily focal aware seizures. Stereo EEG confirmed seizure onset in the left anterior insula. The two anterior insula electrodes were combined as the affected pool and three frontal electrodes as the unaffected pool. FANS isolated 140 neuronal nuclei from the affected and 245 neuronal nuclei from the unaffected pool. A novel somatic missense MTOR variant (p.Leu489Met, CADD score 23.7) was identified in the affected neuronal sample. Droplet digital PCR confirmed a mosaic gradient (VAF 0.78% in affected neuronal sample, variant was absent in all other samples). Conclusions Our finding confirms that harvesting neuronal DNA from depth electrodes followed by molecular analysis to identify brain somatic variants is feasible. Our novel method represents a significant improvement compared to the previous method by focusing the analysis on high quality cells of the cell type of interest. Introduction Recent studies in resected tissue from epilepsy surgery have identified brain somatic variants as a cause of focal epilepsy. These somatic variants are not inherited but occur during brain development and are therefore only present in a subset of cells, often only in the brain (i.e., mosaic). Pathogenic variants that cause overactivity of the mTOR pathway have been identified in focal cortical dysplasia (FCD) type 2 and hemimegalencephaly 1 – 12 . Pathogenic variants in SLC35A2 were found in mild malformation of cortical development with oligodendroglial hyperplasia 13 . Genes of the Ras/Raf/MAPK signaling pathway play a role in mesial temporal lobe epilepsy with hippocampal sclerosis 14 and low-grade epilepsy associated tumors 12 . The identification of brain somatic variants requires access to brain tissue which was classically provided by resective epilepsy surgery. However, not all patients are amenable to surgery and even in patients undergoing surgery, minimally invasive approaches (such as laser interstitial thermal therapy, LITT) are increasingly being used. The latter destroy the epileptogenic tissue in situ rather than remove it. Consequently, novel approaches to identify brain somatic variants are needed in order to allow a molecular diagnosis in a larger group of patients 15 . One such approach uses trace tissue adherent to depth electrodes used for stereo EEG (sEEG) recordings in epilepsy patients undergoing invasive presurgical workup. This method was first proposed by Montier et al. resulting in the identification of MEN1 as a possible candidate gene for epilepsy 16 . Electrodes were collected after extraction in phosphate-buffered saline (PBS), followed by pelleting of cells via centrifugation and whole genome amplification of the DNA. The latter increases the minute amounts of DNA to allow comprehensive molecular analysis, for example with exome sequencing. Ye et al. used the same method to identify a mosaic gradient for a KCNT1 variant in a patient with nonlesional multifocal epilepsy 17 . Three further studies compared variant allele frequencies (VAF) of variants identified in resected tissue samples with the VAF in depth electrode samples from the same patients 18 – 20 . Across these studies, variants could be identified in depth electrode samples in four out of five patients. VAFs in these four patients were 7-27x lower than in tissue. One explanation for the lower allele frequencies is that only a part of the depth electrode may be located within the area of interest resulting in a dilution of the sample with healthy cells from other areas 18 , 20 . However, in our experience there is also significant contamination of the brain cells adhering to the electrodes, for example with immune cells reacting to the implanted electrodes and blood. These contaminating non-brain cells significantly reduce the relative fraction of brain cells that carry the variant which in turn results in lower VAFs. In the worst case, this may result in the inability to identify the underling somatic genetic cause. To overcome this issue, we have developed a novel depth electrode harvesting technique that uses fluorescence-activated nuclei sorting (FANS) to purify neuronal nuclei and exclude any contaminating cells. We then amplify DNA from purified neuronal nuclei which significantly increases VAFs and the ability to identify the underlying somatic variant. In addition, we are using a recently developed amplification method (primary template amplification, PTA) 20 – 22 . PTA only amplifies from the primary template and avoids exponential amplification of artifacts associated with multiple displacement amplification that was used by previous studies 16 , 17 . Here, we use our novel technique to identify a mosaic MTOR variant in a patient with left anterior insula FCD. Methods After obtaining written informed consent, a saliva sample was collected, and DNA extracted (DNA Genotek prepIT L2P). Depth electrode (Ad-Tech SD, 5 mm contact spacing) tips were collected in PBS immediately after their removal and frozen at -80°C. Electrodes were pooled by brain region and seizure onset zone. On the day of processing, samples were thawed on ice and nuclei isolated using the Minute ™ Single Nucleus Isolation Kit for Neuronal Tissues/Cells (BN-020, Invent Biotechnologies Inc). Nuclei were stained with the conjugated antibodies anti-NeuN (ab190195, Abcam), anti-LHX2 (129079-ML650, USBiological) and anti-SPI1 (658010, Biolegend) as well as DAPI 23 . Nuclei were sorted using FANS into neuronal (DAPI+, NeuN+, SPI1-), astrocyte (DAPI+, LHX+, NeuN-, SPI1-), microglia (DAPI+, SPI1+, NeuN-) and other nuclei (DAPI+, NeuN-, LHX2-, SPI1-). Somatic DNA was amplified separately from neuronal and astrocyte nuclei from each electrode pool (i.e., region) using PTA (ResolveDNA® Whole Genome Amplification Kit 100136, Bead Purification Kit 100182, BioSkryb Genomics). DNA was quantified with the Qubit dsDNA HS kit. Amplified somatic and saliva DNA aliquots were analyzed using a multiplex assay including multiple short tandem repeat loci (STR) for quality control (ABI AmpFlSTR Identifiler Plus PCR Amplification Kit A26364). Exome sequencing of DNA from the affected and unaffected neuronal sample as well as saliva was performed at the Centre for Health Genomics and Informatics, University of Calgary, on the NovaSeq 6000 platform (Illumina Inc.) after exome capture using the IDT xGen Human Exome V2 panel. FastQC 24 and Trimmomatic 25 were used for pre-alignment quality control and trimming of low-quality bases, respectively, followed by alignment with BWA-MEM 26 to the hg19 reference genome. Somatic variants were identified using Mutect2 27 in the affected neuronal sample using the unaffected neuronal sample and saliva as control. Identified variants were annotated using Annovar 28 , VCFanno 29 and SnpEff 30 and filtered using population databases (gnomAD 31 , TOPmed 32 ) to exclude the variants with frequencies larger than 1% in an unaffected population. Additionally, an in-house database was employed to exclude sequencing errors. Filtered variants were manually reviewed for quality using the Integrative Genomic Viewer (IGV) 33 for visualization. Droplet digital PCR (ddPCR) was performed for variant validation using a QX200 Droplet Generator (Bio-Rad), QX200 Droplet Reader (Bio-Rad) and a custom TaqMan® SNP genotyping Assay (Thermo Fisher Scientific, forward primer: TGCCACAGTCTTCACTTGCAT, reverse primer: GCCTGGCCCCATTGC, wildtype reporter sequence: TCGAGCCAGCATGCT, variant reporter sequence: TCGAGCCATCATGCT, annealing temperature 58°C) in 60 ng of neuronal and astrocyte DNA from all electrode pools and in saliva. The data was analyzed with the QX Manager Software 2.1 Standard Edition (Bio-Rad). The detection limit of the assay was established using wildtype DNA spiked with decreasing concentrations of mutant gBlock (Integrated DNA Technologies, Inc.). Results We report an adolescent male with drug-resistant genetic-structural epilepsy due to left anterior insula FCD ( Fig. 1 A-B ) who had seizure onset during the first years of life. He had daily focal aware seizures with abdominal pain and fear associated with body stiffening lasting 1-2 minutes. He would often scream in pain during the seizures. MRI showed FCD in the left most anterior short insula gyrus possibly blending towards the left orbitofrontal and left opercular areas ( Fig. 1 A-B ). The posterior insular cortex appeared to be normal. Noninvasive video EEG monitoring had shown bilateral frontal and central interictal epileptiform discharges and left frontocentral ictal onset. A subtraction ictal SPECT showed left frontal hyperperfusion. Neuropsychological testing revealed low average performance with weaknesses in executive dysfunction. Clinical genetic testing including whole exome sequencing and chromosomal microarray from peripheral DNA were negative. Download figure Open in new tab Figure 1: Magnetic resonance imaging showing focal cortical dysplasia and electrode pools Coronal (A) and axial (B) FLAIR sequence showing increased cortical thickness and blurred gray-white matter junction in the left anterior insula (arrows). C-E: Sagittal T1 sequences from left medial (C) to lateral (E) showing the localization and pooling (different colors) of the electrodes. 1: amygdala, 2: anterior hippocampus, 3: posterior hippocampus, 4: anterior insula – anterior, 5: anterior insula – posterior, 6: middle insula, 7: posterior insula – anterior, 8: posterior insula – posterior, 9: frontal operculum – anterior, 10: frontal operculum – posterior, 11: central operculum, 12: anterior cingulate, 13: middle cingulate, 14: lateral orbitofrontal He underwent sEEG using 14 depth electrodes in the left hemisphere to delineate the extent of the seizure onset zone ( Fig. 1 C-E ). Frequent interictal epileptiform discharges were recorded arising from the left anterior insula, at times with a field involving the left middle and posterior insula as well as the left lateral orbitofrontal region. Less frequently, interictal epileptiform discharges were seen arising from the left mesiotemporal and lateral temporal region. Twenty-two seizures (20 electroclinical, 2 electrographic) were captured arising from the left anterior insula with propagation to the left middle insula and sometimes further spread to the left posterior insula, frontal and mesiotemporal electrodes ( Fig. 2 ). Based on the results of the recording, the patient underwent LITT surgery of the left anterior insula with significant improvement of his seizure frequency 5 months postoperatively (mild focal aware seizures every few weeks). Download figure Open in new tab Figure 2: EEG onset in left anterior insula Stereo EEG recording of a typical electroclinical seizure (low frequency filter 1 Hz, high frequency filter and notch off, sensitivity 100 μV/mm, 30 mm/sec). The red arrow indicates seizure onset at electrode 4 (left anterior insula – anterior) with lower amplitude involvement of the deep contacts of electrode 5 (left anterior insula – posterior). Yellow arrows: Propagation to electrode 6 (middle insula) after ∼0.5 sec and to the deep contact of electrode 8 (left posterior insula – posterior) after ∼3.5 sec. The electrodes were combined into 5 pools for genetic analysis ( Fig 1 C-E , Table 1 ). Due to the presence of the lesion and seizure onset zone in the left anterior insula, the left anterior insula pool was selected as the affected region. The left frontal/cingulate pool was selected as unaffected control region as it was distantly located from the affected pool and no epileptiform activity was seen arising primarily from this area. View this table: View inline View popup Download powerpoint Table 1: Depth electrode pools with nuclei yield and variant allele frequencies FANS isolated 140 neuronal nuclei from the affected depth electrode pool and 245 neuronal nuclei from the unaffected depth electrode pool ( Table 1 ). DNA from neuronal and astrocyte nuclei of all pools was amplified using PTA. The multiplex assay revealed identical alleles for all 15 STR and the one sex marker in both neuronal samples and saliva excluding contamination and confirming excellent amplification ( Table 1 ). Exome sequencing resulted in a mean coverage of 178x in the affected neuronal sample with 79% of the exome covered at ≥95x. The unaffected neuronal sample had a mean coverage of 258x with 91% of the exome covered at ≥95x. A novel mosaic missense MTOR variant (ENST00000361445:c.1465C>A, p.Leu489Met) was identified in the affected neuronal sample at a VAF of 3.65% (or 6 reads) which was not present in the unaffected neuronal sample and saliva. The variant had a CADD v1.6 score of 23.7 34 , REVEL score of 0.632 35 , and MISTIC score of 0.863 36 . The variant was not present in gnomAD 31 and TOPmed 32 . Droplet digital PCR confirmed the mosaic gradient with a VAF of 0.78% in the affected neuronal sample ( Fig. 3 , Table 1 ). The variant was not present in any other neuronal or astrocyte sample. The detection limit of the ddPCR assay was 0.05% VAF. Download figure Open in new tab Figure 3: Droplet digital PCR result for left anterior insula pool Gating was determined based on fluorescent intensities of no template control samples. Variant concentration: 2.75 copies/μL, wild-type concentration: 348 copies/μl, variant allele fraction: 0.782%. Blue: variant droplets, green: wild-type droplets, orange: droplets containing multiple DNA templates, gray: empty droplets. Discussion We achieved molecular diagnosis of a novel somatic mosaic MTOR missense variant in a patient with genetic-structural focal epilepsy due to left anterior insula FCD using purified neuronal DNA harvested from sEEG depth electrodes. Mosaic missense variants in MTOR have been reported in the past in FCD type II indicating perfect gene-disease validity 2 – 9 , 11 . Furthermore, the variant is not seen in control cohorts and the high CADD score predicts deleteriousness. Additional support for the pathogenicity of the variant is provided by the mosaic gradient with the highest VAF in the lesion and seizure onset zone and absence of the variant in other brain regions and saliva. Assuming even amplification, a VAF of 0.78% corresponds to 1.56% of the neurons in the affected pool carrying the variant, i.e. 2 out of 140 neurons. Our finding confirms that harvesting neuronal DNA from depth electrodes followed by molecular analysis to identify brain somatic variants is feasible. We achieved molecular diagnosis in the absence of resected surgical tissue as the patient underwent LITT surgery so no tissue could be harvested. In our patient, harvesting cells adhering to depth electrodes was the only available access to brain DNA. As minimally invasive surgical approaches are increasingly being used, it is of paramount importance to further develop techniques to identify somatic variants independent of the availability of surgically resected tissue. With the continuing development of precision medicine approaches, for example the use of mTOR inhibitors in mTORopathies 37 , 38 , such techniques will be paramount to allow optimal treatment of patients in the future. We posit that the success in our patient was made possible by our novel method that allows us to investigate pure neuronal DNA by using FANS to exclude non-brain cells. This method has multiple advantages. Our technique provides the exact number of nuclei of each cell type that are being amplified. This allows estimating the power to identify a certain VAF. In our case, the variant was not seen in the left middle/posterior insula pool which was located most closely to the affected anterior insula region. The presence of 139 neuronal and 188 astrocyte nuclei in this pool provided 80% power to identify VAFs of 0.6% and 0.5%, respectively. We can also conclude that the number of isolated neuronal or astrocyte nuclei of a few other regions was insufficient to exclude low percentage mosaicism (left opercular neuronal nuclei, n=20; left anterior insula astrocyte nuclei, n=31; left frontal/cingulate astrocyte nuclei n=54). This was also reflected by low quality on the STR multiplex assay for these samples whereas all other samples showed excellent quality ( Table 1 ). No neuronal nuclei were isolated from the left temporal pool and, hence, no neuronal DNA was available from this region. The exclusion of non-brain cells by FANS increases the frequency of neuronal variants resulting in a higher chance to identify low percentage mosaicism (low VAF). The previous depth electrode harvesting method amplified DNA from the bulk sample. Any contamination of the sample, for example by blood or immune cells, reduced the percentage of brain cells and resulted in lower VAFs that are more difficult to detect. Our method allows processing of all cells of an electrode pool and then purifies the cell type of interest. Previous methods used only 8% (4 out of 50 μl) 16 or 30% (3 out of 10 μl) 20 of the sample which avoids exceeding the maximum number of cells that can be processed with the amplification kit. However, this means that only a subset of the neurons in a pool were amplified. If fewer neurons undergo amplification, there is a higher risk of missing the abnormal cell fraction in the sample which may prevent detection of the variant with the previous method. Depth electrode harvesting methods in general are limited by the low quality of the cells that are harvested from depth electrode samples. Using our method, a large percentage of nuclei (97%) did not stain as neuronal, astrocyte or microglia. One explanation for this finding is that these nuclei are indeed not of brain origin and represent contamination. In this case, it will be very important to exclude these cells before amplification due to the aforementioned reasons. However, it is possible that some of the unstained nuclei may originate from cells of brain origin but due to degradation they do not stain properly. As successful whole genome amplification requires high molecular DNA, it is likely that amplification from degraded cells with fragmented DNA will not be successful and, hence, exclusion of this pool would also be beneficial. The observed VAF (0.78%; representing only 2 of 140 neurons in the pool) is within the range of MTOR VAFs previously reported in FCD 6 , 39 . However, it is likely that the VAF at the SOZ was somewhat underestimated using this approach due to the dilution of the sample with healthy cells from other areas that were penetrated by the electrodes as well. In this study, the variant was only identified in the neuronal nuclei, supporting the concept that the variant was present in the expected cell type for the disease. However, as only 31 astrocyte nuclei were isolated from the affected pool, it is possible that a low percentage of astrocytes carrying the variant were missed. As future research investigates the presence of mosaic variants in seizure foci, we expect that some identified variants may not be restricted to the neuronal cell type, depending on when the mosaic variant occurred in embryogenesis or neurodevelopment 13 . Non-neuronal cells have been implicated in epileptogenesis 40 – 42 ; the possibility of somatic variants in non-neuronal cells associated with epilepsy is conceptually intriguing and could be detected using this approach. In summary, we used our novel depth electrode harvesting method to establish a molecular diagnosis of a somatic mosaic MTOR variant in an adolescent with genetic-structural focal epilepsy due to left anterior insula FCD. Our novel method represents a significant improvement compared to the previous depth electrode harvesting method by focusing the analysis on high quality cells of the cell type of interest. It will pave the way for molecular diagnosis in patients who do not undergo resective epilepsy surgery and allow application of precision medicine approaches based on the genetic finding. Data Availability The de-identified phenotypic and exome sequencing data will be made available upon reasonable request from any qualified investigator after institution of a material transfer agreement. Author contributions Karl Martin Klein: Designed and conceptualized the study; major role in the acquisition of data; analyzed the data; drafted the manuscript for intellectual content; supervision; funding acquisition. Rumika Mascarenhas: Major role in the acquisition of data; analyzed the data; reviewed the manuscript for intellectual content Daria Merrikh: Major role in the acquisition of data; reviewed the manuscript for intellectual content Maryam Khanbabaei: Major role in the acquisition of data; reviewed the manuscript for intellectual content Tatiana Maroilley: Analyzed the data; reviewed the manuscript for intellectual content Navprabhjot Kaur: Major role in the acquisition of data; reviewed the manuscript for intellectual content Yiping Liu: Major role in the acquisition of data; analyzed the data; reviewed the manuscript for intellectual content Tyler Soule: Major role in the acquisition of data; reviewed the manuscript for intellectual content Minette Manalo: Major role in the acquisition of data; reviewed the manuscript for intellectual content Goichiro Tamura: Major role in the acquisition of data; reviewed the manuscript for intellectual content Julia Jacobs: Major role in the acquisition of data; reviewed the manuscript for intellectual content Walter Hader: Major role in the acquisition of data; reviewed the manuscript for intellectual content Gerald Pfeffer: Analyzed the data; reviewed the manuscript for intellectual content Maja Tarailo-Graovac: Designed and conceptualized the study; analyzed the data; drafted the manuscript for intellectual content; supervision; funding acquisition Acknowledgements We would like to thank the patient and his family for participation in the study. We acknowledge the Flow Cytometry Core Facility and the Centre for Health Genomics and Informatics at the University of Calgary for their support. Footnotes Data Availability Statement The de-identified phenotypic and exome sequencing data will be made available upon reasonable request from any qualified investigator after institution of a material transfer agreement. Funding statement This project has been made possible by the Canada Brain Research Fund (CBRF), an innovative arrangement between the Government of Canada (through Health Canada) and Brain Canada, and by the Azrieli Foundation. It was also supported by Epilepsy Canada, doing business as Epilepsy Canada. KMK also received support from the Department of Clinical Neurosciences, Hotchkiss Brain Institute and Alberta Children’s Hospital Research Institute, University of Calgary. M.T-G was supported by the Alberta Children’s Hospital Foundation and the CIHR-Bridge grant number OGB-185746. Infrastructure in the laboratory of GP was supported by a Canada Foundation for Innovation Grant (John R. Evans Leaders Fund (CFI-JELF) 36624). The views expressed herein do not necessarily represent the views of the Minister of Health or the Government of Canada. Conflict of interest disclosure None of the authors has any conflict of interest to disclose. Ethics approval statement The study was approved by the Conjoint Health Research Ethics Board (CHREB) at the University of Calgary (REB18-2099). Patient consent statement All participants or their legal guardians provided written informed consent. References 1. ↵ Lee JH , Huynh M , Silhavy JL , et al. De novo somatic mutations in components of the PI3K-AKT3-mTOR pathway cause hemimegalencephaly . Nature Genetics 2012 ; 44 : 941 – 945 . OpenUrl CrossRef PubMed 2. ↵ Lim JS , Kim WI , Kang HC , et al. Brain somatic mutations in MTOR cause focal cortical dysplasia type II leading to intractable epilepsy . Nature Medicine 2015 ; 21 : 395 – 400 . OpenUrl CrossRef PubMed 3. Mirzaa GM , Campbell CD , Solovieff N , et al. Association of MTOR Mutations With Developmental Brain Disorders, Including Megalencephaly, Focal Cortical Dysplasia, and Pigmentary Mosaicism . JAMA Neurology 2016 ; 73 : 836 – 845 . OpenUrl 4. D’Gama AM , Geng Y , Couto J a. , et al. mTOR pathway mutations cause hemimegalencephaly and focal cortical dysplasia . Annals of Neurology 2015 ; 77 : 720 – 725 . OpenUrl CrossRef PubMed 5. Sim NS , Ko A , Kim WK , et al. Precise detection of low-level somatic mutation in resected epilepsy brain tissue . Acta Neuropathologica 2019 ; 138 : 901 – 912 . OpenUrl CrossRef 6. ↵ Baldassari S , Ribierre T , Marsan E , et al. Dissecting the genetic basis of focal cortical dysplasia: a large cohort study . Acta Neuropathologica 2019 ; 138 : 885 – 900 . OpenUrl CrossRef PubMed 7. Lee WS , Stephenson SE , Pope K , et al. Genetic characterisation identifies bottom-of-sulcus dysplasia as an mTORopathy . Neurology 2020 ; 95 : e2542 – e2551 . OpenUrl 8. Zhang Z , Gao K , Liu Q , et al. Somatic variants in new candidate genes identified in focal cortical dysplasia type II . Epilepsia 2020 ; 61 : 667 – 678 . OpenUrl 9. ↵ Møller RS , Weckhuysen S , Chipaux M , et al. Germline and somatic mutations in the MTOR gene in focal cortical dysplasia and epilepsy . Neurology Genetics 2016 ; 2 : e118 . OpenUrl 10. Poduri A , Evrony GD , Cai X , et al. Somatic Activation of AKT3 Causes Hemispheric Developmental Brain Malformations . Neuron 2012 ; 74 : 41 – 48 . OpenUrl CrossRef PubMed Web of Science 11. ↵ Jansen LA , Mirzaa GM , Ishak GE , et al. PI3K/AKT pathway mutations cause a spectrum of brain malformations from megalencephaly to focal cortical dysplasia . Brain 2015 ; 138 : 1613 – 1628 . OpenUrl CrossRef PubMed 12. ↵ López-Rivera JA , Leu C , Macnee M , et al. The genomic landscape across 474 surgically accessible epileptogenic human brain lesions . Brain 2023 ; 146 : 1342 – 1356 . OpenUrl 13. ↵ Bonduelle T , Hartlieb T , Baldassari S , et al. Frequent SLC35A2 brain mosaicism in mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE) . Acta Neuropathologica Communications 2021 ; 9 : 3 . OpenUrl 14. ↵ Khoshkhoo S , Wang Y , Chahine Y , et al. Contribution of Somatic Ras/Raf/Mitogen-Activated Protein Kinase Variants in the Hippocampus in Drug-Resistant Mesial Temporal Lobe Epilepsy . JAMA Neurology 2023 ; 80 : 578 – 587 . OpenUrl 15. ↵ Ye Z , Bennett MF , Bahlo M , et al. Cutting edge approaches to detecting brain mosaicism associated with common focal epilepsies: implications for diagnosis and potential therapies . Expert Review of Neurotherapeutics 2021 ; 21 : 1309 – 16 . OpenUrl 16. ↵ Montier L , Haneef Z , Gavvala J , et al. A somatic mutation in MEN1 gene detected in periventricular nodular heterotopia tissue obtained from depth electrodes . Epilepsia 2019 ; 60 : e104 – e109 . OpenUrl 17. ↵ Ye Z , Bennett MF , Neal A , et al. Somatic Mosaic Mutation Gradient Detected in Trace Brain Tissue From Stereo-EEG Depth Electrodes . Neurology 2022 ; 99 : 1036 – 1041 . OpenUrl PubMed 18. ↵ Checri R , Chipaux M , Ferrand-Sorbets S , et al. Detection of brain somatic mutations in focal cortical dysplasia during epilepsy presurgical workup . Brain Communications 2023 ; 5 : fcad174 . OpenUrl 19. Gatesman TA , Hect JL , Phillips HW , et al. Characterization of low-grade epilepsy-associated tumor from implanted stereoelectroencephalography electrodes . Epilepsia Open 2023 ; online ahead of print. https://onlinelibrary.wiley.com/doi/abs/10.1002/epi4.12840 . 20. ↵ Phillips HW , D’Gama AM , Wang Y , et al. Somatic Mosaicism in PIK3CA Variant Correlates With Stereoelectroencephalography-Derived Electrophysiology . Neurology Genetics 2024 ; 10 : e200117 . OpenUrl 21. Gonzalez-Pena V , Natarajan S , Xia Y , et al. Accurate genomic variant detection in single cells with primary template-directed amplification . PNAS 2021 ; 118 : e2024176118 . OpenUrl Abstract / FREE Full Text 22. ↵ Luquette LJ , Miller MB , Zhou Z , et al. Single-cell genome sequencing of human neurons identifies somatic point mutation and indel enrichment in regulatory elements . Nature Genetics 2022 ; 54 : 1564 – 1571 . OpenUrl CrossRef 23. ↵ Nott A , Schlachetzki JCM , Fixsen BR , Glass CK . Nuclei isolation of multiple brain cell types for omics interrogation . Nature Protocols 2021 ; 16 : 1629 – 1646 . OpenUrl 24. ↵ Andrews , S. FastQC: a quality control tool for high throughput sequence data . [online]. 2010 . Available online at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc . 25. ↵ Bolger AM , Lohse M , Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data . Bioinformatics 2014 ; 30 : 2114 – 2120 . OpenUrl CrossRef PubMed Web of Science 26. ↵ Li H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM . arXiv ; 2013 . http://arxiv.org/abs/1303.3997 . 27. ↵ Poplin R , Ruano-Rubio V , DePristo MA , et al. Scaling accurate genetic variant discovery to tens of thousands of samples . bioRxiv 2018 . https://www.biorxiv.org/content/10.1101/201178v3 . 28. ↵ Yang H , Wang K. Genomic variant annotation and prioritization with ANNOVAR and wANNOVAR . Nature Protocols 2015 ; 10 : 1556 – 1566 . OpenUrl 29. ↵ Pedersen BS , Layer RM , Quinlan AR . Vcfanno: fast, flexible annotation of genetic variants . Genome Biology 2016 ; 17 : 118 . OpenUrl CrossRef PubMed 30. ↵ Cingolani P , Platts A , Wang LL , et al. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff . Fly 2012 ; 6 : 80 – 92 . OpenUrl CrossRef PubMed Web of Science 31. ↵ Chen S , Francioli LC , Goodrich JK , et al. A genome-wide mutational constraint map quantified from variation in 76,156 human genomes . bioRxiv 2022 . https://www.biorxiv.org/content/10.1101/2022.03.20.485034v2 . 32. ↵ Taliun D , Harris DN , Kessler MD , et al. Sequencing of 53,831 diverse genomes from the NHLBI TOPMed Program . Nature 2021 ; 590 : 290 – 299 . OpenUrl CrossRef PubMed 33. ↵ Thorvaldsdóttir H , Robinson JT , Mesirov JP . Integrative Genomics Viewer (IGV): highperformance genomics data visualization and exploration . Briefings in Bioinformatics 2013 ; 14 : 178 – 192 . OpenUrl CrossRef PubMed 34. ↵ Rentzsch P , Schubach M , Shendure J , Kircher M. CADD-Splice—improving genome-wide variant effect prediction using deep learning-derived splice scores . Genome Medicine 2021 ; 13 : 31 . OpenUrl 35. ↵ Ioannidis NM , Rothstein JH , Pejaver V , et al. REVEL: An Ensemble Method for Predicting the Pathogenicity of Rare Missense Variants . American Journal of Human Genetics 2016 ; 99 : 877 – 885 . OpenUrl CrossRef PubMed 36. ↵ Chennen K , Weber T , Lornage X , et al. MISTIC: A prediction tool to reveal diseaserelevant deleterious missense variants . PLoS One 2020 ; 15 : e0236962 . OpenUrl CrossRef 37. ↵ D’Gama AM , Poduri A. Precision Therapy for Epilepsy Related to Brain Malformations . Neurotherapeutics 2021 ; 18 : 1548 – 1563 . OpenUrl CrossRef 38. ↵ Moloney PB , Cavalleri GL , Delanty N. Epilepsy in the mTORopathies: opportunities for precision medicine . Brain Communications 2021 ; 3 : fcab222 . OpenUrl 39. ↵ Krochmalnek E , Accogli A , St-Onge J , et al. mTOR Pathway Somatic Pathogenic Variants in Focal Malformations of Cortical Development: Novel Variants, Topographic Mapping, and Clinical Outcomes . Neurology Genetics 2023 ; 9 : e200103 . OpenUrl 40. ↵ Tian G-F , Azmi H , Takano T , et al. An astrocytic basis of epilepsy . Nature Medicine 2005 ; 11 : 973 – 981 . OpenUrl CrossRef PubMed Web of Science 41. Gómez-Gonzalo M , Losi G , Chiavegato A , et al. An excitatory loop with astrocytes contributes to drive neurons to seizure threshold . PLoS Biology 2010 ; 8 : e1000352 . OpenUrl CrossRef PubMed 42. ↵ Rosch RE , Samarut É. Epileptic Seizures: Glia-Neuron Interactions For Better or For Worse . Current Biology 2019 ; 29 : R1248 – R1251 . OpenUrl View the discussion thread. Back to top Previous Next Posted January 20, 2024. Download PDF Data/Code Email Thank you for your interest in spreading the word about medRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Identification of a novel mosaic MTOR variant in purified neuronal DNA from depth electrodes in a patient with focal cortical dysplasia Message Subject (Your Name) has forwarded a page to you from medRxiv Message Body (Your Name) thought you would like to see this page from the medRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Identification of a novel mosaic MTOR variant in purified neuronal DNA from depth electrodes in a patient with focal cortical dysplasia Karl Martin Klein , Rumika Mascarenhas , Daria Merrikh , Maryam Khanbabaei , Tatiana Maroilley , Navprabhjot Kaur , Yiping Liu , Tyler Soule , Minette Manalo , Goichiro Tamura , Julia Jacobs , Walter Hader , Gerald Pfeffer , Maja Tarailo-Graovac medRxiv 2024.01.18.24301006; doi: https://doi.org/10.1101/2024.01.18.24301006 Share This Article: Copy Citation Tools Identification of a novel mosaic MTOR variant in purified neuronal DNA from depth electrodes in a patient with focal cortical dysplasia Karl Martin Klein , Rumika Mascarenhas , Daria Merrikh , Maryam Khanbabaei , Tatiana Maroilley , Navprabhjot Kaur , Yiping Liu , Tyler Soule , Minette Manalo , Goichiro Tamura , Julia Jacobs , Walter Hader , Gerald Pfeffer , Maja Tarailo-Graovac medRxiv 2024.01.18.24301006; doi: https://doi.org/10.1101/2024.01.18.24301006 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neurology Subject Areas All Articles Addiction Medicine (574) Allergy and Immunology (865) Anesthesia (304) Cardiovascular Medicine (4462) Dentistry and Oral Medicine (445) Dermatology (383) Emergency Medicine (611) Endocrinology (including Diabetes Mellitus and Metabolic Disease) (1517) Epidemiology (15251) Forensic Medicine (31) Gastroenterology (1132) Genetic and Genomic Medicine (6621) Geriatric Medicine (669) Health Economics (1002) Health Informatics (4564) Health Policy (1372) Health Systems and Quality Improvement (1617) Hematology (544) HIV/AIDS (1272) Infectious Diseases (except HIV/AIDS) (15938) Intensive Care and Critical Care Medicine (1107) Medical Education (624) Medical Ethics (147) Nephrology (670) Neurology (6643) Nursing (346) Nutrition (1001) Obstetrics and Gynecology (1149) Occupational and Environmental Health (957) Oncology (3350) Ophthalmology (981) Orthopedics (369) Otolaryngology (421) Pain Medicine (436) Palliative Medicine (130) Pathology (665) Pediatrics (1698) Pharmacology and Therapeutics (694) Primary Care Research (714) Psychiatry and Clinical Psychology (5465) Public and Global Health (9259) Radiology and Imaging (2212) Rehabilitation Medicine and Physical Therapy (1372) Respiratory Medicine (1199) Rheumatology (598) Sexual and Reproductive Health (716) Sports Medicine (533) Surgery (715) Toxicology (100) Transplantation (289) Urology (265) (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'a03dd4c08b79e2c5',t:'MTc4MDE0NTA3NQ=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.