Rapid visual detection of Treponema pallidum using the RPA-CRISPR/Cas12a System

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Syphilis, caused by Treponema pallidum , is a sexually transmitted infection that has re-emerged globally over the past decade, posing significant public health challenges. Conventional diagnostic methods are limited by lengthy processing times, operational complexity, and moderate sensitivity, highlighting the urgent need for rapid, sensitive, and user-friendly detection strategies. In this study, we developed a visual detection platform for T. pallidum DNA by integrating recombinase polymerase amplification (RPA) with CRISPR/Cas12a technology. The assay can be completed within one hour, with results directly interpreted via fluorescence readout. It demonstrated a detection limit as low as 11.34 copies/µL and high specificity, accurately distinguishing T. pallidum without cross-reactivity with common blood-borne pathogens, including HIV, HBV, HCV, and DENV. Validation with clinical samples showed complete concordance with standard diagnostic outcomes. To enhance suitability for point-of-care applications, the RPA-CRISPR/Cas12a system was further adapted to a lateral flow assay (LFA) format, achieving a detection sensitivity of 5.56×10² copies/µL while minimizing reliance on specialized instrumentation. Overall, this platform provides a rapid, sensitive, and robust approach for point-of-care syphilis diagnosis and offers a reference framework for detecting other pathogenic organisms.
Full text 110,890 characters · extracted from preprint-html · click to expand
Rapid visual detection of Treponema pallidum using the RPA-CRISPR/Cas12a System | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Rapid visual detection of Treponema pallidum using the RPA-CRISPR/Cas12a System Wenrui Li, Yuanzhong Sun, Minnan Ye, Yuemei Liang, Jinyi Ouyang, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7789887/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 13 Jan, 2026 Read the published version in Scientific Reports → Version 1 posted 11 You are reading this latest preprint version Abstract Syphilis, caused by Treponema pallidum , is a sexually transmitted infection that has re-emerged globally over the past decade, posing significant public health challenges. Conventional diagnostic methods are limited by lengthy processing times, operational complexity, and moderate sensitivity, highlighting the urgent need for rapid, sensitive, and user-friendly detection strategies. In this study, we developed a visual detection platform for T. pallidum DNA by integrating recombinase polymerase amplification (RPA) with CRISPR/Cas12a technology. The assay can be completed within one hour, with results directly interpreted via fluorescence readout. It demonstrated a detection limit as low as 11.34 copies/µL and high specificity, accurately distinguishing T. pallidum without cross-reactivity with common blood-borne pathogens, including HIV, HBV, HCV, and DENV. Validation with clinical samples showed complete concordance with standard diagnostic outcomes. To enhance suitability for point-of-care applications, the RPA-CRISPR/Cas12a system was further adapted to a lateral flow assay (LFA) format, achieving a detection sensitivity of 5.56×10² copies/µL while minimizing reliance on specialized instrumentation. Overall, this platform provides a rapid, sensitive, and robust approach for point-of-care syphilis diagnosis and offers a reference framework for detecting other pathogenic organisms. Biological sciences/Biological techniques Health sciences/Diseases Biological sciences/Microbiology Treponema pallidum recombinase polymerase amplification CRISPR/Cas12a Visualization detection Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Syphilis, a sexually transmitted infection (STI) caused by the spirochete Treponema pallidum subsp. pallidum has undergone a significant global resurgence in recent decades [ 1 , 2 ]. Since the early 2000s, syphilis incidence has risen markedly worldwide, exacerbating the overall burden of STIs and posing substantial challenges to public health infrastructure and socioeconomic stability [ 3 ]. Epidemiological data indicate that approximately 8 million new syphilis cases were reported globally in 2022, with congenital syphilis cases alone reaching an alarming 1.5 million in 2023. These figures underscore persistent gaps in transmission prevention, maternal screening, and neonatal care [ 4 ]. Early detection and timely treatment are essential for mitigating mortality, averting severe sequelae, and enhancing long-term patient outcomes and quality of life [ 5 ]. Current syphilis diagnosis predominantly relies on serological antibody assays, categorized into non-treponemal tests (NTTs) and treponemal tests (TTs) [ 6 ]. NTTs detect immunoglobulin M and G antibodies against lipids released from damaged host cells or cardiolipin components of T. pallidum [ 7 ]. Their sensitivity varies by disease stage, ranging from 62%-78% in primary and late syphilis to 97%-100% in secondary syphilis [ 8 , 9 ]. Despite their simplicity and cost-effectiveness, which facilitate widespread use in screening programs, NTTs are susceptible to false positives in conditions such as pregnancy, autoimmune disorders, and concurrent infections. In contrast, TTs-including the Treponema pallidum particle agglutination assay (TPPA), Treponema pallidum hemagglutination assay (TPHA), enzyme-linked immunosorbent assay (ELISA), and chemiluminescence immunoassay (CLIA)-target antibodies against T. pallidum -specific antigens, providing superior sensitivity and specificity [ 10 , 11 ]. These assays are particularly effective for confirmatory diagnosis in early syphilis, addressing NTT limitations during this phase [ 12 ]. However, a key drawback of TTs is their inability to distinguish between active and resolved infections, as anti-treponemal antibodies often persist lifelong, rendering them unsuitable for monitoring treatment efficacy or disease activity. To enhance diagnostic precision, molecular approaches such as Treponema pallidum polymerase chain reaction (TP-PCR) have been developed, targeting genomic loci including polA [ 13 ], tp47 [ 14 ], and 23S rRNA [ 15 ]. Among these, polA and tp47 are the most commonly validated and implemented targets in clinical laboratories worldwide. Although TP-PCR offers high accuracy, its adoption is constrained by requirements for specialized equipment, technical expertise, and elevated costs [ 16 ]. Consequently, there remains a critical need for rapid, sensitive, specific, and accessible diagnostic tools to bolster syphilis control and curb the epidemic. The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated (Cas) system, initially acclaimed for genome editing, has been adapted for molecular diagnostics [ 17 ]. Systems such as CRISPR/Cas12a [ 18 ], CRISPR/Cas12b [ 19 ], and CRISPR/Cas13a [ 20 ] leverage programmable nucleic acid recognition for highly specific target detection, establishing CRISPR-Cas as a versatile platform for nucleic acid-based diagnostics. Complementing this, recombinase polymerase amplification (RPA) enables the isothermal amplification of double-stranded DNA without the need for thermal cycling, yielding abundant amplicons rapidly [ 21 ]. Integrating RPA with CRISPR-Cas enhances sensitivity and specificity, facilitating detection of low-abundance targets in resource-limited settings [ 22 ]. Relative to traditional PCR methods, RPA-CRISPR/Cas12 platforms offer improved performance while obviating the need for costly instrumentation and advanced facilities. Their adaptability supports diverse readout formats, including fluorescence, lateral flow strips, and naked-eye visualization, making them ideal for point-of-care and field applications [ 23 , 24 ]. In this study, we describe the development, optimization, and validation of a rapid, highly sensitive, and specific syphilis detection assay based on an RPA-CRISPR/Cas12a platform. Results are interpretable via three modalities: naked-eye observation (NEO), lateral flow assay (LFA), and fluorescence-based detection (FBDA). This approach enables efficient identification of T. pallidum and serves as a foundational framework for advancing point-of-care diagnostics for syphilis and other infectious pathogens. Materials and methods Materials and reagents All nucleic acid sequences used in this study, including the recombinant tp47 plasmid, RPA primers, nucleic acid templates from Human Immunodeficiency Virus (HIV, GenBank: D86068.1), Hepatitis B virus(HBV, GenBank: MT426913.1), Hepatitis C virus (HCV, GenBank: KJ439771.1) and Dengue virus (DENV, GenBank: M14931.2). CRISPR RNAs (crRNAs), the fluorescent ssDNA reporter, and the lateral flow strip reporter, were synthesized by Aiji Biotechnology Co., Ltd. (Guangzhou, China). EnGen® Lba Cas12a (Cpf1) was obtained from New England Biolabs (Ipswich, MA, USA), and TwistAmp® Basic DNA Amplification Kits were purchased from TwistDx Ltd (Cambridge, UK). Tiosbio® Cas12/13-specific nucleic acid test strips were acquired from Beijing Baoying Tonghui Biotechnology Co., Ltd. (Beijing, China). Human serum samples for clinical validation were provided by our institutional laboratory. All procedures involving human specimens were conducted in accordance with the Declaration of Helsinki and approved by the Ethics Review Committee of the Ninth People’s Hospital of Dongguan (Approval No. 3, 2022). Plasmid construction and copy number calculation The tp47 gene (GenBank: M88769.1) was selected as the target for syphilis detection and cloned into the pBluescript II SK(-) vector using standard recombinant DNA techniques. Plasmid DNA copy number was determined using the formula: DNA copy number per microliter = [(6.02 x 10^23) x (plasmid concentration, in nanograms per microliter) x 10 − 9 ]/[(fragment length, in nucleotides) x660], where 6.02×10²³ represents Avogadro’s number, and 660 is the average molecular weight of a base pair in Daltons. CrRNA and RPA primer design CrRNA sequences of 41 nucleotides were designed using CRISPR RGEN Tools ( http://www.rgenome.net/cas-designer/ ). The specificity of each crRNA targeting tp47 was validated via NCBI BLAST. RPA primers were subsequently designed based on the tp47 sequence encompassing the crRNA binding region, following the guidelines in the TwistAmp Assay Design Manual. Three candidate primer pairs were evaluated for specificity using NCBI BLAST, and the optimal primer pair was selected based on amplification efficiency and product size confirmed by agarose gel electrophoresis. Table 1 The oligonucleotide sequences for the primer, crRNA, and ssDNA reporter Name Oligonucleotide sequence (5’-3’) tp47F1 GTTCCTCATGAATTAAAAGGGATTGCAAAG tp47R1 AAAAACTATCCTCAGTGAGCATTGTCTTAAGG tp47F2 CGAGGAATACAAGATTACGAACGTAAAGGT tp47R2 CAGAAAAACTATCCTCAGTGAGCATTGTCT tp47F3 TAAGACAATGCTCACTGAGGATAGTTTTTC tp47R3 ACATAGTCGATGAACTCACGGTGCGACAGC CrRNA UAAUUUCUACUAAGUGUAGAU UGCACGUAAGGUAAGCAGCA ssDNA-FQ 6-FAM- TTATT-BHQ1 ssDNA-FB 6-FAM- TTATT-Biotin RPA amplification RPA was performed using the TwistAmp® Basic Kit following the manufacturer’s instructions. The reaction mixture (total volume 47.5 µL) comprised 29.5 µL resuspension buffer, 2.4 µL each of forward and reverse primers (10 µM), 1 µL target nucleic acid template, and one enzyme pellet, with nuclease-free water added to reach the final volume. After thorough mixing, 2.5 µL of magnesium acetate (280 mM) was added to initiate the reaction. The mixture was briefly centrifuged and incubated at 39°C for 30 minutes. Fluorescence detection assay based on RPA-CRISPR/Cas12a For fluorescence-based detection, 10 µL of the RPA-amplified product was combined with 100 nM crRNA, 100 nM EnGen Lba Cas12a (Cpf1; New England Biolabs, USA), 100 nM fluorescent reporter probe and 1× NEBuffer 2.1 in a total volume of 30 µL. The mixture was incubated at 37°C for 30 minutes. Fluorescence was monitored in real time at 1-minute intervals using a real-time PCR system (Applied Biosystems). Fluorescence was also visualized under blue light (470 nm) using a Tanon MINI Space 1000 Gel Imaging System after reaction completion. Lateral flow assay based on RPA-CRISPR/Cas12a For lateral flow detection, the RPA amplification and CRISPR/Cas12a reaction were performed as described above, except that the reporter probe was labeled with FAM and biotin. Following the reaction, the mixture was diluted with 70 µL of ddH₂O, and a lateral flow strip was inserted into the tube. Results were interpreted visually within 10 minutes. Evaluation of sensitivity and specificity The sensitivity of the RPA-CRISPR/Cas12a detection system was assessed using serial dilutions of recombinant tp47 plasmid ranging from 1 ng/µL to 1 fg/µL, prepared with nuclease-free water. Nuclease-free water alone served as the no-template control (NTC). The specificity of the assay was evaluated by testing nucleic acids from HIV, HBV, HCV, and DENV, which can present clinical symptoms similar to Treponema pallidum infection, following the detection procedures described above. Clinical sample evaluation A total of 18 serum samples from patients with suspected syphilis were analyzed using the RPA-CRISPR/Cas12a assay. The true status of each specimen was blinded to the operator during testing, and the minimum detection limit of the assay was applied as the threshold for a positive result. Following completion of the assays, the samples were unblinded, and the results were compared with the clinical diagnosis for evaluation. Statistical analysis All experiments were performed in triplicate, and data are presented as mean ± standard deviation (SD). Statistical comparisons were conducted using unpaired t-tests with GraphPad Prism 9. Differences were considered statistically significant at *P < 0.05, **P < 0.01, and ***P < 0.001. Results Assay workflow and primer optimization for the tp47-targeted RPA-CRISPR/Cas12a rapid visual detection of T. pallidum The working principle of the RPA-CRISPR/Cas12a-based T. pallidum visual detection system is illustrated in Fig. 1 A. Initially, the target gene fragment is amplified using an RPA kit. At a constant temperature of 39°C, DNA recombinase in the RPA reaction forms nucleoprotein complexes with the oligonucleotide primers. These complexes specifically recognize and bind the complementary target sequences, enabling rapid and exponential amplification of the target DNA within 30 minutes. Following amplification, the Cas12a-crRNA complex is introduced into the system. Guided by crRNA through sequence-specific base pairing, Cas12a binds to the target DNA adjacent to the protospacer adjacent motif (PAM). Upon target recognition, Cas12a is activated and exhibits trans-cleavage activity, nonspecifically cleaving single-stranded DNA reporter probes. Fluorescently labeled ssDNA reporters (FQ) release a detectable fluorescence signal upon cleavage, whereas biotin-labeled ssDNA reporters (FB) facilitate result visualization via lateral flow chromatography. In summary, this system allows versatile readouts of T. pallidum detection, including real-time fluorescence monitoring, direct visual observation under blue light, and lateral flow assay-based interpretation, providing a rapid, sensitive, and instrument-flexible platform for pathogen detection. Based on previous studies, the tp47 gene of Treponema pallidum was selected as the molecular target for nucleic acid detection. Three pairs of RPA primers were designed and synthesized according to the tp47 gene sequence. Comparative evaluation of amplification efficiency revealed that the F3/R3 primer pair generated products with superior yield and specificity compared to the other primer sets (Fig. 1 B). Consequently, the F3/R3 primers were selected for all subsequent RPA amplification experiments. Feasibility evaluation of the RPA–CRISPR/Cas12a-based rapid visual detection system To experimentally validate the system, five reaction conditions were established (R1-R5), each lacking a critical component. R1 contained the complete reaction mixture, including the target DNA, Bst DNA polymerase, Cas12a, and crRNA, whereas R2-R5 omitted the target DNA, Bst DNA polymerase, Cas12a, or crRNA, respectively. lateral flow test (LFT) results corroborated the fluorescence assays. A distinct test line (T-line) was visible only in R1, whereas R2-R5 displayed no T-line (Fig. 2 A). This outcome reflects the fact that Cas12a trans-cleavage of the dual-labeled reporter probe (FAM/Biotin) occurs only when both amplification and Cas12a-crRNA targeting are functionally intact. Similarly, only R1 exhibited robust fluorescence under UV illumination, while R2-R5 showed no detectable or negligible background signal (Fig. 2 C). Real-time fluorescence monitoring further confirmed these observations: a significant signal increase was observed exclusively in R1, whereas all incomplete reaction groups remained at baseline levels (Fig. 2 B). The absence of fluorescence in R2-R5 is consistent with the mechanistic requirement that Cas12a activation depends on both sequence-specific recognition by the crRNA-Cas12a complex and the presence of amplified target DNA. Collectively, these results demonstrate that the RPA-CRISPR/Cas12a system achieves highly specific detection of T.pallidum , with negligible risk of false-positive signals. The consistency across fluorescence assays, real-time monitoring, and lateral flow readouts underscores the robustness and reliability of this platform. Optimization of reaction parameters for the RPA-CRISPR/Cas12a system To maximize the detection performance of the RPA-CRISPR/Cas12a assay, key experimental parameters-including RPA amplification time, Cas12a concentration, crRNA concentration, and ssDNA reporter concentration- were systematically optimized. RPA amplification time was first evaluated, as it directly influences the yield of target DNA. Fluorescence intensity increased progressively within the first 30 minutes of amplification and reached a plateau thereafter. This trend was consistent with lateral flow strip readouts, where band intensity stabilized beyond 30 minutes. Therefore, an incubation time of 30 minutes was selected for subsequent RPA reactions (Fig. 3 A-C). Next, the concentrations of Cas12a and crRNA were optimized to enhance trans-cleavage activity. Cas12a was tested at final concentrations of 25, 50, 100, 200, and 250 nM, while crRNA was assessed at 50, 100, 200, 250, and 500 nM. The strongest fluorescence signals were observed with 100 nM Cas12a and 250 nM crRNA, which were thus determined to be the optimal working concentrations (Fig. 3 D-I). Finally, the concentration of the ssDNA reporter was optimized to ensure clear fluorescence detection and unambiguous interpretation of lateral flow strip results. Reporter concentrations ranging from 100 nM to 500 nM were tested. A concentration of 200 nM yielded the most distinct and reproducible results in both fluorescence-based and lateral flow assays, and was therefore selected as the standard condition for subsequent experiments (Fig. 3 J). Collectively, these optimizations established a robust set of working parameters, ensuring both high sensitivity and reliable readout of the RPA-CRISPR/Cas12a detection platform. Sensitivity and specificity evaluation of the RPA-CRISPR/Cas12a fluorescence assay Under optimized reaction conditions, the sensitivity of the RPA-CRISPR/Cas12a assay was evaluated using serial dilutions of the tp47 plasmid ranging from 1 fg/test to 1 ng/test. Fluorescence intensity increased proportionally with target DNA concentration within this range. A strong linear correlation was observed between the fluorescence signal and the logarithm of target concentration across 10 fg/test to 100 pg/test, with a correlation coefficient (R²) of 0.99 (Fig. 4 A-C). Based on three independent negative control (NC) measurements, the limit of detection (LOD) was calculated as 2.04 fg/test (equivalent to 11.34 copies/µL, determined using DNA copy number conversion). The specificity of the assay was further assessed using the tp47 gene fragment alongside nucleic acids from clinically relevant pathogens that present with overlapping symptoms, including HIV, HBV, HCV, and DENV. Robust fluorescence signals were generated exclusively in the presence of the tp47 target, while non-target viral samples and negative controls showed no detectable or negligible signal in both real-time and endpoint fluorescence measurements (Fig. 4 D-E). Notably, at a target concentration of 1 ng/test, signal intensity for tp47 was markedly higher than for all non-target controls, underscoring the high specificity of the system and its capacity to reliably distinguish T. pallidum from other pathogens. Sensitivity and specificity evaluation of the RPA-CRISPR/Cas12a LFT assay To improve the practicality of the assay in resource-limited settings, a LFT-based detection platform was established. This method combines the high sensitivity and operational simplicity of lateral flow assays, eliminating the need for specialized equipment. In this system, the ssDNA reporter was dual-labeled with FAM and biotin. The LFT strip was composed of a conjugate pad (pre-coated with anti-FAM antibodies conjugated to gold nanoparticles), a detection zone containing streptavidin (test line) and IgG (control line), and an absorbent pad. Upon application of the RPA–CRISPR/Cas12a reaction product, intact ssDNA reporters were captured at the control line via streptavidin binding. In the presence of the tp47 target, Cas12a was activated and cleaved the reporter, releasing fragments that were subsequently captured at the test line, resulting in two distinct visible bands. The limit of detection (LOD) for the LFT-based assay was determined to be 100 fg/test (5.56×10² copies/µL). The specificity was fully consistent with that observed in the fluorescence-based assay, enabling clear discrimination of tp47 from non-target viral pathogens (Fig. 5 A-B). These findings confirm that the LFTs platform provides a rapid, instrument-free, and highly specific approach for T. pallidum detection. Clinical validation To assess the diagnostic efficacy of the developed system, 18 identified clinical serum samples were analyzed using the fluorescence-based RPA–CRISPR/Cas12a assay. The cut-off threshold was defined as three times the maximum fluorescence value of the negative controls. All 18 samples generated detectable fluorescence signals, among which 9 samples (ST1, ST2, ST3, ST4, ST7, ST9, ST10, ST11, and ST13) exceeded the positivity threshold and were identified as syphilis-positive (Fig. 6 A). Following unblinding, clinical diagnoses were used as the reference standard, yielding a diagnostic accuracy of 94.4% (Table.2). To further evaluate the field applicability, the LFT-based RPA–CRISPR/Cas12a assay was applied to the same set of samples. Among them, only ST1 was detected as positive, whereas the remaining samples were negative (Fig. 6 B). Quantification of ST1 DNA concentration, based on the established standard curve, indicated 165.96 fg/test, which is above the detection limit of the LFT method. These findings suggest that while the fluorescence-based assay offers high diagnostic accuracy, the current LFT platform is limited by lower sensitivity. Further optimization of strip materials and manufacturing processes will be essential to improve detection performance and enable reliable on-site screening applications. Table 2 Diagnostic analysis of RPA-CRISPR Cas12a fluorescence test results Clinically practical diagnosis Diagnostic accuracy illness Health total RPA- CRISPR Cas12a (fluorescence) Positive 9 0 9 94.4% Negative 1 8 9 total 10 8 18 Discussion In this study, we developed an RPA–CRISPR/Cas12a detection system for the rapid diagnosis of syphilis. Over the past two decades, the incidence of syphilis has steadily increased, and its diverse clinical manifestations—often overlapping with other infections—pose significant challenges to accurate diagnosis and timely treatment [ 26 ]. Currently, syphilis detection relies primarily on combined serological testing (Treponema pallidum-specific and non-Treponema pallidum assays), which serves as a standard approach for screening, diagnosis, and monitoring disease progression and treatment efficacy. Nucleic acid amplification assays, such as conventional PCR, provide direct detection of T. pallidum DNA [ 6 ]. For instance, Zhou et al. employed both conventional PCR and droplet digital PCR to detect spirochete DNA in plasma samples from patients at different stages of syphilis, demonstrating high detection efficiency [ 27 ]. However, PCR-based methods require expensive instrumentation and trained personnel, limiting their utility for large-scale screening, particularly in resource-limited or grassroots settings. Compared with traditional amplification methods, the RPA-CRISPR/Cas12a system offers a simpler workflow and requires minimal equipment, significantly reducing both detection cost and turnaround time. These advantages facilitate on-site pathogen detection. The tp47 gene has been widely selected as a target for T. pallidum detection in previous studies [ 28 ]. tp47 encodes a cytoplasmic membrane protein involved in cell wall synthesis, making it a stable and specific target for nucleic acid-based assays [ 29 ]. RPA is an isothermal amplification technique that has gained popularity due to its rapid amplification, high sensitivity, and operational simplicity. Nonetheless, RPA is prone to primer-dimer formation and nonspecific amplification [ 30 ]. CRISPR/Cas12a, as a molecular detection tool, overcomes some of these limitations through its trans-cleavage activity: upon recognition and binding of crRNA to a complementary double-stranded DNA target, Cas12a is activated and cleaves fluorescent reporter probes, releasing a detectable signal. Several RPA–CRISPR/Cas12a-based viral detection assays have been reported. For example, Li et al. developed two RPA-based assays for monkeypox virus: a fluorescence-based RPA (F-RPA) with an LOD of 15.32 copies/µL, and a vertical flow bar RPA (VF-RPA) with an LOD of 8.53 copies/µL [ 32 ]. Ren et al. reported an RPA–CRISPR/Cas12a dengue virus assay with an LOD of 91.7 copies/test [ 33 ], while Lin et al. described a rapid detection method for Plasmodium parasites, achieving an LOD of 1 copy/µL [ 34 ]. These studies, together with our findings, demonstrate that RPA–CRISPR/Cas12a assays are versatile and effective for detecting both viral genomes and more complex bacterial genomes such as T. pallidum. To facilitate syphilis diagnosis in resource-limited regions and low-income countries, we integrated the RPA–CRISPR/Cas12a detection system with lateral flow assay (LFA) technology, enabling point-of-care testing without reliance on large laboratory instruments. This approach enhances accessibility and scalability for field diagnostics. Despite these advantages, the RPA–CRISPR/Cas12a system has several limitations. First, the LOD of LFA-based detection is generally higher than that obtained with fluorescence-based detection, as fluorescence readouts are quantified using sensitive PCR instrumentation. Second, to minimize RPA aerosol contamination, electrophoretic verification of amplification products is typically omitted, preventing confirmation of amplicon size. Third, the design and validation of RPA-CRISPR/Cas12a assays remain technically demanding and require careful optimization of primers, crRNAs, and reaction conditions. While costs can be reduced through large-scale implementation, they must be considered during assay development. Conclusions In summary, we have successfully established and validated a rapid, sensitive, and specific nucleic acid visual detection platform for T. pallidum based on the integration of RPA and CRISPR/Cas12a. The system supports dual readout modalities: a fluorescence-based assay and an LFB-based assay, both demonstrating high specificity and sensitivity with no observed false-positive results. The fluorescence-based method achieved a limit of detection (LOD) of 2.04 fg/test, while the LFB-based approach exhibited an LOD of 10 fg/test. Collectively, the RPA-CRISPR/Cas12a platform offers a robust, efficient, and user-friendly tool for syphilis diagnosis. Its minimal equipment requirements, rapid turnaround, and adaptability to point-of-care formats highlight its strong potential for deployment in resource-limited settings and for large-scale screening applications. Declarations Acknowledgements Not applicable. Author contributions W. L. and S. O. were responsible for conceptualizing the research. W. L., Y.S., and S. O devised the methodology. Y. S., M.Y., J.O., W.X., Y.S.,D.N and X.H. carried out the formal analysis and investigation. The original draft of the manuscript was prepared by W. L., Y. S., and M.Y. Subsequently, the writing process underwent review and editing by S. O. W.L. and S. O. secured the funding for this project. S. O. supervised the overall study. Each author participated in revising the manuscript and lent their approval to the final version. Funding This work was supported by the Dongguan Science and Technology of Social Development Program (20221800905392, 20231800940452, 20231800940112, 20221800906092), National Natural Science Foundation of China (82370039), Guangdong Basic and Applied Basic Research Foundation (2024A1515140157), Science and Technology Special Envoy Project of Songshan Lake District of Dongguan City (20234404-01KCJG), Songshan Lake Medical and Engineering Integration Project (4SG22310P), the Innovation Project for College Students (2JD24101, 2DC24103G, JDXM2024041). Data availability The datasets analysed during the current study are available in the [NCBI] repository, [M88769.1, D86068.1, MT426913.1, KJ439771.1, M14931.2]. Ethics approval and consent to participate The study protocol complied with the ethical guidelines of the Declaration of Helsinki and was approved by the Ethics Review Committee of the Ninth People’s Hospital of Dongguan (Ethics Review No. 3, 2022). Written informed consent was obtained from all participants prior to enrollment. Clinical trial number Not applicable. Consent for publication Not applicable. Competing interests The authors declare no competing interests. References Satyaputra F, Hendry S, Braddick M, Sivabalan P, Norton R. The Laboratory Diagnosis of Syphilis. J Clin Microbiol. 2021;59(10):e0010021; doi: 10.1128/jcm.00100-21. O'Connor NP, Burke PC, Worley S, Kadkhoda K, Goje O, Foster CB. Outcomes After Positive Syphilis Screening. Pediatrics. 2022;150(3); doi: 10.1542/peds.2022-056457. Peeling RW, Mabey D, Chen XS, Garcia PJ. Syphilis. Lancet (London, England). 2023;402(10398):336-46; doi: 10.1016/s0140-6736(22)02348-0. Bourchier L, Goller J, Bittleston H. Detecting asymptomatic syphilis. The Lancet regional health Western Pacific. 2023;40:100901; doi: 10.1016/j.lanwpc.2023.100901. Sweitzer S, Duncan JA, Seña AC. Update on syphilis diagnostics. Curr Opin Infect Dis. 2025;38(1):44-53; doi: 10.1097/qco.0000000000001073. Talhari C, Arriel K, Serra MS, Veasey JV. Acquired syphilis: update on clinical, diagnostic and therapeutic aspects(⋆). An Bras Dermatol. 2025;100(3):407-21; doi: 10.1016/j.abd.2024.11.002. Reis ARP, Duarte G, Menegueti MG, Reis RK, Silva A, Gir E. Reactive treponemal and non-treponemal tests in pregnant women and associated factors. Revista da Escola de Enfermagem da U S P. 2022;56:e20220146; doi: 10.1590/1980-220X-REEUSP-2022-0146en. Papp JR, Park IU, Fakile Y, Pereira L, Pillay A, Bolan GA. CDC Laboratory Recommendations for Syphilis Testing, United States, 2024. MMWR Recommendations and reports : Morbidity and mortality weekly report Recommendations and reports. 2024;73(1):1-32; doi: 10.15585/mmwr.rr7301a1. Larsen SA, Steiner BM, Rudolph AH. Laboratory diagnosis and interpretation of tests for syphilis. Clinical microbiology reviews. 1995;8(1):1-21; doi: 10.1128/cmr.8.1.1. Theel ES, Katz SS, Pillay A. Molecular and Direct Detection Tests for Treponema pallidum Subspecies pallidum: A Review of the Literature, 1964-2017. Clin Infect Dis. 2020;71(Suppl 1):S4-s12; doi: 10.1093/cid/ciaa176. Haynes AM, Konda KA, Romeis E, Siebert J, Vargas SK, Reyes Diaz M, et al. Evaluation of a minimal array of Treponema pallidum antigens as biomarkers for syphilis diagnosis, infection staging, and response to treatment. Microbiology spectrum. 2024;12(1):e0346623; doi: 10.1128/spectrum.03466-23. Chittle AD, Sandstrom P, Cox J, Tsang RSW. Treponemal point-of-care tests for syphilis. CMAJ : Canadian Medical Association journal = journal de l'Association medicale canadienne. 2024;196(20):E702-e3; doi: 10.1503/cmaj.231548. Castro R, Águas MJ, Batista T, Araújo C, Mansinho K, Pereira Fda L. Detection of Treponema pallidum Sp. Pallidum DNA in Cerebrospinal Fluid (CSF) by Two PCR Techniques. Journal of clinical laboratory analysis. 2016;30(5):628-32; doi: 10.1002/jcla.21913. Grange PA, Jary A, Isnard C, Burrel S, Boutolleau D, Touati A, et al. Use of a Multiplex PCR Assay To Assess the Presence of Treponema pallidum in Mucocutaneous Ulcerations in Patients with Suspected Syphilis. J Clin Microbiol. 2021;59(2); doi: 10.1128/jcm.01994-20. Golden M, O'Donnell M, Lukehart S, Swenson P, Hovey P, Godornes C, et al. Treponema pallidum Nucleic Acid Amplification Testing To Augment Syphilis Screening among Men Who Have Sex with Men. J Clin Microbiol. 2019;57(8); doi: 10.1128/jcm.00572-19. Cao W, Thorpe PG, O'Callaghan K, Kersh EN. Advantages and limitations of current diagnostic laboratory approaches in syphilis and congenital syphilis. Expert Rev Anti Infect Ther. 2023;21(12):1339-54; doi: 10.1080/14787210.2023.2280214. van Beljouw SPB, Sanders J, Rodríguez-Molina A, Brouns SJJ. RNA-targeting CRISPR-Cas systems. Nat Rev Microbiol. 2023;21(1):21-34; doi: 10.1038/s41579-022-00793-y. Mao Z, Chen R, Wang X, Zhou Z, Peng Y, Li S, et al. CRISPR/Cas12a-based technology: A powerful tool for biosensing in food safety. Trends in food science & technology. 2022;122:211-22; doi: 10.1016/j.tifs.2022.02.030. Ming M, Ren Q, Pan C, He Y, Zhang Y, Liu S, et al. CRISPR-Cas12b enables efficient plant genome engineering. Nature plants. 2020;6(3):202-8; doi: 10.1038/s41477-020-0614-6. Gootenberg JS, Abudayyeh OO, Lee JW, Essletzbichler P, Dy AJ, Joung J, et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science. 2017;356(6336):438-42; doi: 10.1126/science.aam9321. Feng X, Liu Y, Zhao Y, Sun Z, Xu N, Zhao C, et al. Recombinase Polymerase Amplification-Based Biosensors for Rapid Zoonoses Screening. Int J Nanomedicine. 2023;18:6311-31; doi: 10.2147/ijn.S434197. Tang G, Zhang Z, Tan W, Long F, Sun J, Li Y, et al. RT-RPA-Cas12a-based assay facilitates the discrimination of SARS-CoV-2 variants of concern. Sensors and actuators B, Chemical. 2023;381:133433; doi: 10.1016/j.snb.2023.133433. Liu Q, Zeng H, Wang T, Ni H, Li Y, Qian W, et al. Development of RPA-Cas12a assay for rapid and sensitive detection of Pneumocystis jirovecii. BMC Microbiol. 2024;24(1):314; doi: 10.1186/s12866-024-03440-z. Tu Q, Cao X, Ling C, Xiang L, Yang P, Huang S. Point-of-care detection of Neisseria gonorrhoeae based on RPA-CRISPR/Cas12a. AMB Express. 2023;13(1):50; doi: 10.1186/s13568-023-01554-7. Li Y, Wang X, Xu R, Wang T, Zhang D, Qian W. Establishment of RT-RPA-Cas12a assay for rapid and sensitive detection of human rhinovirus B. BMC Microbiol. 2023;23(1):333; doi: 10.1186/s12866-023-03096-1. Chan PA, Mena L. Point-of-Care Syphilis Testing: Implementation and Future Direction. Curr HIV/AIDS Rep. 2025;22(1):28; doi: 10.1007/s11904-025-00728-1. Wang C, Zheng X, Guan Z, Zou D, Gu X, Lu H, et al. Quantified Detection of Treponema pallidum DNA by PCR Assays in Urine and Plasma of Syphilis Patients. Microbiology spectrum. 2022;10(2):e0177221; doi: 10.1128/spectrum.01772-21. Wang C, Hu Z, Zheng X, Ye M, Liao C, Shang M, et al. A New Specimen for Syphilis Diagnosis: Evidence by High Loads of Treponema pallidum DNA in Saliva. Clin Infect Dis. 2021;73(9):e3250-e8; doi: 10.1093/cid/ciaa1613. Mi HF, Shen X, Chen XQ, Zhang XL, Ke WJ, Xiao Y. Association between treatment failure in patients with early syphilis and penicillin resistance-related gene mutations of Treponema pallidum: Protocol for a multicentre nested case-control study. Front Med (Lausanne). 2023;10:1131921; doi: 10.3389/fmed.2023.1131921. Srivastava P, Prasad D. Isothermal nucleic acid amplification and its uses in modern diagnostic technologies. 3 Biotech. 2023;13(6):200; doi: 10.1007/s13205-023-03628-6. Paul B, Montoya G. CRISPR-Cas12a: Functional overview and applications. Biomedical journal. 2020;43(1):8-17; doi: 10.1016/j.bj.2019.10.005. Li Y, Gao Y, Tang Y, Li J, Zhang S, Jiang T, et al. Development of rapid nucleic acid assays based on the recombinant polymerase amplification for monkeypox virus. Virol Sin. 2023;38(1):165-70; doi: 10.1016/j.virs.2022.12.001. Zhang Y, Xiang Y, Hou D, Fang L, Cai S, Zhang J, et al. A one-pot method for universal Dengue virus detection by combining RT-RPA amplification and CRISPR/Cas12a assay. BMC Microbiol. 2025;25(1):163; doi: 10.1186/s12866-025-03882-z. Wei H, Li J, Liu Y, Cheng W, Huang H, Liang X, et al. Rapid and Ultrasensitive Detection of Plasmodium spp. Parasites via the RPA-CRISPR/Cas12a Platform. ACS Infect Dis. 2023;9(8):1534-45; doi: 10.1021/acsinfecdis.3c00087. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 13 Jan, 2026 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 03 Dec, 2025 Reviews received at journal 25 Nov, 2025 Reviewers agreed at journal 19 Nov, 2025 Reviews received at journal 19 Nov, 2025 Reviewers agreed at journal 10 Nov, 2025 Reviewers agreed at journal 04 Nov, 2025 Reviewers invited by journal 02 Nov, 2025 Editor assigned by journal 31 Oct, 2025 Editor invited by journal 30 Oct, 2025 Submission checks completed at journal 25 Oct, 2025 First submitted to journal 25 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7789887","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":542620425,"identity":"c3ab0d7c-fef6-41e6-8398-814c5ad982d8","order_by":0,"name":"Wenrui Li","email":"","orcid":"","institution":"Dongguan Ninth People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wenrui","middleName":"","lastName":"Li","suffix":""},{"id":542620426,"identity":"e2ed2b4d-8bf5-478c-bf80-3e5b370fde0e","order_by":1,"name":"Yuanzhong Sun","email":"","orcid":"","institution":"Dongguan Ninth People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yuanzhong","middleName":"","lastName":"Sun","suffix":""},{"id":542620427,"identity":"d56afe0a-2794-453e-93f8-1a83f849188a","order_by":2,"name":"Minnan Ye","email":"","orcid":"","institution":"Dongguan Eighth People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Minnan","middleName":"","lastName":"Ye","suffix":""},{"id":542620428,"identity":"e5cb0d48-53eb-4592-8ed9-c7ee8d36d02d","order_by":3,"name":"Yuemei Liang","email":"","orcid":"","institution":"Dongguan Ninth People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yuemei","middleName":"","lastName":"Liang","suffix":""},{"id":542620430,"identity":"85adb267-8221-4609-b9bc-4383a7e8976c","order_by":4,"name":"Jinyi Ouyang","email":"","orcid":"","institution":"Dongguan Ninth People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jinyi","middleName":"","lastName":"Ouyang","suffix":""},{"id":542620431,"identity":"1bc4b9c9-ad3b-400f-b506-a76d99ec956a","order_by":5,"name":"Wenjie Xu","email":"","orcid":"","institution":"Dongguan Ninth People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wenjie","middleName":"","lastName":"Xu","suffix":""},{"id":542620432,"identity":"eb6cda22-2917-4184-8dfd-4853b9511c0f","order_by":6,"name":"Yugui Su","email":"","orcid":"","institution":"Dongguan Ninth People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yugui","middleName":"","lastName":"Su","suffix":""},{"id":542620433,"identity":"5a11772a-ade5-4330-8fda-681a0ef3e4b6","order_by":7,"name":"Dexin Nie","email":"","orcid":"","institution":"Liaobu Hospital of Dongguan City","correspondingAuthor":false,"prefix":"","firstName":"Dexin","middleName":"","lastName":"Nie","suffix":""},{"id":542620436,"identity":"a79c2898-dd8b-458d-81a5-e17049d3a0ac","order_by":8,"name":"Xueqin Huang","email":"","orcid":"","institution":"Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xueqin","middleName":"","lastName":"Huang","suffix":""},{"id":542620437,"identity":"b88ea1b3-72d1-450f-9d6b-62fd75832ed8","order_by":9,"name":"Suidong Ouyang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5klEQVRIiWNgGAWjYBADxn4GBgMwo4FoLTMbSNay4QCxWvglcgw/F/yqk918fvHWzTwMNrIbDjA/e4BPi+SMHGPpmX2HjbfdeFZ2m4chzXjDATZzA3xaDG7kGEjz9hxI3HbjjBlQy+HEDQd42CQIaDH+zdtTl7h5BljLf6K0mEnz/GBO3MDfA9JygLAWyZ5nZda8DYeNZ9xgK7s5xyDZeOZhNjO8WvjZkzff5vlTJ9vff3jbjTcVdrJ9x5uf4dXCwMBhwMDYBqQlEhggCYAZv3ogYH/AwPAHZN8BgkpHwSgYBaNghAIAfJ5PiwmY7EIAAAAASUVORK5CYII=","orcid":"","institution":"Liaobu Hospital of Dongguan City","correspondingAuthor":true,"prefix":"","firstName":"Suidong","middleName":"","lastName":"Ouyang","suffix":""}],"badges":[],"createdAt":"2025-10-06 09:23:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7789887/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7789887/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-026-35745-6","type":"published","date":"2026-01-13T16:30:31+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":95800886,"identity":"9f82eb6b-82df-434a-be88-e5006c07bf79","added_by":"auto","created_at":"2025-11-13 08:23:49","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4372445,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript0925oygood.docx","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/7e3f75635fa0bea1505cf15e.docx"},{"id":95730392,"identity":"3ca715ac-5401-40be-8682-1c8f7fd198bf","added_by":"auto","created_at":"2025-11-12 11:36:26","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10378,"visible":true,"origin":"","legend":"","description":"","filename":"3cb675bf5e034c17950112efd7f3efca.json","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/b8c10896c6551ec6b3301df7.json"},{"id":95730394,"identity":"f6c424cf-2fe2-40bc-864c-e02950ce4f70","added_by":"auto","created_at":"2025-11-12 11:36:26","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":99673,"visible":true,"origin":"","legend":"","description":"","filename":"3cb675bf5e034c17950112efd7f3efca1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/c14ca15c71aa5fbc8cae4bba.xml"},{"id":95801686,"identity":"2081dae7-9146-4589-8126-f5ba70e6ff05","added_by":"auto","created_at":"2025-11-13 08:25:54","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":288072,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/ed9234dd2c234472f7d82fce.jpeg"},{"id":95730402,"identity":"919f73cf-97f1-452c-bd28-d9bf344ed2d0","added_by":"auto","created_at":"2025-11-12 11:36:27","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":431585,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/35ae7b8ccf1556380a9d4dd6.jpeg"},{"id":95730406,"identity":"7d028cd0-48e6-4a73-a9ea-d5c35a051796","added_by":"auto","created_at":"2025-11-12 11:36:27","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1221224,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/863257e54e5a72950ca94cf0.jpeg"},{"id":95799692,"identity":"e1056e41-0130-40be-a2f7-78f35247f0ec","added_by":"auto","created_at":"2025-11-13 08:20:38","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":453246,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/92a7ae04c2f13ccca4821a66.jpeg"},{"id":95730399,"identity":"19ac9fd3-59a8-4f90-853f-eb6b4a552552","added_by":"auto","created_at":"2025-11-12 11:36:26","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1135442,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/b45c1e54834a2143343580df.jpeg"},{"id":95730403,"identity":"9c099f19-767c-4fb4-b2dc-d11d3a0c7b17","added_by":"auto","created_at":"2025-11-12 11:36:27","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":490858,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/4a9ca87d51fa1ba626830c21.jpeg"},{"id":95730409,"identity":"fb5e30b2-bd12-43f2-90a1-6dca91eca53b","added_by":"auto","created_at":"2025-11-12 11:36:27","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":32569,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/166a27339ee5e1638ef32d55.png"},{"id":95730397,"identity":"b8a05f81-3a07-423a-a1d4-6dfce7eb65c5","added_by":"auto","created_at":"2025-11-12 11:36:26","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":126987,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/ee5f5c0a772ea76a43ece1a4.png"},{"id":95801292,"identity":"8d1818af-9f8d-42be-8e4d-2ca7519f3f43","added_by":"auto","created_at":"2025-11-13 08:24:51","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":110495,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/1c89386df44b6c25aefd6257.png"},{"id":95799853,"identity":"61fab619-4c74-428e-b314-e4ed1676b07b","added_by":"auto","created_at":"2025-11-13 08:21:00","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":49640,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/ae3334a2b4fb22f9838817a9.png"},{"id":95801738,"identity":"892e937f-b4a4-48bd-8ff0-d29dc672e2d4","added_by":"auto","created_at":"2025-11-13 08:26:05","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":123482,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/d2a42a5e1a6fdab31bcc9a30.png"},{"id":95800802,"identity":"f6d556be-e33b-4bb3-a657-066a40ea583c","added_by":"auto","created_at":"2025-11-13 08:23:35","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":43692,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/200441f3f1d9e19a82738fc5.png"},{"id":95730404,"identity":"3f0fe582-d2ec-4d99-9d39-0b2e77970a7a","added_by":"auto","created_at":"2025-11-12 11:36:27","extension":"xml","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":96817,"visible":true,"origin":"","legend":"","description":"","filename":"3cb675bf5e034c17950112efd7f3efca1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/1cd7b04de9f8f669d2331a37.xml"},{"id":95730411,"identity":"8563618d-fe61-4878-bce4-9e6f0ab5ed70","added_by":"auto","created_at":"2025-11-12 11:36:27","extension":"html","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":109601,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/6c8202921f62a90accd0e783.html"},{"id":95730389,"identity":"b85e7f72-930e-4299-8271-3a164a9d63ee","added_by":"auto","created_at":"2025-11-12 11:36:26","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":66480,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRPA-CRISPR/Cas12a detection principle and primer screening.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) The detection principle of the RPA-CRISPR/Cas12a system for the TP detection. (B) Specificity of RPA primers for the \u003cem\u003etp\u003c/em\u003e47 gene was visualized by 1% agarose gel electrophoresis (P1:F1R1, P2:F2R2, P3:F3R3).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/738115aa5dd918edc0ae0b9a.png"},{"id":95730390,"identity":"5c2dddd7-7f56-4754-885a-9a5c694889d6","added_by":"auto","created_at":"2025-11-12 11:36:26","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":148549,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFeasibility analysis of the RPA-CRISPR/Cas12a system for \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eT.pallidum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003edetection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Feasibility analysis of the RPA-CRISPR/Cas12a-LFT system for TP detection. “+” and “−” represent the “presence” and “absence” of the corresponding components in each reaction, respectively. (B). Real-time fluorescence curves caused by isothermal amplification with five reactions (R1-R5) for the detection of the tp47 gene. (C) Fluorescence images of five reactions (R1-R5) with various components were captured using a scanner.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/2d62a0a5c31f03da71b6413e.png"},{"id":95800939,"identity":"12a72466-cbdb-4cc3-89fd-253ada6a055f","added_by":"auto","created_at":"2025-11-13 08:23:59","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":222949,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOptimization of reaction parameters for the RPA-CRISPR/Cas12a system\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Real-time fluorescence curves of RPA reactions at different reaction times in the presence of target DNA (5.56´10\u003csup\u003e5 \u003c/sup\u003ecopies/μL recombinant plasmid\u0026nbsp;tp47). (B) Fluorescence of different RPA reactions at times ranging from 0 min to 40 min. (C) Optimization of the RPA reaction times for the RPA-CRISPR/Cas12a-LFT detection system (5.56´10\u003csup\u003e5\u003c/sup\u003e copies/μL recombinant plasmid\u0026nbsp;tp47 as target DNA). (D) Real-time fluorescence curves of Cas12a at different concentrations in the presence of target DNA (5.56´10\u003csup\u003e6\u003c/sup\u003e copies/μL recombinant plasmid\u0026nbsp;tp47 as target DNA). (E) The fluorescence value of RPA-CRISPR/Cas12a with various concentrations of Cas12a (5.56´10\u003csup\u003e6\u003c/sup\u003e copies/μL recombinant plasmid\u0026nbsp;tp47 as target DNA). (F) Optimization of the Cas12a concentrations for the RPA-CRISPR/Cas12a-LFT detection system (5.56´10\u003csup\u003e6\u003c/sup\u003e copies/μL recombinant plasmid\u0026nbsp;tp47 as target DNA). (G) The fluorescence value of RPA-CRISPR/Cas12a with various concentrations of CrRNA (5.56´10\u003csup\u003e6\u003c/sup\u003e copies/μL recombinant plasmid\u0026nbsp;tp47 as target DNA). (H) Real-time fluorescence curves of CrRNA at different concentrations in the presence of target DNA (5.56´10\u003csup\u003e6 \u003c/sup\u003ecopies/μL recombinant plasmid\u0026nbsp;tp47 as target). (I) Optimization of the CrRNA concentrations for the RPA-CRISPR/Cas12a-LFT detection system (5.56´10\u003csup\u003e6\u003c/sup\u003e copies/μL recombinant plasmid\u0026nbsp;tp47 as target DNA). (J) Optimization of the ssDNA concentrations for the RPA-CRISPR/Cas12a-LFT detection system (5.56´10\u003csup\u003e6\u003c/sup\u003e copies/μL recombinant plasmid\u0026nbsp;tp47 as target DNA).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/bc6262fdaea47c1b50d26c0c.png"},{"id":95730391,"identity":"f7ea3051-1ddb-4678-89c5-62319dc548bc","added_by":"auto","created_at":"2025-11-12 11:36:26","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":100212,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMethodological evaluation of RPA-CRISPR/Cas12a based on fluorescence detection.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;(A) Real-time fluorescence curve detected from the RPA-CRISPR/Cas12a System for recombinant plasmid\u0026nbsp;\u003cem\u003etp47\u003c/em\u003e at different concentrations ranging from 1 fg/test to 1 ng/test (5.56 copies/ul-5.56´10\u003csup\u003e6\u003c/sup\u003e copies/ul). (B). Fluorescence images of eight reactions (R1-R8, R1: 1 ng/test, R2: 100 pg/test, R3: 10 pg/test, R4: 1 pg/test, R5: 100 fg/test, R6: 10 fg/test, R7: 1 fg/test, R8: NC.) were captured using a scanner. (C) Linear relationship between the fluorescence and the logarithm of target DNA concentrations. Error bars represent standard deviation, n = 3. (D) Real-time fluorescence curves detected from the RPA-CRISPR/Cas12a System for TP, HIV, HBV, HCV, and DENV. (E) Photograph (top) and bar graph depicting fluorescence intensity for TP, HIV, HBV, HCV, and DENV.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/e15345d76b38b1b9a8492c79.png"},{"id":95730396,"identity":"895efdfd-e450-4eea-ab2e-a44b951963e8","added_by":"auto","created_at":"2025-11-12 11:36:26","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":219259,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMethodological evaluation of RPA-CRISPR/Cas12a based on lateral flow test strips detection.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Sensitivity analysis of the RPA-CRISPR/Cas12a-LFTs detection system (1:ng/test, 2:100 pg/test, 3:10 pg/test, 4:1 pg/test, 5:100 fg/test, 6:10 fg/test, 7:1 fg/test, 8:NC). \u0026nbsp;(B) Specificity analysis of the RPA- CRISPR/Cas12a-LFTs detection system (1:TP, 2:HIV, 3:HBV, 4:HCV, 5:DENV, NC).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/4641aaedd8fba7182f2d789c.png"},{"id":95800800,"identity":"a505ef4d-27ab-43a4-afd2-a957cfce687f","added_by":"auto","created_at":"2025-11-13 08:23:35","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":86145,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePerformance of the RPA-CRISPR/Cas12a system in clinical sample detection\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e(A) Fluorescence results of RPA-CRISPR/Cas12a for the detection of syphilis. The fluorescence signal was detected by the CRISPR/Cas12a system for 30 min. NC: Negative Control. (B) LFTs results of RPA-CRISPR/Cas12a for the detection of syphilis. The DNA from 18 serum samples was extracted and amplified with RPA for 30 min.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/369e7c8e3d0b19ff6d714cdc.png"},{"id":100614761,"identity":"65e3a686-a9e8-4e36-ac79-d8a8f9912e0f","added_by":"auto","created_at":"2026-01-19 17:24:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1983396,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7789887/v1/622e67ec-6bb6-48e7-ae23-7211b0d5637b.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Rapid visual detection of Treponema pallidum using the RPA-CRISPR/Cas12a System","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSyphilis, a sexually transmitted infection (STI) caused by the spirochete \u003cem\u003eTreponema pallidum subsp. pallidum\u003c/em\u003e has undergone a significant global resurgence in recent decades [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Since the early 2000s, syphilis incidence has risen markedly worldwide, exacerbating the overall burden of STIs and posing substantial challenges to public health infrastructure and socioeconomic stability [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Epidemiological data indicate that approximately 8\u0026nbsp;million new syphilis cases were reported globally in 2022, with congenital syphilis cases alone reaching an alarming 1.5\u0026nbsp;million in 2023. These figures underscore persistent gaps in transmission prevention, maternal screening, and neonatal care [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Early detection and timely treatment are essential for mitigating mortality, averting severe sequelae, and enhancing long-term patient outcomes and quality of life [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eCurrent syphilis diagnosis predominantly relies on serological antibody assays, categorized into non-treponemal tests (NTTs) and treponemal tests (TTs) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. NTTs detect immunoglobulin M and G antibodies against lipids released from damaged host cells or cardiolipin components of \u003cem\u003eT. pallidum\u003c/em\u003e [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Their sensitivity varies by disease stage, ranging from 62%-78% in primary and late syphilis to 97%-100% in secondary syphilis [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Despite their simplicity and cost-effectiveness, which facilitate widespread use in screening programs, NTTs are susceptible to false positives in conditions such as pregnancy, autoimmune disorders, and concurrent infections. In contrast, TTs-including the \u003cem\u003eTreponema pallidum\u003c/em\u003e particle agglutination assay (TPPA), \u003cem\u003eTreponema pallidum\u003c/em\u003e hemagglutination assay (TPHA), enzyme-linked immunosorbent assay (ELISA), and chemiluminescence immunoassay (CLIA)-target antibodies against \u003cem\u003eT. pallidum\u003c/em\u003e-specific antigens, providing superior sensitivity and specificity [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. These assays are particularly effective for confirmatory diagnosis in early syphilis, addressing NTT limitations during this phase [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. However, a key drawback of TTs is their inability to distinguish between active and resolved infections, as anti-treponemal antibodies often persist lifelong, rendering them unsuitable for monitoring treatment efficacy or disease activity.\u003c/p\u003e\u003cp\u003eTo enhance diagnostic precision, molecular approaches such as \u003cem\u003eTreponema pallidum\u003c/em\u003e polymerase chain reaction (TP-PCR) have been developed, targeting genomic loci including polA [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], tp47 [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], and 23S rRNA [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Among these, polA and tp47 are the most commonly validated and implemented targets in clinical laboratories worldwide. Although TP-PCR offers high accuracy, its adoption is constrained by requirements for specialized equipment, technical expertise, and elevated costs [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Consequently, there remains a critical need for rapid, sensitive, specific, and accessible diagnostic tools to bolster syphilis control and curb the epidemic.\u003c/p\u003e\u003cp\u003eThe Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated (Cas) system, initially acclaimed for genome editing, has been adapted for molecular diagnostics [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Systems such as CRISPR/Cas12a [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], CRISPR/Cas12b [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], and CRISPR/Cas13a [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] leverage programmable nucleic acid recognition for highly specific target detection, establishing CRISPR-Cas as a versatile platform for nucleic acid-based diagnostics. Complementing this, recombinase polymerase amplification (RPA) enables the isothermal amplification of double-stranded DNA without the need for thermal cycling, yielding abundant amplicons rapidly [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Integrating RPA with CRISPR-Cas enhances sensitivity and specificity, facilitating detection of low-abundance targets in resource-limited settings [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Relative to traditional PCR methods, RPA-CRISPR/Cas12 platforms offer improved performance while obviating the need for costly instrumentation and advanced facilities. Their adaptability supports diverse readout formats, including fluorescence, lateral flow strips, and naked-eye visualization, making them ideal for point-of-care and field applications [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn this study, we describe the development, optimization, and validation of a rapid, highly sensitive, and specific syphilis detection assay based on an RPA-CRISPR/Cas12a platform. Results are interpretable via three modalities: naked-eye observation (NEO), lateral flow assay (LFA), and fluorescence-based detection (FBDA). This approach enables efficient identification of \u003cem\u003eT. pallidum\u003c/em\u003e and serves as a foundational framework for advancing point-of-care diagnostics for syphilis and other infectious pathogens.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eMaterials and reagents\u003c/h2\u003e\u003cp\u003eAll nucleic acid sequences used in this study, including the recombinant tp47 plasmid, RPA primers, nucleic acid templates from Human Immunodeficiency Virus (HIV, GenBank: D86068.1), Hepatitis B virus(HBV, GenBank: MT426913.1), Hepatitis C virus (HCV, GenBank: KJ439771.1) and Dengue virus (DENV, GenBank: M14931.2). CRISPR RNAs (crRNAs), the fluorescent ssDNA reporter, and the lateral flow strip reporter, were synthesized by Aiji Biotechnology Co., Ltd. (Guangzhou, China). EnGen\u0026reg; Lba Cas12a (Cpf1) was obtained from New England Biolabs (Ipswich, MA, USA), and TwistAmp\u0026reg; Basic DNA Amplification Kits were purchased from TwistDx Ltd (Cambridge, UK). Tiosbio\u0026reg; Cas12/13-specific nucleic acid test strips were acquired from Beijing Baoying Tonghui Biotechnology Co., Ltd. (Beijing, China). Human serum samples for clinical validation were provided by our institutional laboratory. All procedures involving human specimens were conducted in accordance with the Declaration of Helsinki and approved by the Ethics Review Committee of the Ninth People\u0026rsquo;s Hospital of Dongguan (Approval No. 3, 2022).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003ePlasmid construction and copy number calculation\u003c/h3\u003e\n\u003cp\u003eThe tp47 gene (GenBank: M88769.1) was selected as the target for syphilis detection and cloned into the pBluescript II SK(-) vector using standard recombinant DNA techniques. Plasmid DNA copy number was determined using the formula: DNA copy number per microliter = [(6.02 x 10^23) x (plasmid concentration, in nanograms per microliter) x 10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e]/[(fragment length, in nucleotides) x660], where 6.02\u0026times;10\u0026sup2;\u0026sup3; represents Avogadro\u0026rsquo;s number, and 660 is the average molecular weight of a base pair in Daltons.\u003c/p\u003e\n\u003ch3\u003eCrRNA and RPA primer design\u003c/h3\u003e\n\u003cp\u003eCrRNA sequences of 41 nucleotides were designed using CRISPR RGEN Tools (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.rgenome.net/cas-designer/\u003c/span\u003e\u003cspan address=\"http://www.rgenome.net/cas-designer/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The specificity of each crRNA targeting tp47 was validated via NCBI BLAST. RPA primers were subsequently designed based on the tp47 sequence encompassing the crRNA binding region, following the guidelines in the TwistAmp Assay Design Manual. Three candidate primer pairs were evaluated for specificity using NCBI BLAST, and the optimal primer pair was selected based on amplification efficiency and product size confirmed by agarose gel electrophoresis.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe oligonucleotide sequences for the primer, crRNA, and ssDNA reporter\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eName\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eOligonucleotide sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003etp47F1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTTCCTCATGAATTAAAAGGGATTGCAAAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003etp47R1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAAAAACTATCCTCAGTGAGCATTGTCTTAAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003etp47F2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGAGGAATACAAGATTACGAACGTAAAGGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003etp47R2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGAAAAACTATCCTCAGTGAGCATTGTCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003etp47F3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTAAGACAATGCTCACTGAGGATAGTTTTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003etp47R3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACATAGTCGATGAACTCACGGTGCGACAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCrRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eUAAUUUCUACUAAGUGUAGAU UGCACGUAAGGUAAGCAGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003essDNA-FQ\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e6-FAM- TTATT-BHQ1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003essDNA-FB\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e6-FAM- TTATT-Biotin\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eRPA amplification\u003c/h3\u003e\n\u003cp\u003eRPA was performed using the TwistAmp\u0026reg; Basic Kit following the manufacturer\u0026rsquo;s instructions. The reaction mixture (total volume 47.5 \u0026micro;L) comprised 29.5 \u0026micro;L resuspension buffer, 2.4 \u0026micro;L each of forward and reverse primers (10 \u0026micro;M), 1 \u0026micro;L target nucleic acid template, and one enzyme pellet, with nuclease-free water added to reach the final volume. After thorough mixing, 2.5 \u0026micro;L of magnesium acetate (280 mM) was added to initiate the reaction. The mixture was briefly centrifuged and incubated at 39\u0026deg;C for 30 minutes.\u003c/p\u003e\n\u003ch3\u003eFluorescence detection assay based on RPA-CRISPR/Cas12a\u003c/h3\u003e\n\u003cp\u003eFor fluorescence-based detection, 10 \u0026micro;L of the RPA-amplified product was combined with 100 nM crRNA, 100 nM EnGen Lba Cas12a (Cpf1; New England Biolabs, USA), 100 nM fluorescent reporter probe and 1\u0026times; NEBuffer 2.1 in a total volume of 30 \u0026micro;L. The mixture was incubated at 37\u0026deg;C for 30 minutes. Fluorescence was monitored in real time at 1-minute intervals using a real-time PCR system (Applied Biosystems). Fluorescence was also visualized under blue light (470 nm) using a Tanon MINI Space 1000 Gel Imaging System after reaction completion.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eLateral flow assay based on RPA-CRISPR/Cas12a\u003c/h2\u003e\u003cp\u003eFor lateral flow detection, the RPA amplification and CRISPR/Cas12a reaction were performed as described above, except that the reporter probe was labeled with FAM and biotin. Following the reaction, the mixture was diluted with 70 \u0026micro;L of ddH₂O, and a lateral flow strip was inserted into the tube. Results were interpreted visually within 10 minutes.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eEvaluation of sensitivity and specificity\u003c/h3\u003e\n\u003cp\u003eThe sensitivity of the RPA-CRISPR/Cas12a detection system was assessed using serial dilutions of recombinant tp47 plasmid ranging from 1 ng/\u0026micro;L to 1 fg/\u0026micro;L, prepared with nuclease-free water. Nuclease-free water alone served as the no-template control (NTC). The specificity of the assay was evaluated by testing nucleic acids from HIV, HBV, HCV, and DENV, which can present clinical symptoms similar to Treponema pallidum infection, following the detection procedures described above.\u003c/p\u003e\n\u003ch3\u003eClinical sample evaluation\u003c/h3\u003e\n\u003cp\u003eA total of 18 serum samples from patients with suspected syphilis were analyzed using the RPA-CRISPR/Cas12a assay. The true status of each specimen was blinded to the operator during testing, and the minimum detection limit of the assay was applied as the threshold for a positive result. Following completion of the assays, the samples were unblinded, and the results were compared with the clinical diagnosis for evaluation.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eAll experiments were performed in triplicate, and data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Statistical comparisons were conducted using unpaired t-tests with GraphPad Prism 9. Differences were considered statistically significant at *P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eAssay workflow and primer optimization for the tp47-targeted RPA-CRISPR/Cas12a rapid visual detection of\u003c/strong\u003e \u003cstrong\u003eT. pallidum\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe working principle of the RPA-CRISPR/Cas12a-based \u003cem\u003eT. pallidum\u003c/em\u003e visual detection system is illustrated in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA. Initially, the target gene fragment is amplified using an RPA kit. At a constant temperature of 39\u0026deg;C, DNA recombinase in the RPA reaction forms nucleoprotein complexes with the oligonucleotide primers. These complexes specifically recognize and bind the complementary target sequences, enabling rapid and exponential amplification of the target DNA within 30 minutes. Following amplification, the Cas12a-crRNA complex is introduced into the system. Guided by crRNA through sequence-specific base pairing, Cas12a binds to the target DNA adjacent to the protospacer adjacent motif (PAM). Upon target recognition, Cas12a is activated and exhibits trans-cleavage activity, nonspecifically cleaving single-stranded DNA reporter probes. Fluorescently labeled ssDNA reporters (FQ) release a detectable fluorescence signal upon cleavage, whereas biotin-labeled ssDNA reporters (FB) facilitate result visualization via lateral flow chromatography. In summary, this system allows versatile readouts of T. pallidum detection, including real-time fluorescence monitoring, direct visual observation under blue light, and lateral flow assay-based interpretation, providing a rapid, sensitive, and instrument-flexible platform for pathogen detection.\u003c/p\u003e\n\u003cp\u003eBased on previous studies, the tp47 gene of \u003cem\u003eTreponema pallidum\u003c/em\u003e was selected as the molecular target for nucleic acid detection. Three pairs of RPA primers were designed and synthesized according to the tp47 gene sequence. Comparative evaluation of amplification efficiency revealed that the F3/R3 primer pair generated products with superior yield and specificity compared to the other primer sets (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB). Consequently, the F3/R3 primers were selected for all subsequent RPA amplification experiments.\u003c/p\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eFeasibility evaluation of the RPA\u0026ndash;CRISPR/Cas12a-based rapid visual detection system\u003c/h2\u003e\n \u003cp\u003eTo experimentally validate the system, five reaction conditions were established (R1-R5), each lacking a critical component. R1 contained the complete reaction mixture, including the target DNA, Bst DNA polymerase, Cas12a, and crRNA, whereas R2-R5 omitted the target DNA, Bst DNA polymerase, Cas12a, or crRNA, respectively. lateral flow test (LFT) results corroborated the fluorescence assays. A distinct test line (T-line) was visible only in R1, whereas R2-R5 displayed no T-line (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). This outcome reflects the fact that Cas12a trans-cleavage of the dual-labeled reporter probe (FAM/Biotin) occurs only when both amplification and Cas12a-crRNA targeting are functionally intact. Similarly, only R1 exhibited robust fluorescence under UV illumination, while R2-R5 showed no detectable or negligible background signal (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC). Real-time fluorescence monitoring further confirmed these observations: a significant signal increase was observed exclusively in R1, whereas all incomplete reaction groups remained at baseline levels (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). The absence of fluorescence in R2-R5 is consistent with the mechanistic requirement that Cas12a activation depends on both sequence-specific recognition by the crRNA-Cas12a complex and the presence of amplified target DNA. Collectively, these results demonstrate that the RPA-CRISPR/Cas12a system achieves highly specific detection of \u003cem\u003eT.pallidum\u003c/em\u003e, with negligible risk of false-positive signals. The consistency across fluorescence assays, real-time monitoring, and lateral flow readouts underscores the robustness and reliability of this platform.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eOptimization of reaction parameters for the RPA-CRISPR/Cas12a system\u003c/h2\u003e\n \u003cp\u003eTo maximize the detection performance of the RPA-CRISPR/Cas12a assay, key experimental parameters-including RPA amplification time, Cas12a concentration, crRNA concentration, and ssDNA reporter concentration- were systematically optimized. RPA amplification time was first evaluated, as it directly influences the yield of target DNA. Fluorescence intensity increased progressively within the first 30 minutes of amplification and reached a plateau thereafter. This trend was consistent with lateral flow strip readouts, where band intensity stabilized beyond 30 minutes. Therefore, an incubation time of 30 minutes was selected for subsequent RPA reactions (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA-C). Next, the concentrations of Cas12a and crRNA were optimized to enhance trans-cleavage activity. Cas12a was tested at final concentrations of 25, 50, 100, 200, and 250 nM, while crRNA was assessed at 50, 100, 200, 250, and 500 nM. The strongest fluorescence signals were observed with 100 nM Cas12a and 250 nM crRNA, which were thus determined to be the optimal working concentrations (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD-I). Finally, the concentration of the ssDNA reporter was optimized to ensure clear fluorescence detection and unambiguous interpretation of lateral flow strip results. Reporter concentrations ranging from 100 nM to 500 nM were tested. A concentration of 200 nM yielded the most distinct and reproducible results in both fluorescence-based and lateral flow assays, and was therefore selected as the standard condition for subsequent experiments (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eJ). Collectively, these optimizations established a robust set of working parameters, ensuring both high sensitivity and reliable readout of the RPA-CRISPR/Cas12a detection platform.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eSensitivity and specificity evaluation of the RPA-CRISPR/Cas12a fluorescence assay\u003c/h2\u003e\n \u003cp\u003eUnder optimized reaction conditions, the sensitivity of the RPA-CRISPR/Cas12a assay was evaluated using serial dilutions of the tp47 plasmid ranging from 1 fg/test to 1 ng/test. Fluorescence intensity increased proportionally with target DNA concentration within this range. A strong linear correlation was observed between the fluorescence signal and the logarithm of target concentration across 10 fg/test to 100 pg/test, with a correlation coefficient (R\u0026sup2;) of 0.99 (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA-C). Based on three independent negative control (NC) measurements, the limit of detection (LOD) was calculated as 2.04 fg/test (equivalent to 11.34 copies/\u0026micro;L, determined using DNA copy number conversion). The specificity of the assay was further assessed using the tp47 gene fragment alongside nucleic acids from clinically relevant pathogens that present with overlapping symptoms, including HIV, HBV, HCV, and DENV. Robust fluorescence signals were generated exclusively in the presence of the tp47 target, while non-target viral samples and negative controls showed no detectable or negligible signal in both real-time and endpoint fluorescence measurements (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eD-E). Notably, at a target concentration of 1 ng/test, signal intensity for tp47 was markedly higher than for all non-target controls, underscoring the high specificity of the system and its capacity to reliably distinguish T. pallidum from other pathogens.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eSensitivity and specificity evaluation of the RPA-CRISPR/Cas12a LFT assay\u003c/h2\u003e\n \u003cp\u003eTo improve the practicality of the assay in resource-limited settings, a LFT-based detection platform was established. This method combines the high sensitivity and operational simplicity of lateral flow assays, eliminating the need for specialized equipment. In this system, the ssDNA reporter was dual-labeled with FAM and biotin. The LFT strip was composed of a conjugate pad (pre-coated with anti-FAM antibodies conjugated to gold nanoparticles), a detection zone containing streptavidin (test line) and IgG (control line), and an absorbent pad. Upon application of the RPA\u0026ndash;CRISPR/Cas12a reaction product, intact ssDNA reporters were captured at the control line via streptavidin binding. In the presence of the tp47 target, Cas12a was activated and cleaved the reporter, releasing fragments that were subsequently captured at the test line, resulting in two distinct visible bands. The limit of detection (LOD) for the LFT-based assay was determined to be 100 fg/test (5.56\u0026times;10\u0026sup2; copies/\u0026micro;L). The specificity was fully consistent with that observed in the fluorescence-based assay, enabling clear discrimination of tp47 from non-target viral pathogens (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA-B). These findings confirm that the LFTs platform provides a rapid, instrument-free, and highly specific approach for \u003cem\u003eT. pallidum\u003c/em\u003e detection.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003eClinical validation\u003c/h2\u003e\n \u003cp\u003eTo assess the diagnostic efficacy of the developed system, 18 identified clinical serum samples were analyzed using the fluorescence-based RPA\u0026ndash;CRISPR/Cas12a assay. The cut-off threshold was defined as three times the maximum fluorescence value of the negative controls. All 18 samples generated detectable fluorescence signals, among which 9 samples (ST1, ST2, ST3, ST4, ST7, ST9, ST10, ST11, and ST13) exceeded the positivity threshold and were identified as syphilis-positive (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA). Following unblinding, clinical diagnoses were used as the reference standard, yielding a diagnostic accuracy of 94.4% (Table.2).\u003c/p\u003e\n \u003cp\u003eTo further evaluate the field applicability, the LFT-based RPA\u0026ndash;CRISPR/Cas12a assay was applied to the same set of samples. Among them, only ST1 was detected as positive, whereas the remaining samples were negative (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB). Quantification of ST1 DNA concentration, based on the established standard curve, indicated 165.96 fg/test, which is above the detection limit of the LFT method. These findings suggest that while the fluorescence-based assay offers high diagnostic accuracy, the current LFT platform is limited by lower sensitivity. Further optimization of strip materials and manufacturing processes will be essential to improve detection performance and enable reliable on-site screening applications.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eDiagnostic analysis of RPA-CRISPR Cas12a fluorescence test results\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eClinically practical diagnosis\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eDiagnostic accuracy\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eillness\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eHealth\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003etotal\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eRPA- CRISPR Cas12a (fluorescence)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e94.4%\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003etotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we developed an RPA\u0026ndash;CRISPR/Cas12a detection system for the rapid diagnosis of syphilis. Over the past two decades, the incidence of syphilis has steadily increased, and its diverse clinical manifestations\u0026mdash;often overlapping with other infections\u0026mdash;pose significant challenges to accurate diagnosis and timely treatment [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Currently, syphilis detection relies primarily on combined serological testing (Treponema pallidum-specific and non-Treponema pallidum assays), which serves as a standard approach for screening, diagnosis, and monitoring disease progression and treatment efficacy. Nucleic acid amplification assays, such as conventional PCR, provide direct detection of T. pallidum DNA [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. For instance, Zhou et al. employed both conventional PCR and droplet digital PCR to detect spirochete DNA in plasma samples from patients at different stages of syphilis, demonstrating high detection efficiency [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, PCR-based methods require expensive instrumentation and trained personnel, limiting their utility for large-scale screening, particularly in resource-limited or grassroots settings.\u003c/p\u003e\u003cp\u003eCompared with traditional amplification methods, the RPA-CRISPR/Cas12a system offers a simpler workflow and requires minimal equipment, significantly reducing both detection cost and turnaround time. These advantages facilitate on-site pathogen detection. The tp47 gene has been widely selected as a target for T. pallidum detection in previous studies [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. tp47 encodes a cytoplasmic membrane protein involved in cell wall synthesis, making it a stable and specific target for nucleic acid-based assays [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. RPA is an isothermal amplification technique that has gained popularity due to its rapid amplification, high sensitivity, and operational simplicity. Nonetheless, RPA is prone to primer-dimer formation and nonspecific amplification [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. CRISPR/Cas12a, as a molecular detection tool, overcomes some of these limitations through its trans-cleavage activity: upon recognition and binding of crRNA to a complementary double-stranded DNA target, Cas12a is activated and cleaves fluorescent reporter probes, releasing a detectable signal. Several RPA\u0026ndash;CRISPR/Cas12a-based viral detection assays have been reported. For example, Li et al. developed two RPA-based assays for monkeypox virus: a fluorescence-based RPA (F-RPA) with an LOD of 15.32 copies/\u0026micro;L, and a vertical flow bar RPA (VF-RPA) with an LOD of 8.53 copies/\u0026micro;L [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Ren et al. reported an RPA\u0026ndash;CRISPR/Cas12a dengue virus assay with an LOD of 91.7 copies/test [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], while Lin et al. described a rapid detection method for Plasmodium parasites, achieving an LOD of 1 copy/\u0026micro;L [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. These studies, together with our findings, demonstrate that RPA\u0026ndash;CRISPR/Cas12a assays are versatile and effective for detecting both viral genomes and more complex bacterial genomes such as T. pallidum. To facilitate syphilis diagnosis in resource-limited regions and low-income countries, we integrated the RPA\u0026ndash;CRISPR/Cas12a detection system with lateral flow assay (LFA) technology, enabling point-of-care testing without reliance on large laboratory instruments. This approach enhances accessibility and scalability for field diagnostics.\u003c/p\u003e\u003cp\u003eDespite these advantages, the RPA\u0026ndash;CRISPR/Cas12a system has several limitations. First, the LOD of LFA-based detection is generally higher than that obtained with fluorescence-based detection, as fluorescence readouts are quantified using sensitive PCR instrumentation. Second, to minimize RPA aerosol contamination, electrophoretic verification of amplification products is typically omitted, preventing confirmation of amplicon size. Third, the design and validation of RPA-CRISPR/Cas12a assays remain technically demanding and require careful optimization of primers, crRNAs, and reaction conditions. While costs can be reduced through large-scale implementation, they must be considered during assay development.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn summary, we have successfully established and validated a rapid, sensitive, and specific nucleic acid visual detection platform for \u003cem\u003eT. pallidum\u003c/em\u003e based on the integration of RPA and CRISPR/Cas12a. The system supports dual readout modalities: a fluorescence-based assay and an LFB-based assay, both demonstrating high specificity and sensitivity with no observed false-positive results. The fluorescence-based method achieved a limit of detection (LOD) of 2.04 fg/test, while the LFB-based approach exhibited an LOD of 10 fg/test. Collectively, the RPA-CRISPR/Cas12a platform offers a robust, efficient, and user-friendly tool for syphilis diagnosis. Its minimal equipment requirements, rapid turnaround, and adaptability to point-of-care formats highlight its strong potential for deployment in resource-limited settings and for large-scale screening applications.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eW. L. and S. O. were responsible for conceptualizing the research. W. L., Y.S., and S. O devised the methodology. Y. S., M.Y., J.O., W.X., Y.S.,D.N and X.H. carried out the formal analysis and investigation. The original draft of the manuscript was prepared by W. L., \u0026nbsp;Y. S., and M.Y. Subsequently, the writing process underwent review and editing by S. O. W.L. and S. O. secured the funding for this project. S. O. supervised the overall study. Each author participated in revising the manuscript and lent their approval to the final version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Dongguan Science and Technology of Social Development Program (20221800905392, 20231800940452, 20231800940112, 20221800906092), National Natural Science Foundation of China (82370039), Guangdong Basic and Applied Basic Research Foundation (2024A1515140157), Science and Technology Special Envoy Project of Songshan Lake District of Dongguan City (20234404-01KCJG), Songshan Lake Medical and Engineering Integration Project (4SG22310P), the Innovation Project for College Students (2JD24101, 2DC24103G, JDXM2024041).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets analysed during the current study are available in the [NCBI] repository, [M88769.1, \u0026nbsp;D86068.1, MT426913.1, KJ439771.1, M14931.2].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study protocol complied with the ethical guidelines of the \u003cem\u003eDeclaration of Helsinki\u003c/em\u003e and was approved by the Ethics Review Committee of the Ninth People\u0026rsquo;s Hospital of Dongguan (Ethics Review No. 3, 2022). Written informed consent was obtained from all participants prior to enrollment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial number\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSatyaputra F, Hendry S, Braddick M, Sivabalan P, Norton R. The Laboratory Diagnosis of Syphilis. J Clin Microbiol. 2021;59(10):e0010021; doi: 10.1128/jcm.00100-21.\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Connor NP, Burke PC, Worley S, Kadkhoda K, Goje O, Foster CB. Outcomes After Positive Syphilis Screening. Pediatrics. 2022;150(3); doi: 10.1542/peds.2022-056457.\u003c/li\u003e\n\u003cli\u003ePeeling RW, Mabey D, Chen XS, Garcia PJ. Syphilis. Lancet (London, England). 2023;402(10398):336-46; doi: 10.1016/s0140-6736(22)02348-0.\u003c/li\u003e\n\u003cli\u003eBourchier L, Goller J, Bittleston H. Detecting asymptomatic syphilis. The Lancet regional health Western Pacific. 2023;40:100901; doi: 10.1016/j.lanwpc.2023.100901.\u003c/li\u003e\n\u003cli\u003eSweitzer S, Duncan JA, Se\u0026ntilde;a AC. Update on syphilis diagnostics. Curr Opin Infect Dis. 2025;38(1):44-53; doi: 10.1097/qco.0000000000001073.\u003c/li\u003e\n\u003cli\u003eTalhari C, Arriel K, Serra MS, Veasey JV. Acquired syphilis: update on clinical, diagnostic and therapeutic aspects(⋆). An Bras Dermatol. 2025;100(3):407-21; doi: 10.1016/j.abd.2024.11.002.\u003c/li\u003e\n\u003cli\u003eReis ARP, Duarte G, Menegueti MG, Reis RK, Silva A, Gir E. Reactive treponemal and non-treponemal tests in pregnant women and associated factors. Revista da Escola de Enfermagem da U S P. 2022;56:e20220146; doi: 10.1590/1980-220X-REEUSP-2022-0146en.\u003c/li\u003e\n\u003cli\u003ePapp JR, Park IU, Fakile Y, Pereira L, Pillay A, Bolan GA. CDC Laboratory Recommendations for Syphilis Testing, United States, 2024. MMWR Recommendations and reports : Morbidity and mortality weekly report Recommendations and reports. 2024;73(1):1-32; doi: 10.15585/mmwr.rr7301a1.\u003c/li\u003e\n\u003cli\u003eLarsen SA, Steiner BM, Rudolph AH. Laboratory diagnosis and interpretation of tests for syphilis. Clinical microbiology reviews. 1995;8(1):1-21; doi: 10.1128/cmr.8.1.1.\u003c/li\u003e\n\u003cli\u003eTheel ES, Katz SS, Pillay A. Molecular and Direct Detection Tests for Treponema pallidum Subspecies pallidum: A Review of the Literature, 1964-2017. Clin Infect Dis. 2020;71(Suppl 1):S4-s12; doi: 10.1093/cid/ciaa176.\u003c/li\u003e\n\u003cli\u003eHaynes AM, Konda KA, Romeis E, Siebert J, Vargas SK, Reyes Diaz M, et al. Evaluation of a minimal array of Treponema pallidum antigens as biomarkers for syphilis diagnosis, infection staging, and response to treatment. Microbiology spectrum. 2024;12(1):e0346623; doi: 10.1128/spectrum.03466-23.\u003c/li\u003e\n\u003cli\u003eChittle AD, Sandstrom P, Cox J, Tsang RSW. Treponemal point-of-care tests for syphilis. CMAJ : Canadian Medical Association journal = journal de l\u0026apos;Association medicale canadienne. 2024;196(20):E702-e3; doi: 10.1503/cmaj.231548.\u003c/li\u003e\n\u003cli\u003eCastro R, \u0026Aacute;guas MJ, Batista T, Ara\u0026uacute;jo C, Mansinho K, Pereira Fda L. Detection of Treponema pallidum Sp. Pallidum DNA in Cerebrospinal Fluid (CSF) by Two PCR Techniques. Journal of clinical laboratory analysis. 2016;30(5):628-32; doi: 10.1002/jcla.21913.\u003c/li\u003e\n\u003cli\u003eGrange PA, Jary A, Isnard C, Burrel S, Boutolleau D, Touati A, et al. Use of a Multiplex PCR Assay To Assess the Presence of Treponema pallidum in Mucocutaneous Ulcerations in Patients with Suspected Syphilis. J Clin Microbiol. 2021;59(2); doi: 10.1128/jcm.01994-20.\u003c/li\u003e\n\u003cli\u003eGolden M, O\u0026apos;Donnell M, Lukehart S, Swenson P, Hovey P, Godornes C, et al. Treponema pallidum Nucleic Acid Amplification Testing To Augment Syphilis Screening among Men Who Have Sex with Men. J Clin Microbiol. 2019;57(8); doi: 10.1128/jcm.00572-19.\u003c/li\u003e\n\u003cli\u003eCao W, Thorpe PG, O\u0026apos;Callaghan K, Kersh EN. Advantages and limitations of current diagnostic laboratory approaches in syphilis and congenital syphilis. Expert Rev Anti Infect Ther. 2023;21(12):1339-54; doi: 10.1080/14787210.2023.2280214.\u003c/li\u003e\n\u003cli\u003evan Beljouw SPB, Sanders J, Rodr\u0026iacute;guez-Molina A, Brouns SJJ. RNA-targeting CRISPR-Cas systems. Nat Rev Microbiol. 2023;21(1):21-34; doi: 10.1038/s41579-022-00793-y.\u003c/li\u003e\n\u003cli\u003eMao Z, Chen R, Wang X, Zhou Z, Peng Y, Li S, et al. CRISPR/Cas12a-based technology: A powerful tool for biosensing in food safety. Trends in food science \u0026amp; technology. 2022;122:211-22; doi: 10.1016/j.tifs.2022.02.030.\u003c/li\u003e\n\u003cli\u003eMing M, Ren Q, Pan C, He Y, Zhang Y, Liu S, et al. CRISPR-Cas12b enables efficient plant genome engineering. Nature plants. 2020;6(3):202-8; doi: 10.1038/s41477-020-0614-6.\u003c/li\u003e\n\u003cli\u003eGootenberg JS, Abudayyeh OO, Lee JW, Essletzbichler P, Dy AJ, Joung J, et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science. 2017;356(6336):438-42; doi: 10.1126/science.aam9321.\u003c/li\u003e\n\u003cli\u003eFeng X, Liu Y, Zhao Y, Sun Z, Xu N, Zhao C, et al. Recombinase Polymerase Amplification-Based Biosensors for Rapid Zoonoses Screening. Int J Nanomedicine. 2023;18:6311-31; doi: 10.2147/ijn.S434197.\u003c/li\u003e\n\u003cli\u003eTang G, Zhang Z, Tan W, Long F, Sun J, Li Y, et al. RT-RPA-Cas12a-based assay facilitates the discrimination of SARS-CoV-2 variants of concern. Sensors and actuators B, Chemical. 2023;381:133433; doi: 10.1016/j.snb.2023.133433.\u003c/li\u003e\n\u003cli\u003eLiu Q, Zeng H, Wang T, Ni H, Li Y, Qian W, et al. Development of RPA-Cas12a assay for rapid and sensitive detection of Pneumocystis jirovecii. BMC Microbiol. 2024;24(1):314; doi: 10.1186/s12866-024-03440-z.\u003c/li\u003e\n\u003cli\u003eTu Q, Cao X, Ling C, Xiang L, Yang P, Huang S. Point-of-care detection of Neisseria gonorrhoeae based on RPA-CRISPR/Cas12a. AMB Express. 2023;13(1):50; doi: 10.1186/s13568-023-01554-7.\u003c/li\u003e\n\u003cli\u003eLi Y, Wang X, Xu R, Wang T, Zhang D, Qian W. Establishment of RT-RPA-Cas12a assay for rapid and sensitive detection of human rhinovirus B. BMC Microbiol. 2023;23(1):333; doi: 10.1186/s12866-023-03096-1.\u003c/li\u003e\n\u003cli\u003eChan PA, Mena L. Point-of-Care Syphilis Testing: Implementation and Future Direction. Curr HIV/AIDS Rep. 2025;22(1):28; doi: 10.1007/s11904-025-00728-1.\u003c/li\u003e\n\u003cli\u003eWang C, Zheng X, Guan Z, Zou D, Gu X, Lu H, et al. Quantified Detection of Treponema pallidum DNA by PCR Assays in Urine and Plasma of Syphilis Patients. Microbiology spectrum. 2022;10(2):e0177221; doi: 10.1128/spectrum.01772-21.\u003c/li\u003e\n\u003cli\u003eWang C, Hu Z, Zheng X, Ye M, Liao C, Shang M, et al. A New Specimen for Syphilis Diagnosis: Evidence by High Loads of Treponema pallidum DNA in Saliva. Clin Infect Dis. 2021;73(9):e3250-e8; doi: 10.1093/cid/ciaa1613.\u003c/li\u003e\n\u003cli\u003eMi HF, Shen X, Chen XQ, Zhang XL, Ke WJ, Xiao Y. Association between treatment failure in patients with early syphilis and penicillin resistance-related gene mutations of Treponema pallidum: Protocol for a multicentre nested case-control study. Front Med (Lausanne). 2023;10:1131921; doi: 10.3389/fmed.2023.1131921.\u003c/li\u003e\n\u003cli\u003eSrivastava P, Prasad D. Isothermal nucleic acid amplification and its uses in modern diagnostic technologies. 3 Biotech. 2023;13(6):200; doi: 10.1007/s13205-023-03628-6.\u003c/li\u003e\n\u003cli\u003ePaul B, Montoya G. CRISPR-Cas12a: Functional overview and applications. Biomedical journal. 2020;43(1):8-17; doi: 10.1016/j.bj.2019.10.005.\u003c/li\u003e\n\u003cli\u003eLi Y, Gao Y, Tang Y, Li J, Zhang S, Jiang T, et al. Development of rapid nucleic acid assays based on the recombinant polymerase amplification for monkeypox virus. Virol Sin. 2023;38(1):165-70; doi: 10.1016/j.virs.2022.12.001.\u003c/li\u003e\n\u003cli\u003eZhang Y, Xiang Y, Hou D, Fang L, Cai S, Zhang J, et al. A one-pot method for universal Dengue virus detection by combining RT-RPA amplification and CRISPR/Cas12a assay. BMC Microbiol. 2025;25(1):163; doi: 10.1186/s12866-025-03882-z.\u003c/li\u003e\n\u003cli\u003eWei H, Li J, Liu Y, Cheng W, Huang H, Liang X, et al. Rapid and Ultrasensitive Detection of Plasmodium spp. Parasites via the RPA-CRISPR/Cas12a Platform. ACS Infect Dis. 2023;9(8):1534-45; doi: 10.1021/acsinfecdis.3c00087.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Treponema pallidum, recombinase polymerase amplification, CRISPR/Cas12a, Visualization detection","lastPublishedDoi":"10.21203/rs.3.rs-7789887/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7789887/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSyphilis, caused by \u003cem\u003eTreponema pallidum\u003c/em\u003e, is a sexually transmitted infection that has re-emerged globally over the past decade, posing significant public health challenges. Conventional diagnostic methods are limited by lengthy processing times, operational complexity, and moderate sensitivity, highlighting the urgent need for rapid, sensitive, and user-friendly detection strategies. In this study, we developed a visual detection platform for \u003cem\u003eT. pallidum\u003c/em\u003e DNA by integrating recombinase polymerase amplification (RPA) with CRISPR/Cas12a technology. The assay can be completed within one hour, with results directly interpreted via fluorescence readout. It demonstrated a detection limit as low as 11.34 copies/\u0026micro;L and high specificity, accurately distinguishing \u003cem\u003eT. pallidum\u003c/em\u003e without cross-reactivity with common blood-borne pathogens, including HIV, HBV, HCV, and DENV. Validation with clinical samples showed complete concordance with standard diagnostic outcomes. To enhance suitability for point-of-care applications, the RPA-CRISPR/Cas12a system was further adapted to a lateral flow assay (LFA) format, achieving a detection sensitivity of 5.56\u0026times;10\u0026sup2; copies/\u0026micro;L while minimizing reliance on specialized instrumentation. Overall, this platform provides a rapid, sensitive, and robust approach for point-of-care syphilis diagnosis and offers a reference framework for detecting other pathogenic organisms.\u003c/p\u003e","manuscriptTitle":"Rapid visual detection of Treponema pallidum using the RPA-CRISPR/Cas12a System","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-12 11:36:22","doi":"10.21203/rs.3.rs-7789887/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-03T19:15:45+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-25T12:45:56+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"274655047917052224430331917017184630744","date":"2025-11-19T20:08:38+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-19T17:27:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"227181441451968009981780334910493295814","date":"2025-11-10T11:05:47+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"186455855197244463846561869178953028389","date":"2025-11-04T16:40:48+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-11-02T15:39:12+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-31T09:00:20+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-10-30T18:01:19+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-25T14:09:53+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-10-25T14:06:33+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"dd865536-365a-4a90-be97-efe2b4505696","owner":[],"postedDate":"November 12th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":57723870,"name":"Biological sciences/Biological techniques"},{"id":57723871,"name":"Health sciences/Diseases"},{"id":57723872,"name":"Biological sciences/Microbiology"}],"tags":[],"updatedAt":"2026-01-19T16:48:58+00:00","versionOfRecord":{"articleIdentity":"rs-7789887","link":"https://doi.org/10.1038/s41598-026-35745-6","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2026-01-13 16:30:31","publishedOnDateReadable":"January 13th, 2026"},"versionCreatedAt":"2025-11-12 11:36:22","video":"","vorDoi":"10.1038/s41598-026-35745-6","vorDoiUrl":"https://doi.org/10.1038/s41598-026-35745-6","workflowStages":[]},"version":"v1","identity":"rs-7789887","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7789887","identity":"rs-7789887","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00