3,3’-Diindolylmethane disrupts the endoplasmic reticulum and nuclear envelope in fission yeast | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article 3,3’-Diindolylmethane disrupts the endoplasmic reticulum and nuclear envelope in fission yeast Masaru Ueno, Kaiyu Wang, Hyekyung Seol, Parvaneh Parvaneh Emami, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4653264/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract 3,3’-Diindolylmethane is used as an anti-cancer agent for its bioactivity in various pathways. However, the mechanism of 3,3’-Diindolylmethane still needs to be further elucidated. It is reported that 3,3’-Diindolylmethane disturbed the localization of Cut11, a kind of subunit of the nuclear pore complex in Schizosaccharomyces Pombe . In this study, we find that in Schizosaccharomyces Pombe , 3,3’-Diindolylmethane also could disturb the localization of inner nuclear membrane protein Bqt4, nuclear envelope lumen protein Ish1 and leads to the leakage of GFP-NLS, making it evident that 3,3’-Diindolylmethane disrupts the nuclear envelope. Moreover, 3,3’-Diindolylmethane disturbs the localization of GFP-ADEL and Ost4, which are endoplasmic reticulum lumen proteins and membrane proteins respectively, suggesting the function of 3,3’-Diindolylmethane on endoplasmic reticulum disturbance. The nuclear envelope repairment, normal nuclear envelope physical properties, and lipid metabolism homeostasis were indispensable for cells’ survival in the presence of 3,3’-Diindolylmethane. This study provides new insights into the understanding and development of 3,3’-Diindolylmethane as an anti-cancer agent. Biological sciences/Cell biology/Organelles/Nucleus Biological sciences/Cell biology/Organelles/Endoplasmic reticulum 3 3’-Diindolylmethane nuclear envelope endoplasmic reticulum ESCRT-III lipid Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction 3,3’-Diindolylmethane (DIM), which is derived from edible fruit plants like broccoli, shows anticancer activity, through various pathways including apoptosis induction, cellular signaling disturbance such as NF-κB, Akt, Wnt, and so on [ 1 ]. DIM also could induce autophagy in human cells [ 2 ]. S. pombe is a widely used model organism for its simple genome and easy tackling [ 3 ]. It has already been reported that DIM could induce autophagy and apoptosis in S. pombe [ 4 ]. Intriguingly, DIM was suggested to deform the nuclear envelope (NE) [ 4 ]. The nucleus is isolated from the cytoplasm by the NE, a bi-membrane structure, with anchored nuclear pore complex (NPCs) channeling nucleoplasm and cytoplasm for molecule transportation. The inner nuclear membrane (INM) and outer nuclear membrane (ONM) consist of NE [ 5,6 ]. The INM protein is retained at INM and lumen proteins such as Ish1 reside in the lumen between INM and ONM [ 7 ]. The integrity of NE is essential for cell growth and viability as it is the basis for normal nucleus function including maintenance of genome stability [ 8 ]. NE undergoes disassembly during the mitosis, the so-called open mitosis in higher eukaryotes, and is subsequently reassembled by the endosomal sorting complex required for transport-III (ESCRT-III) [ 9,10 ]. In S. pombe , the ESCRT-III complex is recruited by Cmp7 located at the reformed NE, in the process of which, Lem2 might also be required [ 11–13 ]. Notably, ESCRT-III also functions during interphase in mammal cells [ 14,15 ]. The endoplasmic reticulum (ER) is a large organelle within the cell and contiguous with NE. ER is responsible for the synthesizing and refolding of protein. Defects on ER could decrease cell viability [ 16–19 ]. In S. pombe , Lem2 and Lnp1 regulate the boundary between ONM and ER [ 20,21 ]. Lem2 is a highly conserved INM protein with distinct functions among regions of Lem2. In fission yeast, the Lap2–emerin–Man1 (LEM) domain of Lem2 is responsible for interacting with centromeric chromatin and maintaining the localization of centromeres [ 22 ]. The BBM domain is responsible for Bqt4 binding [ 23 ]. The luminal domain is the part berried into the membrane. The MSC (MAN1-Src1p C-terminal) domain mediates heterochromatin silencing and interaction with nuclear exosomes to coordinate RNA degradation [ 22,24,25 ]. Moreover, Lem2 interacts with lipid synthesis enzymes and shows synthetic lethality with the deletion of bqt4 + and lem2 + , and the MSC domain of Lem2 could rescue the synthetic lethality [ 26 ]. In human cells, the MSC domain of LEM2 is responsible for interacting with CHMP7, the ortholog of cmp7 + in S. pombe [ 12 ]. Lem2 is retained at NE by interaction with Bqt4, another INM protein [ 23 ]. Bqt4 is responsible for attaching telomere to NE by binding ability located at its N-terminal domain (NTD) to DNA non-specifically and Rap1[ 27,28 ]. Bqt4 could interact with different kinds of lipid synthesis enzymes and Bqt4 is suggestive of the potential to affect nucleus movement dynamics through the C-terminal domain (CTD) of Bqt4[ 29,30 ]. Bio-membranes including NE and ER are comprised of lipids, thus lipid metabolism hemostasis is crucial for the maintenance of bio-membrane morphology and function. Lipid metabolism is regulated by various factors, Nem1and Pik3 are two of them. Nem1 is the subunit of serine/threonine protein phosphatase (Nem1-Spo7 complex) [ 31 ]. The deletion of nem1 + leads to the expansion of NE [ 32 ] and the decrease of diglyceride and triglyceride levels [ 31 ]. In Saccharomyces cerevisiae , Nem1 activates Pah1 which converts PA to diacylglycerol (DAG) [ 33 ]. Pik3 possesses phosphatidylinositol (PI)-3 kinase activity to specifically phosphorylate PI to yield PI (3)P, and loss of Pik3 could cause a decreased amount of PI (3), the possible accumulation of PI and indirectly disturb the metabolism of other lipids located on NE, ER, etc. [ 34–37 ]. There was no report of severe deformed NE in human cells and less report of the deformed NE in S. pombe by the treatment of DIM, further elucidation is required. In this study, we would like to focus on the effects of DIM on the Bio-membrane system in S. pombe . We unveiled that DIM could disturb NE and ER drastically, NE repair, NE properties, and lipid hemostasis might be indispensable for cell survival in the presence of DIM. The findings in this study provided new insights into the molecular mechanism of DIM as an anti-cancer substance. Results DIM disturbs membranes within the cells. It was reported that localization Cut11, an NPC protein, was severely disturbed by the treatment of DIM at a concentration of 20µg/ml [ 4 ]. In this study, we analyzed the effect of DIM on NE in detail including Cut11-GFP localization with DIM at the same concentration. Hereafter, we referred to the addition of DIM to a concentration of 20µg/ml in liquid cultivates as DIM treatment. In this research, we took time-lapse images in 30-second intervals. The first image was taken 2 minutes after the DIM treatment and kept for 8 minutes, shown as videos in supplementary materials. We selected images at 60-second intervals, shown as time-lapse images. According to the figures, DIM already disturbed Cut11-GFP localization at 2 min. As time goes, the NE shape suggested by the Cut11-GFP signal was severely deformed, implying the failure in maintenance of the spherical nucleus shape. Simultaneously, Cut11-GFP accumulates together forming aggregates and gaps (Fig. 1 A). Interestingly, part of the Cut11-GFP signal appeared inside of the nucleus, possibly by the reorganization of NE, implying the special deformation pattern of the nucleus, such as the generation of protrusion or the multivesicular body (Fig. 1 A, Supplementary Movie 1A, B). In conclusion, the changed Cut11-GFP localization pattern suggests changes in NPC localization, implying the deformation of the nucleus by DIM. Wondering whether other components of the NE are also affected by DIM, we visualized Bqt4 and Ish1, which are an INM protein and an NE lumen protein, respectively. In the case of Bqt4, 2 minutes after DIM treatment, the GFP-Bqt4 signal was slightly deformed. After undergoing severe deformation, GFP-Bqt4 signal intensity exhibited a heterogeneous distribution pattern and formed aggregates, compared to the DMSO group (Fig. 1 B, Supplementary Movie 2A, B). It is worth noting that the GFP-Bqt4 signal kept contiguous, different than that of Cut11-GFP in the presence of DIM. In the later stage, the GFP-Bqt4 signal shows multivesicular bodies, consistent with the observed phenomenon in the Cut11-GFP group (Fig. 1 A). This result suggests the severe reorganization of NE by DIM. In the case of Ish1, 2 minutes after DIM treatment, the deformation of Ish1-mCherry localization occurred, and the Ish1-mCherry signal formed aggregates and a protrusion-like structure. Later, the Ish1-mCherry signal undergoes further deformation, forming bigger Ish1 signal aggregates, and failing to maintain the spherical shape. (Fig. 1 C, Supplementary Movie 3A, B). In general, individually observing the components of NPC, INM protein, and NE lumen, we concluded that DIM caused a drastic disturbance in NE. As the ONM is contiguous with ER, it is possible that DIM also affects ER. To test this idea, we use GFP fused with ADEL amino acid sequence, an ER lumen localization signal, as the ER marker [ 21 ]. 2 minutes after DIM treatment, DIM made the GFP-ADEL signal deformed and kept shrinking, like the observation results of the Ish1-mCherry signal. Notably, the GFP-ADEL signal formed dispersed aggregates at the cytoplasm (Fig. 1 C, Supplementary Movie 3A, B). In case the localization of ADEL, not ER, was changed, we checked the distribution pattern of Ost4-CFP, an integral ER protein, as an ER marker [ 38 ]. A similar localization pattern as GFP-ADEL was observed. After 2 minutes of DIM treatment, the deformation of Ost4-CFP localization occurred. Subsequently, the Ost4-CFP localization underwent further deformation and formed dispersed aggregates (Fig. 1 D, Supplementary Movie 4A, B). The deformed GFP-ADEL and Ost4-CFP signal localization strongly suggested the disturbance of ER by DIM. However, the vacuole seems not to be changed by the DIM treatment suggested by the unchanged Cpy1-mCherry signal (Fig. 1 D, Supplementary Movie 4A, B) [ 38 ]. Drastic membrane reorganization of the NE and the ER could lead to the leakage of nucleoplasm. To confirm that the deformation of NE is concomitant with nucleoplasm leakage, we applied the stain with visualized nucleoplasm by NLS-GFP and visualized NE by both Cut11-3mRFP and Ish1-mCherry. 2 minutes after DIM treatment, NLS-GFP already partially mislocated from nucleoplasm into cytoplasm, with the deformation of the nucleus (Fig. 1 E, Supplementary Movie 5A, B). Subsequently, the NLS-GFP signal underwent further leakage and shrinkage, together with the further deformation of NE (Fig. 1 E). This result suggests that DIM disturbed NE and led to nucleoplasm leakage. ESCRT-III was activated with DIM treatment. NE was disturbed severely by the DIM treatment. NE repair pathway is of significance for maintaining NE integrity [ 39 ]. We are wondering whether the NE repair pathway is activated by the DIM treatment. ESCRT-III pathway is an important NE repair pathway [ 40 ]. As Cmp7 is responsible for recruiting ESCRT-III at the NE rupture site complex, the formation of Cmp7 foci was used as the marker of activation of the ESCRT-III pathway [ 12 ]. We applied strain containing GFP tagged Cmp7 and found that Cmp7-GFP foci showed up after DIM treatment (Fig. 2 A, Supplementary Movie 6A, B). To check whether the functional ESCRT-III pathway is indispensable for cell viability and growth with DIM, we conducted the spot assay using solid mediums containing DIM. Since the concentration of DIM in DIM treatment is so high for conducting spot assay that could extinct all cells, we optimized the concentration to 4.5µg/ml. As loss of Cmp7 could impair the onset of the ESCRT-III pathway [ 12 ], we checked the sensitivity to DIM of WT and cmp7∆ cells in the DIM concentration of 4.5µg/ml by spot assay. cmp7∆ strain showed obvious sensitivity to DIM compared to WT (Fig. 2 B), suggesting that defects in ESCRT-III function in cmp7∆ conferred cell sensitivity to DIM. Besides, the lack of observed sensitivity in lnp1∆ implies the dispensability of functional ER—ONM boundary control in the presence of DIM (Fig. 2 B). Vps4, a type of AAA ATPase, is required for the disassembly and the recycling of ESCRT-III complex in mammal cells [ 11,41–43 ]. In the fission yeast vps4 ∆ strain, the karmellae formation, a kind of deformed NE structure, suggests the importance of Vps4 in the ESCRT-III pathway [ 12 ]. Since the loss of Vps4 could lead to defects in ESCRT-III as well, we checked the sensitivity of vps4∆ to DIM. Based on the spot assay result, vps4∆ exhibited obvious sensitivity to DIM compared to WT, indicating that Vps4 is required for cells living with DIM. DIM sensitivity in vps4∆ also suggests that the disassembly and recycling of the ESCRT-III complex is required for cells in the presence of DIM (Fig. 2 C). In conclusion, DIM could cause NE damage, and a functional ESCRT-III pathway is required for cell survival in the presence of DIM. MSC domain and NTD of Lem2 are required for surviving cells in DIM. Lem2 is an INM protein with distinct domains mediating various functions, including coordination of RNA degradation [ 24 ], interaction with lipid synthesis enzyme [ 29 ], and cooperation with nuclear membrane protein network to regulate genome stability [ 25,26 ], etc. Lem2 was involved in the onset of the ESCRT-III pathway [ 12 ]. Although lem2∆ is reported to be sensitive to DIM in fission yeast [ 4 ], we have no less understanding of what part of Lem2 is required for surviving cells with DIM. To identify the indispensable part of Lem2 in the presence of DIM, we applied Lem2 truncated mutants for spot assay (Fig. 3A). The expression of Lem2 constructs was shown in the strain-original paper [ 24 ]. The NE-localization of Lem2 constructs was checked by fluorescence observation (Supplementary Fig. 1). According to the spot assay results, the loss of full-length Lem2 shows the strongest sensitivity to DIM among other strains. In contrast to the loss of NTD which did not cause DIM sensitivity, merely the loss of the MSC domain in lem2∆MSC could lead to DIM sensitivity. The loss of NTD and MSC domain simultaneously in the lem2∆N∆MSC group resulted in comparable sensitivity to DIM as the lem2∆ group (Fig. 3B). These results suggest the importance of the MSC domain for cells in the presence of DIM, and NTD showed a synergistic function with the MSC domain regarding DIM resistance. Bqt4 is essential for cells in the presence of DIM. Bqt4 is another INM protein, and it is required for Lem2 to retain on NE. Besides the telomere-related function, the latest reports showed the binding affinity of Bqt4 to lipid synthesis enzyme [ 29 ], and the potential to affect NE physical properties [ 30,44 ]. Importantly, bqt4 + deletion is synthetically lethal with lem2 + deletion, suggesting the presence of overlapping or similarity between the function of Bqt4 and Lem2. Since lem2∆ showed DIM sensitivity, it is plausible that bqt4 ∆ cells are also sensitive to DIM. To test this idea, we conducted the spot assay using bqt4FL , bqt4∆ , and bqt4dN(263–432) which lack 1–262 amino acids, to ask whether NTD is indispensable for cell survival with DIM(Fig. 4 A). bqt4∆ cells showed sensitivity to DIM, sustaining that Bqt4 function is required for cell survival with DIM. Intriguingly, the loss of the NTD of Bqt4 did not confer DIM sensitivity upon cells, suggesting that CTD of Bqt4 might be essential for cells with DIM (Fig. 4 B). Additionally, the loss of the transmembrane domain of Bqt4 by removing 19 amino acids from C-terminal of Bqt4 in bqt4-dTM could lead to mis-location of Bqt4 from NE to the nucleoplasm [ 45 ]. However, the bqt4-dTM did not show DIM sensitivity for an unidentified reason (Fig. 4 B). Thus, we conclude that CTD of Bqt4 might possess certain membrane-related functions important in the presence of DIM. Nem1 and Pik3 are indispensable for cell growth with DIM. NE and ER are mainly composed of lipids and were severely disturbed by DIM treatment. Both Lem2 and Bqt4, which are reported to relate to lipid synthesis, showed DIM sensitivity. These results pointed to the importance of lipid metabolism in the presence of DIM. Nem1 and Pik3 are two key factors in lipid metabolism. Nem1 might contribute to the conversion of PA to DAG, and Pik3 could phosphorylate PI to yield PI (3)P[ 33,34,36,37 ]. To investigate the importance of lipid synthesis with DIM, we checked the DIM sensitivity of cells with individually deleted nem1 + and pik3 + by spot assay (Fig. 5 A). Obvious DIM sensitivity observed in both pik3∆ and nem1∆ compared with WT made it evident that Pik3 and Nem1 functions are indispensable for cells with DIM, most likely due to their roles in lipid metabolism. Discussion Anti-cancer activity involving multi-pathway of DIM in human cells promotes us to gain further understanding of molecular mechanisms for DIM as an anti-cancer agent. However, the function of DIM on the Bio-membrane is less elucidated. This study reveals the Bio-membrane disturbance effects of DIM, and functional NE-relating pathways are required for cell survival in the presence of DIM. NE is shown to be affected in this study. 2 minutes after DIM treatment, Cut11 already formed aggregates and gaps, distinguished from other markers of NE including Ish1 and Bqt4. At the same time, both Cut11-GFP and GFP-Bqt4 signal was still distributed in a circular pattern, refuting the severely reorganized NE (Fig. 1 A, B). Together with that Cut11 is the subunit of NPCs that could flow on NE [ 46 ], it is highly possible that the observed Cut11-GFP aggregates and gaps at the 2min timepoint were rooted from NPCs gathering by their own flowing on NE. In the case of GFP-Bqt4, it also shows signal aggregates although it is different than that of Cut11-GFP. Showing up of GFP-Bqt4 aggregates tend to be accompanied by the severe reorganization of NE 6 minutes after DIM treatment (Fig. 1 B). Therefore, the formation of GFP-Bqt4 might result from the reorganization of NE. Interestingly, the GFP-Bqt4 signal is also distributed un-uniformly along with NE, the ability of Bqt4 to flow on NE or the generation of multilayer membrane might be the underlying reason [ 46 ]. No gaps observed in GFP-Bqt4 may be rooted in the size of Bqt4, a protein far smaller than the size of the NPC complex, and its high mobility on NE [ 46 ]. Intriguingly, Bqt4 aggregates tend to localize at the branch of the membrane as shown in the expanded images in the 10-minute timepoint (Fig. 1 B), but the underlying mechanism still needs to be identified. These reorganizations of NE might be concomitant with the activation of the ESCRT-III pathway and nucleoplasm leakage. According to the disturbed distribution of ADEL and Ost4, we conclude that ER is also disturbed by DIM. However, we lacked information about the origination of the aggregates of ADEL and Ost4 in cytoplasm exactly. Based on the video, we assume that Ost4 or ADEL aggregates in cytoplasm might resulted from the translocation of vesicles from the nucleus using NE to the cytoplasm or aggregation of ER which is originally located at cytoplasm (Supplementary Movie 3A, B). To clarify the total changes in cell membranes with the DIM treatment, we used a hypothetical diagram to depict the localization pattern of membrane-related proteins (Fig. 6 A). Cmp7 and Vps4 are required for cell survival in the presence of DIM. Loss of Cmp7 leads to defects in the recruitment of ESCRT-III complex to NE, in turn, leads to the loss of NE integrity [ 12 ]. Vps4 is mainly responsible for the resolution of malformation of NE caused by Cmp7. Loss of Vps4 causes the accumulation of malformed NE [ 12 ]. These kinds of failures in the ESCRT-III pathway might the be root of DIM sensitivity in cmp7∆ and vps4∆ strains. lem2 ∆ stain was sensitive to DIM, and it is less likely caused by the defects in ER-NE boundary control, as Lnp1, which possesses overlapping ability with Lem2 in terms of NE-ER boundary control, did not show DIM sensitivity (Fig. 2 B). Both the LEM domain and the Bqt4 binding domain are located at the NTD of Lem2. LEM domain is required for attaching centromere to SPB, Bqt4 binding domain is responsible for Lem2-Bqt4 interaction to locate Lem2 on NE. Loss of the Bqt4 binding domain will mobilize part of Lem2 from NE to SPB [ 23 ]. Both Bqt4 binding domain truncated Lem2 and NTD truncated Lem2 did not show DIM sensitivity, suggesting that centromere-SPB attachment and Lem2-Bqt4 interaction are not essential for cells with DIM. The decreased amount of Lem2 on NE could not make cells sensitive to DIM, supported by no sensitivity observed in lem2∆BB . DIM sensitivity was observed in lem2∆MSC , demonstrating the importance of the MSC domain in the presence of DIM. Among the functions on the MSC domain of Lem2, the loss of function responsible for synthetic lethality with bqt4 + or the possible loss of interaction with Cmp7 and might be important for DIM sensitivity. Intriguingly, ∆MSC and ∆N showed synergistic function in terms of DIM sensitivity, and further study is required to explain it. Noteworthy, we could not completely exclude the influence of higher protein levels of truncated Lem2. It is less possible that the DIM sensitivity in Lem2 constructs is conferred by the stress on cells caused by the higher level of Lem2 constructs, as these constructs did not show growth defects on the YEA plate. Besides, the DIM sensitivity of lem2∆ is also possibly caused by loss of interaction between Lem2 and lipid synthesis enzyme. bqt4∆ also shows DIM sensitivity. NTD of Bqt4 possesses the BBM protein binding motif and non-specific-DNA-binding motif [ 27,28 ]. Loss of NTD did not show DIM sensitivity, suggesting the importance of CTD of Bqt4 in DIM sensitivity. As other research implies the function of Bqt4-CTD on regulation of NE physical properties [ 30,44 ], the DIM sensitivity in bqt4∆ might resulted from the changed NE physical properties in the absence of CTD of Bqt4. Bqt4 shows synthetic lethality in bqt4∆lem2∆ and could interact with lipid synthesis enzymes [ 29 ]. It is also possible that the loss of these functions leads to DIM sensitivity. Interestingly, Bqt4 with truncated TM domain in bqt4∆TM did not show DIM sensitivity. Decreased NE localization of Bqt4 is tolerable for cells undergoing DIM treatment, which might be one of the plausible explanations. The nem1∆ and pik3∆ strains showed sensitivity to DIM, suggesting the importance of lipid homeostasis in the presence of DIM. nem1∆ and pik3∆ might disturb the composes of ER and NE indirectly, to make NE and ER could not carry out normal functions or more easily deteriorated by DIM. Noteworthy, as functional Pik3 could be required for autophagy which is necessary for surviving cells in the presence of DIM, as an autophagy factor atg7 + deletion makes cells sensitive to DIM [ 4,47 ]. DIM sensitivity in pik3∆ might root from the defects in autophagy. Collectively, DIM shows anti-cancer activity in various pathways in human cells, but the underlying molecular mechanism is less elucidated. The research of DIM using S. pombe reveals the membrane-relation activity of DIM, providing new inspects in understanding DIM as an anti-cancer agent. Methods Growth media Cells were grown in YEA (0.5% yeast extract, 3% glucose, and 40 mg/ mL adenine, or Edinburgh minimal medium (EMM) with appropriate supplement at 30˚C. PH of the mediums were in the range of 6–7. Microscopy. Microscopy images were obtained using an AxioCam digital camera (Zeiss) connected to an Axio Observer.Z1 microscope (Zeiss) with a Plan-Apochromat 63%, numerical aperture (NA) 1.4 objective lens or a 'Plan-FLUAR 100%, NA 1.45 objective lens. Pictures were captured and analyzed using AxioVision Rel. 4.8.2 Software (Zeiss). Transformation: The reagent used in this method as follows: LiAc-TE: 0.1M lithium acetate, 10mM Tris pH 7.5, 1 mM EDTA LiAc-TE-PEG: LiAc-TE plus 40% PEG4000(W/V) Carrier DNA: From Transformation kit (S. pombe Direct Transformation kit Wako Japan) The operation as follows: Grow fission yeast cells in MM to 10 7 cells in 10ml.Pellet 10ml of cells per transformation. (3000 rpm×2 min). Transfer to 1 eppis. Wash cell in 1ml sterilized water (10000×rpm flash), then wash in LiAc-TE (10000×rpm flash). Resuspend in LiAc-TE at 2×10 9 cells/ml. Make 5µl of this solution. Mix 50µl cells with 2µl carrier DNA at 5mg/ml and up to 4µl of DNA; mix gently. Incubate at RT for 10 min.(25°C). Add 130µl of 40% PEG/LiAc-TE; mix gently. Incubate 60 min at 25°C (Mix occasionally). Pre-warmed DMSO at 25℃. preheat the Incubator at 42 ℃. Add 21.5µl pre-warmed DMSO; mix gently. Heat shock at 42°C for 5 min. Pellet (10000×rpm flash) and wash once in 1ml sterilized water (10000×rpm flash). Resuspend in 100µl sterilized water and plate it on YEA. After 24h, replicate it on the selective plate. Strain construction. S. pombe strains used in this research are listed in Supplementary Table 1. The primers and oligos used in this research are listed in Supplementary Table 2. Details of strain construction Construction of 123-E09 The genome of 107-j01(UKK 1519-2A) [h- nem1∆::kanr cut11:GFP:ura4 + leu1-32 ura4-D18 ade6-M210 or M216] was amplified by primer nem1t[GCGACTTACATTCTAGCAAA] and nem1b[TGTCGTTAGCCTAGTGATATG]. The resulting DNA fragment was introduced into stain 108-G02 [h+] . The resulting strain 123-E09 [h + nem1∆::kanr] was constructed. Construction of 123-B04 The genome of 99-J03 [h + pik3::kanr ade6-M210 leu1-32 ura4-D18] was amplified by primers pik3t [AATGTGAGCAAACACAAAAC] and pik3b [ACAATTTCCCATCGAAACAT]. The resulting DNA fragment was introduced into 108-G02 [h+] . The resulting strains 123-B04 [ h + pik3::kanr ] were constructed. Construction of 101-D05 81-F02 [h + GFP-atb2-kanr cut11-3mRFP-hygr sfi1-CFP-natr leu1 ura4 his2] and 100-G10 [hm lys1-131 leu1-32 ura4-D18 ish1-mCherry::ura4 + leu1+::adh1p-GFP-GST-NLS aur1r::atb2-mCherry] fresh cells were prepared and mixed in 10µl sterilized water. The resulting mixed cells were spotted on the ME plate and incubated at 25˚C for 72 hours for conjugation. The resulting cells obtained from conjugation were screened and the construction of 101-D05 [H- cut11-3mRFP leu1+::adh1p-GFP-GST-NLS leu1-32 ura4-D18 ish1-mCherry::ura4+] was confirmed. Construction of 101-E02 the genome of 100-G05 was amplified using primers cmp7t2 [ ATTATATTACCGCTTACAGTATCA), cmp7b2 [GAAAATAGTGAATTAAAAACGGTAC]). The resulting DNA fragment was introduced into stain 32-D05 /wt(975) [h+] . The resulting strain 101-E02 [h + cmp7∆::nat] was constructed. Construction of 101-E04 the genome of 100-H01 /YT2426 [h- lnp1∆::hph]was amplified using primer ; lnp1t1:14-A06 [GCGAATATGCAGTGAAAGCC], lnp1b1: [AAGTCCAAGTTTGCTTCCCC]). The resulting DNA fragment was introduced into stain 32-D05 /wt(975) [h+] . The resulting strain 101-E04 [h + cmp7∆::nat] was constructed Declarations Funding MU is supported by MEXT/JSPS KAKENHI, Grant Number 23K05865. Competing interest No potential conflicts of interest were disclosed. Acknowledgements We thank Y. Hiraoka, Y. Hirano, Y. Chikashige, M. Yanagida, Sigurd J. Braun, Li-lin Du and the National Bioresource Project Japan for providing the plasmids and strains. We thank Editage (www.editage.jp) for English language editing. Data availability: The authors declare that the data supporting the findings of this study are available within the paper and its supplementary information files. Further data are available from the corresponding author upon reasonable request. Author contributions: Kaiyu Wang, Hyekyung Seol, Parvaneh Emami and Hideto Nagai performed experiments. Masaru Ueno and Kaiyu Wang analyzed the results and wrote the paper with contributions from all authors. Wang kaiyu drew the putative diagram in Fig. 6A using Microsoft PowerPoint, version: 16.86 (24060916). https://apps.tokenpedia.com/com.microsoft.office.powerpoint?source=o&device=c&keyword=microsoft%20powerpoint&msclkid=2793065fc1f319d68d296026fa6b2ed9. References Kim, S. M. Cellular and molecular mechanisms of 3,3’-diindolylmethane in gastrointestinal cancer. Int J Mol Sci 17 , (2016). Tang, H. et al. 3,3′-diindolylmethane inhibits LPS-induced human chondrocytes apoptosis and extracellular matrix degradation by activating PI3K-Akt-mTOR-mediated autophagy. Front Pharmacol 13 , 1–20 (2022). Hayles, J. & Nurse, P. Introduction to fission yeast as a model system. Cold Spring Harb Protoc 2018 , 323–333 (2018). Emami, P. & Ueno, M. 3,3′-Diindolylmethane induces apoptosis and autophagy in fission yeast. PLoS One 16 , 1–20 (2021). Gallardo, P., Barrales, R., Daga, R. R. & Salas-pino, S. Nuclear Mechanics in the Fission Yeast. (2019). Agrawal, A. & Lele, T. P. Mechanics of nuclear membranes. J Cell Sci 132 , 1–8 (2019). Asakawa, H., Hirano, Y., Shindo, T., Haraguchi, T. & Hiraoka, Y. Fission yeast Ish1 and Les1 interact with each other in the lumen of the nuclear envelope. Genes to Cells 27 , 643–656 (2022). Webster, B. M. & Lusk, C. P. Border Safety: Quality Control at the Nuclear Envelope. Trends Cell Biol 26 , 29–39 (2016). Güttinger, S., Laurell, E. & Kutay, U. Orchestrating nuclear envelope disassembly and reassembly during mitosis. Nat Rev Mol Cell Biol 10 , 178–191 (2009). Ungricht, R. & Kutay, U. Mechanisms and functions of nuclear envelope remodelling. Nat Rev Mol Cell Biol 18 , 229–245 (2017). Pieper, G. H., Sprenger, S., Teis, D. & Oliferenko, S. ESCRT-III/Vps4 Controls Heterochromatin-Nuclear Envelope Attachments. Dev Cell 53 , 27-41.e6 (2020). Gu, M. et al. LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. (2017) doi:10.1073/pnas.1613916114. von Appen, A. et al. LEM2 phase separation promotes ESCRT-mediated nuclear envelope reformation. Nature 582 , 115–118 (2020). Denais, C. M. et al. Nuclear envelope rupture and repair during cancer cell migration. Science (1979) 352 , 353–358 (2016). Raab, M. et al. ESCRT III repairs nuclear envelope ruptures during cell migration to limit DNA damage and cell death. Science (1979) 352 , 359–362 (2016). Schwarz, D. S. & Blower, M. D. The endoplasmic reticulum: Structure, function and response to cellular signaling. Cellular and Molecular Life Sciences 73 , 79–94 (2016). Wang, N., Shibata, Y., Paulo, J. A., Gygi, S. P. & Rapoport, T. A. A conserved membrane curvature-generating protein is crucial for autophagosome formation in fission yeast. Nat Commun 14 , (2023). Smethurst, D. G. J. & Cooper, K. F. ER fatalities—The role of ER-mitochondrial contact sites in yeast life and death decisions. Mech Ageing Dev 161 , 225–233 (2017). Chen, X., Shi, C., He, M., Xiong, S. & Xia, X. Endoplasmic reticulum stress: molecular mechanism and therapeutic targets. Signal Transduct Target Ther 8 , (2023). Kume, K., Cantwell, H., Burrell, A. & Nurse, P. Nuclear membrane protein Lem2 regulates nuclear size through membrane flow. Nat Commun 10 , 1–8 (2019). Hirano, Y. et al. Lem2 and Lnp1 maintain the membrane boundary between the nuclear envelope and endoplasmic reticulum. Commun Biol 3 , (2020). Braun, S. & Barrales, R. R. Beyond Tethering and the LEM domain: MSCellaneous functions of the inner nuclear membrane Lem2. Nucleus 7 , 523–531 (2016). Hirano, Y. et al. Lem2 is retained at the nuclear envelope through its interaction with Bqt4 in fission yeast. Genes to Cells 23 , 122–135 (2018). Caballero, L. M. et al. The inner nuclear membrane protein Lem2 coordinates RNA degradation at the nuclear periphery. 29 , (2022). Barrales, R. R., Forn, M., Georgescu, P. R., Sarkadi, Z. & Braun, S. Control of heterochromatin localization and silencing by the nuclear membrane protein Lem2. Genes Dev 30 , 133–148 (2016). Tange, Y. et al. Inner nuclear membrane protein Lem2 augments heterochromatin formation in response to nutritional conditions. Genes to Cells 21 , 812–832 (2016). Hu, C. et al. The Inner Nuclear Membrane Protein Bqt4 in Fission Yeast Contains a DNA-Binding Domain Essential for Telomere Association with the Nuclear Envelope. Structure 27 , 335-343.e3 (2019). Hu, C. et al. Structural insights into chromosome attachment to the nuclear envelope by an inner nuclear membrane protein Bqt4 in fission yeast. Nucleic Acids Res 47 , 1573–1584 (2019). Hirano, Y. et al. Inner nuclear membrane proteins Lem2 and Bqt4 interact with different lipid synthesis enzymes in fission yeast. J Biochem 174 , 33–46 (2023). Wang, K., Ito, H., Kanoh, J. & Ueno, M. Bqt4 affects relative movement between SPB and nucleolus in fission yeast. Biochem Biophys Res Commun 714 , 149970 (2024). Foo, S., Cazenave-Gassiot, A., Wenk, M. R. & Oliferenko, S. Diacylglycerol at the inner nuclear membrane fuels nuclear envelope expansion in closed mitosis. J Cell Sci 136 , (2023). Kume, K. et al. A systematic genomic screen implicates nucleocytoplasmic transport and membrane growth in nuclear size control. PLoS Genet 13 , 1–18 (2017). Khondker, S., Han, G. S. & Carman, G. M. Phosphorylation-mediated regulation of the Nem1-Spo7/Pah1 phosphatase cascade in yeast lipid synthesis. Adv Biol Regul 84 , 100889 (2022). Morita, R. et al. Phosphatidylinositol-3 Kinase in Fission Yeast: A Possible Role in Stress Responses. Biosci Biotechnol Biochem 59 , 678–682 (1995). Takegawa, K., DeWald, D. B. & Emr, S. D. Schizosaccharomyces pombe Vps34p, a phosphatidylinositol-specific PI 3-kinase essential for normal cell growth and vacuole morphology. J Cell Sci 108 , 3745–3756 (1995). Mitra, P. et al. A novel phosphatidylinositol(3,4,5)P3 pathway in fission yeast. Journal of Cell Biology 166 , 205–211 (2004). Onishi, M. et al. Role of phosphatidylinositol 3-phosphate in formation of forespore membrane in Schizosaccharomyces pombe. Yeast 20 , 193–206 (2003). Zou, C. X. et al. The ortholog of human REEP1-4 is required for autophagosomal enclosure of ER-phagy/ nucleophagy cargos in fission yeast. PLoS Biol 21 , 1–27 (2023). Kamikawa, Y. et al. Impact of cell cycle on repair of ruptured nuclear envelope and sensitivity to nuclear envelope stress in glioblastoma. Cell Death Discov 9 , 1–2 (2023). Isermann, P. & Lammerding, J. Consequences of a tight squeeze: Nuclear envelope rupture and repair. Nucleus 8 , 268–274 (2017). Vietri, M., Radulovic, M. & Stenmark, H. The many functions of ESCRTs. Nat Rev Mol Cell Biol 21 , 25–42 (2020). Shestakova, A., Curtiss, M., Davies, B. A., Katzmann, D. J. & Babst, M. The Linker Region Plays a Regulatory Role in Assembly and Activity of the Vps4 AAA ATPase. Journal of Biological Chemistry 288 , 26810–26819 (2013). Jouvenet, N. Dynamics of ESCRT proteins. Cellular and Molecular Life Sciences 69 , 4121–4133 (2012). Le, T. K. et al. A ubiquitin–proteasome pathway degrades the inner nuclear membrane protein Bqt4 to maintain nuclear membrane homeostasis. J Cell Sci 136 , (2023). Chikashige, Y. et al. Membrane proteins Bqt3 and -4 anchor telomeres to the nuclear envelope to ensure chromosomal bouquet formation. Journal of Cell Biology 187 , 413–427 (2009). Ebrahimi, H., Masuda, H., Jain, D. & Cooper, J. P. Distinct ‘safe zones’ at the nuclear envelope ensure robust replication of heterochromatic chromosome regions. Elife 7 , 1–32 (2018). Yu, Z. Q. et al. Atg38-Atg8 interaction in fission yeast establishes a positive feedback loop to promote autophagy. Autophagy 16 , 2036–2051 (2020). Additional Declarations No competing interests reported. Supplementary Files SupplementaryMovie.zip Supplementary Movie. Videos of fluorescence-tagged stains with or without DIM treatment. The Videos started after 2 minutes of DIM treatment, taken in 30-second intervals and kept for 8 minutes. Frames:5, Scale bar: 2µm. Supplementary Movie 1(A, B) are the videos for the strain tagged by Cut11-GFP in the DMSO group and DIM treatment group, Supplementary Movie 2(A, B) for GFP-Bqt4, Supplementary Movie 3(A, B) for GFP-ADEL and Ish1-mCherry, Supplementary Movie 4(A, B) for Cpy1-mChery and Ost4-CFP, Supplementary Movie 5(A, B) for Cut11-3mRFP, Ish1-mCherry and GFP-NLS, Supplementary Movie 6(A, B) for Cmp7-GFP, respectively. SupplementaryFigure.docx SupplementaryTable.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4653264","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":331264559,"identity":"babe9990-f8c5-4945-8e09-d35616fd661a","order_by":0,"name":"Masaru Ueno","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAElEQVRIiWNgGAWjYBADOQNmIMnYIAEXYSakxZh0LYkbGMBaiHCQfPvpNImPO2zSt7PzPnz4c4dFNH8DjwHDjxoGdnMcWgzO5G6TnHkmLXdnM7uxMe8ZidwZB3gMGHuOMTBb4rDSQIJ3mzRv2+HcDYfZ2KQZ2yRyG+6/MWDgbWBgNjiAw2EzgFr+th1ONwBqkfwJ1DIfZMtfPFoYbgC1MLYdTgBpkeAFatkA1MKMzxagXzZb9ralGQIdxmwM0rLxAFvBYZljEjj9It9+duONn2028gbnjzE+/NlWlzvvAPPGh29qbJJxhRh2AHSSRLIBSVpAwI50LaNgFIyCUTBMAQBMUVPuNW+thgAAAABJRU5ErkJggg==","orcid":"","institution":"Hiroshima University","correspondingAuthor":true,"prefix":"","firstName":"Masaru","middleName":"","lastName":"Ueno","suffix":""},{"id":331264560,"identity":"916cedac-cc62-4beb-bca2-5767a58f134c","order_by":1,"name":"Kaiyu Wang","email":"","orcid":"","institution":"Hiroshima University","correspondingAuthor":false,"prefix":"","firstName":"Kaiyu","middleName":"","lastName":"Wang","suffix":""},{"id":331264561,"identity":"23b8fa1e-58d5-4b9c-bb4b-67e7d36320a9","order_by":2,"name":"Hyekyung Seol","email":"","orcid":"","institution":"Hiroshima University","correspondingAuthor":false,"prefix":"","firstName":"Hyekyung","middleName":"","lastName":"Seol","suffix":""},{"id":331264564,"identity":"8df030ed-ae19-4afe-8251-2df461caf8df","order_by":3,"name":"Parvaneh Parvaneh Emami","email":"","orcid":"","institution":"Hiroshima University","correspondingAuthor":false,"prefix":"","firstName":"Parvaneh","middleName":"Parvaneh","lastName":"Emami","suffix":""},{"id":331264568,"identity":"b14b8566-4937-4c6e-9d86-039b5f56a1af","order_by":4,"name":"Hideto Nagai","email":"","orcid":"","institution":"Hiroshima University","correspondingAuthor":false,"prefix":"","firstName":"Hideto","middleName":"","lastName":"Nagai","suffix":""}],"badges":[],"createdAt":"2024-06-28 08:30:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4653264/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4653264/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":61268795,"identity":"d09f36ba-44df-4a59-9995-2d9a3a05a844","added_by":"auto","created_at":"2024-07-29 01:20:24","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":9634400,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDIM disturbs the NE and the ER. Time-lapse images of cells with different fluorescence markers were shown.\u003c/strong\u003e The first image was captured 2 minutes after DIM treatment. These images were originally captured every 30 seconds for 8 minutes in each group. We selected images in a 1-minute interval. Scale bar: 2µm. We calculated the percentage of the cells exhibiting NE, and ER deformation after 10 minutes of DIM treatment. Significant differences were checked by the two-sample proportion Z-test (two-tailed test).\u003cstrong\u003e (A-E) \u003c/strong\u003eTime-lapse images of cells with Cut11-GFP (A), GFP-Bqt4 (B), GFP-ADEL and Ish1-mCherry (C), Ost4-CFP and Cpy1-mCherry(D), GFP-NLS, cut11-3mRFP, and Ish1-mCherry (E) in DIM treatment and DMSO groups were shown. The percentage of cells with severely deformed Cut11-GFP (A), GFP-Bqt4 (B), GFP-ADEL and Ish1-mCherry (C), Ost4-CFP (D), GFP-NLS, NE (E)signal was significantly higher in the DIM group than in the DMSO group, P-value = 4.14e\u003csup\u003e-107\u003c/sup\u003e, 2.82e\u003csup\u003e-121\u003c/sup\u003e, 1.30e\u003csup\u003e-108\u003c/sup\u003e, 2.47e\u003csup\u003e-99\u003c/sup\u003e, 5.10e\u003csup\u003e-105\u003c/sup\u003e, 1.65e\u003csup\u003e-91\u003c/sup\u003e, and 3.81e\u003csup\u003e-91\u003c/sup\u003e, respectively. \u003cstrong\u003e(A)\u003c/strong\u003e The expanded images at 2 minutes and 4 minutes in the DIM treatment group were shown. White brackets indicate large Cut11-GFP signal gaps. White dashed arrows indicate Cut11-GFP signal aggregates. White arrows indicate the generated Cut11-GFP signal inside the nucleus. \u003cstrong\u003e(B)\u003c/strong\u003e White dashed arrows indicate GFP-Bqt4 signal aggregates. White arrows indicate the GFP-Bqt4 signal aggregates at the NE branch. \u003cstrong\u003e(C)\u003c/strong\u003e Expanded images at 3 minutes in the DIM treatment group were shown. White dashed arrows indicate the GFP-ADEL signal aggregates on the NE cytoplasm, and White arrow indicates the GFP-ADEL signal aggregates in the cytoplasm.\u003cstrong\u003e (D)\u003c/strong\u003e The expanded image at 5 minutes in the DIM treatment group was shown. The White arrow indicates the Ost4-CFP signal aggregate in the cytoplasm.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4653264/v1/326d856d9bd9496d5d5538d1.png"},{"id":61268047,"identity":"d035aadf-57b9-4185-89e3-5be99b4f58d5","added_by":"auto","created_at":"2024-07-29 01:04:24","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":765911,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eESCRT-III is required for cell survival in the presence of DIM\u003c/strong\u003e.\u003cstrong\u003e (A)\u003c/strong\u003e Time-lapse photos of cells with Cmp7-GFP in DIM treatment and DMSO groups were shown. Cmp7-GFP loci formed after DIM treatment. The expanded image at 5 minutes was shown. White arrows indicate formed Cmp7-GFP foci. Scale bar: 2µm. The percentage of cells with Cmp7 foci is significantly higher in the DIM group than in the DMSO group, P-value = 3.02e\u003csup\u003e-34\u003c/sup\u003e \u003cstrong\u003e(B, C) \u003c/strong\u003eDIM sensitivity of \u003cem\u003ecmp7∆\u003c/em\u003e, lnp\u003cem\u003e1∆\u003c/em\u003e, and \u003cem\u003evps4∆\u003c/em\u003e as determined by plating five-fold serial dilutions from the same number of log phase cells onto YEA plates with or without DIM at the concentration of 4.5µg/ml. Cells were incubated at 30˚C for 3-4 days.\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4653264/v1/f1471088ee18a39055fd5d1a.jpg"},{"id":61268526,"identity":"946f01ac-6c24-4bc0-aceb-2e3b585435fe","added_by":"auto","created_at":"2024-07-29 01:12:24","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":543257,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe Lem2 MSC domain is essential for cell survival in the presence of DIM. (A) \u003c/strong\u003eSchematic representation of Lem2 truncation constructs. Protein domains and positions (amino acids) are highlighted. All constructs were C-terminally GFP-tagged and expressed from the endogenous locus. \u003cstrong\u003e(B) \u003c/strong\u003eDIM sensitivity of Lem2 truncation constructs as determined by plating five-fold serial dilutions from the same number of log phase cells onto YEA plates with or without DIM at the concentration of 4.5µg/ml. Cells were incubated at 30˚C for 3-4 days.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4653264/v1/ee73c8c1b5c198b36e373250.jpg"},{"id":61268796,"identity":"36243f79-1cfa-419a-bd66-363469fe1ba5","added_by":"auto","created_at":"2024-07-29 01:20:24","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1280986,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe Bqt4 is essential for cell survival in the presence of DIM. (A) \u003c/strong\u003eSchematic representation of Bqt4 truncation constructs. Protein domains and positions (amino acids) are highlighted. All constructs were N-terminally GFP-tagged and expressed from the exogenous locus(\u003cem\u003elys1\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e). \u003cstrong\u003e(B) \u003c/strong\u003eDIM sensitivity of Bqt4 truncation constructs as determined by plating five-fold serial dilutions from the same number of log phase cells onto YEA plates with or without DIM at the concentration of 4.5µg/ml. Cells were incubated at 30˚C for 3-4 days.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4653264/v1/40b1b5e3fe8a470b7d2df714.png"},{"id":61268050,"identity":"c3fed163-55d1-472b-8c7b-03095b9aa600","added_by":"auto","created_at":"2024-07-29 01:04:24","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":397684,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBalance of lipid metabolism is indispensable for cells with DIM. (A) \u003c/strong\u003eDIM sensitivity \u003cem\u003enem1∆\u003c/em\u003e and \u003cem\u003epik3∆\u003c/em\u003eas determined by plating five-fold serial dilutions from the same number of log phase cells onto YEA plates with or without DIM at the concentration of 4.5µg/ml. Cells were incubated at 30˚C for 2-3 days.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4653264/v1/67683761d8d54c86fc0442d8.png"},{"id":61268052,"identity":"297c3aba-ab83-4b6f-9ae6-35f58139d595","added_by":"auto","created_at":"2024-07-29 01:04:24","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":341968,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA. DIM treatment disturbs the membrane-related protein localization pattern. \u003c/strong\u003eThe putative diagram of the DMSO group and DIM treatment group were shown. In the DMSO group, NPC channels nucleoplasm and cytoplasm, locating at NE uniformly. The Ish1 resided at the NE lumen. Bqt4 was anchored to INM. GFP-NLS signal was insulated inside of the NE. ER is contiguous with NE, and Ost4 localizes on the surface of ER. In the lumen of ER, is GFP-ADEL. In the DIM treatment group, the NE was severely punctured and deformed, showing the multivesicular body pattern. The Ish1, Bqt4, Ost4, Cut11, and ADEL signals form aggregates on NE, possibly colocalized. Besides, The Bqt4 accumulated at the branch of the cell, and the Cut11 could form aggregates by its mobility on NE without colocalizing with other membrane-related proteins. The Ost4 and GFP-ADEL could form dispersed aggregates within the cytoplasm including the Plasma membrane-ER contact site.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4653264/v1/a6c49abba34f9801977dbd1b.jpg"},{"id":64084038,"identity":"d0168daa-beb8-4131-89cf-c96c3ca7df5f","added_by":"auto","created_at":"2024-09-06 11:34:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":19012808,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4653264/v1/0191b9be-f396-49b3-bcea-07940854c82d.pdf"},{"id":61268053,"identity":"f1fcb904-5ade-4f06-abbb-3db23a0e1b4d","added_by":"auto","created_at":"2024-07-29 01:04:25","extension":"zip","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":67995252,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Movie. Videos of fluorescence-tagged stains with or without DIM treatment. \u003c/strong\u003eThe Videos started after 2 minutes of DIM treatment, taken in 30-second intervals and kept for 8 minutes. Frames:5, Scale bar: 2µm. Supplementary Movie 1(A, B) are the videos for the strain tagged by Cut11-GFP in the DMSO group and DIM treatment group, Supplementary Movie 2(A, B) for GFP-Bqt4, Supplementary Movie 3(A, B) for GFP-ADEL and Ish1-mCherry, Supplementary Movie 4(A, B) for Cpy1-mChery and Ost4-CFP, Supplementary Movie 5(A, B) for Cut11-3mRFP, Ish1-mCherry and GFP-NLS, Supplementary Movie 6(A, B) for Cmp7-GFP, respectively.\u003c/p\u003e","description":"","filename":"SupplementaryMovie.zip","url":"https://assets-eu.researchsquare.com/files/rs-4653264/v1/7249f80fb120aa4257b81064.zip"},{"id":61268527,"identity":"600ebeba-bd10-4d90-9b39-e30c3df8caf9","added_by":"auto","created_at":"2024-07-29 01:12:24","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":360828,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure.docx","url":"https://assets-eu.researchsquare.com/files/rs-4653264/v1/9ec6d89fd83054b3b3ef4860.docx"},{"id":61268045,"identity":"338830bb-b78a-4443-955b-af5e26ac47c6","added_by":"auto","created_at":"2024-07-29 01:04:24","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":19370,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable.docx","url":"https://assets-eu.researchsquare.com/files/rs-4653264/v1/87d642225823211ec37a36b3.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"3,3’-Diindolylmethane disrupts the endoplasmic reticulum and nuclear envelope in fission yeast","fulltext":[{"header":"Introduction","content":"\u003cp\u003e3,3\u0026rsquo;-Diindolylmethane (DIM), which is derived from edible fruit plants like broccoli, shows anticancer activity, through various pathways including apoptosis induction, cellular signaling disturbance such as NF-\u0026kappa;B, Akt, Wnt, and so on [\u003csup\u003e1\u003c/sup\u003e]. DIM also could induce autophagy in human cells [\u003csup\u003e2\u003c/sup\u003e]. \u003cem\u003eS. pombe\u003c/em\u003e is a widely used model organism for its simple genome and easy tackling [\u003csup\u003e3\u003c/sup\u003e]. It has already been reported that DIM could induce autophagy and apoptosis in \u003cem\u003eS. pombe\u003c/em\u003e [\u003csup\u003e4\u003c/sup\u003e]. Intriguingly, DIM was suggested to deform the nuclear envelope (NE) [\u003csup\u003e4\u003c/sup\u003e].\u003c/p\u003e\n\u003cp\u003eThe nucleus is isolated from the cytoplasm by the NE, a bi-membrane structure, with anchored nuclear pore complex (NPCs) channeling nucleoplasm and cytoplasm for molecule transportation. The inner nuclear membrane (INM) and outer nuclear membrane (ONM) consist of NE [\u003csup\u003e5,6\u003c/sup\u003e]. The INM protein is retained at INM and lumen proteins such as Ish1 reside in the lumen between INM and ONM [\u003csup\u003e7\u003c/sup\u003e]. The integrity of NE is essential for cell growth and viability as it is the basis for normal nucleus function including maintenance of genome stability [\u003csup\u003e8\u003c/sup\u003e]. NE undergoes disassembly during the mitosis, the so-called open mitosis in higher eukaryotes, and is subsequently reassembled by the endosomal sorting complex required for transport-III (ESCRT-III) [\u003csup\u003e9,10\u003c/sup\u003e]. In \u003cem\u003eS. pombe\u003c/em\u003e, the ESCRT-III complex is recruited by Cmp7 located at the reformed NE, in the process of which, Lem2 might also be required [\u003csup\u003e11\u0026ndash;13\u003c/sup\u003e]. Notably, ESCRT-III also functions during interphase in mammal cells [\u003csup\u003e14,15\u003c/sup\u003e].\u003c/p\u003e\n\u003cp\u003eThe endoplasmic reticulum (ER) is a large organelle within the cell and contiguous with NE. ER is responsible for the synthesizing and refolding of protein. Defects on ER could decrease cell viability [\u003csup\u003e16\u0026ndash;19\u003c/sup\u003e]. In \u003cem\u003eS. pombe\u003c/em\u003e, Lem2 and Lnp1 regulate the boundary between ONM and ER [\u003csup\u003e20,21\u003c/sup\u003e].\u003c/p\u003e\n\u003cp\u003eLem2 is a highly conserved INM protein with distinct functions among regions of Lem2. In fission yeast, the Lap2\u0026ndash;emerin\u0026ndash;Man1 (LEM) domain of Lem2 is responsible for interacting with centromeric chromatin and maintaining the localization of centromeres [\u003csup\u003e22\u003c/sup\u003e]. The BBM domain is responsible for Bqt4 binding [\u003csup\u003e23\u003c/sup\u003e]. The luminal domain is the part berried into the membrane. The MSC (MAN1-Src1p C-terminal) domain mediates heterochromatin silencing and interaction with nuclear exosomes to coordinate RNA degradation [\u003csup\u003e22,24,25\u003c/sup\u003e]. Moreover, Lem2 interacts with lipid synthesis enzymes and shows synthetic lethality with the deletion of \u003cem\u003ebqt4\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003elem2\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e, and the MSC domain of Lem2 could rescue the synthetic lethality [\u003csup\u003e26\u003c/sup\u003e]. In human cells, the MSC domain of LEM2 is responsible for interacting with CHMP7, the ortholog of \u003cem\u003ecmp7\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e in \u003cem\u003eS. pombe\u003c/em\u003e [\u003csup\u003e12\u003c/sup\u003e]. Lem2 is retained at NE by interaction with Bqt4, another INM protein [\u003csup\u003e23\u003c/sup\u003e]. Bqt4 is responsible for attaching telomere to NE by binding ability located at its N-terminal domain (NTD) to DNA non-specifically and Rap1[\u003csup\u003e27,28\u003c/sup\u003e]. Bqt4 could interact with different kinds of lipid synthesis enzymes and Bqt4 is suggestive of the potential to affect nucleus movement dynamics through the C-terminal domain (CTD) of Bqt4[\u003csup\u003e29,30\u003c/sup\u003e].\u003c/p\u003e\n\u003cp\u003eBio-membranes including NE and ER are comprised of lipids, thus lipid metabolism hemostasis is crucial for the maintenance of bio-membrane morphology and function. Lipid metabolism is regulated by various factors, Nem1and Pik3 are two of them. Nem1 is the subunit of serine/threonine protein phosphatase (Nem1-Spo7 complex) [\u003csup\u003e31\u003c/sup\u003e]. The deletion of \u003cem\u003enem1\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e leads to the expansion of NE [\u003csup\u003e32\u003c/sup\u003e] and the decrease of diglyceride and triglyceride levels [\u003csup\u003e31\u003c/sup\u003e]. In \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e, Nem1 activates Pah1 which converts PA to diacylglycerol (DAG) [\u003csup\u003e33\u003c/sup\u003e]. Pik3 possesses phosphatidylinositol (PI)-3 kinase activity to specifically phosphorylate PI to yield PI (3)P, and loss of Pik3 could cause a decreased amount of PI (3), the possible accumulation of PI and indirectly disturb the metabolism of other lipids located on NE, ER, etc. [\u003csup\u003e34\u0026ndash;37\u003c/sup\u003e].\u003c/p\u003e\n\u003cp\u003eThere was no report of severe deformed NE in human cells and less report of the deformed NE in \u003cem\u003eS. pombe\u003c/em\u003e by the treatment of DIM, further elucidation is required. In this study, we would like to focus on the effects of DIM on the Bio-membrane system in \u003cem\u003eS. pombe\u003c/em\u003e. We unveiled that DIM could disturb NE and ER drastically, NE repair, NE properties, and lipid hemostasis might be indispensable for cell survival in the presence of DIM. The findings in this study provided new insights into the molecular mechanism of DIM as an anti-cancer substance.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eDIM disturbs membranes within the cells.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIt was reported that localization Cut11, an NPC protein, was severely disturbed by the treatment of DIM at a concentration of 20\u0026micro;g/ml [\u003csup\u003e4\u003c/sup\u003e]. In this study, we analyzed the effect of DIM on NE in detail including Cut11-GFP localization with DIM at the same concentration. Hereafter, we referred to the addition of DIM to a concentration of 20\u0026micro;g/ml in liquid cultivates as DIM treatment. In this research, we took time-lapse images in 30-second intervals. The first image was taken 2 minutes after the DIM treatment and kept for 8 minutes, shown as videos in supplementary materials. We selected images at 60-second intervals, shown as time-lapse images. According to the figures, DIM already disturbed Cut11-GFP localization at 2 min. As time goes, the NE shape suggested by the Cut11-GFP signal was severely deformed, implying the failure in maintenance of the spherical nucleus shape. Simultaneously, Cut11-GFP accumulates together forming aggregates and gaps (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Interestingly, part of the Cut11-GFP signal appeared inside of the nucleus, possibly by the reorganization of NE, implying the special deformation pattern of the nucleus, such as the generation of protrusion or the multivesicular body (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, Supplementary Movie 1A, B). In conclusion, the changed Cut11-GFP localization pattern suggests changes in NPC localization, implying the deformation of the nucleus by DIM.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWondering whether other components of the NE are also affected by DIM, we visualized Bqt4 and Ish1, which are an INM protein and an NE lumen protein, respectively.\u003c/p\u003e \u003cp\u003eIn the case of Bqt4, 2 minutes after DIM treatment, the GFP-Bqt4 signal was slightly deformed. After undergoing severe deformation, GFP-Bqt4 signal intensity exhibited a heterogeneous distribution pattern and formed aggregates, compared to the DMSO group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, Supplementary Movie 2A, B). It is worth noting that the GFP-Bqt4 signal kept contiguous, different than that of Cut11-GFP in the presence of DIM. In the later stage, the GFP-Bqt4 signal shows multivesicular bodies, consistent with the observed phenomenon in the Cut11-GFP group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). This result suggests the severe reorganization of NE by DIM.\u003c/p\u003e \u003cp\u003eIn the case of Ish1, 2 minutes after DIM treatment, the deformation of Ish1-mCherry localization occurred, and the Ish1-mCherry signal formed aggregates and a protrusion-like structure. Later, the Ish1-mCherry signal undergoes further deformation, forming bigger Ish1 signal aggregates, and failing to maintain the spherical shape. (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, Supplementary Movie 3A, B).\u003c/p\u003e \u003cp\u003eIn general, individually observing the components of NPC, INM protein, and NE lumen, we concluded that DIM caused a drastic disturbance in NE. As the ONM is contiguous with ER, it is possible that DIM also affects ER. To test this idea, we use GFP fused with ADEL amino acid sequence, an ER lumen localization signal, as the ER marker [\u003csup\u003e21\u003c/sup\u003e]. 2 minutes after DIM treatment, DIM made the GFP-ADEL signal deformed and kept shrinking, like the observation results of the Ish1-mCherry signal. Notably, the GFP-ADEL signal formed dispersed aggregates at the cytoplasm (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, Supplementary Movie 3A, B).\u003c/p\u003e \u003cp\u003eIn case the localization of ADEL, not ER, was changed, we checked the distribution pattern of Ost4-CFP, an integral ER protein, as an ER marker [\u003csup\u003e38\u003c/sup\u003e]. A similar localization pattern as GFP-ADEL was observed. After 2 minutes of DIM treatment, the deformation of Ost4-CFP localization occurred. Subsequently, the Ost4-CFP localization underwent further deformation and formed dispersed aggregates (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, Supplementary Movie 4A, B). The deformed GFP-ADEL and Ost4-CFP signal localization strongly suggested the disturbance of ER by DIM. However, the vacuole seems not to be changed by the DIM treatment suggested by the unchanged Cpy1-mCherry signal (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, Supplementary Movie 4A, B) [\u003csup\u003e38\u003c/sup\u003e].\u003c/p\u003e \u003cp\u003eDrastic membrane reorganization of the NE and the ER could lead to the leakage of nucleoplasm. To confirm that the deformation of NE is concomitant with nucleoplasm leakage, we applied the stain with visualized nucleoplasm by NLS-GFP and visualized NE by both Cut11-3mRFP and Ish1-mCherry. 2 minutes after DIM treatment, NLS-GFP already partially mislocated from nucleoplasm into cytoplasm, with the deformation of the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, Supplementary Movie 5A, B). Subsequently, the NLS-GFP signal underwent further leakage and shrinkage, together with the further deformation of NE (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). This result suggests that DIM disturbed NE and led to nucleoplasm leakage.\u003c/p\u003e \u003cp\u003e \u003cb\u003eESCRT-III was activated with DIM treatment.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eNE was disturbed severely by the DIM treatment. NE repair pathway is of significance for maintaining NE integrity [\u003csup\u003e39\u003c/sup\u003e]. We are wondering whether the NE repair pathway is activated by the DIM treatment. ESCRT-III pathway is an important NE repair pathway [\u003csup\u003e40\u003c/sup\u003e]. As Cmp7 is responsible for recruiting ESCRT-III at the NE rupture site complex, the formation of Cmp7 foci was used as the marker of activation of the ESCRT-III pathway [\u003csup\u003e12\u003c/sup\u003e]. We applied strain containing GFP tagged Cmp7 and found that Cmp7-GFP foci showed up after DIM treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, Supplementary Movie 6A, B). To check whether the functional ESCRT-III pathway is indispensable for cell viability and growth with DIM, we conducted the spot assay using solid mediums containing DIM. Since the concentration of DIM in DIM treatment is so high for conducting spot assay that could extinct all cells, we optimized the concentration to 4.5\u0026micro;g/ml. As loss of Cmp7 could impair the onset of the ESCRT-III pathway [\u003csup\u003e12\u003c/sup\u003e], we checked the sensitivity to DIM of WT and \u003cem\u003ecmp7∆\u003c/em\u003e cells in the DIM concentration of 4.5\u0026micro;g/ml by spot assay. \u003cem\u003ecmp7∆\u003c/em\u003e strain showed obvious sensitivity to DIM compared to WT (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), suggesting that defects in ESCRT-III function in \u003cem\u003ecmp7∆\u003c/em\u003e conferred cell sensitivity to DIM. Besides, the lack of observed sensitivity in \u003cem\u003elnp1∆\u003c/em\u003e implies the dispensability of functional ER\u0026mdash;ONM boundary control in the presence of DIM (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eVps4, a type of AAA ATPase, is required for the disassembly and the recycling of ESCRT-III complex in mammal cells [\u003csup\u003e11,41\u0026ndash;43\u003c/sup\u003e]. In the fission yeast \u003cem\u003evps4\u003c/em\u003e∆ strain, the karmellae formation, a kind of deformed NE structure, suggests the importance of Vps4 in the ESCRT-III pathway [\u003csup\u003e12\u003c/sup\u003e]. Since the loss of Vps4 could lead to defects in ESCRT-III as well, we checked the sensitivity of \u003cem\u003evps4∆\u003c/em\u003e to DIM. Based on the spot assay result, \u003cem\u003evps4∆\u003c/em\u003e exhibited obvious sensitivity to DIM compared to WT, indicating that Vps4 is required for cells living with DIM. DIM sensitivity in \u003cem\u003evps4∆\u003c/em\u003e also suggests that the disassembly and recycling of the ESCRT-III complex is required for cells in the presence of DIM (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). In conclusion, DIM could cause NE damage, and a functional ESCRT-III pathway is required for cell survival in the presence of DIM.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMSC domain and NTD of Lem2 are required for surviving cells in DIM.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eLem2 is an INM protein with distinct domains mediating various functions, including coordination of RNA degradation [\u003csup\u003e24\u003c/sup\u003e], interaction with lipid synthesis enzyme [\u003csup\u003e29\u003c/sup\u003e], and cooperation with nuclear membrane protein network to regulate genome stability [\u003csup\u003e25,26\u003c/sup\u003e], etc. Lem2 was involved in the onset of the ESCRT-III pathway [\u003csup\u003e12\u003c/sup\u003e]. Although \u003cem\u003elem2∆\u003c/em\u003e is reported to be sensitive to DIM in fission yeast [\u003csup\u003e4\u003c/sup\u003e], we have no less understanding of what part of Lem2 is required for surviving cells with DIM. To identify the indispensable part of Lem2 in the presence of DIM, we applied Lem2 truncated mutants for spot assay (Fig.\u0026nbsp;3A). The expression of Lem2 constructs was shown in the strain-original paper [\u003csup\u003e24\u003c/sup\u003e]. The NE-localization of Lem2 constructs was checked by fluorescence observation (Supplementary Fig.\u0026nbsp;1). According to the spot assay results, the loss of full-length Lem2 shows the strongest sensitivity to DIM among other strains. In contrast to the loss of NTD which did not cause DIM sensitivity, merely the loss of the MSC domain in \u003cem\u003elem2∆MSC\u003c/em\u003e could lead to DIM sensitivity. The loss of NTD and MSC domain simultaneously in the \u003cem\u003elem2∆N∆MSC\u003c/em\u003e group resulted in comparable sensitivity to DIM as the \u003cem\u003elem2∆\u003c/em\u003e group (Fig.\u0026nbsp;3B). These results suggest the importance of the MSC domain for cells in the presence of DIM, and NTD showed a synergistic function with the MSC domain regarding DIM resistance.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBqt4 is essential for cells in the presence of DIM.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eBqt4 is another INM protein, and it is required for Lem2 to retain on NE. Besides the telomere-related function, the latest reports showed the binding affinity of Bqt4 to lipid synthesis enzyme [\u003csup\u003e29\u003c/sup\u003e], and the potential to affect NE physical properties [\u003csup\u003e30,44\u003c/sup\u003e]. Importantly, \u003cem\u003ebqt4\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e deletion is synthetically lethal with \u003cem\u003elem2\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e deletion, suggesting the presence of overlapping or similarity between the function of Bqt4 and Lem2. Since \u003cem\u003elem2∆\u003c/em\u003e showed DIM sensitivity, it is plausible that \u003cem\u003ebqt4\u003c/em\u003e∆ cells are also sensitive to DIM. To test this idea, we conducted the spot assay using \u003cem\u003ebqt4FL\u003c/em\u003e, \u003cem\u003ebqt4∆\u003c/em\u003e, and \u003cem\u003ebqt4dN(263\u0026ndash;432)\u003c/em\u003e which lack 1\u0026ndash;262 amino acids, to ask whether NTD is indispensable for cell survival with DIM(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). \u003cem\u003ebqt4∆\u003c/em\u003e cells showed sensitivity to DIM, sustaining that Bqt4 function is required for cell survival with DIM. Intriguingly, the loss of the NTD of Bqt4 did not confer DIM sensitivity upon cells, suggesting that CTD of Bqt4 might be essential for cells with DIM (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Additionally, the loss of the transmembrane domain of Bqt4 by removing 19 amino acids from C-terminal of Bqt4 in \u003cem\u003ebqt4-dTM\u003c/em\u003e could lead to mis-location of Bqt4 from NE to the nucleoplasm [\u003csup\u003e45\u003c/sup\u003e]. However, the \u003cem\u003ebqt4-dTM\u003c/em\u003e did not show DIM sensitivity for an unidentified reason (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Thus, we conclude that CTD of Bqt4 might possess certain membrane-related functions important in the presence of DIM.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eNem1 and Pik3 are indispensable for cell growth with DIM.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eNE and ER are mainly composed of lipids and were severely disturbed by DIM treatment. Both Lem2 and Bqt4, which are reported to relate to lipid synthesis, showed DIM sensitivity. These results pointed to the importance of lipid metabolism in the presence of DIM. Nem1 and Pik3 are two key factors in lipid metabolism. Nem1 might contribute to the conversion of PA to DAG, and Pik3 could phosphorylate PI to yield PI (3)P[\u003csup\u003e33,34,36,37\u003c/sup\u003e]. To investigate the importance of lipid synthesis with DIM, we checked the DIM sensitivity of cells with individually deleted \u003cem\u003enem1\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003epik3\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e by spot assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Obvious DIM sensitivity observed in both \u003cem\u003epik3∆\u003c/em\u003e and \u003cem\u003enem1∆\u003c/em\u003e compared with WT made it evident that Pik3 and Nem1 functions are indispensable for cells with DIM, most likely due to their roles in lipid metabolism.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAnti-cancer activity involving multi-pathway of DIM in human cells promotes us to gain further understanding of molecular mechanisms for DIM as an anti-cancer agent. However, the function of DIM on the Bio-membrane is less elucidated. This study reveals the Bio-membrane disturbance effects of DIM, and functional NE-relating pathways are required for cell survival in the presence of DIM.\u003c/p\u003e \u003cp\u003eNE is shown to be affected in this study. 2 minutes after DIM treatment, Cut11 already formed aggregates and gaps, distinguished from other markers of NE including Ish1 and Bqt4. At the same time, both Cut11-GFP and GFP-Bqt4 signal was still distributed in a circular pattern, refuting the severely reorganized NE (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B). Together with that Cut11 is the subunit of NPCs that could flow on NE [\u003csup\u003e46\u003c/sup\u003e], it is highly possible that the observed Cut11-GFP aggregates and gaps at the 2min timepoint were rooted from NPCs gathering by their own flowing on NE.\u003c/p\u003e \u003cp\u003eIn the case of GFP-Bqt4, it also shows signal aggregates although it is different than that of Cut11-GFP. Showing up of GFP-Bqt4 aggregates tend to be accompanied by the severe reorganization of NE 6 minutes after DIM treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Therefore, the formation of GFP-Bqt4 might result from the reorganization of NE. Interestingly, the GFP-Bqt4 signal is also distributed un-uniformly along with NE, the ability of Bqt4 to flow on NE or the generation of multilayer membrane might be the underlying reason [\u003csup\u003e46\u003c/sup\u003e]. No gaps observed in GFP-Bqt4 may be rooted in the size of Bqt4, a protein far smaller than the size of the NPC complex, and its high mobility on NE [\u003csup\u003e46\u003c/sup\u003e]. Intriguingly, Bqt4 aggregates tend to localize at the branch of the membrane as shown in the expanded images in the 10-minute timepoint (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), but the underlying mechanism still needs to be identified. These reorganizations of NE might be concomitant with the activation of the ESCRT-III pathway and nucleoplasm leakage.\u003c/p\u003e \u003cp\u003eAccording to the disturbed distribution of ADEL and Ost4, we conclude that ER is also disturbed by DIM. However, we lacked information about the origination of the aggregates of ADEL and Ost4 in cytoplasm exactly. Based on the video, we assume that Ost4 or ADEL aggregates in cytoplasm might resulted from the translocation of vesicles from the nucleus using NE to the cytoplasm or aggregation of ER which is originally located at cytoplasm (Supplementary Movie 3A, B). To clarify the total changes in cell membranes with the DIM treatment, we used a hypothetical diagram to depict the localization pattern of membrane-related proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCmp7 and Vps4 are required for cell survival in the presence of DIM. Loss of Cmp7 leads to defects in the recruitment of ESCRT-III complex to NE, in turn, leads to the loss of NE integrity [\u003csup\u003e12\u003c/sup\u003e]. Vps4 is mainly responsible for the resolution of malformation of NE caused by Cmp7. Loss of Vps4 causes the accumulation of malformed NE [\u003csup\u003e12\u003c/sup\u003e]. These kinds of failures in the ESCRT-III pathway might the be root of DIM sensitivity in \u003cem\u003ecmp7∆\u003c/em\u003e and \u003cem\u003evps4∆\u003c/em\u003e strains.\u003c/p\u003e \u003cp\u003e \u003cem\u003elem2\u003c/em\u003e∆ stain was sensitive to DIM, and it is less likely caused by the defects in ER-NE boundary control, as Lnp1, which possesses overlapping ability with Lem2 in terms of NE-ER boundary control, did not show DIM sensitivity (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Both the LEM domain and the Bqt4 binding domain are located at the NTD of Lem2. LEM domain is required for attaching centromere to SPB, Bqt4 binding domain is responsible for Lem2-Bqt4 interaction to locate Lem2 on NE. Loss of the Bqt4 binding domain will mobilize part of Lem2 from NE to SPB [\u003csup\u003e23\u003c/sup\u003e]. Both Bqt4 binding domain truncated Lem2 and NTD truncated Lem2 did not show DIM sensitivity, suggesting that centromere-SPB attachment and Lem2-Bqt4 interaction are not essential for cells with DIM. The decreased amount of Lem2 on NE could not make cells sensitive to DIM, supported by no sensitivity observed in \u003cem\u003elem2∆BB\u003c/em\u003e. DIM sensitivity was observed in \u003cem\u003elem2∆MSC\u003c/em\u003e, demonstrating the importance of the MSC domain in the presence of DIM. Among the functions on the MSC domain of Lem2, the loss of function responsible for synthetic lethality with \u003cem\u003ebqt4\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e or the possible loss of interaction with Cmp7 and might be important for DIM sensitivity. Intriguingly, ∆MSC and ∆N showed synergistic function in terms of DIM sensitivity, and further study is required to explain it. Noteworthy, we could not completely exclude the influence of higher protein levels of truncated Lem2. It is less possible that the DIM sensitivity in Lem2 constructs is conferred by the stress on cells caused by the higher level of Lem2 constructs, as these constructs did not show growth defects on the YEA plate. Besides, the DIM sensitivity of \u003cem\u003elem2∆\u003c/em\u003e is also possibly caused by loss of interaction between Lem2 and lipid synthesis enzyme.\u003c/p\u003e \u003cp\u003e \u003cem\u003ebqt4∆\u003c/em\u003e also shows DIM sensitivity. NTD of Bqt4 possesses the BBM protein binding motif and non-specific-DNA-binding motif [\u003csup\u003e27,28\u003c/sup\u003e]. Loss of NTD did not show DIM sensitivity, suggesting the importance of CTD of Bqt4 in DIM sensitivity. As other research implies the function of Bqt4-CTD on regulation of NE physical properties [\u003csup\u003e30,44\u003c/sup\u003e], the DIM sensitivity in \u003cem\u003ebqt4∆\u003c/em\u003e might resulted from the changed NE physical properties in the absence of CTD of Bqt4. Bqt4 shows synthetic lethality in \u003cem\u003ebqt4∆lem2∆\u003c/em\u003e and could interact with lipid synthesis enzymes [\u003csup\u003e29\u003c/sup\u003e]. It is also possible that the loss of these functions leads to DIM sensitivity. Interestingly, Bqt4 with truncated TM domain in \u003cem\u003ebqt4∆TM\u003c/em\u003e did not show DIM sensitivity. Decreased NE localization of Bqt4 is tolerable for cells undergoing DIM treatment, which might be one of the plausible explanations.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003enem1∆\u003c/em\u003e and \u003cem\u003epik3∆\u003c/em\u003e strains showed sensitivity to DIM, suggesting the importance of lipid homeostasis in the presence of DIM. \u003cem\u003enem1∆\u003c/em\u003e and \u003cem\u003epik3∆\u003c/em\u003e might disturb the composes of ER and NE indirectly, to make NE and ER could not carry out normal functions or more easily deteriorated by DIM. Noteworthy, as functional Pik3 could be required for autophagy which is necessary for surviving cells in the presence of DIM, as an autophagy factor \u003cem\u003eatg7\u003c/em\u003e\u003csup\u003e+\u003c/sup\u003e deletion makes cells sensitive to DIM [\u003csup\u003e4,47\u003c/sup\u003e]. DIM sensitivity in \u003cem\u003epik3∆\u003c/em\u003e might root from the defects in autophagy.\u003c/p\u003e \u003cp\u003eCollectively, DIM shows anti-cancer activity in various pathways in human cells, but the underlying molecular mechanism is less elucidated. The research of DIM using S. pombe reveals the membrane-relation activity of DIM, providing new inspects in understanding DIM as an anti-cancer agent.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eGrowth media\u003c/h2\u003e \u003cp\u003eCells were grown in YEA (0.5% yeast extract, 3% glucose, and 40 mg/ mL adenine, or Edinburgh minimal medium (EMM) with appropriate supplement at 30˚C. PH of the mediums were in the range of 6\u0026ndash;7.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMicroscopy.\u003c/b\u003e Microscopy images were obtained using an AxioCam digital camera (Zeiss) connected to an Axio Observer.Z1 microscope (Zeiss) with a Plan-Apochromat 63%, numerical aperture (NA) 1.4 objective lens or a 'Plan-FLUAR 100%, NA 1.45 objective lens. Pictures were captured and analyzed using AxioVision Rel. 4.8.2 Software (Zeiss).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eTransformation:\u003c/h2\u003e \u003cp\u003eThe reagent used in this method as follows:\u003c/p\u003e \u003cp\u003eLiAc-TE: 0.1M lithium acetate, 10mM Tris pH 7.5, 1 mM EDTA\u003c/p\u003e \u003cp\u003eLiAc-TE-PEG: LiAc-TE plus 40% PEG4000(W/V)\u003c/p\u003e \u003cp\u003eCarrier DNA: From Transformation kit (S. pombe Direct Transformation kit Wako Japan)\u003c/p\u003e \u003cp\u003eThe operation as follows: Grow fission yeast cells in MM to 10\u003csup\u003e7\u003c/sup\u003e cells in 10ml.Pellet 10ml of cells per transformation. (3000 rpm\u0026times;2 min). Transfer to 1 eppis. Wash cell in 1ml sterilized water (10000\u0026times;rpm flash), then wash in LiAc-TE (10000\u0026times;rpm flash). Resuspend in LiAc-TE at 2\u0026times;10\u003csup\u003e9\u003c/sup\u003e cells/ml. Make 5\u0026micro;l of this solution. Mix 50\u0026micro;l cells with 2\u0026micro;l carrier DNA at 5mg/ml and up to 4\u0026micro;l of DNA; mix gently. Incubate at RT for 10 min.(25\u0026deg;C). Add 130\u0026micro;l of 40% PEG/LiAc-TE; mix gently. Incubate 60 min at 25\u0026deg;C (Mix occasionally). Pre-warmed DMSO at 25℃. preheat the Incubator at 42 ℃. Add 21.5\u0026micro;l pre-warmed DMSO; mix gently. Heat shock at 42\u0026deg;C for 5 min. Pellet (10000\u0026times;rpm flash) and wash once in 1ml sterilized water (10000\u0026times;rpm flash). Resuspend in 100\u0026micro;l sterilized water and plate it on YEA. After 24h, replicate it on the selective plate.\u003c/p\u003e \u003cp\u003e \u003cb\u003eStrain construction.\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eS. pombe\u003c/em\u003e strains used in this research are listed in Supplementary Table\u0026nbsp;1. The primers and oligos used in this research are listed in Supplementary Table\u0026nbsp;2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eDetails of strain construction\u003c/h2\u003e \u003cp\u003eConstruction of 123-E09\u003c/p\u003e \u003cp\u003eThe genome of 107-j01(UKK 1519-2A) \u003cem\u003e[h- nem1∆::kanr cut11:GFP:ura4\u0026thinsp;+\u0026thinsp;leu1-32 ura4-D18 ade6-M210 or M216]\u003c/em\u003e was amplified by primer nem1t[GCGACTTACATTCTAGCAAA] and nem1b[TGTCGTTAGCCTAGTGATATG]. The resulting DNA fragment was introduced into stain 108-G02 \u003cem\u003e[h+]\u003c/em\u003e. The resulting strain 123-E09 \u003cem\u003e[h\u0026thinsp;+\u0026thinsp;nem1∆::kanr]\u003c/em\u003e was constructed.\u003c/p\u003e \u003cp\u003eConstruction of 123-B04\u003c/p\u003e \u003cp\u003eThe genome of 99-J03\u003cem\u003e[h\u0026thinsp;+\u0026thinsp;pik3::kanr ade6-M210 leu1-32 ura4-D18]\u003c/em\u003e was amplified by primers pik3t [AATGTGAGCAAACACAAAAC] and pik3b [ACAATTTCCCATCGAAACAT]. The resulting DNA fragment was introduced into 108-G02 \u003cem\u003e[h+]\u003c/em\u003e. The resulting strains 123-B04 \u003cem\u003e[ h\u0026thinsp;+\u0026thinsp;pik3::kanr ]\u003c/em\u003e were constructed.\u003c/p\u003e \u003cp\u003eConstruction of 101-D05\u003c/p\u003e \u003cp\u003e81-F02\u003cem\u003e[h\u0026thinsp;+\u0026thinsp;GFP-atb2-kanr cut11-3mRFP-hygr sfi1-CFP-natr leu1 ura4 his2]\u003c/em\u003e and 100-G10\u003cem\u003e[hm lys1-131 leu1-32 ura4-D18 ish1-mCherry::ura4\u0026thinsp;+\u0026thinsp;leu1+::adh1p-GFP-GST-NLS aur1r::atb2-mCherry]\u003c/em\u003e fresh cells were prepared and mixed in 10\u0026micro;l sterilized water. The resulting mixed cells were spotted on the ME plate and incubated at 25˚C for 72 hours for conjugation. The resulting cells obtained from conjugation were screened and the construction of 101-D05 \u003cem\u003e[H- cut11-3mRFP leu1+::adh1p-GFP-GST-NLS leu1-32 ura4-D18 ish1-mCherry::ura4+]\u003c/em\u003e was confirmed.\u003c/p\u003e \u003cp\u003eConstruction of 101-E02\u003c/p\u003e \u003cp\u003ethe genome of 100-G05 was amplified using primers cmp7t2 [ ATTATATTACCGCTTACAGTATCA), cmp7b2 [GAAAATAGTGAATTAAAAACGGTAC]). The resulting DNA fragment was introduced into stain 32-D05 /wt(975) \u003cem\u003e[h+]\u003c/em\u003e. The resulting strain 101-E02 \u003cem\u003e[h\u0026thinsp;+\u0026thinsp;cmp7∆::nat]\u003c/em\u003e was constructed.\u003c/p\u003e \u003cp\u003eConstruction of 101-E04\u003c/p\u003e \u003cp\u003ethe genome of 100-H01 /YT2426 [h- lnp1∆::hph]was amplified using primer ; lnp1t1:14-A06 [GCGAATATGCAGTGAAAGCC], lnp1b1: [AAGTCCAAGTTTGCTTCCCC]). The resulting DNA fragment was introduced into stain 32-D05 /wt(975) \u003cem\u003e[h+]\u003c/em\u003e. The resulting strain 101-E04 \u003cem\u003e[h\u0026thinsp;+\u0026thinsp;cmp7∆::nat]\u003c/em\u003e was constructed\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMU is supported by MEXT/JSPS KAKENHI, Grant Number 23K05865.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo potential conflicts of interest were disclosed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Y. Hiraoka, Y. Hirano, Y. Chikashige,\u0026nbsp;M. Yanagida,\u0026nbsp;Sigurd J. Braun, Li-lin Du\u0026nbsp;and the National Bioresource Project Japan for providing the plasmids and strains. We thank Editage\u0026nbsp;(www.editage.jp)\u0026nbsp;for English language editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the data supporting the findings of this study are available within the paper and its supplementary information files. Further data are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKaiyu Wang, Hyekyung Seol, Parvaneh Emami and Hideto Nagai performed experiments. Masaru Ueno and Kaiyu Wang analyzed the results and wrote the paper with contributions from all authors. Wang kaiyu drew the putative diagram in Fig. 6A using Microsoft PowerPoint, version: 16.86 (24060916).\u003c/p\u003e\n\u003cp\u003ehttps://apps.tokenpedia.com/com.microsoft.office.powerpoint?source=o\u0026amp;device=c\u0026amp;keyword=microsoft%20powerpoint\u0026amp;msclkid=2793065fc1f319d68d296026fa6b2ed9.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKim, S. M. Cellular and molecular mechanisms of 3,3\u0026rsquo;-diindolylmethane in gastrointestinal cancer. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, (2016).\u003c/li\u003e\n\u003cli\u003eTang, H. \u003cem\u003eet al.\u003c/em\u003e 3,3\u0026prime;-diindolylmethane inhibits LPS-induced human chondrocytes apoptosis and extracellular matrix degradation by activating PI3K-Akt-mTOR-mediated autophagy. \u003cem\u003eFront Pharmacol\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1\u0026ndash;20 (2022).\u003c/li\u003e\n\u003cli\u003eHayles, J. \u0026amp; Nurse, P. Introduction to fission yeast as a model system. \u003cem\u003eCold Spring Harb Protoc\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, 323\u0026ndash;333 (2018).\u003c/li\u003e\n\u003cli\u003eEmami, P. \u0026amp; Ueno, M. 3,3\u0026prime;-Diindolylmethane induces apoptosis and autophagy in fission yeast. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 1\u0026ndash;20 (2021).\u003c/li\u003e\n\u003cli\u003eGallardo, P., Barrales, R., Daga, R. R. \u0026amp; Salas-pino, S. Nuclear Mechanics in the Fission Yeast. (2019).\u003c/li\u003e\n\u003cli\u003eAgrawal, A. \u0026amp; Lele, T. P. Mechanics of nuclear membranes. \u003cem\u003eJ Cell Sci\u003c/em\u003e \u003cstrong\u003e132\u003c/strong\u003e, 1\u0026ndash;8 (2019).\u003c/li\u003e\n\u003cli\u003eAsakawa, H., Hirano, Y., Shindo, T., Haraguchi, T. \u0026amp; Hiraoka, Y. Fission yeast Ish1 and Les1 interact with each other in the lumen of the nuclear envelope. \u003cem\u003eGenes to Cells\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 643\u0026ndash;656 (2022).\u003c/li\u003e\n\u003cli\u003eWebster, B. M. \u0026amp; Lusk, C. P. Border Safety: Quality Control at the Nuclear Envelope. \u003cem\u003eTrends Cell Biol\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 29\u0026ndash;39 (2016).\u003c/li\u003e\n\u003cli\u003eG\u0026uuml;ttinger, S., Laurell, E. \u0026amp; Kutay, U. Orchestrating nuclear envelope disassembly and reassembly during mitosis. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 178\u0026ndash;191 (2009).\u003c/li\u003e\n\u003cli\u003eUngricht, R. \u0026amp; Kutay, U. Mechanisms and functions of nuclear envelope remodelling. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 229\u0026ndash;245 (2017).\u003c/li\u003e\n\u003cli\u003ePieper, G. H., Sprenger, S., Teis, D. \u0026amp; Oliferenko, S. ESCRT-III/Vps4 Controls Heterochromatin-Nuclear Envelope Attachments. \u003cem\u003eDev Cell\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, 27-41.e6 (2020).\u003c/li\u003e\n\u003cli\u003eGu, M. \u003cem\u003eet al.\u003c/em\u003e LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. (2017) doi:10.1073/pnas.1613916114.\u003c/li\u003e\n\u003cli\u003evon Appen, A. \u003cem\u003eet al.\u003c/em\u003e LEM2 phase separation promotes ESCRT-mediated nuclear envelope reformation. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e582\u003c/strong\u003e, 115\u0026ndash;118 (2020).\u003c/li\u003e\n\u003cli\u003eDenais, C. M. \u003cem\u003eet al.\u003c/em\u003e Nuclear envelope rupture and repair during cancer cell migration. \u003cem\u003eScience (1979)\u003c/em\u003e \u003cstrong\u003e352\u003c/strong\u003e, 353\u0026ndash;358 (2016).\u003c/li\u003e\n\u003cli\u003eRaab, M. \u003cem\u003eet al.\u003c/em\u003e ESCRT III repairs nuclear envelope ruptures during cell migration to limit DNA damage and cell death. \u003cem\u003eScience (1979)\u003c/em\u003e \u003cstrong\u003e352\u003c/strong\u003e, 359\u0026ndash;362 (2016).\u003c/li\u003e\n\u003cli\u003eSchwarz, D. S. \u0026amp; Blower, M. D. The endoplasmic reticulum: Structure, function and response to cellular signaling. \u003cem\u003eCellular and Molecular Life Sciences\u003c/em\u003e \u003cstrong\u003e73\u003c/strong\u003e, 79\u0026ndash;94 (2016).\u003c/li\u003e\n\u003cli\u003eWang, N., Shibata, Y., Paulo, J. A., Gygi, S. P. \u0026amp; Rapoport, T. A. A conserved membrane curvature-generating protein is crucial for autophagosome formation in fission yeast. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, (2023).\u003c/li\u003e\n\u003cli\u003eSmethurst, D. G. J. \u0026amp; Cooper, K. F. ER fatalities\u0026mdash;The role of ER-mitochondrial contact sites in yeast life and death decisions. \u003cem\u003eMech Ageing Dev\u003c/em\u003e \u003cstrong\u003e161\u003c/strong\u003e, 225\u0026ndash;233 (2017).\u003c/li\u003e\n\u003cli\u003eChen, X., Shi, C., He, M., Xiong, S. \u0026amp; Xia, X. Endoplasmic reticulum stress: molecular mechanism and therapeutic targets. \u003cem\u003eSignal Transduct Target Ther\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, (2023).\u003c/li\u003e\n\u003cli\u003eKume, K., Cantwell, H., Burrell, A. \u0026amp; Nurse, P. Nuclear membrane protein Lem2 regulates nuclear size through membrane flow. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 1\u0026ndash;8 (2019).\u003c/li\u003e\n\u003cli\u003eHirano, Y. \u003cem\u003eet al.\u003c/em\u003e Lem2 and Lnp1 maintain the membrane boundary between the nuclear envelope and endoplasmic reticulum. \u003cem\u003eCommun Biol\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eBraun, S. \u0026amp; Barrales, R. R. Beyond Tethering and the LEM domain: MSCellaneous functions of the inner nuclear membrane Lem2. \u003cem\u003eNucleus\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 523\u0026ndash;531 (2016).\u003c/li\u003e\n\u003cli\u003eHirano, Y. \u003cem\u003eet al.\u003c/em\u003e Lem2 is retained at the nuclear envelope through its interaction with Bqt4 in fission yeast. \u003cem\u003eGenes to Cells\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 122\u0026ndash;135 (2018).\u003c/li\u003e\n\u003cli\u003eCaballero, L. M. \u003cem\u003eet al.\u003c/em\u003e The inner nuclear membrane protein Lem2 coordinates RNA degradation at the nuclear periphery. \u003cstrong\u003e29\u003c/strong\u003e, (2022).\u003c/li\u003e\n\u003cli\u003eBarrales, R. R., Forn, M., Georgescu, P. R., Sarkadi, Z. \u0026amp; Braun, S. Control of heterochromatin localization and silencing by the nuclear membrane protein Lem2. \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 133\u0026ndash;148 (2016).\u003c/li\u003e\n\u003cli\u003eTange, Y. \u003cem\u003eet al.\u003c/em\u003e Inner nuclear membrane protein Lem2 augments heterochromatin formation in response to nutritional conditions. \u003cem\u003eGenes to Cells\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 812\u0026ndash;832 (2016).\u003c/li\u003e\n\u003cli\u003eHu, C. \u003cem\u003eet al.\u003c/em\u003e The Inner Nuclear Membrane Protein Bqt4 in Fission Yeast Contains a DNA-Binding Domain Essential for Telomere Association with the Nuclear Envelope. \u003cem\u003eStructure\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 335-343.e3 (2019).\u003c/li\u003e\n\u003cli\u003eHu, C. \u003cem\u003eet al.\u003c/em\u003e Structural insights into chromosome attachment to the nuclear envelope by an inner nuclear membrane protein Bqt4 in fission yeast. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e47\u003c/strong\u003e, 1573\u0026ndash;1584 (2019).\u003c/li\u003e\n\u003cli\u003eHirano, Y. \u003cem\u003eet al.\u003c/em\u003e Inner nuclear membrane proteins Lem2 and Bqt4 interact with different lipid synthesis enzymes in fission yeast. \u003cem\u003eJ Biochem\u003c/em\u003e \u003cstrong\u003e174\u003c/strong\u003e, 33\u0026ndash;46 (2023).\u003c/li\u003e\n\u003cli\u003eWang, K., Ito, H., Kanoh, J. \u0026amp; Ueno, M. Bqt4 affects relative movement between SPB and nucleolus in fission yeast. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e \u003cstrong\u003e714\u003c/strong\u003e, 149970 (2024).\u003c/li\u003e\n\u003cli\u003eFoo, S., Cazenave-Gassiot, A., Wenk, M. R. \u0026amp; Oliferenko, S. Diacylglycerol at the inner nuclear membrane fuels nuclear envelope expansion in closed mitosis. \u003cem\u003eJ Cell Sci\u003c/em\u003e \u003cstrong\u003e136\u003c/strong\u003e, (2023).\u003c/li\u003e\n\u003cli\u003eKume, K. \u003cem\u003eet al.\u003c/em\u003e A systematic genomic screen implicates nucleocytoplasmic transport and membrane growth in nuclear size control. \u003cem\u003ePLoS Genet\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1\u0026ndash;18 (2017).\u003c/li\u003e\n\u003cli\u003eKhondker, S., Han, G. S. \u0026amp; Carman, G. M. Phosphorylation-mediated regulation of the Nem1-Spo7/Pah1 phosphatase cascade in yeast lipid synthesis. \u003cem\u003eAdv Biol Regul\u003c/em\u003e \u003cstrong\u003e84\u003c/strong\u003e, 100889 (2022).\u003c/li\u003e\n\u003cli\u003eMorita, R. \u003cem\u003eet al.\u003c/em\u003e Phosphatidylinositol-3 Kinase in Fission Yeast: A Possible Role in Stress Responses. \u003cem\u003eBiosci Biotechnol Biochem\u003c/em\u003e \u003cstrong\u003e59\u003c/strong\u003e, 678\u0026ndash;682 (1995).\u003c/li\u003e\n\u003cli\u003eTakegawa, K., DeWald, D. B. \u0026amp; Emr, S. D. Schizosaccharomyces pombe Vps34p, a phosphatidylinositol-specific PI 3-kinase essential for normal cell growth and vacuole morphology. \u003cem\u003eJ Cell Sci\u003c/em\u003e \u003cstrong\u003e108\u003c/strong\u003e, 3745\u0026ndash;3756 (1995).\u003c/li\u003e\n\u003cli\u003eMitra, P. \u003cem\u003eet al.\u003c/em\u003e A novel phosphatidylinositol(3,4,5)P3 pathway in fission yeast. \u003cem\u003eJournal of Cell Biology\u003c/em\u003e \u003cstrong\u003e166\u003c/strong\u003e, 205\u0026ndash;211 (2004).\u003c/li\u003e\n\u003cli\u003eOnishi, M. \u003cem\u003eet al.\u003c/em\u003e Role of phosphatidylinositol 3-phosphate in formation of forespore membrane in Schizosaccharomyces pombe. \u003cem\u003eYeast\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 193\u0026ndash;206 (2003).\u003c/li\u003e\n\u003cli\u003eZou, C. X. \u003cem\u003eet al.\u003c/em\u003e The ortholog of human REEP1-4 is required for autophagosomal enclosure of ER-phagy/ nucleophagy cargos in fission yeast. \u003cem\u003ePLoS Biol\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 1\u0026ndash;27 (2023).\u003c/li\u003e\n\u003cli\u003eKamikawa, Y. \u003cem\u003eet al.\u003c/em\u003e Impact of cell cycle on repair of ruptured nuclear envelope and sensitivity to nuclear envelope stress in glioblastoma. \u003cem\u003eCell Death Discov\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 1\u0026ndash;2 (2023).\u003c/li\u003e\n\u003cli\u003eIsermann, P. \u0026amp; Lammerding, J. Consequences of a tight squeeze: Nuclear envelope rupture and repair. \u003cem\u003eNucleus\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 268\u0026ndash;274 (2017).\u003c/li\u003e\n\u003cli\u003eVietri, M., Radulovic, M. \u0026amp; Stenmark, H. The many functions of ESCRTs. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 25\u0026ndash;42 (2020).\u003c/li\u003e\n\u003cli\u003eShestakova, A., Curtiss, M., Davies, B. A., Katzmann, D. J. \u0026amp; Babst, M. The Linker Region Plays a Regulatory Role in Assembly and Activity of the Vps4 AAA ATPase. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e \u003cstrong\u003e288\u003c/strong\u003e, 26810\u0026ndash;26819 (2013).\u003c/li\u003e\n\u003cli\u003eJouvenet, N. Dynamics of ESCRT proteins. \u003cem\u003eCellular and Molecular Life Sciences\u003c/em\u003e \u003cstrong\u003e69\u003c/strong\u003e, 4121\u0026ndash;4133 (2012).\u003c/li\u003e\n\u003cli\u003eLe, T. K. \u003cem\u003eet al.\u003c/em\u003e A ubiquitin\u0026ndash;proteasome pathway degrades the inner nuclear membrane protein Bqt4 to maintain nuclear membrane homeostasis. \u003cem\u003eJ Cell Sci\u003c/em\u003e \u003cstrong\u003e136\u003c/strong\u003e, (2023).\u003c/li\u003e\n\u003cli\u003eChikashige, Y. \u003cem\u003eet al.\u003c/em\u003e Membrane proteins Bqt3 and -4 anchor telomeres to the nuclear envelope to ensure chromosomal bouquet formation. \u003cem\u003eJournal of Cell Biology\u003c/em\u003e \u003cstrong\u003e187\u003c/strong\u003e, 413\u0026ndash;427 (2009).\u003c/li\u003e\n\u003cli\u003eEbrahimi, H., Masuda, H., Jain, D. \u0026amp; Cooper, J. P. Distinct \u0026lsquo;safe zones\u0026rsquo; at the nuclear envelope ensure robust replication of heterochromatic chromosome regions. \u003cem\u003eElife\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1\u0026ndash;32 (2018).\u003c/li\u003e\n\u003cli\u003eYu, Z. Q. \u003cem\u003eet al.\u003c/em\u003e Atg38-Atg8 interaction in fission yeast establishes a positive feedback loop to promote autophagy. \u003cem\u003eAutophagy\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 2036\u0026ndash;2051 (2020).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"3,3’-Diindolylmethane, nuclear envelope, endoplasmic reticulum, ESCRT-III, lipid","lastPublishedDoi":"10.21203/rs.3.rs-4653264/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4653264/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e3,3\u0026rsquo;-Diindolylmethane is used as an anti-cancer agent for its bioactivity in various pathways. However, the mechanism of 3,3\u0026rsquo;-Diindolylmethane still needs to be further elucidated. It is reported that 3,3\u0026rsquo;-Diindolylmethane disturbed the localization of Cut11, a kind of subunit of the nuclear pore complex in \u003cem\u003eSchizosaccharomyces Pombe\u003c/em\u003e. In this study, we find that in \u003cem\u003eSchizosaccharomyces Pombe\u003c/em\u003e, 3,3\u0026rsquo;-Diindolylmethane also could disturb the localization of inner nuclear membrane protein Bqt4, nuclear envelope lumen protein Ish1 and leads to the leakage of GFP-NLS, making it evident that 3,3\u0026rsquo;-Diindolylmethane disrupts the nuclear envelope. Moreover, 3,3\u0026rsquo;-Diindolylmethane disturbs the localization of GFP-ADEL and Ost4, which are endoplasmic reticulum lumen proteins and membrane proteins respectively, suggesting the function of 3,3\u0026rsquo;-Diindolylmethane on endoplasmic reticulum disturbance. The nuclear envelope repairment, normal nuclear envelope physical properties, and lipid metabolism homeostasis were indispensable for cells\u0026rsquo; survival in the presence of 3,3\u0026rsquo;-Diindolylmethane. This study provides new insights into the understanding and development of 3,3\u0026rsquo;-Diindolylmethane as an anti-cancer agent.\u003c/p\u003e","manuscriptTitle":"3,3’-Diindolylmethane disrupts the endoplasmic reticulum and nuclear envelope in fission yeast","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-29 01:04:19","doi":"10.21203/rs.3.rs-4653264/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"28ca3f0f-a7dc-4352-8566-ff90e1530365","owner":[],"postedDate":"July 29th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":35071874,"name":"Biological sciences/Cell biology/Organelles/Nucleus"},{"id":35071875,"name":"Biological sciences/Cell biology/Organelles/Endoplasmic reticulum"}],"tags":[],"updatedAt":"2024-09-06T11:25:58+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-29 01:04:19","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4653264","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4653264","identity":"rs-4653264","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.