Identification and Molecular Characterization of Carbapenem-Resistant Enterobacteriaceae in hospitalized children in Shandong, China

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background The prevalence of carbapenem-resistant Enterobacteriaceae (CRE) has emerged as a serious public health problem worldwide, and the data on CRE strains that cause infections in hospitalized children in China remains limited. This study aimed to investigate the prevalence and molecular characteristics of CRE in hospitalized children in Shandong, China. Methods A retrospective study was conducted from August to November 2023. Antimicrobial susceptibility testing was performed by the broth microdilution method. Carbapenemase genes, drug resistance genes, and plasmid replicon types were detected using multiplex real-time PCR and whole-genome sequencing. Multilocus sequence typing (MLST) was used to determine the genetic relationships between strains. Results A total of 20 CRE isolates were identified from 432 fecal samples, with a fecal carriage rate of 4.6%. The CRE isolates predominantly consisted of Escherichia coli (E. coli, n = 13) and Klebsiella species (K. pneumonia, n = 5). CRE isolates showed a high resistance rate of 90%-100% to seven β-lactam antibiotics. Resistance rates for other antibiotics such as trimethoprim/sulfamethoxazole, tetracycline, azithromycin, ciprofloxacin, chloramphenicol, nalidixic acid, and streptomycin were 95%, 85%, 85%, 80%, 75%, 75%, and 75%, respectively. CRE isolates showed low resistance to amikacin (20%), and none of the isolates were resistant to colistin and tigecycline. Additionally, the multidrug resistance rate of CRE isolates was 95%. All CRE strains carried sulfonamide antibiotic and β-lactamase resistance genes, of which the most common β-lactamase resistance genes were blaNDM−1 (n = 9), blaNDM−5 (n = 7) and blaOXA−1 (n = 7). Resistance genes to tetracycline and macrolide antibiotics were also widespread among the strains. The study found that IncFIB and IncFII series plasmids were present in 84% and 42% of the CRE strains, respectively. Additionally, Col, IncFIA, IncC, IncHI2, and IncX series plasmids were also detected. MLST analysis revealed diverse sequence types (STs) among CRE isolates, with ST167 being a common ST among E. coli isolates. Conclusion This study revealed blaNDM E. coli were the dominant isolates in fecal samples of hospitalized children in Shandong Province, with a broad multidrug resistance to antibiotics, emphasizing that infection control measures need to be taken to limit the spread of these strains.
Full text 152,727 characters · extracted from preprint-html · click to expand
Identification and Molecular Characterization of Carbapenem-Resistant Enterobacteriaceae in hospitalized children in Shandong, China | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification and Molecular Characterization of Carbapenem-Resistant Enterobacteriaceae in hospitalized children in Shandong, China Xia Deng, Shuyun Wang, Peibin Hou, Na Sun, Ying Yang, Qian Zeng, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4471227/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background The prevalence of carbapenem-resistant Enterobacteriaceae (CRE) has emerged as a serious public health problem worldwide, and the data on CRE strains that cause infections in hospitalized children in China remains limited. This study aimed to investigate the prevalence and molecular characteristics of CRE in hospitalized children in Shandong, China. Methods A retrospective study was conducted from August to November 2023. Antimicrobial susceptibility testing was performed by the broth microdilution method. Carbapenemase genes, drug resistance genes, and plasmid replicon types were detected using multiplex real-time PCR and whole-genome sequencing. Multilocus sequence typing (MLST) was used to determine the genetic relationships between strains. Results A total of 20 CRE isolates were identified from 432 fecal samples, with a fecal carriage rate of 4.6%. The CRE isolates predominantly consisted of Escherichia coli ( E. coli , n = 13) and Klebsiella species ( K. pneumonia , n = 5). CRE isolates showed a high resistance rate of 90%-100% to seven β-lactam antibiotics. Resistance rates for other antibiotics such as trimethoprim/sulfamethoxazole, tetracycline, azithromycin, ciprofloxacin, chloramphenicol, nalidixic acid, and streptomycin were 95%, 85%, 85%, 80%, 75%, 75%, and 75%, respectively. CRE isolates showed low resistance to amikacin (20%), and none of the isolates were resistant to colistin and tigecycline. Additionally, the multidrug resistance rate of CRE isolates was 95%. All CRE strains carried sulfonamide antibiotic and β-lactamase resistance genes, of which the most common β-lactamase resistance genes were bla NDM−1 (n = 9), bla NDM−5 (n = 7) and bla OXA−1 (n = 7). Resistance genes to tetracycline and macrolide antibiotics were also widespread among the strains. The study found that IncFIB and IncFII series plasmids were present in 84% and 42% of the CRE strains, respectively. Additionally, Col, IncFIA, IncC, IncHI2, and IncX series plasmids were also detected. MLST analysis revealed diverse sequence types (STs) among CRE isolates, with ST167 being a common ST among E. coli isolates. Conclusion This study revealed bla NDM E. coli were the dominant isolates in fecal samples of hospitalized children in Shandong Province, with a broad multidrug resistance to antibiotics, emphasizing that infection control measures need to be taken to limit the spread of these strains. Carbapenem-resistant Enterobacteriaceae hospitalized children antimicrobial drug resistance carbapenemase genes Figures Figure 1 Figure 2 Introduction CRE are defined as Enterobacteriaceae , represented by K. pneumoniae and E. coli , that exhibit resistance to carbapenems and are not susceptible to extended spectrum cephalosporins. Carbapenems are a class of broad-spectrum antibiotics that are normally used as the last resort to treat serious gram-negative bacterial infections. The data from the World Health Organization (WHO) showed that CRE has been identified as one of the bacteria for which new antibiotics are urgently needed[ 1 ]. CRE has spread globally, with widespread distribution reported in countries across Europe, Asia, Africa, and the Americas, posing a significant threat to human health[ 2 ]. In recent years, the prevalence of CRE in China has gradually increased. According to China Antimicrobial Surveillance Network (CHINET) data ( www.chinets.com ), the resistance rate of K. pneumoniae to carbapenems has significantly increased from 2.9% in 2005 to 26% in 2023, with this proportion still on the rise. A previous study indicated that the carriage rate of CRE in healthy individuals in Shandong province, China, increased from 2.4% in 2015 to 13.4% in 2017[ 3 ]. This growing trend of CRE infections poses a global threat to public health, especially in hospitalized children. Due to imperfections in immune system development and the limited use of antibiotics in clinical treatment, children are more easily at greater risk from CRE infections. Studies conducted on CRE within the setting of children's hospitals have mostly focused on intensive care units (ICUs). Studies have reported a colonization rate of CRE up to 19.5% in pediatric intensive care units (PICUs)[ 4 , 5 ], with a 30-day mortality rate of 50% in children infected with CRE in PICUs. In Vietnam, 337 of 941 cases (35.8%) during the CRE screening performed on pediatric ICU admissions and cohort care were positive for CRE[ 6 ]. However, there has been relatively limited studies that focus on noncritically ill hospitalized children. In three hospitals in southern China, 158 of 4033 screened fecal samples (3.92%) from pediatric children were CRE positive[ 7 ]. A tertiary pediatric hospital in Shanghai, China collected 880 fecal samples for screening tests. From these, 32 non-duplicate fecal samples from 32 children were identified, each containing a strain of CRE, resulting in a carriage rate of 3.6%[ 8 ]. The risks of CRE infections to noncritically ill hospitalized children should not be ignored. Carbapenemase is the main resistance mechanism of CRE. This type of enzyme belongs to a special type of beta-lactamase that can effectively break down carbapenem antibiotics, leading to bacterial resistance. The main types of carbapenemases include Klebsiella pneumoniae carbapenemase (KPC), New Delhi metallo-β-lactamase(NDM), and Verona Integron-Encoded metallo-β-lactamase (VIM). Among these types, bla NDM is particularly prevalent in children[ 9 ], suggesting that we need to pay special attention to this type of resistance mechanism in antibiotic treatment strategies for children. Numerous variants of the NDM, such as NDM-1 (the primary variant) and its derivatives bla NDM−2 , bla NDM−3 , bla NDM−4 , and bla NDM−5 (secondary variants), have been identified globally[ 10 ]. The genes encoding bla NDM−1 are typically located on plasmids, which facilitates their easy transfer among microorganisms via horizontal gene transfer[ 11 ]. The transmission of bla NDM−1 producing strains can occur through cross-contamination during food preparation or via bodily fluids, a process that can happen in both community and hospital settings[ 12 ]. The presence of these carbapenemase genes in the intestinal microbiota of children is particularly concerning with children serving as carriers and being vulnerable to infection[ 13 ]. The colonization of CRE in the intestines of children might lead to the spread of resistant bacteria within the community and hospitals, posing a risk to other susceptible children. However, relatively little is known about the prevalence of CRE colonization and carbapenemase genes in the intestines of children in northern China. In this study, we isolated and identified CRE strains in fecal samples from hospitalized children in Shandong, northern China, and investigated the molecular epidemiology, antimicrobial drug resistance, and resistance mechanisms of CRE isolates. Genomic characterization indicated the genetic diversity of drug resistance genes in intestinal colonization of CRE isolates, and antimicrobial drug resistance profiles might have become prevalent among CRE strains. Methods and Materials Sample Collection Fecal samples were collected from hospitalized children (aged ≤ 14 years) from August to November 2023 at the Clinical Laboratory of Children's Hospital Affiliated with Shandong University, a major pediatric hospital in Shandong Province, China. Clinical data, including gender, age, department, and reason for visit, were extracted from patient records. Each fecal sample was placed in a separate sterile tube and transported to the laboratory at the Shandong Center for Disease Control and Prevention under refrigeration at 4°C. Isolation of CRE strains Samples were homogenized with 1 ml of 0.9% saline and plated on MacConkey agar containing 2 µg/ml meropenem. Plates were incubated at 37°C for 18–24 hours. Colonies indicative of CRE growth were subcultured on brain heart infusion agar and incubated under the same conditions. The identification of CRE strains was preliminary performed using the MALDI Biotyper sirius IVD (Bruker Daltonics GmbH & Co. KG, Germany) and the VITEK® 2 Compact system (BioMérieux, France). CRE isolates were stored in 40% glycerol at -80°C for further analysis. DNA extraction and carbapenemase genes screening by multiplex real-time PCR To screen for carbapenemase genes in CRE isolates, multiplex real-time PCR was performed on identified CRE strains as previously described [ 14 ]. DNA was extracted from CRE isolates using the Endo-Free Plasmid Mini Kit I (Omega Bio-Tek, USA). DNA concentration was standardized to 10 ng/µL. Carbapenemase genes were detected using multiplex real-time PCR with primers as detailed in Table 1 . The PCR mixture included 12.5 µL of 2× HRM PCR master mix, primers at optimized concentrations (IMP-F and IMP-R at 1.2 µM, others at 0.2 µM), and 1 µL of DNA. PCR was conducted on the QuantStudio 7 Flex (Thermo Fisher Scientific, USA) with the following cycle: initial denaturation at 95°C for 5 min, 35 cycles of denaturation at 95°C for 20 s, annealing at 55°C for 45 s, and extension at 72°C for 30 s. A melt curve from 65°C to 95°C confirmed amplicon specificity. Table 1 Primers used in this study. Target Primer name Sequence (5′ − 3′) Amplicon size (bp) Primer concentration (mM) Tm bla KPC type KPC-F TCGCTAAACTCGAACAGG 785 0.2 91.6 KPC-R TTACTGCCCGTTGACGCCCAATCC bla NDM type NDM-F TTGGCCTTGCTGTCCTTG 82 0.2 84 NDM-R ACACCAGTGACAATATCACCG bla GES type GES-F CTATTACTGGCAGGGATCG 594 0.2 88.6 GES-R CCTCTCAATGGTGTGGGT bla OXA-48 OXA-48-F TGTTTTTGGTGGCATCGAT 177 0.2 81.6 OXA-48-R GTAAMRATGCTTGGTTCGC bla IMP type IMP-F GAGTGGCTTAATTCTCRATC 120 1.2 80.1 IMP-R AACTAYCCAATAYRTAAC bla VIM type VIM-F GTTTGGTCGCATATCGCAAC 382 0.2 90.3 VIM-R AATGCGCAGCACCAGGATAG Antimicrobial susceptibility testing Antimicrobial susceptibility testing was conducted using the Customized AST plate CHNENF (Trek Diagnostic Systems Ltd., United Kingdom) and Sensititre ARIS 2X (Thermo Fisher Scientific, United States) according to the manufacturer’s instructions. The plate includes 17 antimicrobial agents: β-lactam antibiotics including ceftazidime/avibactam (CZA), ertapenem (ETP), cefotaxime ampicillin (CAZ), cefotaxime (CTX), ampicillin (AMP), ampicillin/sulbactam (AMS), meropenem (MEM); tetracycline antibiotics including tigecycline (TIG) and tetracycline (TET); fluoroquinolone drugs including ciprofloxacin (CIP) and nalidixic acid (NAL); aminoglycoside antibiotics including streptomycin (STR) and amikacin (AMI); and azithromycin (AZM), trimethoprim/sulfamethoxazole (SXT), colistin (CT),chloramphenicol (CHL). The strains for quality control were E. coli strain ATCC 25922. Interpretation followed the latest CLSI breakpoints (M100-ED32, M45-ED3, NARMS). Whole Genome Sequencing Genomic DNA was extracted with the TaKaRa MiniBEST Bacterial Genomic DNA Extraction Kit. DNA purity (A260/280 ratio between 1.8 and 2.0) was confirmed via UV spectrophotometry. Sequencing was performed at Novogene Bioinformatics Technology Co., Ltd., Beijing, using the Illumina NovaSeq with a PE150 approach. Sequences were deposited in NCBI GenBank under project number PRJNA1074525. Sequencing data were assembled and analyzed for core genome multilocus sequence typing (cgMLST) clustering through the Foodborne Disease Molecular Traceability Network (TraNet China). Genomic annotation was performed using the Prokka software (version 1.14.6). MLST, resistance genes, and plasmids analysis were conducted using the Pathogenic Microorganism Analysis website ( https://pathogen.watch/genomes/all ). Statistical Analysis Statistical analyses were performed using SPSS software 22 (SPSS Inc., Chicago, IL, USA). The χ2 test was used to evaluate differences in gender data, and the Fisher exact test was used to evaluate differences in age and hospital department data. P < 0.05 was considered a statistically significant difference. Results Samples collection and CRE isolation During the study period, we collected 434 fecal samples from hospitalized children at the Clinical Laboratory of Children's Hospital Affiliated to Shandong University. The mean age of the participants was 5.19 ± 3.53 years (range: 1 day to 14 years), comprising 271 males (62.4%) and 163 females (37.6%), though this difference was not statistically significant ( P > 0.05). We successfully isolated CRE from 20 non-repetitive samples, representing an overall positivity rate of 4.6%. The isolated strains included Escherichia coli (65%, n = 13), Klebsiella spp. (30%, n = 6), and Raoultella planticola (5%, n = 1). The age distribution of CRE-positive samples revealed the highest incidence in the 0 ~ 1 year group (8.5%, 6/71), with no cases detected in the 9 ~ 14 year age group ( P > 0.05). Department-wise, the highest incidence was observed in neonatology and pediatric surgery (18.5%, 5/27), significantly higher than in other departments, such as Gastroenterology, Neuroendocrinology, and Otolaryngology. ( P < 0.05). Screening of carbapenemase genes We initially screened carbapenemase genes using multiplex real-time PCR. Carbapenemase genes were detected in all CRE isolates, with bla NDM being the most prevalent (95%, 19/20), followed by bla GES (5%, 1/20). Other carbapenemase genes such as bla IPM , bla OXA−48 , bla VIM , and bla KPC were not found in our screening. Antimicrobial susceptibility As shown in Table 2 , the resistance profile against β-lactam antibiotics of CRE isolates was 90%-100%, followed by SXT (95%), AMZ (85%), TET (85%), and CIP (80%). The resistance rates to CHL, NAL, and STR were 75%, respectively. CRE isolates showed low resistance to AMI (20%). None of the isolates were resistant to CT and TIG. The susceptibility rates of isolates to TIG and CT were 80% and 20%, respectively. The rate of multidrug resistance of CRE isolates was 95%. Table 2 Minimal inhibitory concentration values of CRE isolates in fecal samples from hospitalized children NO. Strains MIC (µg/ml) CZA ETP MEM CAZ CTX AMP AMS CHL SXT CT AZM STR AMI TIG TET AMP NAL E.1 Escherichia.coli > 8 > 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 64 > 32 <=4 16 > 2 > 32 E.2 Escherichia.coli 0.5 8 2 > 16 > 16 > 32 > 32 > 32 > 8 64 > 32 <=4 2 > 32 E.3 Escherichia.coli > 8 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 8 16 > 32 16 2 > 32 E.4 Escherichia.coli > 8 > 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 0.5 > 64 > 32 64 16 > 2 > 32 E.5 Escherichia.coli > 8 > 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 8 > 64 > 32 > 64 16 > 2 > 32 E.6 Escherichia.coli > 8 > 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 32 16 > 2 > 32 E.7 Escherichia.coli > 8 > 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 1 > 64 > 32 8 16 > 2 > 32 E.8 Escherichia.coli > 8 > 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 64 > 32 <=4 16 > 2 > 32 E.9 Escherichia.coli > 8 8 > 2 > 16 > 16 > 32 > 32 16 <=0.5 <=0.25 64 8 8 > 8 > 2 > 16 > 16 > 32 > 32 8 > 8 <=0.25 32 16 <=4 16 > 2 > 32 E.11 Escherichia.coli > 8 > 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 64 > 32 <=4 16 > 2 > 32 E.12 Escherichia.coli > 8 > 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 32 <=4 16 0.25 8 > 8 > 2 > 16 > 16 > 32 > 32 8 <=0.25 8 <=8 16 0.5 8 k.1 Klebsiella pneumoniae > 8 > 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 64 > 32 <=4 16 > 2 > 32 k.2 Klebsiella pneumoniae > 8 > 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 4 > 64 > 32 64 1 > 16 > 2 > 32 k.3 Klebsiella variicola > 8 > 8 > 2 > 16 > 16 > 32 > 32 4 > 8 <=0.25 8 8 16 0.5 8 k.4 Klebsiella variicola > 8 > 8 > 2 > 16 > 16 > 32 > 32 8 > 8 0.5 > 64 <=8 2 16 k.5 Klebsiella pasteurii > 8 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 8 > 64 > 32 > 64 16 > 2 > 32 k.6 Klebsiella aerogenes 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 <=0.25 64 32 2 > 32 R.1 Raoultella ornithinolytica > 8 > 8 > 2 > 16 > 16 > 32 > 32 > 32 > 8 64 > 32 <=4 16 > 2 > 32 STs patterns As shown in Fig. 1 , MLST revealed 10 sequence types among the 13 carbapenem-resistant E. coli isolates, with ST167 being the most common. Notably, three patients were carried by the carbapenem-resistant E. coli isolates with the same STs patterns and carbapenemases. Among the Klebsiella strains, STs ncluded ST37 and ST462 for K. pneumonia k.2 and k.1, ST3200 for Klebsiella variicola , ST4 for Klebsiella aerogenes , and ST*ff57 for Klebsiella pasteurii. Characteristics of antimicrobial resistance genes All CRE strains tested harbored sulfonamide antibiotic resistance genes and β-lactamase genes (Fig. 2 A). Among them, β-lactamase genes show a high degree of diversity, and common drug resistance genes include bla NDM−1 (n = 9), bla NDM−5 (n = 7) and bla OXA−1 (n = 7), followed by bla CTX−M−55 (n = 5), bla CTX−M−55TEM−1B (n = 4), as well as bla CTX−M−15 , bla SFO−1 , bla CTX−M−27 and bla DHA−1 (n = 5, respectively). In terms of sulfonamide antibiotic resistance genes, most strains harbored sul 1 gene (n = 18), followed by sul 2 (n = 5) and sul 3 (n = 3). Among the TET resistance genes, tet A detected in 11 isolates, tet B detected in 3 isolates, and tet M detected in one isolate. Among the macrolide antibiotic resistance genes, mph A and erm B detected in 11 and 7 isolates, respectively, and msr E and mph E detected in 4 isolates. In addition, this study also found other important resistance genes: 74% of the strains carried TET resistance genes, 79% of the strains carried dihydrofolate reductase genes, of which dfr A12 was detected in 8 isolates, dfr A17 was detected in 6 isolates, 68% of the strains carried multidrug resistance efflux pump genes, of which mdf A was detected in 13 isolates, and 58% of the strains carried antiseptic resistance genes and macrolide antibiotics, of which qnrS1 was detected in 5 isolates, qnrB4 was detected in 3 isolates, 53% of the strains carried fos A3 fenfenicol resistance gene (n = 5), 47% of the strains carried cat B3 CHL resistance gene (n = 6), 32% of the strains carried quinolone resistance genes, and 26% of the strains carried fosfomycin resistance genes. Characteristics of plasmid replicon types In the plasmid analysis of CRE isolates, a distribution of multiple plasmid types was found (Fig. 2 B). IncFIB series plasmids were detected in 84% of strains, of which IncFIB(K) was detected in 5 isolates and IncFIB (AP001918) was detected in 8 isolates, which were the most common plasmid types. IncFIB (pLF82-PhagePlasmid), IncFIB (pKPHS1), IncFIB(K) (pCAV1099-114) and IncFIB (pNDM-Mar) were detected in one strain, respectively. IncFII series plasmids were found in 42% of the strains, including IncFII(pHN7A8), IncFII(29), IncFII(pSE11), IncFII(pAMA1167-NDM-5) and IncFII(K). IncI series plasmids were detected in 21% of strains, with IncI2 (Delta) found in two strains, IncI1-I (Alpha) and IncI2 detected in one strains, respectively.Col series plasmids were found in 37% of strains, including Col(pHAD28)(n = 5) and Col(MG828) (n = 5), and Col(BS512)(n = 2) and Col156(n = 2). In addition, the carriages rates of IncFIA series, IncC series, IncHI2 series and IncX series plasmids of CRE isolates were 37%, 26%, 11% and 16%, respectively. Discussion This study investigated the prevalence of CRE in fecal samples of hospitalized children in Shandong Province and found a CRE detection rate of 4.6% in the children's feces. This rate was comparable to previous report, such as a 4.5% CRE positivity rate in rectal swabs from children in the United Kingdom in 2012[ 15 ], and a 5.2% detection rate in the United States [ 16 ]. In China, a previous study revealed the CRE positivity rate for pediatric inpatients in Southern China is 3.92%[ 7 ], while in Shanghai, the carriage rate for outpatient children was 3.6% in 2016[ 8 ], and 8.6% for hospitalized children in 2019[ 17 ]. Our results indicated that the carriage rate of CRE in children in Shandong, northern China was not significantly higher than in these regions,reflecting a moderate CRE burden in our pediatric population comparable to both Western and other regional Chinese settings. Regarding age grouping, there was no significant difference was found in the detection rate of CRE in children in this study. The overall prevalence of CRE in children in China was reported is 6.4%, with 8.8% in the neonatal period, 7.3% in infancy, 3.8% in toddlerhood, 4.0% in the preschool period, 4.7% in school age, and 7.4% in adolescence[ 18 ]. Notably, our study found that the detection rate in neonatology and neonatal surgery was significantly higher than in other departments. This finding was consistent with a study from the Asian region in 2023, which indicated that infants under one month of age had a higher rate of infection than other children[ 19 ]. This suggests that neonates, particularly those requiring surgical intervention, are at increased susceptibility to CRE infections, underscoring the need for stringent infection control measures in these high-risk areas. This study conducted a detailed analysis of the antimicrobial drug resistance profiles of CRE strains. The findings of this study were consistent with previous reports, confirming that CRE strains were commonly resistant to many classes of antibiotics [ 20 ], which provided an important basis for future prevention and treatment strategies and guidance on antibiotic use. The higher multidrug resistance rate observed in this study further highlighted the major challenges in clinical treatment. It was particularly noteworthy that the resistance rate to β-lactam antibiotics was as high as 90%-100%, which reflected the widespread clinical use of this class of drugs and the corresponding resistance pressure. In addition, the resistance rates to SXT and TET were as high as 95% and 85% respectively, highlighting the prevalence of CRE isolates resistant to these commonly used antimicrobials. Resistance rates to aminoglycoside antibiotics in particular were also detected to be higher, posing a serious challenge to treatment options for pediatric patients, as some key antibiotics had limited use in children. For instance, fluoroquinolones were unsuitable for children and adolescents because of potential damage to joint cartilage and effects on bone growth[ 21 ]; and aminoglycosides, although commonly used, could cause ototoxicity and nephrotoxicity if overused[ 22 ];Tetracycline antibiotics may affect bone and tooth development in children[ 23 ]. At the same time, there were some differences compared to the previous report [ 24 ], which found higher susceptibility rates to CZA and CT. In this study, most CRE isolates showed intermediate resistance to CT, which showed that CT had limited clinical efficacy. Our results showed that CRE strains generally carried multiple drug resistance genes. In particular, β-lactamase genes such as bla NDM−1 , bla NDM−5 , and OXA-1 are ubiquitous among strains, and the high prevalence of these genes was consistent with CRE reported in many countries worldwide [ 25 ]. In addition, a variety of types of resistance genes were discovered in our study, including the sulfa antibiotic resistance genes sul 1, sul2 and sul3 , and the TET resistance gene tet A. The presence of these genes reflected the bacterial response to the environment. Adaptability to antibiotic selection pressures. The prevalence of macrolide antibiotic resistance genes such as mph A and erm B also indicated the difficulties that these antibiotics might encounter in clinical practice[ 26 ]. For fluoroquinolones and other broad-spectrum antibiotics, we observed that 32% of strains carried quinolone resistance genes, a finding consistent with the global trend of increasing quinolone resistance[ 27 ]. The increase in such resistance was associated with a high frequency of use, inappropriate use and widespread use in agriculture[ 28 ]. It was worth noting that the ubiquity of multidrug resistance efflux pump genes such as mdf A illustrates the ability of CRE strains to enhance their drug resistance through multiple mechanisms[ 29 ]. This type of efflux pump could pump a variety of antibiotics out of the cell, effectively reducing the internal antibiotic concentration, thereby reducing the bactericidal or bacteriostatic effect of the antibiotics. The cluster analysis results of this study showed that three patients carried carbapenem-resistant E. coli isolates with ST167, suggesting that dominant strains of this ST type might exist in children's hospitals. It was worth noting that the ST167 strain had not been reported before 2017, but the latest research showed that this strain was not only found in hospital patients but also in healthy individuals, indicating its possible spread in the population wider than expected[ 30 ]. Globally, ST167 strains were widely distributed and found in 164 strains in 25 countries, 95 of which carry the bla NDM gene, and bla NDM−5 was the most common. In China, ST167 strains have the highest prevalence, accounting for 37%[ 31 ]. These data indicated that the prevalence of ST167 carbapenem-resistant E. coli was a public health issue requiring global attention. Moreover, Klebslella pasteurii strain isolated was with unique or incompletely defined sequence type ST*ff57 and the type of Raoultella ornithinolytica strain cannot be determined. Raoultella ornithinolytica was reclassified from the genus Klebsiella in 2001, so data on its epidemiology and clinical relevance are not yet complete, and more studies are needed to determine its ST pattern[ 32 ]. In plasmid analysis, we observed that IncFIB and IncFII series plasmids were extremely prevalent in CRE strains, suggesting that these plasmids might be the main vectors of horizontal transmission of resistance genes. Especially for the IncFIB family, its frequent detection in multiple strains highlighted its central role in the spread of antibiotic resistance. According to existing studies, the high prevalence of plasmids such as IncFIB, IncFII, IncR and IncFIA in CRE further indicated their importance in the spread of multidrug resistance[ 33 ]. These findings highlighted the role of specific plasmids in antibiotic resistance and provided important information for further research and countermeasures. Although the IncX3 plasmid showed high prevalence in environmental samples from Shandong and children's samples from Shanghai[ 17 , 34 ], the detection rate of IncX3 was lower in children's samples from Shandong, while the IncFIB plasmid appeared to be particularly common. This difference might stem from the different compositions of the microbial communities. In our study, the main CRE strain isolated was carbapenem-resistant E. coli . A study on E. coli isolates contained a variety of plasmids, mainly IncFIB (AP001918). This plasmid has been confirmed to be associated with resistance to a variety of antibacterial drugs, including β-lactas, aminoglycosides, sulfonamides, tetracyclines, etc[ 29 ]. These observations highlighted the importance of considering sample type and geography when studying the spread of resistance genes. This study filled a research gap on the carriage of CRE among hospitalized children in Shandong Province, northern China, providing preliminary data for understanding the CRE infection status in this population. However, this present study has limitations, mainly in sample representativeness and the lack of detailed clinical information. First, only stool sample was collected and detected from each child, and collecting and incorporating data from multiple clinical specimens (blood, urine, and sputum) of hospitalized children may provide additional power to our study. Second, due to a lack of adequate clinical information about hospitalize children, stool samples may be obtained from the children after antibiotic treatment; this may have affected the results. Future research should further delineate population characteristics, especially with more exhaustive observation of the neonatal group, to better understand CRE transmission and infection in different populations. Furthermore, studies with larger sample sizes and more techniques are warranted to confirm these findings and investigate the mechanisms of antimicrobial drug resistance underlying the observed associations. Conclusion In summary, this study demonstrated a major intestinal colonization of bla NDM E. coli and K. pneumoniae strains among hospitalized children in Shandong, China. All CRE isolates were extensively multidrug-resistant, with multiple resistance genes and plasmid replicon types. To reduce CRE infection and transmission, it is imperative to rigorously implement prevention and control measures in clinical settings, especially in neonatal departments and other high-risk populations. These measures are crucial for reducing infections by multidrug-resistant bacteria and optimizing clinical antimicrobial treatment. Declarations Acknowledgments We thank Dr. Shuai Liu (Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, China) for reading and revising the manuscript. Funding This work was supported by the Shandong Provincial Natural Science Foundation (ZR2022QH216) and the Weifang City Research on the Spectrum of Diarrheal Pathogens and Disease Burden (LH2022GG03). Data availability statement The datasets presented in the study can be acquired in online repositories. The accession number can be found at: NCBI-PRJNA1074525. Ethics approval and consent to participate Experiments involving human participants were conducted in accordance with the Declaration of Helsinki and approved by the Shandong Second Medical University Ethics Committee (approval No. 2024YX109) and Jinan Children's Hospital Ethics Committee (approval No. SDFE-IRB/P-2024002) in accordance with its guidelines for the protection of human volunteers. Informed consent was obtained from all participants and their parents or legal guardians. Consent for publication Not applicable. Conflict of interest The authors declare no competing interests. References Tacconelli E, Carrara E, Savoldi A, Harbarth S, Mendelson M, Monnet DL, Pulcini C, Kahlmeter G, Kluytmans J, Carmeli Y et al : Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect Dis 2018, 18(3):318-327. Li Y, Sun X, Dong N, Wang Z, Li R: Global distribution and genomic characteristics of carbapenemase-producing Escherichia coli among humans, 2005-2023. Drug Resist Updat 2024, 72:101031. Chen B, Berglund B, Wang S, Borjesson S, Bi Z, Nilsson M, Yin H, Zheng B, Xiao Y, Bi Z et al : Rapid increase in occurrence of carbapenem-resistant Enterobacteriaceae in healthy rural residents in Shandong Province, China, from 2015 to 2017. J Glob Antimicrob Resist 2022, 28:38-42. Krupanandan RK, Kapalavai SK, Ekka AS, Balusamy I, Sadasivam K, Nambi PS, Ramachandran B: Active surveillance for carbapenem resistant enterobacteriaceae (CRE) using stool cultures as a method to decrease CRE infections in the pediatric intensive care unit (PICU). Indian J Med Microbiol 2023, 44:100370. Liu P, Mai Y, Yuan W, Xie L, Ma W, Liu J, Xu L, Yang J, Wang P, Wang H: Risk Factors for Mortality and Antimicrobial Regimens in Pediatric Intensive Care Unit Patients with Carbapenem-Resistant Enterobacteriaceae Infections: A Six-Year Retrospective Study. Infect Drug Resist 2022, 15:7307-7316. Garpvall K, Duong V, Linnros S, Quoc TN, Mucchiano D, Modeen S, Lagercrantz L, Edman A, Le NK, Huong T et al : Admission screening and cohort care decrease carbapenem resistant enterobacteriaceae in Vietnamese pediatric ICU's. Antimicrob Resist Infect Control 2021, 10(1):128. Xiong Z, Zhang C, Sarbandi K, Liang Z, Mai J, Liang B, Cai H, Chen X, Gao F, Lan F et al : Clinical and molecular epidemiology of carbapenem-resistant Enterobacteriaceae in pediatric inpatients in South China. Microbiol Spectr 2023, 11(6):e0283923. Pan F, Tian D, Wang B, Zhao W, Qin H, Zhang T, Zhang H: Fecal carriage and molecular epidemiology of carbapenem-resistant Enterobacteriaceae from outpatient children in Shanghai. BMC Infect Dis 2019, 19(1):678. Fu B, Yin D, Sun C, Shen Y, Liu D, Bai R, Zhang R, Shen J, Hu F, Wang Y: Clonal and Horizontal Transmission of bla(NDM) among Klebsiella pneumoniae in Children's Intensive Care Units. Microbiol Spectr 2022, 10(4):e0157421. Farooq S, Khan AU: Current Update on New Delhi Metallo-beta-lactamase (NDM) Variants: New Challenges in the Journey of Evolution. Curr Protein Pept Sci 2023, 24(8):655-665. Findlay J, Poirel L, Kessler J, Kronenberg A, Nordmann P: New Delhi Metallo-beta-Lactamase-Producing Enterobacterales Bacteria, Switzerland, 2019-2020. Emerg Infect Dis 2021, 27(10):2628-2637. Zhai Y, Lee S, Teng L, Ma Z, Hilliard NB, May RJ, Brown SA, Yu F, Desear KE, Cherabuddi K et al : Dissemination mechanisms of NDM genes in hospitalized patients. JAC Antimicrob Resist 2021, 3(1):dlab032. Xu J, Kong X, Li J, Mao H, Zhu Y, Zhu X, Xu Y: Pediatric intensive care unit treatment alters the diversity and composition of the gut microbiota and antimicrobial resistance gene expression in critically ill children. Front Microbiol 2023, 14:1237993. Monteiro J, Widen RH, Pignatari AC, Kubasek C, Silbert S: Rapid detection of carbapenemase genes by multiplex real-time PCR. J Antimicrob Chemother 2012, 67(4):906-909. Drew RJ, Turton JF, Hill RL, Livermore DM, Woodford N, Paulus S, Cunliffe NA: Emergence of carbapenem-resistant Enterobacteriaceae in a UK paediatric hospital. J Hosp Infect 2013, 84(4):300-304. Logan LK, Renschler JP, Gandra S, Weinstein RA, Laxminarayan R, Centers for Disease C, Prevention Epicenters P: Carbapenem-Resistant Enterobacteriaceae in Children, United States, 1999-2012. Emerg Infect Dis 2015, 21(11):2014-2021. Xu Q, Pan F, Sun Y, Wang C, Shi Y, Zhang T, Yu F, Zhang H: Fecal Carriage and Molecular Epidemiology of Carbapenem-Resistant Enterobacteriaceae from Inpatient Children in a Pediatric Hospital of Shanghai. Infect Drug Resist 2020, 13:4405-4415. Guo Y, Hu FP, Zhu DM, Wang CQ, Wang AM, Zhang H, Wang C, Dong F, Zhen JH, Zhou SP et al : [Antimicrobial resistance changes of carbapenem-resistant Enterobacteriaceae strains isolated from children]. Zhonghua Er Ke Za Zhi 2018, 56(12):907-914. Yen CS, Hsiao HL, Lee CC, Tsai TC, Chen HY, Chen CL, Chiu CH: Carbapenem-resistant Enterobacteriaceae infection in children less than one year old in an Asian medical center. Pediatr Neonatol 2023, 64(2):168-175. Wang Q, Wang X, Wang J, Ouyang P, Jin C, Wang R, Zhang Y, Jin L, Chen H, Wang Z et al : Phenotypic and Genotypic Characterization of Carbapenem-resistantEnterobacteriaceae: Data From a Longitudinal Large-scale CRE Study in China (2012–2016). Clinical Infectious Diseases 2018, 67(suppl_2):S196-S205. Patel K, Goldman JL: Safety Concerns Surrounding Quinolone Use in Children. J Clin Pharmacol 2016, 56(9):1060-1075. Le TA, Hiba T, Chaudhari D, Preston AN, Palowsky ZR, Ahmadzadeh S, Shekoohi S, Cornett EM, Kaye AD: Aminoglycoside-Related Nephrotoxicity and Ototoxicity in Clinical Practice: A Review of Pathophysiological Mechanism and Treatment Options. Adv Ther 2023, 40(4):1357-1365. Sapadin AN, Fleischmajer R: Tetracyclines: nonantibiotic properties and their clinical implications. J Am Acad Dermatol 2006, 54(2):258-265. Zhou H, Zhang K, Chen W, Chen J, Zheng J, Liu C, Cheng L, Zhou W, Shen H, Cao X: Epidemiological characteristics of carbapenem-resistant Enterobacteriaceae collected from 17 hospitals in Nanjing district of China. Antimicrob Resist Infect Control 2020, 9(1):15. Wu W, Feng Y, Tang G, Qiao F, McNally A, Zong Z: NDM Metallo-beta-Lactamases and Their Bacterial Producers in Health Care Settings. Clin Microbiol Rev 2019, 32(2). Cao B, Zhao CJ, Yin YD, Zhao F, Song SF, Bai L, Zhang JZ, Liu YM, Zhang YY, Wang H et al : High prevalence of macrolide resistance in Mycoplasma pneumoniae isolates from adult and adolescent patients with respiratory tract infection in China. Clin Infect Dis 2010, 51(2):189-194. Aldred KJ, Kerns RJ, Osheroff N: Mechanism of quinolone action and resistance. Biochemistry 2014, 53(10):1565-1574. Samreen, Ahmad I, Malak HA, Abulreesh HH: Environmental antimicrobial resistance and its drivers: a potential threat to public health. J Glob Antimicrob Resist 2021, 27:101-111. Zhou W, Lin R, Zhou Z, Ma J, Lin H, Zheng X, Wang J, Wu J, Dong Y, Jiang H et al : Antimicrobial resistance and genomic characterization of Escherichia coli from pigs and chickens in Zhejiang, China. Front Microbiol 2022, 13:1018682. Chen Q, Zou Z, Cai C, Li H, Wang Y, Lei L, Shao B: Characterization of bla(NDM-5)-and bla(CTX-M-199)-Producing ST167 Escherichia coli Isolated from Shared Bikes. Antibiotics (Basel) 2022, 11(8). Li L, Zhang Y, Guo H, Yang J, He F: Genomic insights into a bla(NDM-5)-carrying Escherichia coli ST167 isolate recovered from faecal sample of a healthy individual in China. J Glob Antimicrob Resist 2024, 36:240-243. Hajjar R, Ambaraghassi G, Sebajang H, Schwenter F, Su SH: Raoultella ornithinolytica: Emergence and Resistance. Infect Drug Resist 2020, 13:1091-1104. Livorsi DJ, Chorazy ML, Schweizer ML, Balkenende EC, Blevins AE, Nair R, Samore MH, Nelson RE, Khader K, Perencevich EN: A systematic review of the epidemiology of carbapenem-resistant Enterobacteriaceae in the United States. Antimicrob Resist Infect Control 2018, 7:55. Guo CH, Liu YQ, Li Y, Duan XX, Yang TY, Li FY, Zou M, Liu BT: High prevalence and genomic characteristics of carbapenem-resistant Enterobacteriaceae and colistin-resistant Enterobacteriaceae from large-scale rivers in China. Environ Pollut 2023, 331(Pt 2):121869. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4471227","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":329589194,"identity":"a1c6ca39-8755-419e-bd32-fdac6ada48cc","order_by":0,"name":"Xia Deng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDklEQVRIiWNgGAWjYDCCAyDCgEGOn5n54AOJCiCHmbmBKC3Gku1tyQYWZ0BaGInRwsCQuKHnjJlEZRuITUAL3/Hew695CuwSN0gkGEjcnFcbzd8O1PKjYhtOLZJnzqVZzjBINt4ukZBgOHPb8dwZhxkbGHvO3MapxeBGjpnBBwNm2Z0zEg4kS247ltsA1MLM2IZHy/03ZgYJBvWMG24kNhz+O+dY7nyCWm7wGD/4YHBYccMZoFLJhprcDYS0SJ7JMWOcYXAcFMjMDBLHDuRuBGo5iM8vfMfPGH/m+VMNjEr+7z8kaupy550/fPDBjwrcWoCATQKJcxhMHsCnHgiYPyBx6ggoHgWjYBSMgpEIAHriZHxI8bCYAAAAAElFTkSuQmCC","orcid":"","institution":"Shandong Second Medical University","correspondingAuthor":true,"prefix":"","firstName":"Xia","middleName":"","lastName":"Deng","suffix":""},{"id":329589195,"identity":"50054c4a-0942-48fa-bdc1-8a5de9faf60b","order_by":1,"name":"Shuyun Wang","email":"","orcid":"","institution":"Jinan Children's Hospital, Children's Hospital Affiliated to Shandong University","correspondingAuthor":false,"prefix":"","firstName":"Shuyun","middleName":"","lastName":"Wang","suffix":""},{"id":329589196,"identity":"872dcf5b-81b0-42fc-acfc-d9bb1b05816d","order_by":2,"name":"Peibin Hou","email":"","orcid":"","institution":"Shandong Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Peibin","middleName":"","lastName":"Hou","suffix":""},{"id":329589197,"identity":"bd82979a-4ee7-466a-ab3e-6d50cc3db242","order_by":3,"name":"Na Sun","email":"","orcid":"","institution":"Shandong Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Sun","suffix":""},{"id":329589198,"identity":"8ea54c48-9972-475a-97e0-9f37acb74ea6","order_by":4,"name":"Ying Yang","email":"","orcid":"","institution":"Shandong Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Yang","suffix":""},{"id":329589199,"identity":"74224e39-bfc1-42f4-b1f2-eb1d5eef8c9c","order_by":5,"name":"Qian Zeng","email":"","orcid":"","institution":"Jinan Children's Hospital, Children's Hospital Affiliated to Shandong University","correspondingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Zeng","suffix":""},{"id":329589200,"identity":"e269d335-28b0-4ac2-b3f7-e768fab61a9e","order_by":6,"name":"Juan Wang","email":"","orcid":"","institution":"Jinan Children's Hospital, Children's Hospital Affiliated to Shandong University","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"","lastName":"Wang","suffix":""},{"id":329589201,"identity":"0ea52eae-ba56-409b-9ef2-f60d381710ac","order_by":7,"name":"Chunping Wang","email":"","orcid":"","institution":"Shandong Second Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chunping","middleName":"","lastName":"Wang","suffix":""},{"id":329589202,"identity":"0d83ef45-dfdb-4e69-8b21-6e3b0f870858","order_by":8,"name":"Xin Lv","email":"","orcid":"","institution":"Jinan Children's Hospital, Children's Hospital Affiliated to Shandong University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Lv","suffix":""},{"id":329589203,"identity":"dd33a4e5-3d3e-4ac9-ad6d-5be3b6864ed7","order_by":9,"name":"Wenqiang Zhang","email":"","orcid":"","institution":"Shandong Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Wenqiang","middleName":"","lastName":"Zhang","suffix":""},{"id":329589204,"identity":"fd049060-27ef-4097-b34e-f827c0d3e6fc","order_by":10,"name":"Ruyue Fan","email":"","orcid":"","institution":"Shandong Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Ruyue","middleName":"","lastName":"Fan","suffix":""}],"badges":[],"createdAt":"2024-05-24 08:53:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4471227/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4471227/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60851266,"identity":"4bdd0383-7412-4460-bfcc-42e7c032cc8b","added_by":"auto","created_at":"2024-07-22 21:00:28","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":104572,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eClustering tree constructed using UPGMA algorithm for carbapenem-resistant \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. Annotation information includes MLST typing, CRE genotype, and strain isolation time.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4471227/v1/06db629a88247abcf01a0f64.png"},{"id":60851269,"identity":"5d481d94-72e0-4ecc-8bd7-396aabbf31da","added_by":"auto","created_at":"2024-07-22 21:00:28","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":734177,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA heat-map summary of the sources. \u003c/strong\u003eA. A heat map of antimicrobial resistance genes. B. A heat map of plasmid replicon types.\u003cstrong\u003e \u003c/strong\u003eBlack squares shown indicated the feature of antimicrobial resistance profiles and the plasmid replicon types present in CRE isolates.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4471227/v1/4808774444085b9b02a99a06.png"},{"id":69933027,"identity":"652d866e-6df8-424e-8286-91da954ea84e","added_by":"auto","created_at":"2024-11-26 18:09:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1793332,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4471227/v1/039ddcc4-672e-4502-b028-99bb25a27c60.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Identification and Molecular Characterization of Carbapenem-Resistant Enterobacteriaceae in hospitalized children in Shandong, China","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCRE are defined as \u003cem\u003eEnterobacteriaceae\u003c/em\u003e, represented by \u003cem\u003eK. pneumoniae\u003c/em\u003e and \u003cem\u003eE. coli\u003c/em\u003e, that exhibit resistance to carbapenems and are not susceptible to extended spectrum cephalosporins. Carbapenems are a class of broad-spectrum antibiotics that are normally used as the last resort to treat serious gram-negative bacterial infections. The data from the World Health Organization (WHO) showed that CRE has been identified as one of the bacteria for which new antibiotics are urgently needed[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. CRE has spread globally, with widespread distribution reported in countries across Europe, Asia, Africa, and the Americas, posing a significant threat to human health[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In recent years, the prevalence of CRE in China has gradually increased. According to China Antimicrobial Surveillance Network (CHINET) data (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://www.chinets.com\" target=\"_blank\"\u003ewww.chinets.com\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.chinets.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), the resistance rate of \u003cem\u003eK. pneumoniae\u003c/em\u003e to carbapenems has significantly increased from 2.9% in 2005 to 26% in 2023, with this proportion still on the rise. A previous study indicated that the carriage rate of CRE in healthy individuals in Shandong province, China, increased from 2.4% in 2015 to 13.4% in 2017[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThis growing trend of CRE infections poses a global threat to public health, especially in hospitalized children. Due to imperfections in immune system development and the limited use of antibiotics in clinical treatment, children are more easily at greater risk from CRE infections. Studies conducted on CRE within the setting of children's hospitals have mostly focused on intensive care units (ICUs). Studies have reported a colonization rate of CRE up to 19.5% in pediatric intensive care units (PICUs)[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], with a 30-day mortality rate of 50% in children infected with CRE in PICUs. In Vietnam, 337 of 941 cases (35.8%) during the CRE screening performed on pediatric ICU admissions and cohort care were positive for CRE[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. However, there has been relatively limited studies that focus on noncritically ill hospitalized children. In three hospitals in southern China, 158 of 4033 screened fecal samples (3.92%) from pediatric children were CRE positive[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. A tertiary pediatric hospital in Shanghai, China collected 880 fecal samples for screening tests. From these, 32 non-duplicate fecal samples from 32 children were identified, each containing a strain of CRE, resulting in a carriage rate of 3.6%[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The risks of CRE infections to noncritically ill hospitalized children should not be ignored.\u003c/p\u003e \u003cp\u003eCarbapenemase is the main resistance mechanism of CRE. This type of enzyme belongs to a special type of beta-lactamase that can effectively break down carbapenem antibiotics, leading to bacterial resistance. The main types of carbapenemases include \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e carbapenemase (KPC), New Delhi metallo-β-lactamase(NDM), and Verona Integron-Encoded metallo-β-lactamase (VIM). Among these types, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e is particularly prevalent in children[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], suggesting that we need to pay special attention to this type of resistance mechanism in antibiotic treatment strategies for children. Numerous variants of the NDM, such as NDM-1 (the primary variant) and its derivatives \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;2\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;3\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;4\u003c/sub\u003e, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;5\u003c/sub\u003e (secondary variants), have been identified globally[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The genes encoding \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;1\u003c/sub\u003e are typically located on plasmids, which facilitates their easy transfer among microorganisms via horizontal gene transfer[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The transmission of \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;1\u003c/sub\u003e producing strains can occur through cross-contamination during food preparation or via bodily fluids, a process that can happen in both community and hospital settings[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The presence of these carbapenemase genes in the intestinal microbiota of children is particularly concerning with children serving as carriers and being vulnerable to infection[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The colonization of CRE in the intestines of children might lead to the spread of resistant bacteria within the community and hospitals, posing a risk to other susceptible children. However, relatively little is known about the prevalence of CRE colonization and carbapenemase genes in the intestines of children in northern China.\u003c/p\u003e \u003cp\u003eIn this study, we isolated and identified CRE strains in fecal samples from hospitalized children in Shandong, northern China, and investigated the molecular epidemiology, antimicrobial drug resistance, and resistance mechanisms of CRE isolates. Genomic characterization indicated the genetic diversity of drug resistance genes in intestinal colonization of CRE isolates, and antimicrobial drug resistance profiles might have become prevalent among CRE strains.\u003c/p\u003e"},{"header":"Methods and Materials","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample Collection\u003c/h2\u003e \u003cp\u003eFecal samples were collected from hospitalized children (aged\u0026thinsp;\u0026le;\u0026thinsp;14 years) from August to November 2023 at the Clinical Laboratory of Children's Hospital Affiliated with Shandong University, a major pediatric hospital in Shandong Province, China. Clinical data, including gender, age, department, and reason for visit, were extracted from patient records. Each fecal sample was placed in a separate sterile tube and transported to the laboratory at the Shandong Center for Disease Control and Prevention under refrigeration at 4\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eIsolation of CRE strains\u003c/h2\u003e \u003cp\u003eSamples were homogenized with 1 ml of 0.9% saline and plated on MacConkey agar containing 2 \u0026micro;g/ml meropenem. Plates were incubated at 37\u0026deg;C for 18\u0026ndash;24 hours. Colonies indicative of CRE growth were subcultured on brain heart infusion agar and incubated under the same conditions. The identification of CRE strains was preliminary performed using the MALDI Biotyper sirius IVD (Bruker Daltonics GmbH \u0026amp; Co. KG, Germany) and the VITEK\u0026reg; 2 Compact system (BioM\u0026eacute;rieux, France). CRE isolates were stored in 40% glycerol at -80\u0026deg;C for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eDNA extraction and carbapenemase genes screening by multiplex real-time PCR\u003c/h2\u003e \u003cp\u003eTo screen for carbapenemase genes in CRE isolates, multiplex real-time PCR was performed on identified CRE strains as previously described [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. DNA was extracted from CRE isolates using the Endo-Free Plasmid Mini Kit I (Omega Bio-Tek, USA). DNA concentration was standardized to 10 ng/\u0026micro;L. Carbapenemase genes were detected using multiplex real-time PCR with primers as detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The PCR mixture included 12.5 \u0026micro;L of 2\u0026times; HRM PCR master mix, primers at optimized concentrations (IMP-F and IMP-R at 1.2 \u0026micro;M, others at 0.2 \u0026micro;M), and 1 \u0026micro;L of DNA. PCR was conducted on the QuantStudio 7 Flex (Thermo Fisher Scientific, USA) with the following cycle: initial denaturation at 95\u0026deg;C for 5 min, 35 cycles of denaturation at 95\u0026deg;C for 20 s, annealing at 55\u0026deg;C for 45 s, and extension at 72\u0026deg;C for 30 s. A melt curve from 65\u0026deg;C to 95\u0026deg;C confirmed amplicon specificity.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5\u0026prime; \u0026minus;\u0026thinsp;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAmplicon size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePrimer concentration (mM)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTm\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003eKPC type\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKPC-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGCTAAACTCGAACAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e785\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e91.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKPC-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTACTGCCCGTTGACGCCCAATCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003eNDM type\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNDM-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGGCCTTGCTGTCCTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e84\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNDM-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACACCAGTGACAATATCACCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003eGES type\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGES-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTATTACTGGCAGGGATCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e594\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e88.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGES-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTCTCAATGGTGTGGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003eOXA-48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOXA-48-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTTTTTGGTGGCATCGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e177\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e81.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOXA-48-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTAAMRATGCTTGGTTCGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003eIMP type\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIMP-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGTGGCTTAATTCTCRATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e120\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e80.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIMP-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAACTAYCCAATAYRTAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003eVIM type\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVIM-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTTGGTCGCATATCGCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e382\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e90.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVIM-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAATGCGCAGCACCAGGATAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAntimicrobial susceptibility testing\u003c/h2\u003e \u003cp\u003eAntimicrobial susceptibility testing was conducted using the Customized AST plate CHNENF (Trek Diagnostic Systems Ltd., United Kingdom) and Sensititre ARIS 2X (Thermo Fisher Scientific, United States) according to the manufacturer\u0026rsquo;s instructions. The plate includes 17 antimicrobial agents: β-lactam antibiotics including ceftazidime/avibactam (CZA), ertapenem (ETP), cefotaxime ampicillin (CAZ), cefotaxime (CTX), ampicillin (AMP), ampicillin/sulbactam (AMS), meropenem (MEM); tetracycline antibiotics including tigecycline (TIG) and tetracycline (TET); fluoroquinolone drugs including ciprofloxacin (CIP) and nalidixic acid (NAL); aminoglycoside antibiotics including streptomycin (STR) and amikacin (AMI); and azithromycin (AZM), trimethoprim/sulfamethoxazole (SXT), colistin (CT),chloramphenicol (CHL). The strains for quality control were \u003cem\u003eE. coli\u003c/em\u003e strain ATCC 25922. Interpretation followed the latest CLSI breakpoints (M100-ED32, M45-ED3, NARMS).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eWhole Genome Sequencing\u003c/h2\u003e \u003cp\u003eGenomic DNA was extracted with the TaKaRa MiniBEST Bacterial Genomic DNA Extraction Kit. DNA purity (A260/280 ratio between 1.8 and 2.0) was confirmed via UV spectrophotometry. Sequencing was performed at Novogene Bioinformatics Technology Co., Ltd., Beijing, using the Illumina NovaSeq with a PE150 approach. Sequences were deposited in NCBI GenBank under project number PRJNA1074525.\u003c/p\u003e \u003cp\u003eSequencing data were assembled and analyzed for core genome multilocus sequence typing (cgMLST) clustering through the Foodborne Disease Molecular Traceability Network (TraNet China). Genomic annotation was performed using the Prokka software (version 1.14.6). MLST, resistance genes, and plasmids analysis were conducted using the Pathogenic Microorganism Analysis website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pathogen.watch/genomes/all\u003c/span\u003e\u003cspan address=\"https://pathogen.watch/genomes/all\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were performed using SPSS software 22 (SPSS Inc., Chicago, IL, USA). The χ2 test was used to evaluate differences in gender data, and the Fisher exact test was used to evaluate differences in age and hospital department data. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered a statistically significant difference.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eSamples collection and CRE isolation\u003c/h2\u003e \u003cp\u003eDuring the study period, we collected 434 fecal samples from hospitalized children at the Clinical Laboratory of Children's Hospital Affiliated to Shandong University. The mean age of the participants was 5.19\u0026thinsp;\u0026plusmn;\u0026thinsp;3.53 years (range: 1 day to 14 years), comprising 271 males (62.4%) and 163 females (37.6%), though this difference was not statistically significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). We successfully isolated CRE from 20 non-repetitive samples, representing an overall positivity rate of 4.6%. The isolated strains included \u003cem\u003eEscherichia coli\u003c/em\u003e (65%, n\u0026thinsp;=\u0026thinsp;13), \u003cem\u003eKlebsiella\u003c/em\u003e spp. (30%, n\u0026thinsp;=\u0026thinsp;6), and \u003cem\u003eRaoultella planticola\u003c/em\u003e (5%, n\u0026thinsp;=\u0026thinsp;1). The age distribution of CRE-positive samples revealed the highest incidence in the 0\u0026thinsp;~\u0026thinsp;1 year group (8.5%, 6/71), with no cases detected in the 9\u0026thinsp;~\u0026thinsp;14 year age group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Department-wise, the highest incidence was observed in neonatology and pediatric surgery (18.5%, 5/27), significantly higher than in other departments, such as Gastroenterology, Neuroendocrinology, and Otolaryngology. (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eScreening of carbapenemase genes\u003c/h2\u003e \u003cp\u003eWe initially screened carbapenemase genes using multiplex real-time PCR. Carbapenemase genes were detected in all CRE isolates, with \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e being the most prevalent (95%, 19/20), followed by \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eGES\u003c/sub\u003e (5%, 1/20). Other carbapenemase genes such as \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eIPM\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA\u0026minus;48\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eVIM\u003c/sub\u003e, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eKPC\u003c/sub\u003e were not found in our screening.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAntimicrobial susceptibility\u003c/h2\u003e \u003cp\u003eAs shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, the resistance profile against β-lactam antibiotics of CRE isolates was 90%-100%, followed by SXT (95%), AMZ (85%), TET (85%), and CIP (80%). The resistance rates to CHL, NAL, and STR were 75%, respectively. CRE isolates showed low resistance to AMI (20%). None of the isolates were resistant to CT and TIG. The susceptibility rates of isolates to TIG and CT were 80% and 20%, respectively. The rate of multidrug resistance of CRE isolates was 95%.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMinimal inhibitory concentration values of CRE isolates in fecal samples from hospitalized children\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"19\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c15\" colnum=\"15\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c16\" colnum=\"16\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c17\" colnum=\"17\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c18\" colnum=\"18\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c19\" colnum=\"19\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNO.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eStrains\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"17\" nameend=\"c19\" namest=\"c3\"\u003e \u003cp\u003eMIC (\u0026micro;g/ml)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCZA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eETP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMEM\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCAZ\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCTX\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eAMP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eAMS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCHL\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eSXT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003eAZM\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c14\"\u003e \u003cp\u003eSTR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c15\"\u003e \u003cp\u003eAMI\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c16\"\u003e \u003cp\u003eTIG\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c17\"\u003e \u003cp\u003eTET\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c18\"\u003e \u003cp\u003eAMP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c19\"\u003e \u003cp\u003eNAL\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026lt;=0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eEscherichia.coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026lt;=8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ek.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ek.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ek.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eKlebsiella variicola\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ek.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eKlebsiella variicola\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026lt;=8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ek.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eKlebsiella pasteurii\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ek.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eKlebsiella aerogenes\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eR.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eRaoultella ornithinolytica\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u0026lt;=4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026lt;=0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eSTs patterns\u003c/h2\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, MLST revealed 10 sequence types among the 13 carbapenem-resistant \u003cem\u003eE. coli\u003c/em\u003e isolates, with ST167 being the most common. Notably, three patients were carried by the carbapenem-resistant \u003cem\u003eE. coli\u003c/em\u003e isolates with the same STs patterns and carbapenemases. Among the \u003cem\u003eKlebsiella\u003c/em\u003e strains, STs ncluded ST37 and ST462 for \u003cem\u003eK. pneumonia\u003c/em\u003e k.2 \u003cem\u003eand\u003c/em\u003e k.1, ST3200 for \u003cem\u003eKlebsiella variicola\u003c/em\u003e, ST4 for \u003cem\u003eKlebsiella aerogenes\u003c/em\u003e, and ST*ff57 for \u003cem\u003eKlebsiella pasteurii.\u003c/em\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCharacteristics of antimicrobial resistance genes\u003c/h2\u003e \u003cp\u003eAll CRE strains tested harbored sulfonamide antibiotic resistance genes and β-lactamase genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Among them, β-lactamase genes show a high degree of diversity, and common drug resistance genes include \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;1\u003c/sub\u003e (n\u0026thinsp;=\u0026thinsp;9), \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;5\u003c/sub\u003e (n\u0026thinsp;=\u0026thinsp;7) and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA\u0026minus;1\u003c/sub\u003e (n\u0026thinsp;=\u0026thinsp;7), followed by \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u0026minus;55\u003c/sub\u003e (n\u0026thinsp;=\u0026thinsp;5), \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u0026minus;55TEM\u0026minus;1B\u003c/sub\u003e (n\u0026thinsp;=\u0026thinsp;4), as well as \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u0026minus;15\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eSFO\u0026minus;1\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u0026minus;27\u003c/sub\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eDHA\u0026minus;1\u003c/sub\u003e (n\u0026thinsp;=\u0026thinsp;5, respectively). In terms of sulfonamide antibiotic resistance genes, most strains harbored \u003cem\u003esul\u003c/em\u003e1 gene (n\u0026thinsp;=\u0026thinsp;18), followed by \u003cem\u003esul\u003c/em\u003e2 (n\u0026thinsp;=\u0026thinsp;5) and \u003cem\u003esul\u003c/em\u003e3 (n\u0026thinsp;=\u0026thinsp;3). Among the TET resistance genes, \u003cem\u003etet\u003c/em\u003eA detected in 11 isolates, \u003cem\u003etet\u003c/em\u003eB detected in 3 isolates, and \u003cem\u003etet\u003c/em\u003eM detected in one isolate. Among the macrolide antibiotic resistance genes, \u003cem\u003emph\u003c/em\u003eA and \u003cem\u003eerm\u003c/em\u003eB detected in 11 and 7 isolates, respectively, and \u003cem\u003emsr\u003c/em\u003eE and \u003cem\u003emph\u003c/em\u003eE detected in 4 isolates.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn addition, this study also found other important resistance genes: 74% of the strains carried TET resistance genes, 79% of the strains carried dihydrofolate reductase genes, of which \u003cem\u003edfr\u003c/em\u003eA12 \u003cem\u003ewas\u003c/em\u003e detected in 8 isolates, \u003cem\u003edfr\u003c/em\u003eA17 \u003cem\u003ewas\u003c/em\u003e detected in 6 isolates, 68% of the strains carried multidrug resistance efflux pump genes, of which \u003cem\u003emdf\u003c/em\u003eA \u003cem\u003ewas\u003c/em\u003e detected in 13 isolates, and 58% of the strains carried antiseptic resistance genes and macrolide antibiotics, of which \u003cem\u003eqnrS1 was\u003c/em\u003e detected in 5 isolates, \u003cem\u003eqnrB4 was\u003c/em\u003e detected in 3 isolates, 53% of the strains carried \u003cem\u003efos\u003c/em\u003eA3 fenfenicol resistance gene (n\u0026thinsp;=\u0026thinsp;5), 47% of the strains carried \u003cem\u003ecat\u003c/em\u003eB3 CHL resistance gene (n\u0026thinsp;=\u0026thinsp;6), 32% of the strains carried quinolone resistance genes, and 26% of the strains carried fosfomycin resistance genes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eCharacteristics of plasmid replicon types\u003c/h2\u003e \u003cp\u003eIn the plasmid analysis of CRE isolates, a distribution of multiple plasmid types was found (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). IncFIB series plasmids were detected in 84% of strains, of which IncFIB(K) was detected in 5 isolates and IncFIB (AP001918) was detected in 8 isolates, which were the most common plasmid types. IncFIB (pLF82-PhagePlasmid), IncFIB (pKPHS1), IncFIB(K) (pCAV1099-114) and IncFIB (pNDM-Mar) were detected in one strain, respectively. IncFII series plasmids were found in 42% of the strains, including IncFII(pHN7A8), IncFII(29), IncFII(pSE11), IncFII(pAMA1167-NDM-5) and IncFII(K). IncI series plasmids were detected in 21% of strains, with IncI2 (Delta) found in two strains, IncI1-I (Alpha) and IncI2 detected in one strains, respectively.Col series plasmids were found in 37% of strains, including Col(pHAD28)(n\u0026thinsp;=\u0026thinsp;5) and Col(MG828) (n\u0026thinsp;=\u0026thinsp;5), and Col(BS512)(n\u0026thinsp;=\u0026thinsp;2) and Col156(n\u0026thinsp;=\u0026thinsp;2). In addition, the carriages rates of IncFIA series, IncC series, IncHI2 series and IncX series plasmids of CRE isolates were 37%, 26%, 11% and 16%, respectively.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study investigated the prevalence of CRE in fecal samples of hospitalized children in Shandong Province and found a CRE detection rate of 4.6% in the children's feces. This rate was comparable to previous report, such as a 4.5% CRE positivity rate in rectal swabs from children in the United Kingdom in 2012[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], and a 5.2% detection rate in the United States [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In China, a previous study revealed the CRE positivity rate for pediatric inpatients in Southern China is 3.92%[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], while in Shanghai, the carriage rate for outpatient children was 3.6% in 2016[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], and 8.6% for hospitalized children in 2019[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Our results indicated that the carriage rate of CRE in children in Shandong, northern China was not significantly higher than in these regions,reflecting a moderate CRE burden in our pediatric population comparable to both Western and other regional Chinese settings.\u003c/p\u003e \u003cp\u003eRegarding age grouping, there was no significant difference was found in the detection rate of CRE in children in this study. The overall prevalence of CRE in children in China was reported is 6.4%, with 8.8% in the neonatal period, 7.3% in infancy, 3.8% in toddlerhood, 4.0% in the preschool period, 4.7% in school age, and 7.4% in adolescence[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Notably, our study found that the detection rate in neonatology and neonatal surgery was significantly higher than in other departments. This finding was consistent with a study from the Asian region in 2023, which indicated that infants under one month of age had a higher rate of infection than other children[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. This suggests that neonates, particularly those requiring surgical intervention, are at increased susceptibility to CRE infections, underscoring the need for stringent infection control measures in these high-risk areas.\u003c/p\u003e \u003cp\u003eThis study conducted a detailed analysis of the antimicrobial drug resistance profiles of CRE strains. The findings of this study were consistent with previous reports, confirming that CRE strains were commonly resistant to many classes of antibiotics [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], which provided an important basis for future prevention and treatment strategies and guidance on antibiotic use. The higher multidrug resistance rate observed in this study further highlighted the major challenges in clinical treatment. It was particularly noteworthy that the resistance rate to β-lactam antibiotics was as high as 90%-100%, which reflected the widespread clinical use of this class of drugs and the corresponding resistance pressure. In addition, the resistance rates to SXT and TET were as high as 95% and 85% respectively, highlighting the prevalence of CRE isolates resistant to these commonly used antimicrobials. Resistance rates to aminoglycoside antibiotics in particular were also detected to be higher, posing a serious challenge to treatment options for pediatric patients, as some key antibiotics had limited use in children. For instance, fluoroquinolones were unsuitable for children and adolescents because of potential damage to joint cartilage and effects on bone growth[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]; and aminoglycosides, although commonly used, could cause ototoxicity and nephrotoxicity if overused[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e];Tetracycline antibiotics may affect bone and tooth development in children[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. At the same time, there were some differences compared to the previous report [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], which found higher susceptibility rates to CZA and CT. In this study, most CRE isolates showed intermediate resistance to CT, which showed that CT had limited clinical efficacy.\u003c/p\u003e \u003cp\u003eOur results showed that CRE strains generally carried multiple drug resistance genes. In particular, β-lactamase genes such as \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;1\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eNDM\u0026minus;5\u003c/em\u003e\u003c/sub\u003e, and \u003cem\u003eOXA-1\u003c/em\u003e are ubiquitous among strains, and the high prevalence of these genes was consistent with CRE reported in many countries worldwide [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In addition, a variety of types of resistance genes were discovered in our study, including the sulfa antibiotic resistance genes \u003cem\u003esul\u003c/em\u003e1, \u003cem\u003esul2\u003c/em\u003e and \u003cem\u003esul3\u003c/em\u003e, and the TET resistance gene \u003cem\u003etet\u003c/em\u003eA. The presence of these genes reflected the bacterial response to the environment. Adaptability to antibiotic selection pressures. The prevalence of macrolide antibiotic resistance genes such as \u003cem\u003emph\u003c/em\u003eA and \u003cem\u003eerm\u003c/em\u003eB also indicated the difficulties that these antibiotics might encounter in clinical practice[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. For fluoroquinolones and other broad-spectrum antibiotics, we observed that 32% of strains carried quinolone resistance genes, a finding consistent with the global trend of increasing quinolone resistance[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The increase in such resistance was associated with a high frequency of use, inappropriate use and widespread use in agriculture[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. It was worth noting that the ubiquity of multidrug resistance efflux pump genes such as \u003cem\u003emdf\u003c/em\u003eA illustrates the ability of CRE strains to enhance their drug resistance through multiple mechanisms[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. This type of efflux pump could pump a variety of antibiotics out of the cell, effectively reducing the internal antibiotic concentration, thereby reducing the bactericidal or bacteriostatic effect of the antibiotics.\u003c/p\u003e \u003cp\u003eThe cluster analysis results of this study showed that three patients carried carbapenem-resistant \u003cem\u003eE. coli\u003c/em\u003e isolates with ST167, suggesting that dominant strains of this ST type might exist in children's hospitals. It was worth noting that the ST167 strain had not been reported before 2017, but the latest research showed that this strain was not only found in hospital patients but also in healthy individuals, indicating its possible spread in the population wider than expected[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Globally, \u003cem\u003eST167\u003c/em\u003e strains were widely distributed and found in 164 strains in 25 countries, 95 of which carry the bla\u003csub\u003eNDM\u003c/sub\u003e gene, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eNDM\u0026minus;5\u003c/em\u003e\u003c/sub\u003e was the most common. In China, ST167 strains have the highest prevalence, accounting for 37%[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. These data indicated that the prevalence of \u003cem\u003eST167\u003c/em\u003e carbapenem-resistant \u003cem\u003eE. coli\u003c/em\u003e was a public health issue requiring global attention. Moreover, \u003cem\u003eKlebslella pasteurii\u003c/em\u003e strain isolated was with unique or incompletely defined sequence type ST*ff57 and the type of \u003cem\u003eRaoultella ornithinolytica\u003c/em\u003e strain cannot be determined. \u003cem\u003eRaoultella ornithinolytica\u003c/em\u003e was reclassified from the genus \u003cem\u003eKlebsiella\u003c/em\u003e in 2001, so data on its epidemiology and clinical relevance are not yet complete, and more studies are needed to determine its ST pattern[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn plasmid analysis, we observed that IncFIB and IncFII series plasmids were extremely prevalent in CRE strains, suggesting that these plasmids might be the main vectors of horizontal transmission of resistance genes. Especially for the IncFIB family, its frequent detection in multiple strains highlighted its central role in the spread of antibiotic resistance. According to existing studies, the high prevalence of plasmids such as IncFIB, IncFII, IncR and IncFIA in CRE further indicated their importance in the spread of multidrug resistance[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. These findings highlighted the role of specific plasmids in antibiotic resistance and provided important information for further research and countermeasures. Although the IncX3 plasmid showed high prevalence in environmental samples from Shandong and children's samples from Shanghai[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], the detection rate of IncX3 was lower in children's samples from Shandong, while the IncFIB plasmid appeared to be particularly common. This difference might stem from the different compositions of the microbial communities. In our study, the main CRE strain isolated was carbapenem-resistant \u003cem\u003eE. coli\u003c/em\u003e. A study on \u003cem\u003eE. coli\u003c/em\u003e isolates contained a variety of plasmids, mainly IncFIB (AP001918). This plasmid has been confirmed to be associated with resistance to a variety of antibacterial drugs, including β-lactas, aminoglycosides, sulfonamides, tetracyclines, etc[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. These observations highlighted the importance of considering sample type and geography when studying the spread of resistance genes.\u003c/p\u003e \u003cp\u003eThis study filled a research gap on the carriage of CRE among hospitalized children in Shandong Province, northern China, providing preliminary data for understanding the CRE infection status in this population. However, this present study has limitations, mainly in sample representativeness and the lack of detailed clinical information. First, only stool sample was collected and detected from each child, and collecting and incorporating data from multiple clinical specimens (blood, urine, and sputum) of hospitalized children may provide additional power to our study. Second, due to a lack of adequate clinical information about hospitalize children, stool samples may be obtained from the children after antibiotic treatment; this may have affected the results. Future research should further delineate population characteristics, especially with more exhaustive observation of the neonatal group, to better understand CRE transmission and infection in different populations. Furthermore, studies with larger sample sizes and more techniques are warranted to confirm these findings and investigate the mechanisms of antimicrobial drug resistance underlying the observed associations.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, this study demonstrated a major intestinal colonization of \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e \u003cem\u003eE. coli\u003c/em\u003e and \u003cem\u003eK. pneumoniae\u003c/em\u003e strains among hospitalized children in Shandong, China. All CRE isolates were extensively multidrug-resistant, with multiple resistance genes and plasmid replicon types. To reduce CRE infection and transmission, it is imperative to rigorously implement prevention and control measures in clinical settings, especially in neonatal departments and other high-risk populations. These measures are crucial for reducing infections by multidrug-resistant bacteria and optimizing clinical antimicrobial treatment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Dr. Shuai Liu (Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, China) for reading and revising the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Shandong Provincial Natural Science Foundation (ZR2022QH216) and the Weifang City Research on the Spectrum of Diarrheal Pathogens and Disease Burden (LH2022GG03).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets presented in the study can be acquired in online repositories. The accession number can be found at: NCBI-PRJNA1074525.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExperiments involving human participants were conducted in accordance with the Declaration of Helsinki and approved by the Shandong Second Medical University Ethics Committee (approval No. 2024YX109) and Jinan Children\u0026apos;s Hospital Ethics Committee (approval No. SDFE-IRB/P-2024002) in accordance with its guidelines for the protection of human volunteers. Informed consent was obtained from all participants and their parents or legal guardians.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eTacconelli E, Carrara E, Savoldi A, Harbarth S, Mendelson M, Monnet DL, Pulcini C, Kahlmeter G, Kluytmans J, Carmeli Y\u003cem\u003e et al\u003c/em\u003e: Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. \u003cem\u003eLancet Infect Dis \u003c/em\u003e2018, 18(3):318-327.\u003c/li\u003e\n\u003cli\u003eLi Y, Sun X, Dong N, Wang Z, Li R: Global distribution and genomic characteristics of carbapenemase-producing Escherichia coli among humans, 2005-2023. \u003cem\u003eDrug Resist Updat \u003c/em\u003e2024, 72:101031.\u003c/li\u003e\n\u003cli\u003eChen B, Berglund B, Wang S, Borjesson S, Bi Z, Nilsson M, Yin H, Zheng B, Xiao Y, Bi Z\u003cem\u003e et al\u003c/em\u003e: Rapid increase in occurrence of carbapenem-resistant Enterobacteriaceae in healthy rural residents in Shandong Province, China, from 2015 to 2017. \u003cem\u003eJ Glob Antimicrob Resist \u003c/em\u003e2022, 28:38-42.\u003c/li\u003e\n\u003cli\u003eKrupanandan RK, Kapalavai SK, Ekka AS, Balusamy I, Sadasivam K, Nambi PS, Ramachandran B: Active surveillance for carbapenem resistant enterobacteriaceae (CRE) using stool cultures as a method to decrease CRE infections in the pediatric intensive care unit (PICU). \u003cem\u003eIndian J Med Microbiol \u003c/em\u003e2023, 44:100370.\u003c/li\u003e\n\u003cli\u003eLiu P, Mai Y, Yuan W, Xie L, Ma W, Liu J, Xu L, Yang J, Wang P, Wang H: Risk Factors for Mortality and Antimicrobial Regimens in Pediatric Intensive Care Unit Patients with Carbapenem-Resistant Enterobacteriaceae Infections: A Six-Year Retrospective Study. \u003cem\u003eInfect Drug Resist \u003c/em\u003e2022, 15:7307-7316.\u003c/li\u003e\n\u003cli\u003eGarpvall K, Duong V, Linnros S, Quoc TN, Mucchiano D, Modeen S, Lagercrantz L, Edman A, Le NK, Huong T\u003cem\u003e et al\u003c/em\u003e: Admission screening and cohort care decrease carbapenem resistant enterobacteriaceae in Vietnamese pediatric ICU\u0026apos;s. \u003cem\u003eAntimicrob Resist Infect Control \u003c/em\u003e2021, 10(1):128.\u003c/li\u003e\n\u003cli\u003eXiong Z, Zhang C, Sarbandi K, Liang Z, Mai J, Liang B, Cai H, Chen X, Gao F, Lan F\u003cem\u003e et al\u003c/em\u003e: Clinical and molecular epidemiology of carbapenem-resistant Enterobacteriaceae in pediatric inpatients in South China. \u003cem\u003eMicrobiol Spectr \u003c/em\u003e2023, 11(6):e0283923.\u003c/li\u003e\n\u003cli\u003ePan F, Tian D, Wang B, Zhao W, Qin H, Zhang T, Zhang H: Fecal carriage and molecular epidemiology of carbapenem-resistant Enterobacteriaceae from outpatient children in Shanghai. \u003cem\u003eBMC Infect Dis \u003c/em\u003e2019, 19(1):678.\u003c/li\u003e\n\u003cli\u003eFu B, Yin D, Sun C, Shen Y, Liu D, Bai R, Zhang R, Shen J, Hu F, Wang Y: Clonal and Horizontal Transmission of bla(NDM) among Klebsiella pneumoniae in Children\u0026apos;s Intensive Care Units. \u003cem\u003eMicrobiol Spectr \u003c/em\u003e2022, 10(4):e0157421.\u003c/li\u003e\n\u003cli\u003eFarooq S, Khan AU: Current Update on New Delhi Metallo-beta-lactamase (NDM) Variants: New Challenges in the Journey of Evolution. \u003cem\u003eCurr Protein Pept Sci \u003c/em\u003e2023, 24(8):655-665.\u003c/li\u003e\n\u003cli\u003eFindlay J, Poirel L, Kessler J, Kronenberg A, Nordmann P: New Delhi Metallo-beta-Lactamase-Producing Enterobacterales Bacteria, Switzerland, 2019-2020. \u003cem\u003eEmerg Infect Dis \u003c/em\u003e2021, 27(10):2628-2637.\u003c/li\u003e\n\u003cli\u003eZhai Y, Lee S, Teng L, Ma Z, Hilliard NB, May RJ, Brown SA, Yu F, Desear KE, Cherabuddi K\u003cem\u003e et al\u003c/em\u003e: Dissemination mechanisms of NDM genes in hospitalized patients. \u003cem\u003eJAC Antimicrob Resist \u003c/em\u003e2021, 3(1):dlab032.\u003c/li\u003e\n\u003cli\u003eXu J, Kong X, Li J, Mao H, Zhu Y, Zhu X, Xu Y: Pediatric intensive care unit treatment alters the diversity and composition of the gut microbiota and antimicrobial resistance gene expression in critically ill children. \u003cem\u003eFront Microbiol \u003c/em\u003e2023, 14:1237993.\u003c/li\u003e\n\u003cli\u003eMonteiro J, Widen RH, Pignatari AC, Kubasek C, Silbert S: Rapid detection of carbapenemase genes by multiplex real-time PCR. \u003cem\u003eJ Antimicrob Chemother \u003c/em\u003e2012, 67(4):906-909.\u003c/li\u003e\n\u003cli\u003eDrew RJ, Turton JF, Hill RL, Livermore DM, Woodford N, Paulus S, Cunliffe NA: Emergence of carbapenem-resistant Enterobacteriaceae in a UK paediatric hospital. \u003cem\u003eJ Hosp Infect \u003c/em\u003e2013, 84(4):300-304.\u003c/li\u003e\n\u003cli\u003eLogan LK, Renschler JP, Gandra S, Weinstein RA, Laxminarayan R, Centers for Disease C, Prevention Epicenters P: Carbapenem-Resistant Enterobacteriaceae in Children, United States, 1999-2012. \u003cem\u003eEmerg Infect Dis \u003c/em\u003e2015, 21(11):2014-2021.\u003c/li\u003e\n\u003cli\u003eXu Q, Pan F, Sun Y, Wang C, Shi Y, Zhang T, Yu F, Zhang H: Fecal Carriage and Molecular Epidemiology of Carbapenem-Resistant Enterobacteriaceae from Inpatient Children in a Pediatric Hospital of Shanghai. \u003cem\u003eInfect Drug Resist \u003c/em\u003e2020, 13:4405-4415.\u003c/li\u003e\n\u003cli\u003eGuo Y, Hu FP, Zhu DM, Wang CQ, Wang AM, Zhang H, Wang C, Dong F, Zhen JH, Zhou SP\u003cem\u003e et al\u003c/em\u003e: [Antimicrobial resistance changes of carbapenem-resistant Enterobacteriaceae strains isolated from children]. \u003cem\u003eZhonghua Er Ke Za Zhi \u003c/em\u003e2018, 56(12):907-914.\u003c/li\u003e\n\u003cli\u003eYen CS, Hsiao HL, Lee CC, Tsai TC, Chen HY, Chen CL, Chiu CH: Carbapenem-resistant Enterobacteriaceae infection in children less than one year old in an Asian medical center. \u003cem\u003ePediatr Neonatol \u003c/em\u003e2023, 64(2):168-175.\u003c/li\u003e\n\u003cli\u003eWang Q, Wang X, Wang J, Ouyang P, Jin C, Wang R, Zhang Y, Jin L, Chen H, Wang Z\u003cem\u003e et al\u003c/em\u003e: Phenotypic and Genotypic Characterization of Carbapenem-resistantEnterobacteriaceae: Data From a Longitudinal Large-scale CRE Study in China (2012\u0026ndash;2016). \u003cem\u003eClinical Infectious Diseases \u003c/em\u003e2018, 67(suppl_2):S196-S205.\u003c/li\u003e\n\u003cli\u003ePatel K, Goldman JL: Safety Concerns Surrounding Quinolone Use in Children. \u003cem\u003eJ Clin Pharmacol \u003c/em\u003e2016, 56(9):1060-1075.\u003c/li\u003e\n\u003cli\u003eLe TA, Hiba T, Chaudhari D, Preston AN, Palowsky ZR, Ahmadzadeh S, Shekoohi S, Cornett EM, Kaye AD: Aminoglycoside-Related Nephrotoxicity and Ototoxicity in Clinical Practice: A Review of Pathophysiological Mechanism and Treatment Options. \u003cem\u003eAdv Ther \u003c/em\u003e2023, 40(4):1357-1365.\u003c/li\u003e\n\u003cli\u003eSapadin AN, Fleischmajer R: Tetracyclines: nonantibiotic properties and their clinical implications. \u003cem\u003eJ Am Acad Dermatol \u003c/em\u003e2006, 54(2):258-265.\u003c/li\u003e\n\u003cli\u003eZhou H, Zhang K, Chen W, Chen J, Zheng J, Liu C, Cheng L, Zhou W, Shen H, Cao X: Epidemiological characteristics of carbapenem-resistant Enterobacteriaceae collected from 17 hospitals in Nanjing district of China. \u003cem\u003eAntimicrob Resist Infect Control \u003c/em\u003e2020, 9(1):15.\u003c/li\u003e\n\u003cli\u003eWu W, Feng Y, Tang G, Qiao F, McNally A, Zong Z: NDM Metallo-beta-Lactamases and Their Bacterial Producers in Health Care Settings. \u003cem\u003eClin Microbiol Rev \u003c/em\u003e2019, 32(2).\u003c/li\u003e\n\u003cli\u003eCao B, Zhao CJ, Yin YD, Zhao F, Song SF, Bai L, Zhang JZ, Liu YM, Zhang YY, Wang H\u003cem\u003e et al\u003c/em\u003e: High prevalence of macrolide resistance in Mycoplasma pneumoniae isolates from adult and adolescent patients with respiratory tract infection in China. \u003cem\u003eClin Infect Dis \u003c/em\u003e2010, 51(2):189-194.\u003c/li\u003e\n\u003cli\u003eAldred KJ, Kerns RJ, Osheroff N: Mechanism of quinolone action and resistance. \u003cem\u003eBiochemistry \u003c/em\u003e2014, 53(10):1565-1574.\u003c/li\u003e\n\u003cli\u003eSamreen, Ahmad I, Malak HA, Abulreesh HH: Environmental antimicrobial resistance and its drivers: a potential threat to public health. \u003cem\u003eJ Glob Antimicrob Resist \u003c/em\u003e2021, 27:101-111.\u003c/li\u003e\n\u003cli\u003eZhou W, Lin R, Zhou Z, Ma J, Lin H, Zheng X, Wang J, Wu J, Dong Y, Jiang H\u003cem\u003e et al\u003c/em\u003e: Antimicrobial resistance and genomic characterization of Escherichia coli from pigs and chickens in Zhejiang, China. \u003cem\u003eFront Microbiol \u003c/em\u003e2022, 13:1018682.\u003c/li\u003e\n\u003cli\u003eChen Q, Zou Z, Cai C, Li H, Wang Y, Lei L, Shao B: Characterization of bla(NDM-5)-and bla(CTX-M-199)-Producing ST167 Escherichia coli Isolated from Shared Bikes. \u003cem\u003eAntibiotics (Basel) \u003c/em\u003e2022, 11(8).\u003c/li\u003e\n\u003cli\u003eLi L, Zhang Y, Guo H, Yang J, He F: Genomic insights into a bla(NDM-5)-carrying Escherichia coli ST167 isolate recovered from faecal sample of a healthy individual in China. \u003cem\u003eJ Glob Antimicrob Resist \u003c/em\u003e2024, 36:240-243.\u003c/li\u003e\n\u003cli\u003eHajjar R, Ambaraghassi G, Sebajang H, Schwenter F, Su SH: Raoultella ornithinolytica: Emergence and Resistance. \u003cem\u003eInfect Drug Resist \u003c/em\u003e2020, 13:1091-1104.\u003c/li\u003e\n\u003cli\u003eLivorsi DJ, Chorazy ML, Schweizer ML, Balkenende EC, Blevins AE, Nair R, Samore MH, Nelson RE, Khader K, Perencevich EN: A systematic review of the epidemiology of carbapenem-resistant Enterobacteriaceae in the United States. \u003cem\u003eAntimicrob Resist Infect Control \u003c/em\u003e2018, 7:55.\u003c/li\u003e\n\u003cli\u003eGuo CH, Liu YQ, Li Y, Duan XX, Yang TY, Li FY, Zou M, Liu BT: High prevalence and genomic characteristics of carbapenem-resistant Enterobacteriaceae and colistin-resistant Enterobacteriaceae from large-scale rivers in China. \u003cem\u003eEnviron Pollut \u003c/em\u003e2023, 331(Pt 2):121869.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Carbapenem-resistant Enterobacteriaceae, hospitalized children, antimicrobial drug resistance, carbapenemase genes","lastPublishedDoi":"10.21203/rs.3.rs-4471227/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4471227/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eThe prevalence of carbapenem-resistant \u003cem\u003eEnterobacteriaceae\u003c/em\u003e (CRE) has emerged as a serious public health problem worldwide, and the data on CRE strains that cause infections in hospitalized children in China remains limited. This study aimed to investigate the prevalence and molecular characteristics of CRE in hospitalized children in Shandong, China.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eA retrospective study was conducted from August to November 2023. Antimicrobial susceptibility testing was performed by the broth microdilution method. Carbapenemase genes, drug resistance genes, and plasmid replicon types were detected using multiplex real-time PCR and whole-genome sequencing. Multilocus sequence typing (MLST) was used to determine the genetic relationships between strains.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eA total of 20 CRE isolates were identified from 432 fecal samples, with a fecal carriage rate of 4.6%. The CRE isolates predominantly consisted of \u003cem\u003eEscherichia coli\u003c/em\u003e (\u003cem\u003eE. coli\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;13) and \u003cem\u003eKlebsiella species\u003c/em\u003e (\u003cem\u003eK. pneumonia\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;5). CRE isolates showed a high resistance rate of 90%-100% to seven β-lactam antibiotics. Resistance rates for other antibiotics such as trimethoprim/sulfamethoxazole, tetracycline, azithromycin, ciprofloxacin, chloramphenicol, nalidixic acid, and streptomycin were 95%, 85%, 85%, 80%, 75%, 75%, and 75%, respectively. CRE isolates showed low resistance to amikacin (20%), and none of the isolates were resistant to colistin and tigecycline. Additionally, the multidrug resistance rate of CRE isolates was 95%. All CRE strains carried sulfonamide antibiotic and β-lactamase resistance genes, of which the most common β-lactamase resistance genes were \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;1\u003c/sub\u003e (n\u0026thinsp;=\u0026thinsp;9), \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;5\u003c/sub\u003e (n\u0026thinsp;=\u0026thinsp;7) and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA\u0026minus;1\u003c/sub\u003e (n\u0026thinsp;=\u0026thinsp;7). Resistance genes to tetracycline and macrolide antibiotics were also widespread among the strains. The study found that IncFIB and IncFII series plasmids were present in 84% and 42% of the CRE strains, respectively. Additionally, Col, IncFIA, IncC, IncHI2, and IncX series plasmids were also detected. MLST analysis revealed diverse sequence types (STs) among CRE isolates, with ST167 being a common ST among \u003cem\u003eE. coli\u003c/em\u003e isolates.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThis study revealed \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u003c/sub\u003e \u003cem\u003eE. coli\u003c/em\u003e were the dominant isolates in fecal samples of hospitalized children in Shandong Province, with a broad multidrug resistance to antibiotics, emphasizing that infection control measures need to be taken to limit the spread of these strains.\u003c/p\u003e","manuscriptTitle":"Identification and Molecular Characterization of Carbapenem-Resistant Enterobacteriaceae in hospitalized children in Shandong, China","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-22 21:00:22","doi":"10.21203/rs.3.rs-4471227/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fad7d4fb-e91e-426e-87d3-4de0a351ffc0","owner":[],"postedDate":"July 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-11-26T18:09:17+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-22 21:00:22","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4471227","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4471227","identity":"rs-4471227","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00