Generation of hypoimmunogenic universal iPSCs through HLA-type gene knockout

Generation of hypoimmunogenic universal iPSCs through HLA-type gene knockout | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Generation of hypoimmunogenic universal iPSCs through HLA-type gene knockout Ji Hyeon Ju, Juryun Kim, Yoojun Nam, Doyeong Jeon, Yujin Choi, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4354435/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 14 Mar, 2025 Read the published version in Experimental & Molecular Medicine → Version 1 posted 10 You are reading this latest preprint version Abstract Hypoimmunogenic universal induced pluripotent stem cells (iPSCs) were generated through the targeted disruption of key genes, including human leukocyte antigen ( HLA )- A , HLA-B , and HLA-DR alpha ( DRA ), using the CRISPR/Cas9 system. This approach aimed to minimize immune recognition and enhance the potential of iPSCs for allogeneic therapy. Heterozygous iPSCs were used for guide RNA (gRNA) design and validation to facilitate the knockout (KO) of HLA-A, HLA-B , and HLA-DRA genes. Electroporation of iPSCs using the selected gRNAs enabled the generation of triple-KO iPSCs, followed by single-cell cloning for clone selection. Clone A7, an iPSC with a targeted KO of HLA-A, HLA-B , and HLA-DRA genes, was identified as the final candidate. mRNA analysis revealed robust expression of pluripotency markers, such as octamer-binding transcription factor 4 ( OCT4 ), SRY (sex-determining region Y)-box 2 ( SOX2 ), Krüppel-like factor 4 ( KLF4 ), Lin-28 homolog A ( LIN28 ), and Nanog homeobox (NANOG) , while protein expression assays confirmed the presence of OCT4, stage-specific embryonic antigen 4 (SSEA4), NANOG, and tumor rejection antigen 1–60 (TRA-1-60). Karyotype examination demonstrated no anomalies, and three germ layer differentiation assays confirmed differentiation potential. Following interferon-gamma (INF-γ) stimulation, the gene-corrected clone A7 exhibited the absence of HLA-A, HLA-B, and HLA-DR protein expression. Immunogenicity testing further confirmed the hypoimmunogenicity of Clone A7, which was evidenced by the absence of proliferation in central memory T cells (TCM) and effector memory T cells (TEM). In conclusion, Clone A7, a triple KO iPSC clone that demonstrates immune evasion properties, retained its intrinsic iPSC characteristics and exhibited no immunogenicity. Biological sciences/Stem cells/Pluripotent stem cells/Induced pluripotent stem cells Biological sciences/Biological techniques/Genetic engineering Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction In cell therapy, overcoming immunogenicity is crucial for the successful application of induced pluripotent stem cell (iPSC). Research utilizing adult stem cells, such as mesenchymal stem cells (MSCs), embryonic stem cells (ESCs), and iPSCs, has been advancing 1 . iPSCs, generated by introducing Yamanaka factors into somatic cells, possess pluripotent characteristics and the ability to differentiate into various cell types, making them promising candidates for therapeutic use 2 , 3 . However, allogeneic therapy using iPSCs is challenging owing to immunogenicity 4 . To address this issue, we aimed to generate hypoimmunogenic universal iPSCs by editing the human leukocyte antigen ( HLA ) genes. The HLA system is crucial for transplantation 5 . While HLA polymorphism is imperative for immune defense, it often causes failure owing to immune reactions as a result of genetic disparities in organ transplantation 6 . This phenomenon extends to cell therapies, where mismatched HLA types from the donor are identified as non-self, resulting in potential attacks by CD4 T, CD8 T, and natural killer (NK) cells, thereby triggering an ensuing immune response 7 . The major histocompatibility complex (MHC), also known as the HLA gene, contains genes responsible for encoding the MHC molecules that function within the immune system 8 , 9 . Located on chromosome 6, it consists of HLA class I (A, B, and C) and class II (DR, DQ, and DP) molecules, representing the most polymorphic regions within the human genome. Class I MHC molecules, such as HLA-A, B, and C, present foreign proteins to cytotoxic T (Tc) cells in the presence of non-self-proteins. They consist of a polymorphic α-chain and non-polymorphic β2M chain. Class II MHC molecules, including HLA-DR , HLA-DQ , and HLA-DP , consist of a polymorphic β1 chain, a non-polymorphic α chain, and β2. They present foreign proteins to helper T cells upon detecting non-self proteins 10 , 11 . Although patient-donor HLA typing alignment is optimal for transplantation, identifying such matches poses challenges 12 . In cases of partial HLA mismatch, the degree of mismatch can significantly influence the severity of immune rejection reactions. HLA matching is crucial in transplantation 13 . However, despite the existence of a bone marrow registry with four million donors in the US, only 50–60% of cases find matches for HLA-A and B. Autologous transplantation is the most desirable method 14 , 15 , but it involves significant time and expense before transplantation. Allogeneic transplantation using iPSCs from donors with homozygous HLA alleles can broaden their applicability to a more diverse patient population. However, covering all HLA types within a population is impractical. In Korea, there are examples of 13 good manufacturing practice (GMP)-grade homozygous iPSCs obtained by assessing common homozygous HLA-A, B, and DRB1 types 16 , but it still proves challenging to cover the entire Korean population. Similarly, in Japan, where 140 homozygote iPSCs can cover 90% of the population 17 , identifying such homozygous iPSCs remains a significant challenge. Researchers are exploring the use of iPSCs in transplantation by correcting mutations or editing HLA using gene-editing techniques, such as CRISPR-Cas9. These genetically modified iPSCs can differentiate into target cells and be administered to the patients. Currently, studies are focusing on generating hypoimmunogenic iPSCs using gene-editing methods for transplantation. The CRISPR-Cas9 system is used for gene editing by targeting specific gene regions to induce DNA breaks. This facilitates non-homologous end joining (NHEJ) to introduce random mutations or homology-directed repair (HDR) to insert the desired genes 18 . When transfection-delivered guide RNA (sgRNA) binds to the target sequence, Cas9 enzyme precisely cuts the intended region, enabling sequence editing. This technique can be used to knockout (KO) polymorphic HLA genes and eliminate genes that trigger immune responses. Since its inception in 2012, CRISPR-Cas9 has been widely used across various fields, including the development of gene and cell therapies 19 . The clinical trial registration system ( http://clinicaltrials.gov ) identified 49 clinical trials that used this technology, with one clinical approval for applying this technology to iPSCs 20 . Numerous studies on HLA gene engineering of existing iPSCs are in progress 21 – 23 , aiming to establish clinical-grade universal iPSCs within good manufacturing practice (GMP) facilities 24 . Recent research has used the CRISPR-Cas9 technology to induce KO of HLA genes 25 . Studies on universal iPSCs have involved deleting HLA-A, HLA- B, HLA-C, β2M , 26 – 28 or class II major histocompatibility complex transactivator ( CIITA ) to eliminate MHC class I and II 11 , 29 , 30 . Without gene editing, these cells are susceptible to cytotoxic T (Tc) cells, helper T (Th) cells, and NK cells. When MHC class I is completely deleted because of β2M, Tc and Th rejection can be prevented, but NK cell attacks cannot be avoided. HLA-E blocks NK and CD8 + T cell attacks 31 , whereas HLA-G blocks attacks from CD8 + T, CD4 + T, B 32 , and NK cells, and macrophages, prompting research into selective deletion methods. Additionally, strategies involving knocking in CD47 33 , which signals "don't-eat me" 34 to programmed death-ligand 1 (PD-L1), HLA-G, and macrophages, are pursued 35 , 36 . Selective KO methods include biallelic KO of HLA-A and HLA-B genes, monoallelic KO of HLA-C gene, and the KO of CIITA to eliminate all HLA class II molecules 37 , 38 . This study aimed to generate hypoimmunogenic iPSCs by eliminating immunogenicity through the deletion of HLA-A, HLA-B , and HLA-DRA genes, which are closely associated with recipient T cell responses among donor HLA types during cell transplantation. Using the CRISPR-Cas9 system, HLA-A, HLA-B , and HLA-DRA genes were deleted in the YiP3 cell line, which is derived from peripheral blood mononuclear cell (PBMC)-derived iPSCs with heterozygosity for HLA gene, to prevent immune rejection reactions. Previous studies on universal iPSCs have used homozygous iPSCs or iPSCs with partially matching alleles in the HLA genes as gene editing targets 39 . In contrast, this study aimed to genetically modify both the alleles in heterozygous iPSCs. The majority of existing studies and patents have focused on deleting HLA-A, HLA-B , and HLA-DRB1 40 , with no research reporting on knocking out, HLA-DRA . This strategy involves deleting the DRA α-chain, thereby eliminating the structure of MHC class II responsible for antigen recognition. Regarding the HLA-DR component, considering the presence of HLA-DRA alongside HLA-DRB1, HLA-DRB3, HLA-DRB4 , and HLA-DRB5 , targeting only HLA-DRB1 for KO was selected to prevent concerns regarding the expression of HLA-DRB3, HLA-DRB4 , and HLA-DRB5 . In this study, we established hypoimmunogenic iPSCs to mitigate immune responses, which are potential adverse effects in allogeneic transplantation. Quality testing and immunogenicity assessments of the iPSCs were conducted to prepare them for use in cell therapy. Materials and Methods Gene-editing iPSCs On day 0, CRISPR/Cas9 reagents (ribonucleoprotein [RNP] complexes) were prepared by combining 80 µg of gRNA for HLA-A, HLA-B, and HLA-DRA , with CAS9. Subsequently, 1 million PBMC-derived iPSCs (YiP3) were mixed with these complexes and subjected to electroporation. From days 3 to 5, the transfected cells were collected and subjected to single-cell cloning using flow cytometry. Approximately 10,000 cells were collected for electroporation pool analysis. The transfected electroporation pool was genotyped from days 5 to 13. After seeding the transfected iPSCs into a 96-well plate, they were cultured with mTeSR-Plus, and single clones were selected. From day 11–13 to day 25–28, the gene-edited clones were analyzed through PCR and Sanger sequencing. iPSC culture The gene-edited cell lines were thawed and passaged following the supplementary methods. After the cells were stabilized, the coating material and culture medium were replaced to culture the cells under conditions similar to those of the control iPSCs. Detailed methods are described in the supplementary methods. Endothelial cell (EC) differentiation ECs were generated as previous study 41 . Detailed methods for EC differentiation from iPSCs are described in supplementary methods. Alkaline Phosphate (AP) Staining Alkaline phosphate staining was performed using an Alkaline Phosphate Detection Kit (SCR004; Sigma), following the manufacturer’s protocol. Detailed protocol is described in the supplementary methods. Fluorescence-activated cell sorting (FACS) Analysis Detailed methods and antibodies used for fluorescence-activated cell sorting (FACS) analysis are provided in the supplementary methods. Three germ lineage Differentiation assay The differentiation potential of trilineage germ cell layers was determined using the STEMdiff Trilineage differentiation kit (05230; STEMCELL technology), following the manufacturer’s protocol. Detailed protocol is described in the supplementary methods. Quantitative real-time PCR Total RNA was isolated using TRIzol reagent (15596026; Invitrogen). cDNA was synthesized from the isolated RNA using the RevertAid First Strand cDNA Synthesis Kit (K1622; Thermo Fisher) following the manufacturer’s protocol. Quantitative real-time PCR was performed using the QuantStudio 3 instrument (Applied Biosystems) and Power SYBR Green PCR Master Mix (4367659; Applied Biosystems). Primer details are listed in the Table 1 in the supplementary Table. Table 1 The primer list of pluripotency markers, three germ layer differentiation markers, and human leukocyte antigen ( HLA ) Genes Direction Sequence NANOG Forward GATTTGTGGGCCTGAAGAAA Reverse CAGATCCATGGAGGAAGGAA OCT4 Forward ACCCCTGGTGCCGTGAA Reverse GGCTGAATACCTTCCCAAATA SOX2 Forward ATGGGTTCGGTGGTCAAGTC Reverse CTGATCATGTCCCGGAGGTC LIN28 Forward GTTCGGCTTCCTGTCCAT Reverse CTGCCTCACCCTCCTTCA KLF4 Forward TTCCCATCTCAAGGCACAC Reverse GGTCGCATTTTTGGCACT PAX6 Forward GTGTCCAACGGATGTGTGAG Reverse CTAGCCAGGTTGCGAAGAAC BRACHYURY Forward AATTGGTCCAGCCTTGGAAT Reverse CGTTGCTCACAGACCACA SOX17 Forward CGCACGGAATTTGAACAGTA Reverse GGATCAGGGACCTGTCACAC HLA-A Forward AGATACACCTGCCATGTGCAGC Reverse GATCACAGCTCCAAGGAGAACC HLA-B Forward CTGCTGTGATGTGTAGGAGGAAG Reverse GCTGTGAGAGACACATCAGAGC HLA-C Forward GGAGACACAGAAGTACAAGCGC Reverse ACATCCTCTGGAGGGTGTGAGA HLA-DRA Forward AGCTGTGGACAAAGCCAACCTG Reverse CTCTCAGTTCCACAGGGCTGTT Sanger sequencing Following gDNA extraction from iPSCs, PCR and Sanger sequencing were performed using the primers listed in Table 2 , 3 , 4 of the supplementary Table. Table 2 Primer sequence for Sanger sequencing (human leukocyte antigen [ HLA ]- A ) Primer name Sequence PCR product PCR Primer G0002-HLA-A-947-F GGAGGGAAACCGCCTCTGC 947bp PCR Primer G0002-HLA-A-947- R GGAGATCTACAGGCGATCAGGG Sequencing primer G0002-HLA-A-Seq-F TCTTCACATCCGTGTCCCG Sequencing Primer G0002-Seq-R ACTTGCGCTTGGTGATCTGA Table 3 Primer sequence for Sanger sequencing (human leukocyte antigen [ HLA ]- B ) Primer name Sequence PCR product Exon 2 PCR Primer G0002-HLA-B-exon2-F ACTTGTGTCGGGTCCTTCTTC 714bp PCR Primer G0002-HLA-B-exon2-R CTCGGACCCGGAGACTCG Sequencing primer G0002-HLA-B-Seq-F TCAGAGTCTCCTCAGACGCC Exon 3 PCR Primer G0002-HLA-B-exon3-F GGCTACTACAACCAGAGCGAG 822bp PCR Primer G0002-HLA-B-exon3-R GAAAAGTCACGGTTCCCAAGG Sequencing primer G0002-HLA-B-exon3- Seq-F GTCGCCCCGAGTCTCCG Sequencing primer G0002-HLA-B-exon3- Seq-R GAAAAGTCACGGTTCCCAAGG Table 4 Primer sequence for Sanger sequencing (human leukocyte antigen [ HLA ]- DRA ) Primer name Sequence product size Exon 2 PCR Primer G0002-HLA-DRA-Exon2-F GCCCGGGTAAAGAAAGTGAGAG 754bp PCR Primer G0002-HLA-DRA-Exon2-R GAATTTGGGGCTTGTTAATGGC Sequencing primer G0002-HLA-DRA-exon2- Seq-F ACTCTGGGTTCTTTAGCCCTC Sequencing primer G0002-HLA-DRA-exon2- Seq-R GTTGGCCAATGCACCTTGAG Exon 3 PCR Primer G0002-HLA-DRA-exon 3-F GGGGGTGCTGTCAGAGATTG 748bp PCR Primer G0002-HLA-DRA-exon3-R GGGAAATAAGGCAGAGTACATGGT Sequencing primer G0002-HLA-DRA-exon3- Seq-F CGTTTGTACCACAATTGAGCATGG Sequencing primer G0002-HLA-DRA-exon3- Seq-R CACCGAGTTTCACACAAGCATC Table 5 Variants associated with genome editing detected from whole-genome sequencing (WGS) data of clones A7 and B2 Clone Structural variant Detail of variant type Size of variant (bp) Position (bp) on chromosome Related gene A7 Deletion c.170_197del (p.Phe57SerfsTer11) 28 bp Chr6:29,942,853- 29,942,880 HLA-A B2 Deletion c.165_198del (p.Gln56ArgfsTer10) 34 bp Chr6:29,942,847- 29,942,880 HLA-A B2 Deletion CNV loss 636,211 bp Chr2:137,427,785- 138,063,995 THSD7B ~ HNMT B2 Deletion CNV loss 1,085,752 bp Chr6:31,356,818- 32,442,567 HLA-B ~ HLA-DRA *fs, frame-shift; Ter, termination Table 6 Detection of somatic variants from whole-genome sequencing (WGS) data Variants No. of SNV No. of InDel YiP3: Donor vs WT WT vs A7 WT vs B2 YiP3: Donor vs WT WT vs A7 WT vs B2 Variant type (total no. of variant) 90 18 21 89 22 26 Introns 78 17 18 78 17 20 5'-/3'-UTRs 11 1 3 11 3 4 Coding exons 1 0 0 0 2 2 Synonymous variants 0 0 0 0 0 0 Variant related to functional effects 1 0 0 0 2 2 Missense (+ start lost, stop lost) 1 0 0 0 0 0 Frame-shift 0 0 0 0 2 2 In-frame 0 0 0 0 0 0 Nonsense 0 0 0 0 0 0 Splice site 0 0 0 0 0 0 Variant annotation (total no. of variant) 0 0 0 0 0 0 PolyPhen2/SIFT 0 0 0 0 0 0 ClinVar mutation 0 0 0 0 0 0 Mutation in COSMIC Tier 1 gene 0 0 0 0 0 0 *WT, Passage 15 of YiP3 Immunofluorescence (IF) assay Detailed methods and antibodies used are provided in the supplementary methods. Western blotting Detailed methods and antibodies used for immunoblotting are described in the supplementary methods. In vitro immunogenicity assay An in vitro immunogenicity assay was performed to assess the CD4 + T cell response. Detailed methods are described in the supplementary methods. Assessment of genetic stability Copy number variation (CNV) analysis The genomic DNAs of YiP3 iPSC (wild-type) and HLA-triple KO clones (A7 and B2) were genotyped using the CytoScan-HD array (Thermo Fisher Scientific, Inc.), following the manufacturer’s protocol. Data analysis was conducted using the Chromosome Analysis Suite (ChAS) (version 4.4.0.63; Thermo Fisher Scientific, Inc.). Detailed methods are described in the supplementary methods. Whole-genome sequencing (WGS) and bioinformatic analysis Sequencing libraries of YiP3, A7, and B2 were prepared from input DNA (1 µg) using a TruSeq DNA sample prep kit (Illumina, Inc.), following the manufacturer’s protocols. These libraries underwent paired-end sequencing using a 150 bp read length on the Illumina NovaSeq 6000 platform (Illumina, Inc.). Detailed methods are described in the supplementary methods. RNA-seq and bioinformatic analysis cDNA libraries were prepared from the total RNA (1 µg) of each sample using the TruSeq Stranded mRNA sample prep kit (Illumina, Inc.), following the manufacturer’s protocols. Following qPCR validation, libraries underwent paired-end sequencing with a 150 bp read length on the Illumina NovaSeq 6000 platform (Illumina, Inc.). Detailed methods are described in the supplementary methods. Statistical analysis Statistical analyses were conducted using the GraphPad Prism software (v. 5.01; GraphPad, San Diego, CA, USA). Statistical significance was assessed using a two-way analysis of variance (ANOVA) and is expressed as follows: *, p < 0.05; **, p < 0.01; ***, and p < 0.001. Results Design of triple HLA gene KO iPSCs To generate hypoimmunogenic iPSCs without immune rejection, we used YiP3 PBMC-derived iPSCs with heterozygous alleles for the HLA genes on chromosome 6. The YiP3 line carried the following alleles: HLA-A 11:01:01:01 and HLA-A 29:01:01:01, HLA-B 13:02:01:01 and HLA-B 58:01:01:01, HLA-C 03:02:02 and HLA-C 02:02:02, and HLA-DRA 01:02:01 and HLA-DRA 01:01:02. Our strategy aimed to KO HLA-A and HLA-B , which represent polymorphisms in class I of the HLA locus, using CRISPR/Cas9, and KO HLA-DRA to prevent the expression of HLA-DR , which represents polymorphism in class II, while leaving HLA-C , which has a minor polymorphism (Fig. 1 a, b). The CRISPR/Cas9 system was used for gene KO. For each gene, two guide RNAs (gRNAs) were designed to target regions excluding heterogeneous regions within the HLA-A gene, where a protospacer adjacent motif (PAM) site (NGG) existed and may act biallelically on a 20 bp sequence (Supplementary Fig. 1a-c). For example, using immuno polymorphism database-international immunogenetics information system (IPD-IMGT)/HLA database 42 , each allele was aligned We designed a gRNA (G0002-HLA-A-g1, ACAGCGACGCCGCGAGCCAG, PAM:AGG) targeting codons 37–43 within Exon 2 for HLA-A . We designed a gRNA (G0002-HLA-B-g1, GCTGTCGAACCTCACGAACT, PAM:GGG) targeting codons 31–38 within Exon 2 for HLA-B and a gRNA (G0002-HLA-DRA-g2, TGGCAAAGAAGGAGACGGTC, PAM:TGG) targeting codons 36–42 within Exon 2 for HLA-DRA (Fig. 1 c, d, e). Assessment of designed gRNA The efficiency of CRISPR/Cas9 guide RNAs (gRNAs) designed for the HLA-A , HLA-B , and HLA-DRA genes was assessed by electroporating bulk iPSCs with each gRNA and measuring the transfection efficiency (Fig. 2 a). Sanger sequencing and inference of CRISPR edits (ICE) analysis of the transfected iPSC pool revealed that, for HLA-A gRNA, G0002-HLA-A-g1 and G0002-HLA-A-g2 demonstrated 91 and 47% efficiency, respectively. Therefore, G0002-HLA-A-g1 was selected as the final gRNA. For HLA-B gRNA, G0002-HLA-B-g1 and G0002-HLA-B-g2 demonstrated 78 and 0% efficiency, respectively, indicating a lack of match. Therefore, G0002- HLA-B -g1 was selected as the final gRNA. For HLA-DRA , G0002-HLA-DRA-g1 and G0002-HLA-DRA-g2 demonstrated 99 and 86% efficiency, respectively. However, considering that the HLA-DR polymorphism predominantly occurs within Exon 2, G0002-HLA-DRA-g1, targeting this region, was selected as the final gRNA (Fig. 2 b, c, d). Confirmation of triple HLA gene KO iPSCs To obtain engineered YiP3 cells with triple HLA gene KO, single clones were obtained through electroporation-mediated transfection using selected gRNAs that target the HLA-A , HLA-B , and HLA-DRA genes (Fig. 2 e). To establish the concentration conditions for each gRNA for transfection, 40 and 80 µg of each gRNA were used to form the RNP complex. The efficiency of KO score for each gene, determined through ICE analysis, was 53, 37, 44, 58, 45, and 56%. Subsequently, transfection was performed using 80 µg of each gRNA to generate the RNP complex (Supplementary Fig. 2a). Single-cell cloning was conducted on the transfected iPSCs, followed by EP pool analysis and genotyping using next-generation sequencing (NGS). Subsequently, 48 clones were collected by seeding them into a 96-well plate, and each clone was screened and genotyped using Sanger sequencing. Six potential triple-KO clones were selected and further assessed through confirmatory sequencing and/or NGS (Supplementary Fig. 2b). Clone B4 had mixed alleles in the HLA-B region, whereas clone C6 had unresolved issues in the HLA-A region and was excluded from further assays (Supplementary Fig. 3b). Genotyping results for the triple-KO clones underwent further sequencing verification for final confirmation. Clone A7 exhibited homozygosity with a 1-bp insertion, 28-bp deletion, and 1-bp deletion in the HLA-A , HLA-B , and HLA-DRA regions, respectively. Clone B2 exhibited homozygosity with a 1-bp insertion, 34-bp deletion, and 2-bp deletion in the HLA-A , HLA-B , and HLA-DRA regions, respectively (Fig. 2 f, Supplementary Fig. 2b). Additionally, clones B3 and B11 demonstrated incomplete HLA-A with a 1-bp insertion and 1-bp deletion near g1 (Supplementary Fig. 2b, c). Therefore, based on the genotyping results, clones A7 and B2 were selected as strong candidates for the triple HLA gene KO, and further comparative analysis was conducted along with clones B3 and B11 through additional assays. Engineered triple-KO iPSCs retain the pluripotency To assess the pluripotency, quality testing was conducted on the triple-KO iPSC clones in comparison to the control YiP3. Morphologically, clones A7 and B2 exhibited colony formation (Fig. 3 a), and positive staining for alkaline phosphatase (AP) confirmed their undifferentiated state (Fig. 3 b). At the mRNA level, the expression of pluripotency markers, such as octamer-binding transcription factor 4 ( OCT4 ), SRY (sex-determining region Y)-box 2 ( SOX2 ), Krüppel-like factor 4 ( KLF4 ), Lin-28 homolog A ( LIN28 ), and Nanog homeobox ( NANOG ) was confirmed, whereas the endoderm differentiation marker ( SOX17 ), mesoderm differentiation marker ( BRACHYURY ), and ectoderm marker (paired box 6 [ PAX6 ]) were not expressed (Fig. 3 c). Similar patterns were observed in clones B3 and B11 (Supplementary Fig. 3a, b, c). Subsequently, to compare the expression of pluripotency markers at the protein level using pre-engineered YiP3, flow cytometry was performed for OCT4, stage-specific embryonic antigen 4 (SSEA4), NANOG, tumor rejection antigen 1–60 (TRA-1-60), and the negative marker (CD34). The results demonstrated that clones A7 and B2 expressed OCT4, SSEA4, NANOG, and TRA-1-60 at levels exceeding 95% in cell populations, comparable to YiP3 (Fig. 3 d). Clone B11 exhibited expression levels exceeding 99% when compared to YiP3, whereas clone B3 exhibited a lower expression of NANOG at 86% (Supplementary Fig. 3d). To assess the ability of each clone to differentiate into the three germ layers (endoderm, mesoderm, and ectoderm), lineage differentiation was induced, and immunofluorescence staining for SOX17, BRACHYURY, and paired box 6 (PAX6) markers was performed. Expression of these markers was confirmed in all clones, indicating that engineered iPSC clones A7 and B2 retained their differentiation capacity similar to that of YiP3 without any alterations (Fig. 3 e). Similar results were observed for clones B3 and B11, indicating no effect on the differentiation of three germ layers (Supplementary Fig. 3f). In conclusion, among the selected triple-KO clones, clones A7 and B2 exhibited normal iPSC properties regarding pluripotency and the differentiation ability of three germ layers, similar to YiP3. However, clone B3 was excluded because of its significantly lower NANOG expression at the protein level. Genetic stability of HLA -triple KO iPSCs in clones A7 and B2 The genetic stability of HLA -triple KO clones A7 and B2 was assessed by investigating karyotypes, CNVs, CRISPR/Cas9 off-targets, and expression alterations of cell differentiation potential-associated genes. Normal karyotypes were identified for clones A7 and B2 (Fig. 5 a), whereas clone B11 exhibited a chromosomal abnormality with a deletion on chromosome 6p (Supplementary Fig. 3e), thereby precluding its consideration as an HLA -triple KO iPSC candidate clone. No CNV was identified in clone A7 through SNP genotyping using the CytoScan HD array (Fig. 5 b). However, copy number (CN) losses at two loci, 2q22.1 (138.17–138.82 Mbp on chromosome 2) and 6p21.33–6p21.32 (31.32–32.41 Mbp on chromosome 6), were identified (Fig. 5 b). Specifically, CN loss at 6p21.33 and 6p21.32 indicates the genomic instability of HLA-B and HLA-DRA in clone B2 (Fig. 5 b). After predicting CRISPR/Cas9 off-targets in the human reference genome using Cas-OFFinder, potential off-target Cas9 activity was detected from WGS data of clones A7 and B2. Among the 21 predicted off-target sites using Cas-OFFinder, none corresponding to off-target sites was observed in the WGS data of clones A7 and B2 (Fig. 5 c). However, four structural variants (SVs) that may be induced through on-target and/or off-target activity were identified: a 28-bp deletion in HLA-A for clone A7, and a 34-bp deletion in HLA-A and two CNV losses for clone B2 (Fig. 5 c). The SVs identified in clones A7 and B2 were observed within coding sequences adjacent to the on-targets for HLA-A and HLA-B KO (Supplementary Table 5), indicating the possibility of additive induction in HLA-A and HLA-B KO. Additionally, somatic mutations, including single nucleotide variants (SNVs) and insertions and/or deletions (InDels), were analyzed from the whole-genome sequence data of A7 and B2 clones by comparing them with YiP3 iPSCs. Somatic coding variants that may cause functional effects were not observed in clones A7 and B2 (Supplementary Table 6). In addition to assessing the genomic stability of the HLA -triple KO clones, we assessed their transcriptome alterations. First, it was confirmed that the KO genes ( HLA-A , HLA-B , and HLA-DRA ) were downregulated in clones A7 and B2 compared to those in YiP3 (Fig. 5 d), indicating the consequences of HLA-A , HLA-B , and HLA-DRA KOs. Second, despite the KO events, a strong correlation in overall gene expression was observed among YiP3, A7, and B2: a Pearson correlation of ≥ 0.99 between YiP3 and A7, and ≥ 0.98 between YiP3 and B2 (Fig. 5 e). This indicates that the genome-wide gene expression pattern of the HLA -triple KO clones A7 and B2 closely resembles that of the wild-type YiP3. Third, we also assessed the potential role of the cell differentiation process through gene set enrichment analysis (GSEA). In contrast to clone A7, genes associated with the development of the three germ layers (endoderm, mesoderm, and ectoderm) in pluripotent stem cells were significantly downregulated in clone B2 (p = 0.000 ~ 0.029) (Fig. 5 f), which was consistent with the low EC differentiation ability in clone B2 (Fig. 7 b). These results indicate the potential genomic instability of clone B2 owing to the downregulation of genes associated with cell development and off-target effects, such as CNV loss. Considering these results, our findings demonstrate that only the HLA -triple KO clone A7 attains genomic stability. Assessment of the HLA expression We assessed the mRNA expression levels of HLA-A , HLA-B , and HLA-DRA in the genetically edited and selected clones (A7 and B2). Real-time PCR analysis revealed a significant reduction in the delta cycle threshold (dCt) values of HLA-A and HLA-B compared to YiP3 (p < 0.01 vs. YiP3), and a reduction in HLA-DRA expression (p < 0.05 vs. YiP3). Normalization using glyceraldehyde 3-phosphate dehydrogenase ( GAPDH ) relative to YiP3 demonstrated a significant reduction in the mRNA levels of HLA-A and HLA-B (p < 0.01 vs. YiP3), alongside a reduction in HLA-DRA expression (p < 0.05 vs. YiP3) (Fig. 4 a). Flow cytometry analysis was conducted to assess whether gene editing and selection targeting HLA-A, B, and DRA in clones A7 and B2 resulted in the absence of HLA-DR protein expression. Without IFN-γ stimulation, YiP3 and clones A7 or B2 iPSCs did not express HLA-A, B, DR, and C (unedited region). Following IFN-γ stimulation for two days, HLA-A, B, and C protein expression increased in YiP3, with HLA-A, B, C, and DR increasing by 99.03, 91.61, 88.35, and 0.04%, respectively (Fig. 4 b). In contrast, under IFN-γ stimulation, the triple-KO clone A7 exhibited a significant reduction in HLA-A (0.07%), HLA-B (0.15%), and HLA-DR (0.02%) protein expression. However, HLA-C protein expression (97.34%) remained unaffected, because it was not within the gene-edited region. Similar results were observed for clone B2 (Fig. 4 b). These results demonstrate selective KO of the targeted HLA-A, B, and DRA regions in YiP3 at the protein level, as confirmed through our analyses. In vitro immunogenicity test To assess whether gene-edited iPSCs exhibit immunogenicity, we conducted co-culture experiments using PBMCs from a donor whose HLA types differed from those of YiP3. We isolated TEM and TCM cells and assessed their proliferation levels (Fig. 4 a). Initially, we selected a donor with HLA types different from those of YiP3 for each allele. Allele 1 carried HLA-A 02:01, HLA-B 15:01, HLA-C 01:02, and HLA-DRB1 11:01, and allele 2 carried HLA-A 02:07, HLA-B 46:01, HLA-C 04:01, and HLA-DRB1 15:02 (Fig. 4 b). Before co-culturing with PBMCs, both YiP3 and clones A7 and B2 were stimulated with IFN-γ for two days. We analyzed the proliferation of activated T cells in response to antigen presentation by antigen-presenting cells within PBMCs that were depleted of T cells. Co-cultures were initiated using PBMCs and carboxyfluorescein succinimidyl ester (CFSE)-labeled CD4 + T cells, to assess the proliferation of CD4 + TCM (CD3 + CD4 + CD45RO + CD62L+) and CD4 + TEM (CD3 + CD4 + CD45RO + CD62L-) cells using flow cytometry. Harvesting PBMCs and CFSE-labeled CD4 + TCM cells seven days after the initiation of co-culture revealed a slight increase in the cell population for YiP3 and clones A7 and B2, with average increases of 4.8, 4.5, and 4.7%, respectively. However, upon restimulation of YiP3 and clones A7 and B2 using IFN-γ-stimulated PBMCs after 14 and 21 days of co-culture, respectively, the proliferation of CFSE-labeled CD4 + TCM cells increased to 12.8% (day 14, mean) and 25.2% (day 21, mean) for YiP3. In contrast, proliferation was reduced to 9.6% (day14, mean) and 19.3% (day 21, mean) for clone A7, which was significantly lower than that of YiP3 (p < 0.05 vs. YiP3). Clone B2 demonstrated a similar trend of increased proliferation, but the reduction was less pronounced compared to that of clone A7, with no significant difference in p-values observed (Fig. 4 c, d). Similar results were observed in CFSE-labeled CD4 + TEM cells. On the 21st day of co-culture, proliferation increased to 22.7% (day 21, mean) for CD4 + TEM cells in response to YiP3 stimulation, while clone A7 exhibited a significantly lower proliferation of 17.1% (day 21, mean) compared to that of YiP3 (p < 0.05 vs. YiP3). Clone B2 did not exhibit significant alterations compared with YiP3 (Fig. 4 c, d). In conclusion, triple-KO clone A7, with edited HLA-A , HLA-B , and HLA-DRA genes, exhibited reduced immunogenicity when co-cultured with PBMCs of different HLA types, indicating its potential for immunological compatibility. Assessment of the HLA protein expression in EC We differentiated clones A7 and B2 into ECs of mesoderm lineage and compared their differentiation capacities. Both YiP3 and clone A7 differentiated into ECs through the hemogenic mesoderm, displaying morphology similar to that of primary ECs. However, we observed a slightly different morphology for clone B2. Flow cytometry analysis of CD31 and VE-cadherin double-positive cells, markers for ECs, revealed percentages of 95.69, 91.9, and 0.36% for YiP3, clone A7, and clone B2, respectively. These results indicated that clone A7, with a differentiation rate of over 90% in ECs, exhibited normal differentiation ability. In contrast, clone B2 exhibited a diminished capacity to differentiate into ECs. Western blot analysis revealed that before IFN-γ stimulation, HLA-A, B, and C were not expressed in ECs derived from YiP3 and clones A7 and B2. However, following IFN-γ stimulation, HLA-A, B, and C were expressed in YiP3, whereas only HLA-C was expressed in clones A7 and B2, which indicated that HLA-A and B were not expressed. This confirmed that clone A7 retained its differentiation capacity into ECs, and under IFN-γ stimulation, HLA-A and B were not expressed, whereas HLA-C, which was not the target of gene editing, was expressed. Discussion In this study, we aimed to generate immune-evasive iPSCs for gene editing using iPSCs with heterogeneous HLA gene types. Using the CRISPR/CAS9 system, we knocked out HLA-A , HLA-B , and HLA-DRA regions. While previous research has focused on editing HLA genes using homozygous or partially homozygous iPSCs, the majority of iPSCs in practical applications are derived from donor somatic cells with heterozygous HLA genes 39 . In this study, we attempted gene editing in PBMC-derived iPSCs with heterogeneous alleles in the HLA region, addressing the technical challenge of editing three genes ( HLA-A , HLA-B , and HLA-DRA ) that can be sliced by a common gRNA. The selected triple-KO clone (clone A7) demonstrated gene knockout at the RNA level and confirmed the absence of HLA-A, B, and DR proteins upon IFN-γ stimulation at the protein level, which was observed through flow cytometry. Additionally, we demonstrated that clone A7 retained pluripotency following gene editing. Moreover, when co-culturing CD4 + T cells obtained from PBMCs, which have different HLA types compared to YiP3, alongside INFγ-stimulated triple KO clone A7, the proliferation of TCM and TEM cells was significantly reduced compared to that of unedited iPSC YiP3. This confirmed the absence of immune evasion in clone A7. Recent research has been focused on generating universal iPSCs by editing HLA genes. Additionally, studies have aimed to edit HLA genes in ESCs 43 and completely eliminate MHC class I genes using β2M KO and MHC class II genes using CIITA KO in iPSCs 44 , 45 . Recent studies have been conducted on selecting 46 and knocking out one HLA gene at a time 37 . In this study, considering the risk of NK cell or macrophage attacks that may occur in cases where all HLA genes are eliminated—we chose to retain minor HLA-C and selected HLA-A and HLA-B for KO, while implementing a strategy to KO HLA-DRA to eliminate HLA-DR protein expression. While previous studies have focused on knocking out HLA-DRB1 , we disrupted the protein structure of HLA-DR by knocking out HLA-DRA gene. To design gRNA for knock out, we used immuno polymorphism database-international immunogenetics information system (IPD-IMGT)/HLA database, which reflects the polymorphism of HLA genes. The validation of gRNA design ensured the selection of common regions shared by both alleles. To assess the KO efficiency of gRNA candidates, we initially performed electroporation followed by Sanger sequencing. One gRNA was selected for each HLA-A , HLA-B , and HLA-DRA gene. To attempt triple KO using the selected gRNAs, we determined the amount of RNP to be transfected and executed the procedure accordingly. Upon confirming the KO efficiency through Sanger sequencing, we obtained clone A7, which exhibited 1-bp insertion, 28-bp deletion, and 1-bp deletion in the HLA-A , HLA-B , and HLA-DRA regions, respectively. To select the final triple KO clone, we initially selected 48 clones and confirmed clone A7 through NGS, pluripotency assays, karyotyping, and WGS 47 . During the clone selection process, clones A7 and B2 emerged as strong candidates based on NGS analysis, with B3 and B11 as secondary options. Because triple-KO iPSCs should retain pluripotency following gene editing, iPSC quality control was conducted. Among the candidate clones, B3 was excluded because of its significantly low NANOG expression in protein analysis following gene editing. In contrast, B11 was disregarded because of abnormal karyotyping results. The candidate clones excluded from the clone selection process displayed normal morphology; however, they exhibited different outcomes compared to those of YiP3 in quality control parameters, such as pluripotency, karyotype, and NGS analysis. To further compare clones A7 and B2, they were differentiated into ECs of a mesoderm lineage. When comparing differentiation rates, clone A7 exhibited a differentiation rate similar to that of the pre-gene-edited YiP3, indicating that the triple KO did not affect differentiation. However, clone B2 exhibited a significantly lower efficiency in EC differentiation, resulting in its exclusion from the final clone selection. HLA protein expression was not observed in iPSCs or differentiated cells. In this study, we assessed HLA expression in iPSCs upon INF-γ stimulation, which marked the first instance of this phenomenon 48 . Flow cytometry results revealed that clones A7 and B2 did not express HLA-A, B, or DR proteins upon INFγ stimulation. HLA-DR exhibited consistently low protein expression in iPSCs, which did not significantly increase upon INF-γ stimulation but was reduced following gene editing. Before INF-γ stimulation, HLA-A and B proteins were not expressed during EC differentiation 41 . However, YiP3 was expressed before gene editing, whereas clones A7 and B2 demonstrated no expression. HLA-C expression was retained throughout the study period. However, HLA-DR and DRA expression was not confirmed upon INF-γ stimulation in differentiated ECs. While HLA-DR protein expression has been documented in ECs 49 , 50 , it was not observed in our differentiated cells. Because of its abundance in immune cells 51 , further assessment is required. To use universal iPSCs as cell therapeutics, it is essential to conduct immunogenicity testing. In this study, we performed in vitro immunogenicity tests instead of mouse models because of the challenges in studying memory T cells owing to interspecies differences 52 , 53 . We used PBMCs from donors with different HLA types from the HLA type of YiP3 before gene editing. CD4 + T cells were labeled using CFSE to assess their proliferation in response to stimulation with YiP3, and clones A7 and B2, which served as antigenic stimuli. T cell activation was initiated using IFN-γ-stimulated iPSCs two days prior, and the proliferation of central memory T cells and effector memory T cells was examined. We observed reduced proliferation levels in clone A7 compared to those in YiP3, indicating that clone A7 failed to induce T cell proliferation because of the absence of HLA-A , HLA-B , and HLA-DRA expression. iPSCs have the potential to differentiate into various cell types, including ECs, neurons, cardiac cells, and immune cells 54 . Because of their ability to proliferate indefinitely and differentiate into all three germ layers, iPSCs exhibit immense potential for cell therapies. Clinical trials involving the transplantation of allogeneic iPSCs have primarily focused on immune-privileged sites, such as the eye and cartilage 55 – 57 . However, for transplantation into tissues associated with immune responses, such as the cardiovascular system, immune cells, and kidneys, it is crucial to use hypoimmunogenic iPSCs with immunoevasive properties as the source cells 58 . This study demonstrates the selection of clones that selectively KO HLA-A , HLA-B , and HLA-DRA genes through various quality control measures, indicating their suitability for therapeutic applications. These HLA -KO iPSC clones hold promise for cell therapy and the development of iPSC-derived organoid therapies. While currently used for research purposes, advancing these iPSCs to clinical-grade status involves production within good manufacturing practice (GMP) facilities and adherence to regulatory science standards 59 – 61 . With such advancements, it is conceivable that clinical-grade universal iPSCs may be developed for research and development purposes. We generated hypoimmunogenic iPSC clone A7 by knocking out the HLA-A , HLA-B , and HLA-DRA genes in PBMC-derived iPSCs with heterozygous HLA gene types. We confirmed that this clone retains the pluripotency of iPSCs and confirmed its genetic stability using various sequencing methods. Our results establish a strategy and quality standards for selectively using triple-KO iPSCs lacking HLA-A , HLA-B , and HLA-DRA as universally accepted iPSCs devoid of immunogenicity. Our findings offer significant criteria and methodologies for the future development of clinical-grade universal iPSCs. Declarations Acknowledgments Not applicable. Author contributions JK designed and performed the experiments, analyzed the results, and wrote the manuscript. YN analyzed the results, and wrote the manuscript. DJ performed the experiments and data analysis. YC performed experiments and data analysis. SC performed informatics data analysis. CH performed informatics data analysis. HJ generated iPSC. NP generated iPSC. YS performed statistical analysis. YAR helped analyze the results and Correspondence the manuscript JHJ helped analyze the results and Correspondence the manuscript. All authors read and approved the final draft of the manuscript. Conflict of interests The authors declare that they have no competing Funding This research was supported by a grant of Tech Investor Program for Scale-up, funded and Korea Technology and Information Promotion Agency for SMEs through Ministry of SMEs and Startups (grant number: RS-2023-00302955), as well as a grant of the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health & Welfare, Republic of Korea (grant number: HI23C1234). Additionally, this work was supported by the Technology Innovation Program (or Industrial Strategic Technology Development Program) funded By the Ministry of Trade, Industry & Energy (MOTIE, Korea) (grant number:20024297), and supported by the Ministry of Education of the Republic of Korea and the National Research Foundation of Korea (grant number: NRF-2023M3A9E4009811) References Thanaskody, K. et al. MSCs vs. iPSCs: Potential in therapeutic applications. Front. Cell Dev. Biol. 10, 1005926 (2022). Takahashi, K. et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872 (2007). Bellin, M., Marchetto, M.C., Gage, F.H. & Mummery, C.L. Induced pluripotent stem cells: the new patient? Nat. Rev. Mol. Cell Biol. 13, 713–726 (2012). Liu, X., Li, W., Fu, X. & Xu, Y. The immunogenicity and immune tolerance of pluripotent stem cell derivatives. Front. Immunol. 8, 645 (2017). Montgomery, R.A., Tatapudi, V.S., Leffell, M.S. & Zachary, A.A. HLA in transplantation. Nat. Rev. Nephrol. 14, 558–570 (2018). Duneton, C., Winterberg, P.D. & Ford, M.L. Activation and regulation of alloreactive T cell immunity in solid organ transplantation. Nat. Rev. Nephrol. 18, 663–676 (2022). Petrus-Reurer, S. et al. Immunological considerations and challenges for regenerative cellular therapies. Commun. Biol. 4, 798 (2021). Nakamura, T., Shirouzu, T., Nakata, K., Yoshimura, N. & Ushigome, H. The role of major histocompatibility complex in organ transplantation-donor specific anti-major histocompatibility complex antibodies analysis goes to the next stage. Int. J. Mol. Sci. 20, 4544 (2019). Radwan, J., Babik, W., Kaufman, J., Lenz, T.L. & Winternitz, J. Advances in the evolutionary understanding of MHC polymorphism. Trends. Genet. 36, 298–311 (2020). Roche, P.A. & Furuta, K. The ins and outs of MHC class II-mediated antigen processing and presentation. Nat. Rev. Immunol. 15, 203–216 (2015). Deuse, T. et al. Hypoimmunogenic derivatives of induced pluripotent stem cells evade immune rejection in fully immunocompetent allogeneic recipients. Nat. Biotechnol. 37, 252–258 (2019). Bray, R.A. et al. National marrow donor program HLA matching guidelines for unrelated adult donor hematopoietic cell transplants. Biol. Blood Marrow Transplant. 14, 45–53 (2008). Sheldon, S. & Poulton, K. HLA typing and its influence on organ transplantation. Transplant. Immunol.: Methods and protocols 333, 157–174 (2006). Mandai, M. et al. Autologous induced stem-cell-derived retinal cells for macular degeneration. N. Engl. J. Med. 376, 1038–1046 (2017). Schweitzer, J.S. et al. Personalized iPSC-derived dopamine progenitor cells for Parkinson's disease. N. Engl. J. Med. 382, 1926–1932 (2020). Rim, Y.A. et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. J. Tissue Eng. Regen. Med. 12, e1531-e1536 (2018). Okita, K. et al. A more efficient method to generate integration-free human iPS cells. Nat. Methods 8, 409–412 (2011). Ran, F.A. et al. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281–2308 (2013). Lu, Y. et al. Safety and feasibility of CRISPR-edited T cells in patients with refractory non-small-cell lung cancer. Nat. Med. 26, 732–740 (2020). Ottaviano, G. et al. Phase 1 clinical trial of CRISPR-engineered CAR19 universal T cells for treatment of children with refractory B cell leukemia. Sci. Transl. Med. 14, eabq3010 (2022). Trionfini, P. et al. Hypoimmunogenic human pluripotent stem cells as a powerful tool for lLiver regenerative medicine. Int. J. Mol. Sci. 24, 11810 (2023). Börger, A.K. et al. Generation of HLA-universal iPSC-derived megakaryocytes and platelets for survival under refractoriness conditions. Mol. Med. 22, 274–285 (2016). Deuse, T. et al. Hypoimmune induced pluripotent stem cell-derived cell therapeutics treat cardiovascular and pulmonary diseases in immunocompetent allogeneic mice. Proc. Natl. Acad. Sci. 118, e20220911 (2021). Kitano, Y. et al. Generation of hypoimmunogenic induced pluripotent stem cells by CRISPR-Cas9 system and detailed evaluation for clinical application. Mol. Ther. Methods Clin. Dev. 26, 15–25 (2022). Geng, B.C. et al. A simple, quick, and efficient CRISPR/Cas9 genome editing method for human induced pluripotent stem cells. Acta. Pharmacol. Sin. 41, 1427–1432 (2020). Thongsin, N. & Wattanapanitch, M. Generation of B2M bi-allelic knockout human induced pluripotent stem cells (MUSIi001-A-1) using a CRISPR/Cas9 system. Stem Cell Res. 56, 102551 (2021). Suzuki, D. et al. iPSC-derived platelets depleted of HLA class I are inert to anti-HLA class I and natural killer cell immunity. Stem Cell Rep. 14, 49–59 (2020). Song, C. et al. Generation of individualized immunocompatible endothelial cells from HLA-I-matched human pluripotent stem cells. Stem Cell Res. Ther. 13, 48 (2022). Mattapally, S. et al. Human leukocyte antigen class I and II knockout human induced pluripotent stem cell-derived cells: universal donor for cell therapy. J. Am. Heart Assoc. 7, e010239 (2018). Wang, B. et al. Generation of hypoimmunogenic T cells from genetically engineered allogeneic human induced pluripotent stem cells. Nat. Biomed. Eng. 5, 429–440 (2021). Lee, N. et al. HLA-E is a major ligand for the natural killer inhibitory receptor CD94/NKG2A. Proc. Natl. Acad. Sci. 95, 5199–5204 (1998). Ferreira, L.M.R., Meissner, T.B., Tilburgs, T. & Strominger, J.L. HLA-G: at the interface of maternal-fetal tolerance. Trends. Immunol. 38, 272–286 (2017). Deuse, T. et al. Hypoimmunogenic derivatives of induced pluripotent stem cells evade immune rejection in fully immunocompetent allogeneic recipients. Nat. Biotechnol. 37, 252–258 (2019). Deuse, T. et al. The SIRPα-CD47 immune checkpoint in NK cells. J. Exp. Med. 218, e20200839 (2021). Flahou, C., Morishima, T., Takizawa, H. & Sugimoto, N. Fit-for-all iPSC-derived cell therapies and their evaluation in humanized mice with NK cell immunity. Front. Immunol. 12, 662360 (2021). Zhao, W. et al. Strategies for genetically engineering hypoimmunogenic universal pluripotent stem cells. iScience. 23, 101162 (2020). Xu, H. et al. Targeted disruption of HLA genes via CRISPR-Cas9 generates iPSCs with enhanced immune compatibility. Cell Stem Cell 24, 566–578 (2019). Han, X. et al. Generation of hypoimmunogenic human pluripotent stem cells. Proc. Natl. Acad. Sci. 116, 10441–10446 (2019). Jang, Y. et al. Development of immunocompatible pluripotent stem cells via CRISPR-based human leukocyte antigen engineering. Exp. Mol. Med. 51, 1–11 (2019). Kim, A. et al. Off-the-shelf, immune-compatible human embryonic stem cells generated via CRISPR-mediated genome editing. Stem Cell Rev. Rep. 17, 1053–1067 (2021). Palpant, N.J. et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nat. Protoc. 12, 15–31 (2017). Robinson, J. et al. The IPD and IMGT/HLA database: allele variant databases. Nucleic Acids Res. 43, D423-431 (2015). Meissner, T.B., Schulze, H.S. & Dale, S.M. Immune editing: overcoming immune barriers in stem cell transplantation. Curr. Stem Cell Rep. 8, 206–218 (2022). Koga, K., Wang, B. & Kaneko, S. Current status and future perspectives of HLA-edited induced pluripotent stem cells. Inflamm. Regen. 40, 23 (2020). Wang, X. et al. Diminished expression of major histocompatibility complex facilitates the use of human induced pluripotent stem cells in monkey. Stem Cell Res. Ther. 11, 1–14 (2020). Parent, A.V. et al. Selective deletion of human leukocyte antigens protects stem cell-derived islets from immune rejection. Cell Rep. 36, 109538 (2021). Jo, H.Y. et al. Development of genetic quality tests for good manufacturing practice-compliant induced pluripotent stem cells and their derivatives. Sci. Rep. 10, 3939 (2020). Keskinen, P., Ronni, T., Matikainen, S., Lehtonen, A. & Julkunen, I. Regulation of HLA class I and II expression by interferons and influenza A virus in human peripheral blood mononuclear cells. Immunol. 91, 421–429 (1997). Abrahimi, P. et al. Efficient gene disruption in cultured primary human endothelial cells by CRISPR/Cas9. Circ. Res. 117, 121–128 (2015). Maenaka, A. et al. Interferon-γ-induced HLA Class II expression on endothelial cells is decreased by inhibition of mTOR and HMG-CoA reductase. FEBS. Open Bio. 10, 927–936 (2020). Couture, A. et al. HLA-Class II artificial antigen presenting cells in CD4(+) T cell-based immunotherapy. Front. Immunol. 10, 447508 (2019). Pepper, M. & Jenkins, M.K. Origins of CD4(+) effector and central memory T cells. Nat. Immunol. 12, 467–471 (2011). Wood, K.J., Bushell, A. & Hester, J. Regulatory immune cells in transplantation. Nat. Rev. Immunol. 12, 417–430 (2012). Shi, Y., Inoue, H., Wu, J.C. & Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nat. Rev. Drug Discov. 16, 115–130 (2017). Sugita, S. et al. Successful transplantation of retinal pigment epithelial cells from MHC homozygote iPSCs in MHC-matched models. Stem Cell Rep. 7, 635–648 (2016). Abe, K. et al. Engraftment of allogeneic iPS cell-derived cartilage organoid in a primate model of articular cartilage defect. Nat. Commun. 14, 804 (2023). Deinsberger, J., Reisinger, D. & Weber, B. Global trends in clinical trials involving pluripotent stem cells: a systematic multi-database analysis. NPJ Regen. Med. 5, 15 (2020). Otsuka, R., Wada, H., Murata, T. & Seino, K.I. Immune reaction and regulation in transplantation based on pluripotent stem cell technology. Inflamm. Regen. 40, 1–9 (2020). McKenna, D.H. & Perlingeiro, R.C.R. Development of allogeneic iPS cell-based therapy: from bench to bedside. EMBO Mol. Med. 15, e15315 (2023). Neofytou, E., O'Brien, C.G., Couture, L.A. & Wu, J.C. Hurdles to clinical translation of human induced pluripotent stem cells. J. clin. Invest. 125, 2551–2557 (2015). Dashnau, J.L. et al. A risk-based approach for cell line development, manufacturing and characterization of genetically engineered, induced pluripotent stem cell-derived allogeneic cell therapies. Cytother. 25, 1–13 (2023). Additional Declarations (Not answered) Supplementary Files SupplementaryMateiralandMethods.docx Supplementary_Material and Methods SupplementaryTable.docx Supplementary_Table SupplementaryInformation.docx Supplementary Information Cite Share Download PDF Status: Published Journal Publication published 14 Mar, 2025 Read the published version in Experimental & Molecular Medicine → Version 1 posted Editorial decision: revise 22 Jul, 2024 Review # 2 received at journal 03 Jul, 2024 Review # 1 received at journal 02 Jul, 2024 Reviewer # 2 agreed at journal 21 Jun, 2024 Reviewer # 1 agreed at journal 18 Jun, 2024 Reviewers invited by journal 17 Jun, 2024 Submission checks completed at journal 02 May, 2024 First submitted to journal 02 May, 2024 Unknown event 01 May, 2024 Editor assigned by journal 01 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4354435","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":315237088,"identity":"e94aa187-dfd5-4aef-9279-988ff97b6315","order_by":0,"name":"Ji Hyeon Ju","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIiWNgGAWjYBACxgaGhAMfGCTA7AMPiNVycAZEC8OBBGJtYuaBMojTwjwj4eFh2zaLPPn2wweAWuzkdBsIOWxGQsLh3DaJYoMzaQlALcnGZgeI1JK4QYLHAKjlQOI2orRYArXMn8H/gQQtjEAtDTd4GIjU0vMg4WDPObBfgA4zIMIvhu05yR9+lNWBQuzhgw8VdnKEtTTwJDAwsjEkQLgGBJSDgDwDO9DUPzAto2AUjIJRMAqwAACbZEqVQ4UbVwAAAABJRU5ErkJggg==","orcid":"","institution":"YipScell","correspondingAuthor":true,"prefix":"","firstName":"Ji","middleName":"Hyeon","lastName":"Ju","suffix":""},{"id":315237089,"identity":"07544682-dc15-4d59-9c31-997aeaa2aacf","order_by":1,"name":"Juryun Kim","email":"","orcid":"","institution":"YiPSCELL","correspondingAuthor":false,"prefix":"","firstName":"Juryun","middleName":"","lastName":"Kim","suffix":""},{"id":315237090,"identity":"7a4546cc-41cd-449e-b3a3-b571a8389526","order_by":2,"name":"Yoojun Nam","email":"","orcid":"","institution":"YiPSCELL, Inc.,","correspondingAuthor":false,"prefix":"","firstName":"Yoojun","middleName":"","lastName":"Nam","suffix":""},{"id":315237091,"identity":"f48b6c03-de4f-43a8-9405-540a18852d30","order_by":3,"name":"Doyeong Jeon","email":"","orcid":"","institution":"YiPSCELL","correspondingAuthor":false,"prefix":"","firstName":"Doyeong","middleName":"","lastName":"Jeon","suffix":""},{"id":315237092,"identity":"b3e203e9-1ebc-4fb8-8f1f-91317f2bbf91","order_by":4,"name":"Yujin Choi","email":"","orcid":"","institution":"YiPSCELL","correspondingAuthor":false,"prefix":"","firstName":"Yujin","middleName":"","lastName":"Choi","suffix":""},{"id":315237093,"identity":"da44313e-64d8-4ba6-aaa3-918adc2e0d4a","order_by":5,"name":"SeonJu Choi","email":"","orcid":"","institution":"YiPSCELL","correspondingAuthor":false,"prefix":"","firstName":"SeonJu","middleName":"","lastName":"Choi","suffix":""},{"id":315237094,"identity":"2f4d7568-c406-4bff-92fd-2c6c54299156","order_by":6,"name":"Chang Pyo Hong","email":"","orcid":"","institution":"YipScell","correspondingAuthor":false,"prefix":"","firstName":"Chang","middleName":"Pyo","lastName":"Hong","suffix":""},{"id":315237095,"identity":"7266b845-a1a8-49c5-b388-42803fbaae57","order_by":7,"name":"Hyerin Jung","email":"","orcid":"","institution":"YiPSCELL","correspondingAuthor":false,"prefix":"","firstName":"Hyerin","middleName":"","lastName":"Jung","suffix":""},{"id":315237096,"identity":"e3f10dda-e33b-493b-9917-7c17695db225","order_by":8,"name":"Narae Park","email":"","orcid":"","institution":"YiPSCELL","correspondingAuthor":false,"prefix":"","firstName":"Narae","middleName":"","lastName":"Park","suffix":""},{"id":315237097,"identity":"2680d19a-5171-4d49-98bd-4c530c95a191","order_by":9,"name":"Yeowon Sohn","email":"","orcid":"","institution":"Sungkyunkwan University","correspondingAuthor":false,"prefix":"","firstName":"Yeowon","middleName":"","lastName":"Sohn","suffix":""},{"id":315237098,"identity":"1063a534-e732-4b8e-87ee-c907d58c8574","order_by":10,"name":"Yeri Alice Rim","email":"","orcid":"","institution":"Seoul St. Mary’s Hospital, The Catholic University of Korea","correspondingAuthor":false,"prefix":"","firstName":"Yeri","middleName":"Alice","lastName":"Rim","suffix":""}],"badges":[],"createdAt":"2024-05-01 13:11:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4354435/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4354435/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s12276-025-01422-3","type":"published","date":"2025-03-14T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":59603797,"identity":"900a843a-3999-4f92-8abf-9b15a3e42b87","added_by":"auto","created_at":"2024-07-03 17:58:21","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2375607,"visible":true,"origin":"","legend":"\u003cp\u003eDesign of triple human leukocyte antigen (\u003cem\u003eHLA\u003c/em\u003e) gene knockout (KO) induced pluripotent stem cells (iPSCs)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003e Scheme of triple \u003cem\u003eHLA\u003c/em\u003e gene Knockout (KO) iPSC.\u003cstrong\u003e b.\u003c/strong\u003e Strategy scheme of HLA type of YiP3 iPSC. \u003cstrong\u003ec, d, e.\u003c/strong\u003e Exon 2 nucleotide sequence of \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e for YiP3 iPSC displayed in codons. Blue part in sequence: guide RNA (gRNA) region, green part: protospacer adjacent motif (PAM) site. The nucleotide sequence is displayed using sequence alignment tool in the immune polymorphism database-international immunogenetics information system/human leukocyte antigen (IPD-IMGT/HLA) database.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4354435/v1/c675b9cbb28575ac25363a00.jpg"},{"id":59603799,"identity":"e93da5ae-7848-404a-85b6-4ef75aa163b7","added_by":"auto","created_at":"2024-07-03 17:58:21","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2859596,"visible":true,"origin":"","legend":"\u003cp\u003eguide RNA (gRNA) assessment in induced pluripotent stem cells (iPSCs) and confirmation of triple human leukocyte antigen (\u003cem\u003eHLA)\u003c/em\u003e gene knockout (KO) iPSCs\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003e Scheme of gRNA assessment in iPSCs. This illustration is created using BioRender. \u003cstrong\u003eb.\u003c/strong\u003e Sanger sequence images and inference of CRISPR edits (ICE) analysis demonstrating the efficiency of two candidate gRNA per \u003cem\u003eHLA-A\u003c/em\u003egene. \u003cstrong\u003ec.\u003c/strong\u003e Sanger sequence images and ICE analysis demonstrating the efficiency of two candidate gRNA per \u003cem\u003eHLA-B\u003c/em\u003e gene. \u003cstrong\u003ed.\u003c/strong\u003e Sanger sequence images and ICE analysis demonstrating the efficiency of two candidate gRNA per \u003cem\u003eHLA-DRA\u003c/em\u003e gene. \u003cstrong\u003ee. \u003c/strong\u003eA schematic representation of the single clone picking process for iPSCs with \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e knocked out. This illustration is created using BioRender.\u003cstrong\u003e f.\u003c/strong\u003e The Sanger sequence images demonstrate the KO of the \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e \u0026nbsp;genes in the YiP3 iPSC line. A7 and B2 represent KO clones, with each clone demonstrating the KO of the \u003cem\u003eHLA-A\u003c/em\u003eand \u003cem\u003eHLA-B\u003c/em\u003e genes, respectively, while the \u003cem\u003eHLA-DRA\u003c/em\u003e gene is also knocked out.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4354435/v1/aceeacacb4132c0e03642d3c.jpg"},{"id":59604104,"identity":"4fc7e64a-ca17-4710-b876-948f85831762","added_by":"auto","created_at":"2024-07-03 18:06:21","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3160707,"visible":true,"origin":"","legend":"\u003cp\u003eAssessment of the characteristics of engineered induced pluripotent stem cells (iPSCs).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003e Microscope image of iPSCs and clones A7 and B2 with \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e \u0026nbsp;knocked out\u003cstrong\u003e. \u003c/strong\u003eScale bars, 500 μm.\u003cstrong\u003e b. \u003c/strong\u003eAlkaline phosphatase\u003cstrong\u003e (\u003c/strong\u003eAP) staining imageof iPSCs, YiP3, and clones A7 and B2. Scale bars, 500 μm. \u003cstrong\u003ec.\u003c/strong\u003e The real-time PCR data for the pluripotency markers, such as octamer-binding transcription factor 4 (\u003cem\u003eOCT4\u003c/em\u003e), SRY (sex-determining region Y)-box 2 (\u003cem\u003eSOX2\u003c/em\u003e), Krüppel-like factor 4 (\u003cem\u003eKLF4\u003c/em\u003e), Lin-28 homolog A (\u003cem\u003eLIN28\u003c/em\u003e), and Nanog homeobox (\u003cem\u003eNANOG\u003c/em\u003e), and the three germ layer differentiation markers, such as \u003cem\u003eSOX17\u003c/em\u003e, \u003cem\u003eBRACHYURY\u003c/em\u003e, and paired box 6 (\u003cem\u003ePAX6\u003c/em\u003e), in YiP3 and clones A7 and B2. \u003cstrong\u003ed.\u003c/strong\u003eThe Flow cytometry data for the pluripotency markers, such as tumor rejection antigen 1-60 (TRA-1-60), NANOG, stage specific embryonic antigen-1 (SSEA-4), OCT4, and the negative marker CD34 in YiP3 and clones A7 and B2. \u003cstrong\u003ee.\u003c/strong\u003e The immunocytochemistry images demonstrating the expression of markers (PAX6) for ectoderm, (BRACHYURY) for mesoderm, and (SOX17) for endoderm following differentiation into the three germ layers using YiP3 and clones A7 and B2. Scale bars, 200 μm\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4354435/v1/aff308b198d1b1d31ee6772e.jpg"},{"id":59603443,"identity":"8cd5bc81-ab75-44b1-92c3-0c8910993f67","added_by":"auto","created_at":"2024-07-03 17:50:21","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1200143,"visible":true,"origin":"","legend":"\u003cp\u003eAssessment of the expression of human leukocyte antigen (\u003cem\u003eHLA\u003c/em\u003e) gene and protein.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003e The real-time PCR data display the mRNA levels of \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e in YiP3 and clones A7 and B2. The upper graph depicts the relative mRNA expression in delta cycle threshold (dCt) values, while the lower graph is normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), using YiP3 as the reference value. Statistical significance is indicated by the p-value (analysis of variance [ANOVA] test) vs. YiP3: *p \u0026lt; 0.05; **p \u0026lt; 0.01; and ***p \u0026lt; 0.001. \u003cstrong\u003eb.\u003c/strong\u003e The flow cytometry data demonstrate alterations in the expression of HLA-A, HLA-B, and HLA-DR in YiP3 and clones A7 and B2 induced pluripotent stem cells (iPSCs) before and after stimulation with interferon-gamma (INF-γ). Histograms represented by lines depict the cell populations before INF-γ stimulation, whereas those shaded in cyan represent the cell populations after INF-γ stimulation.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4354435/v1/f61a597cd8632a690dc50d5c.jpg"},{"id":59603452,"identity":"3b769d68-85ac-4923-b797-30ef755c26d3","added_by":"auto","created_at":"2024-07-03 17:50:22","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2803137,"visible":true,"origin":"","legend":"\u003cp\u003eAssessment of genetic stability of human leukocyte antigen (\u003cem\u003eHLA\u003c/em\u003e)-triple knockout (KO) induced pluripotent stem cells (iPSCs) in clones A7 and B2\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003e Karyotype analysis of YiP3 iPSC and \u003cem\u003eHLA\u003c/em\u003e-triple KO iPSCs in clones A7 and B2. \u003cstrong\u003eb.\u003c/strong\u003e Identification of copy number (CN) losses in clone B2. Copy number (CN) losses at 2q22.1 (138.17~138.82 Mbp on chromosome 2) and 6p21.33~6p21.32 (31.32~32.41 Mbp on chromosome 6) loci are identified through high-resolution single nucleotide polymorphism (SNP) genotyping using the CytoScan HD array. \u003cstrong\u003ec.\u003c/strong\u003e Identification of CRISPR/Cas9 off-targets induced by three gRNAs in clones A7 and B2. In the Circos plot, the first layer represents all human chromosomes (Chr). The second layer represents off-target sites (Predict Off; black color bar) in the human reference genome predicted by Cas-OFFinder, facilitating two mismatches. The third layer represents off-targets (Obs. Off) such as SNV or InDel observed from whole-genome sequence (WGS) data of clones B2 (green color bar) and A7 (red color bar). The fourth layer represents structural variants (Obs. SV) related to on-target and/or off-target activity detected from WGS data of clones B2 (green color bar) and A7 (red color bar). In clone A7, a SV event is detected: a 28-bp deletion in \u003cem\u003eHLA-A\u003c/em\u003e. In clone B2, three SV events are detected: a 34-bp insertion in \u003cem\u003eHLA-A\u003c/em\u003e, and CN losses at two loci, 2q22.1 (encompassing THSD7B to HNMT) and 6p21.33–6p21.32 (encompassing \u003cem\u003eHLA-B\u003c/em\u003e and \u003cem\u003eHLA-DRA\u003c/em\u003e). \u003cstrong\u003ed.\u003c/strong\u003e Expression of targeted genes \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e in YiP3 and clones A7 and B2. \u003cstrong\u003ee.\u003c/strong\u003e Gene expression correlation among YiP3, A7, and B2. \u003cstrong\u003ef\u003c/strong\u003e. Enrichment plot for endoderm (GO:0007492), mesoderm (GO:0007498), and ectoderm (GO:0007398) development. The top portion of the plot demonstrates the running enrichment score (ES) for the gene set as the analysis continues down the ranked list (middle portion of the plot).\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4354435/v1/2f0f26ea3b772d6235397928.jpg"},{"id":59603448,"identity":"eb847f27-062b-4bed-9a4f-2b93c5b5b869","added_by":"auto","created_at":"2024-07-03 17:50:21","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1687519,"visible":true,"origin":"","legend":"\u003cp\u003eImmunogenicity test for triple knockout (KO)-engineered induced pluripotent stem cells (iPSCs) under interferon-gamma (INF-γ) stimulation\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003e A schematic representation of the process of the in vitro immunogenicity test for YiP3 and clones A7 and B2. This illustration is created using BioRender. \u003cstrong\u003eb.\u003c/strong\u003e The human leukocyte antigen (HLA) type of YiP3 and the HLA type of the peripheral blood mononuclear cell (PBMC) donor used in the immunogenicity test for YiP3, which differs from YiP3’s HLA type. \u003cstrong\u003ec.\u003c/strong\u003e The histograms from flow cytometry depict the proliferation of carboxyfluorescein succinimidyl ester (CFSE)-stained T cells and T cell-depleted donor peripheral blood mononuclear cells (PBMCs) co-cultured with YiP3 and clones A7 B2. On the left, carboxyfluorescein succinimidyl ester (CFSE)-labeled T cells represent TCM (central memory T cells), while CFSE-labeled T cells on the right represent effector memory T cells (TEM). The proliferation levels of TCM and TEM are measured on days 7, 14, and 21. \u003cstrong\u003ed.\u003c/strong\u003e The % data of CD4+ T cell proliferation obtained from flow cytometry. On the left, it depicts the extent of proliferation of CD4+ TCM (central memory T cells) from YiP3 and clones A7and B2 on days 7, 14, and 21. On the right, it depicts the extent of proliferation of CD4+ TCM from YiP3 and clones A7 and B2 on days 7, 14, and 21. Statistical significance is indicated by the p-value (analysis of variance [ANOVA] test), vs. YiP3: *p \u0026lt; 0.05; **p \u0026lt; 0.01; and ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4354435/v1/d0e4f312cee0e016ccf68407.jpg"},{"id":59603451,"identity":"3ea6ebbd-f12e-4c05-b592-3e3721e601e6","added_by":"auto","created_at":"2024-07-03 17:50:21","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":3053150,"visible":true,"origin":"","legend":"\u003cp\u003eAssessment of endothelial differentiation capability and validation of human leukocyte antigen (HLA) protein expression in triple-\u003cem\u003eHLA\u003c/em\u003e knockout (KO) induced pluripotent stem cell (iPSC)-derived endothelial cells (ECs).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea.\u003c/strong\u003e Microscope images following endothelial cell (EC) differentiation using YiP3 and clones A7 and B2. Scale bars, 500 μm. \u003cstrong\u003eb.\u003c/strong\u003e Flow cytometry data measuring the cell population expressing EC markers CD31 and VE-Cadherin following EC differentiation of YiP3 and clones A7 and B2. \u003cstrong\u003ec.\u003c/strong\u003e Western blotting data measuring the alterations in the protein expression of HLA-A, HLA-B, and HLA-C before and after interferon (IFN) stimulation following EC differentiation of YiP3 and clones A7 and B2.\u003cstrong\u003e d. \u003c/strong\u003eA schematic diagram illustrating the process of selecting triple knockout (KO) clones for \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e following gene correction. This illustration is created using BioRender.\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4354435/v1/4e17d7e3c13ae566d348fa87.jpg"},{"id":78566687,"identity":"be3db10f-056d-427f-b7a3-77d0743dfa11","added_by":"auto","created_at":"2025-03-15 07:08:00","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":18532678,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4354435/v1/637bd465-2bd6-4352-8c07-e96455c0a110.pdf"},{"id":59603442,"identity":"a050cf30-444a-403a-8b9d-7fd20921aac9","added_by":"auto","created_at":"2024-07-03 17:50:21","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":33642,"visible":true,"origin":"","legend":"Supplementary_Material and Methods","description":"","filename":"SupplementaryMateiralandMethods.docx","url":"https://assets-eu.researchsquare.com/files/rs-4354435/v1/4df332f83c3b08c79c0f3fba.docx"},{"id":59603796,"identity":"d5dc6a75-4ba0-49ba-b509-2f667799d7b2","added_by":"auto","created_at":"2024-07-03 17:58:21","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":30992,"visible":true,"origin":"","legend":"Supplementary_Table","description":"","filename":"SupplementaryTable.docx","url":"https://assets-eu.researchsquare.com/files/rs-4354435/v1/c6b7d95e20e13053155db49d.docx"},{"id":59603445,"identity":"21488f03-77a6-491f-b4fd-527eee4852ab","added_by":"auto","created_at":"2024-07-03 17:50:21","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":1879062,"visible":true,"origin":"","legend":"Supplementary Information","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-4354435/v1/83012cc203d1e050b42c65f6.docx"}],"financialInterests":"(Not answered)","formattedTitle":"Generation of hypoimmunogenic universal iPSCs through HLA-type gene knockout","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn cell therapy, overcoming immunogenicity is crucial for the successful application of induced pluripotent stem cell (iPSC). Research utilizing adult stem cells, such as mesenchymal stem cells (MSCs), embryonic stem cells (ESCs), and iPSCs, has been advancing \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. iPSCs, generated by introducing Yamanaka factors into somatic cells, possess pluripotent characteristics and the ability to differentiate into various cell types, making them promising candidates for therapeutic use \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. However, allogeneic therapy using iPSCs is challenging owing to immunogenicity \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. To address this issue, we aimed to generate hypoimmunogenic universal iPSCs by editing the human leukocyte antigen (\u003cem\u003eHLA\u003c/em\u003e) genes.\u003c/p\u003e \u003cp\u003eThe HLA system is crucial for transplantation \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. While HLA polymorphism is imperative for immune defense, it often causes failure owing to immune reactions as a result of genetic disparities in organ transplantation \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. This phenomenon extends to cell therapies, where mismatched HLA types from the donor are identified as non-self, resulting in potential attacks by CD4 T, CD8 T, and natural killer (NK) cells, thereby triggering an ensuing immune response \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe major histocompatibility complex (MHC), also known as the \u003cem\u003eHLA\u003c/em\u003e gene, contains genes responsible for encoding the MHC molecules that function within the immune system \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Located on chromosome 6, it consists of HLA class I (A, B, and C) and class II (DR, DQ, and DP) molecules, representing the most polymorphic regions within the human genome. Class I MHC molecules, such as HLA-A, B, and C, present foreign proteins to cytotoxic T (Tc) cells in the presence of non-self-proteins. They consist of a polymorphic α-chain and non-polymorphic β2M chain. Class II MHC molecules, including \u003cem\u003eHLA-DR\u003c/em\u003e, \u003cem\u003eHLA-DQ\u003c/em\u003e, and \u003cem\u003eHLA-DP\u003c/em\u003e, consist of a polymorphic β1 chain, a non-polymorphic α chain, and β2. They present foreign proteins to helper T cells upon detecting non-self proteins \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAlthough patient-donor HLA typing alignment is optimal for transplantation, identifying such matches poses challenges \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. In cases of partial HLA mismatch, the degree of mismatch can significantly influence the severity of immune rejection reactions. HLA matching is crucial in transplantation \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. However, despite the existence of a bone marrow registry with four million donors in the US, only 50\u0026ndash;60% of cases find matches for HLA-A and B. Autologous transplantation is the most desirable method \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e, but it involves significant time and expense before transplantation. Allogeneic transplantation using iPSCs from donors with homozygous HLA alleles can broaden their applicability to a more diverse patient population. However, covering all HLA types within a population is impractical. In Korea, there are examples of 13 good manufacturing practice (GMP)-grade homozygous iPSCs obtained by assessing common homozygous HLA-A, B, and DRB1 types \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, but it still proves challenging to cover the entire Korean population. Similarly, in Japan, where 140 homozygote iPSCs can cover 90% of the population \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e, identifying such homozygous iPSCs remains a significant challenge.\u003c/p\u003e \u003cp\u003eResearchers are exploring the use of iPSCs in transplantation by correcting mutations or editing \u003cem\u003eHLA\u003c/em\u003e using gene-editing techniques, such as CRISPR-Cas9. These genetically modified iPSCs can differentiate into target cells and be administered to the patients. Currently, studies are focusing on generating hypoimmunogenic iPSCs using gene-editing methods for transplantation.\u003c/p\u003e \u003cp\u003eThe CRISPR-Cas9 system is used for gene editing by targeting specific gene regions to induce DNA breaks. This facilitates non-homologous end joining (NHEJ) to introduce random mutations or homology-directed repair (HDR) to insert the desired genes \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. When transfection-delivered guide RNA (sgRNA) binds to the target sequence, Cas9 enzyme precisely cuts the intended region, enabling sequence editing. This technique can be used to knockout (KO) polymorphic \u003cem\u003eHLA\u003c/em\u003e genes and eliminate genes that trigger immune responses. Since its inception in 2012, CRISPR-Cas9 has been widely used across various fields, including the development of gene and cell therapies \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The clinical trial registration system (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://clinicaltrials.gov\u003c/span\u003e\u003cspan address=\"http://clinicaltrials.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) identified 49 clinical trials that used this technology, with one clinical approval for applying this technology to iPSCs \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eNumerous studies on \u003cem\u003eHLA\u003c/em\u003e gene engineering of existing iPSCs are in progress \u003csup\u003e\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e, aiming to establish clinical-grade universal iPSCs within good manufacturing practice (GMP) facilities \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eRecent research has used the CRISPR-Cas9 technology to induce KO of \u003cem\u003eHLA\u003c/em\u003e genes \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Studies on universal iPSCs have involved deleting \u003cem\u003eHLA-A, HLA- B, HLA-C, β2M\u003c/em\u003e, \u003csup\u003e\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e or class II major histocompatibility complex transactivator (\u003cem\u003eCIITA\u003c/em\u003e) to eliminate MHC class I and II \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Without gene editing, these cells are susceptible to cytotoxic T (Tc) cells, helper T (Th) cells, and NK cells. When MHC class I is completely deleted because of β2M, Tc and Th rejection can be prevented, but NK cell attacks cannot be avoided. HLA-E blocks NK and CD8\u0026thinsp;+\u0026thinsp;T cell attacks \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e, whereas HLA-G blocks attacks from CD8\u0026thinsp;+\u0026thinsp;T, CD4\u0026thinsp;+\u0026thinsp;T, B \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e, and NK cells, and macrophages, prompting research into selective deletion methods. Additionally, strategies involving knocking in CD47 \u003csup\u003e33\u003c/sup\u003e, which signals \"don't-eat me\" \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e to programmed death-ligand 1 (PD-L1), HLA-G, and macrophages, are pursued \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Selective KO methods include biallelic KO of \u003cem\u003eHLA-A\u003c/em\u003e and \u003cem\u003eHLA-B\u003c/em\u003e genes, monoallelic KO of HLA-C gene, and the KO of \u003cem\u003eCIITA\u003c/em\u003e to eliminate all HLA class II molecules \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThis study aimed to generate hypoimmunogenic iPSCs by eliminating immunogenicity through the deletion of \u003cem\u003eHLA-A, HLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e genes, which are closely associated with recipient T cell responses among donor HLA types during cell transplantation. Using the CRISPR-Cas9 system, \u003cem\u003eHLA-A, HLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e genes were deleted in the YiP3 cell line, which is derived from peripheral blood mononuclear cell (PBMC)-derived iPSCs with heterozygosity for \u003cem\u003eHLA\u003c/em\u003e gene, to prevent immune rejection reactions. Previous studies on universal iPSCs have used homozygous iPSCs or iPSCs with partially matching alleles in the \u003cem\u003eHLA\u003c/em\u003e genes as gene editing targets \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. In contrast, this study aimed to genetically modify both the alleles in heterozygous iPSCs. The majority of existing studies and patents have focused on deleting \u003cem\u003eHLA-A, HLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRB1\u003c/em\u003e \u003csup\u003e40\u003c/sup\u003e, with no research reporting on knocking out, \u003cem\u003eHLA-DRA\u003c/em\u003e. This strategy involves deleting the DRA α-chain, thereby eliminating the structure of MHC class II responsible for antigen recognition. Regarding the \u003cem\u003eHLA-DR\u003c/em\u003e component, considering the presence of \u003cem\u003eHLA-DRA\u003c/em\u003e alongside \u003cem\u003eHLA-DRB1, HLA-DRB3, HLA-DRB4\u003c/em\u003e, and \u003cem\u003eHLA-DRB5\u003c/em\u003e, targeting only \u003cem\u003eHLA-DRB1\u003c/em\u003e for KO was selected to prevent concerns regarding the expression of \u003cem\u003eHLA-DRB3, HLA-DRB4\u003c/em\u003e, and \u003cem\u003eHLA-DRB5\u003c/em\u003e. In this study, we established hypoimmunogenic iPSCs to mitigate immune responses, which are potential adverse effects in allogeneic transplantation. Quality testing and immunogenicity assessments of the iPSCs were conducted to prepare them for use in cell therapy.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eGene-editing iPSCs\u003c/h2\u003e \u003cp\u003eOn day 0, CRISPR/Cas9 reagents (ribonucleoprotein [RNP] complexes) were prepared by combining 80 \u0026micro;g of gRNA for \u003cem\u003eHLA-A, HLA-B, and HLA-DRA\u003c/em\u003e, with CAS9. Subsequently, 1\u0026nbsp;million PBMC-derived iPSCs (YiP3) were mixed with these complexes and subjected to electroporation. From days 3 to 5, the transfected cells were collected and subjected to single-cell cloning using flow cytometry. Approximately 10,000 cells were collected for electroporation pool analysis. The transfected electroporation pool was genotyped from days 5 to 13. After seeding the transfected iPSCs into a 96-well plate, they were cultured with mTeSR-Plus, and single clones were selected. From day 11\u0026ndash;13 to day 25\u0026ndash;28, the gene-edited clones were analyzed through PCR and Sanger sequencing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eiPSC culture\u003c/h2\u003e \u003cp\u003eThe gene-edited cell lines were thawed and passaged following the supplementary methods. After the cells were stabilized, the coating material and culture medium were replaced to culture the cells under conditions similar to those of the control iPSCs. Detailed methods are described in the supplementary methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eEndothelial cell (EC) differentiation\u003c/h2\u003e \u003cp\u003eECs were generated as previous study \u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. Detailed methods for EC differentiation from iPSCs are described in supplementary methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAlkaline Phosphate (AP) Staining\u003c/h2\u003e \u003cp\u003eAlkaline phosphate staining was performed using an Alkaline Phosphate Detection Kit (SCR004; Sigma), following the manufacturer\u0026rsquo;s protocol. Detailed protocol is described in the supplementary methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eFluorescence-activated cell sorting (FACS) Analysis\u003c/h2\u003e \u003cp\u003eDetailed methods and antibodies used for fluorescence-activated cell sorting (FACS) analysis are provided in the supplementary methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eThree germ lineage Differentiation assay\u003c/h2\u003e \u003cp\u003eThe differentiation potential of trilineage germ cell layers was determined using the STEMdiff Trilineage differentiation kit (05230; STEMCELL technology), following the manufacturer\u0026rsquo;s protocol. Detailed protocol is described in the supplementary methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated using TRIzol reagent (15596026; Invitrogen). cDNA was synthesized from the isolated RNA using the RevertAid First Strand cDNA Synthesis Kit (K1622; Thermo Fisher) following the manufacturer\u0026rsquo;s protocol. Quantitative real-time PCR was performed using the QuantStudio 3 instrument (Applied Biosystems) and Power SYBR Green PCR Master Mix (4367659; Applied Biosystems). Primer details are listed in the Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e in the supplementary Table.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primer list of pluripotency markers, three germ layer differentiation markers, and human leukocyte antigen (\u003cem\u003eHLA\u003c/em\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDirection\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eNANOG\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATTTGTGGGCCTGAAGAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGATCCATGGAGGAAGGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eOCT4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCCCTGGTGCCGTGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCTGAATACCTTCCCAAATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSOX2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGGGTTCGGTGGTCAAGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGATCATGTCCCGGAGGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLIN28\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTCGGCTTCCTGTCCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGCCTCACCCTCCTTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eKLF4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCCCATCTCAAGGCACAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTCGCATTTTTGGCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ePAX6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGTCCAACGGATGTGTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTAGCCAGGTTGCGAAGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eBRACHYURY\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAATTGGTCCAGCCTTGGAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGTTGCTCACAGACCACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSOX17\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCACGGAATTTGAACAGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGATCAGGGACCTGTCACAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eHLA-A\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGATACACCTGCCATGTGCAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATCACAGCTCCAAGGAGAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eHLA-B\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGCTGTGATGTGTAGGAGGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTGTGAGAGACACATCAGAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eHLA-C\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGACACAGAAGTACAAGCGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACATCCTCTGGAGGGTGTGAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eHLA-DRA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCTGTGGACAAAGCCAACCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCTCAGTTCCACAGGGCTGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eSanger sequencing\u003c/h2\u003e \u003cp\u003eFollowing gDNA extraction from iPSCs, PCR and Sanger sequencing were performed using the primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, \u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e of the supplementary Table.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequence for Sanger sequencing (human leukocyte antigen [\u003cem\u003eHLA\u003c/em\u003e]-\u003cem\u003eA\u003c/em\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePCR product\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-A-947-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGGGAAACCGCCTCTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e947bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-A-947- R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGATCTACAGGCGATCAGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSequencing primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-A-Seq-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTTCACATCCGTGTCCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSequencing Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-Seq-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTTGCGCTTGGTGATCTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequence for Sanger sequencing (human leukocyte antigen [\u003cem\u003eHLA\u003c/em\u003e]-\u003cem\u003eB\u003c/em\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003ePCR product\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003eExon 2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-B-exon2-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTTGTGTCGGGTCCTTCTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e \u003cp\u003e714bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-B-exon2-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCGGACCCGGAGACTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSequencing primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-B-Seq-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAGAGTCTCCTCAGACGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003eExon 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-B-exon3-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCTACTACAACCAGAGCGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c5\" namest=\"c4\" rowspan=\"2\"\u003e \u003cp\u003e822bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-B-exon3-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAAAGTCACGGTTCCCAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSequencing primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-B-exon3- Seq-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCGCCCCGAGTCTCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSequencing primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-B-exon3- Seq-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAAAGTCACGGTTCCCAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequence for Sanger sequencing (human leukocyte antigen [\u003cem\u003eHLA\u003c/em\u003e]-\u003cem\u003eDRA\u003c/em\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eproduct size\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003eExon 2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-DRA-Exon2-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCCGGGTAAAGAAAGTGAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e754bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-DRA-Exon2-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAATTTGGGGCTTGTTAATGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSequencing primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-DRA-exon2- Seq-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTCTGGGTTCTTTAGCCCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSequencing primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-DRA-exon2- Seq-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTGGCCAATGCACCTTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003eExon 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-DRA-exon 3-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGGGTGCTGTCAGAGATTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e748bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-DRA-exon3-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGAAATAAGGCAGAGTACATGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSequencing primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-DRA-exon3- Seq-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGTTTGTACCACAATTGAGCATGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSequencing primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG0002-HLA-DRA-exon3- Seq-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCGAGTTTCACACAAGCATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eVariants associated with genome editing detected from whole-genome sequencing (WGS) data of clones A7 and B2\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClone\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStructural\u003c/p\u003e \u003cp\u003evariant\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDetail of variant type\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSize of variant\u003c/p\u003e \u003cp\u003e(bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePosition (bp) on chromosome\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRelated gene\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDeletion\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.170_197del\u003c/p\u003e \u003cp\u003e(p.Phe57SerfsTer11)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e28 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChr6:29,942,853-\u003c/p\u003e \u003cp\u003e29,942,880\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eHLA-A\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDeletion\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.165_198del\u003c/p\u003e \u003cp\u003e(p.Gln56ArgfsTer10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e34 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChr6:29,942,847-\u003c/p\u003e \u003cp\u003e29,942,880\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eHLA-A\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDeletion\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCNV loss\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e636,211 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChr2:137,427,785-\u003c/p\u003e \u003cp\u003e138,063,995\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eTHSD7B ~\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003eHNMT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDeletion\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCNV loss\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1,085,752 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChr6:31,356,818-\u003c/p\u003e \u003cp\u003e32,442,567\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eHLA-B ~\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003eHLA-DRA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e*fs, frame-shift; Ter, termination\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDetection of somatic variants from whole-genome sequencing (WGS) data\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eVariants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eNo. of SNV\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e \u003cp\u003eNo. of InDel\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYiP3:\u003c/p\u003e \u003cp\u003eDonor vs WT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWT vs A7\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eWT vs B2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eYiP3:\u003c/p\u003e \u003cp\u003eDonor vs WT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWT vs A7\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWT vs B2\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariant type (total no. of variant)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIntrons\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5'-/3'-UTRs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCoding exons\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSynonymous variants\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariant related to functional effects\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMissense (+\u0026thinsp;start lost, stop lost)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFrame-shift\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIn-frame\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNonsense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSplice site\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariant annotation (total no. of variant)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePolyPhen2/SIFT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClinVar mutation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMutation in COSMIC Tier 1 gene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003e*WT, Passage 15 of YiP3\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence (IF) assay\u003c/h2\u003e \u003cp\u003eDetailed methods and antibodies used are provided in the supplementary methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eDetailed methods and antibodies used for immunoblotting are described in the supplementary methods.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003eimmunogenicity assay\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAn \u003cem\u003ein vitro\u003c/em\u003e immunogenicity assay was performed to assess the CD4\u0026thinsp;+\u0026thinsp;T cell response. Detailed methods are described in the supplementary methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eAssessment of genetic stability\u003c/h2\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003eCopy number variation (CNV) analysis\u003c/h2\u003e \u003cp\u003eThe genomic DNAs of YiP3 iPSC (wild-type) and HLA-triple KO clones (A7 and B2) were genotyped using the CytoScan-HD array (Thermo Fisher Scientific, Inc.), following the manufacturer\u0026rsquo;s protocol. Data analysis was conducted using the Chromosome Analysis Suite (ChAS) (version 4.4.0.63; Thermo Fisher Scientific, Inc.). Detailed methods are described in the supplementary methods.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eWhole-genome sequencing (WGS) and bioinformatic analysis\u003c/h2\u003e \u003cp\u003eSequencing libraries of YiP3, A7, and B2 were prepared from input DNA (1 \u0026micro;g) using a TruSeq DNA sample prep kit (Illumina, Inc.), following the manufacturer\u0026rsquo;s protocols. These libraries underwent paired-end sequencing using a 150 bp read length on the Illumina NovaSeq 6000 platform (Illumina, Inc.). Detailed methods are described in the supplementary methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eRNA-seq and bioinformatic analysis\u003c/h2\u003e \u003cp\u003ecDNA libraries were prepared from the total RNA (1 \u0026micro;g) of each sample using the TruSeq Stranded mRNA sample prep kit (Illumina, Inc.), following the manufacturer\u0026rsquo;s protocols. Following qPCR validation, libraries underwent paired-end sequencing with a 150 bp read length on the Illumina NovaSeq 6000 platform (Illumina, Inc.). Detailed methods are described in the supplementary methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were conducted using the GraphPad Prism software (v. 5.01; GraphPad, San Diego, CA, USA). Statistical significance was assessed using a two-way analysis of variance (ANOVA) and is expressed as follows: *, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; ***, and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eDesign of triple\u003c/b\u003e \u003cb\u003eHLA\u003c/b\u003e \u003cb\u003egene KO iPSCs\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo generate hypoimmunogenic iPSCs without immune rejection, we used YiP3 PBMC-derived iPSCs with heterozygous alleles for the \u003cem\u003eHLA\u003c/em\u003e genes on chromosome 6. The YiP3 line carried the following alleles: \u003cem\u003eHLA-A\u003c/em\u003e 11:01:01:01 and \u003cem\u003eHLA-A\u003c/em\u003e 29:01:01:01, \u003cem\u003eHLA-B\u003c/em\u003e 13:02:01:01 and \u003cem\u003eHLA-B\u003c/em\u003e 58:01:01:01, \u003cem\u003eHLA-C\u003c/em\u003e 03:02:02 and \u003cem\u003eHLA-C\u003c/em\u003e 02:02:02, and \u003cem\u003eHLA-DRA\u003c/em\u003e 01:02:01 and \u003cem\u003eHLA-DRA\u003c/em\u003e 01:01:02. Our strategy aimed to KO \u003cem\u003eHLA-A\u003c/em\u003e and \u003cem\u003eHLA-B\u003c/em\u003e, which represent polymorphisms in class I of the HLA locus, using CRISPR/Cas9, and KO \u003cem\u003eHLA-DRA\u003c/em\u003e to prevent the expression of \u003cem\u003eHLA-DR\u003c/em\u003e, which represents polymorphism in class II, while leaving \u003cem\u003eHLA-C\u003c/em\u003e, which has a minor polymorphism (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b). The CRISPR/Cas9 system was used for gene KO. For each gene, two guide RNAs (gRNAs) were designed to target regions excluding heterogeneous regions within the \u003cem\u003eHLA-A\u003c/em\u003e gene, where a protospacer adjacent motif (PAM) site (NGG) existed and may act biallelically on a 20 bp sequence (Supplementary Fig.\u0026nbsp;1a-c). For example, using immuno polymorphism database-international immunogenetics information system (IPD-IMGT)/HLA database \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e, each allele was aligned We designed a gRNA (G0002-HLA-A-g1, ACAGCGACGCCGCGAGCCAG, PAM:AGG) targeting codons 37\u0026ndash;43 within Exon 2 for \u003cem\u003eHLA-A\u003c/em\u003e. We designed a gRNA (G0002-HLA-B-g1, GCTGTCGAACCTCACGAACT, PAM:GGG) targeting codons 31\u0026ndash;38 within Exon 2 for \u003cem\u003eHLA-B\u003c/em\u003e and a gRNA (G0002-HLA-DRA-g2, TGGCAAAGAAGGAGACGGTC, PAM:TGG) targeting codons 36\u0026ndash;42 within Exon 2 for \u003cem\u003eHLA-DRA\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, d, e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eAssessment of designed gRNA\u003c/h2\u003e \u003cp\u003eThe efficiency of CRISPR/Cas9 guide RNAs (gRNAs) designed for the \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e genes was assessed by electroporating bulk iPSCs with each gRNA and measuring the transfection efficiency (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Sanger sequencing and inference of CRISPR edits (ICE) analysis of the transfected iPSC pool revealed that, for \u003cem\u003eHLA-A\u003c/em\u003e gRNA, G0002-HLA-A-g1 and G0002-HLA-A-g2 demonstrated 91 and 47% efficiency, respectively. Therefore, G0002-HLA-A-g1 was selected as the final gRNA. For \u003cem\u003eHLA-B\u003c/em\u003e gRNA, G0002-HLA-B-g1 and G0002-HLA-B-g2 demonstrated 78 and 0% efficiency, respectively, indicating a lack of match. Therefore, G0002-\u003cem\u003eHLA-B\u003c/em\u003e-g1 was selected as the final gRNA. For \u003cem\u003eHLA-DRA\u003c/em\u003e, G0002-HLA-DRA-g1 and G0002-HLA-DRA-g2 demonstrated 99 and 86% efficiency, respectively. However, considering that the \u003cem\u003eHLA-DR\u003c/em\u003e polymorphism predominantly occurs within Exon 2, G0002-HLA-DRA-g1, targeting this region, was selected as the final gRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, c, d).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eConfirmation of triple HLA gene KO iPSCs\u003c/h2\u003e \u003cp\u003eTo obtain engineered YiP3 cells with triple \u003cem\u003eHLA\u003c/em\u003e gene KO, single clones were obtained through electroporation-mediated transfection using selected gRNAs that target the \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee). To establish the concentration conditions for each gRNA for transfection, 40 and 80 \u0026micro;g of each gRNA were used to form the RNP complex. The efficiency of KO score for each gene, determined through ICE analysis, was 53, 37, 44, 58, 45, and 56%. Subsequently, transfection was performed using 80 \u0026micro;g of each gRNA to generate the RNP complex (Supplementary Fig.\u0026nbsp;2a). Single-cell cloning was conducted on the transfected iPSCs, followed by EP pool analysis and genotyping using next-generation sequencing (NGS). Subsequently, 48 clones were collected by seeding them into a 96-well plate, and each clone was screened and genotyped using Sanger sequencing. Six potential triple-KO clones were selected and further assessed through confirmatory sequencing and/or NGS (Supplementary Fig.\u0026nbsp;2b).\u003c/p\u003e \u003cp\u003eClone B4 had mixed alleles in the \u003cem\u003eHLA-B\u003c/em\u003e region, whereas clone C6 had unresolved issues in the \u003cem\u003eHLA-A\u003c/em\u003e region and was excluded from further assays (Supplementary Fig.\u0026nbsp;3b). Genotyping results for the triple-KO clones underwent further sequencing verification for final confirmation. Clone A7 exhibited homozygosity with a 1-bp insertion, 28-bp deletion, and 1-bp deletion in the \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e regions, respectively. Clone B2 exhibited homozygosity with a 1-bp insertion, 34-bp deletion, and 2-bp deletion in the \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e regions, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef, Supplementary Fig.\u0026nbsp;2b). Additionally, clones B3 and B11 demonstrated incomplete \u003cem\u003eHLA-A\u003c/em\u003e with a 1-bp insertion and 1-bp deletion near g1 (Supplementary Fig.\u0026nbsp;2b, c). Therefore, based on the genotyping results, clones A7 and B2 were selected as strong candidates for the triple \u003cem\u003eHLA\u003c/em\u003e gene KO, and further comparative analysis was conducted along with clones B3 and B11 through additional assays.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eEngineered triple-KO iPSCs retain the pluripotency\u003c/h2\u003e \u003cp\u003eTo assess the pluripotency, quality testing was conducted on the triple-KO iPSC clones in comparison to the control YiP3. Morphologically, clones A7 and B2 exhibited colony formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea), and positive staining for alkaline phosphatase (AP) confirmed their undifferentiated state (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). At the mRNA level, the expression of pluripotency markers, such as octamer-binding transcription factor 4 (\u003cem\u003eOCT4\u003c/em\u003e), SRY (sex-determining region Y)-box 2 (\u003cem\u003eSOX2\u003c/em\u003e), Kr\u0026uuml;ppel-like factor 4 (\u003cem\u003eKLF4\u003c/em\u003e), Lin-28 homolog A (\u003cem\u003eLIN28\u003c/em\u003e), and Nanog homeobox (\u003cem\u003eNANOG\u003c/em\u003e) was confirmed, whereas the endoderm differentiation marker (\u003cem\u003eSOX17\u003c/em\u003e), mesoderm differentiation marker (\u003cem\u003eBRACHYURY\u003c/em\u003e), and ectoderm marker (paired box 6 [\u003cem\u003ePAX6\u003c/em\u003e]) were not expressed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Similar patterns were observed in clones B3 and B11 (Supplementary Fig.\u0026nbsp;3a, b, c).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSubsequently, to compare the expression of pluripotency markers at the protein level using pre-engineered YiP3, flow cytometry was performed for OCT4, stage-specific embryonic antigen 4 (SSEA4), NANOG, tumor rejection antigen 1\u0026ndash;60 (TRA-1-60), and the negative marker (CD34). The results demonstrated that clones A7 and B2 expressed OCT4, SSEA4, NANOG, and TRA-1-60 at levels exceeding 95% in cell populations, comparable to YiP3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed). Clone B11 exhibited expression levels exceeding 99% when compared to YiP3, whereas clone B3 exhibited a lower expression of NANOG at 86% (Supplementary Fig.\u0026nbsp;3d).\u003c/p\u003e \u003cp\u003eTo assess the ability of each clone to differentiate into the three germ layers (endoderm, mesoderm, and ectoderm), lineage differentiation was induced, and immunofluorescence staining for SOX17, BRACHYURY, and paired box 6 (PAX6) markers was performed. Expression of these markers was confirmed in all clones, indicating that engineered iPSC clones A7 and B2 retained their differentiation capacity similar to that of YiP3 without any alterations (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee). Similar results were observed for clones B3 and B11, indicating no effect on the differentiation of three germ layers (Supplementary Fig.\u0026nbsp;3f).\u003c/p\u003e \u003cp\u003eIn conclusion, among the selected triple-KO clones, clones A7 and B2 exhibited normal iPSC properties regarding pluripotency and the differentiation ability of three germ layers, similar to YiP3. However, clone B3 was excluded because of its significantly lower NANOG expression at the protein level.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGenetic stability of\u003c/b\u003e \u003cb\u003eHLA\u003c/b\u003e\u003cb\u003e-triple KO iPSCs in clones A7 and B2\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe genetic stability of \u003cem\u003eHLA\u003c/em\u003e-triple KO clones A7 and B2 was assessed by investigating karyotypes, CNVs, CRISPR/Cas9 off-targets, and expression alterations of cell differentiation potential-associated genes. Normal karyotypes were identified for clones A7 and B2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ea), whereas clone B11 exhibited a chromosomal abnormality with a deletion on chromosome 6p (Supplementary Fig.\u0026nbsp;3e), thereby precluding its consideration as an \u003cem\u003eHLA\u003c/em\u003e-triple KO iPSC candidate clone. No CNV was identified in clone A7 through SNP genotyping using the CytoScan HD array (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). However, copy number (CN) losses at two loci, 2q22.1 (138.17\u0026ndash;138.82 Mbp on chromosome 2) and 6p21.33\u0026ndash;6p21.32 (31.32\u0026ndash;32.41 Mbp on chromosome 6), were identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). Specifically, CN loss at 6p21.33 and 6p21.32 indicates the genomic instability of \u003cem\u003eHLA-B\u003c/em\u003e and \u003cem\u003eHLA-DRA\u003c/em\u003e in clone B2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). After predicting CRISPR/Cas9 off-targets in the human reference genome using Cas-OFFinder, potential off-target Cas9 activity was detected from WGS data of clones A7 and B2. Among the 21 predicted off-target sites using Cas-OFFinder, none corresponding to off-target sites was observed in the WGS data of clones A7 and B2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). However, four structural variants (SVs) that may be induced through on-target and/or off-target activity were identified: a 28-bp deletion in \u003cem\u003eHLA-A\u003c/em\u003e for clone A7, and a 34-bp deletion in \u003cem\u003eHLA-A\u003c/em\u003e and two CNV losses for clone B2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). The SVs identified in clones A7 and B2 were observed within coding sequences adjacent to the on-targets for \u003cem\u003eHLA-A\u003c/em\u003e and \u003cem\u003eHLA-B\u003c/em\u003e KO (Supplementary Table\u0026nbsp;5), indicating the possibility of additive induction in \u003cem\u003eHLA-A\u003c/em\u003e and \u003cem\u003eHLA-B\u003c/em\u003e KO. Additionally, somatic mutations, including single nucleotide variants (SNVs) and insertions and/or deletions (InDels), were analyzed from the whole-genome sequence data of A7 and B2 clones by comparing them with YiP3 iPSCs. Somatic coding variants that may cause functional effects were not observed in clones A7 and B2 (Supplementary Table\u0026nbsp;6). In addition to assessing the genomic stability of the \u003cem\u003eHLA\u003c/em\u003e-triple KO clones, we assessed their transcriptome alterations. First, it was confirmed that the KO genes (\u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e) were downregulated in clones A7 and B2 compared to those in YiP3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ed), indicating the consequences of \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e KOs. Second, despite the KO events, a strong correlation in overall gene expression was observed among YiP3, A7, and B2: a Pearson correlation of \u0026ge;\u0026thinsp;0.99 between YiP3 and A7, and \u0026ge;\u0026thinsp;0.98 between YiP3 and B2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ee). This indicates that the genome-wide gene expression pattern of the \u003cem\u003eHLA\u003c/em\u003e-triple KO clones A7 and B2 closely resembles that of the wild-type YiP3. Third, we also assessed the potential role of the cell differentiation process through gene set enrichment analysis (GSEA). In contrast to clone A7, genes associated with the development of the three germ layers (endoderm, mesoderm, and ectoderm) in pluripotent stem cells were significantly downregulated in clone B2 (p\u0026thinsp;=\u0026thinsp;0.000\u0026thinsp;~\u0026thinsp;0.029) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ef), which was consistent with the low EC differentiation ability in clone B2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eb). These results indicate the potential genomic instability of clone B2 owing to the downregulation of genes associated with cell development and off-target effects, such as CNV loss. Considering these results, our findings demonstrate that only the \u003cem\u003eHLA\u003c/em\u003e-triple KO clone A7 attains genomic stability.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eAssessment of the HLA expression\u003c/h2\u003e \u003cp\u003eWe assessed the mRNA expression levels of \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e in the genetically edited and selected clones (A7 and B2). Real-time PCR analysis revealed a significant reduction in the delta cycle threshold (dCt) values of \u003cem\u003eHLA-A\u003c/em\u003e and \u003cem\u003eHLA-B\u003c/em\u003e compared to YiP3 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs. YiP3), and a reduction in \u003cem\u003eHLA-DRA\u003c/em\u003e expression (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 vs. YiP3). Normalization using glyceraldehyde 3-phosphate dehydrogenase (\u003cem\u003eGAPDH\u003c/em\u003e) relative to YiP3 demonstrated a significant reduction in the mRNA levels of \u003cem\u003eHLA-A\u003c/em\u003e and \u003cem\u003eHLA-B\u003c/em\u003e (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs. YiP3), alongside a reduction in \u003cem\u003eHLA-DRA\u003c/em\u003e expression (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 vs. YiP3) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFlow cytometry analysis was conducted to assess whether gene editing and selection targeting HLA-A, B, and DRA in clones A7 and B2 resulted in the absence of HLA-DR protein expression. Without IFN-γ stimulation, YiP3 and clones A7 or B2 iPSCs did not express HLA-A, B, DR, and C (unedited region). Following IFN-γ stimulation for two days, HLA-A, B, and C protein expression increased in YiP3, with HLA-A, B, C, and DR increasing by 99.03, 91.61, 88.35, and 0.04%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). In contrast, under IFN-γ stimulation, the triple-KO clone A7 exhibited a significant reduction in HLA-A (0.07%), HLA-B (0.15%), and HLA-DR (0.02%) protein expression. However, HLA-C protein expression (97.34%) remained unaffected, because it was not within the gene-edited region. Similar results were observed for clone B2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). These results demonstrate selective KO of the targeted HLA-A, B, and DRA regions in YiP3 at the protein level, as confirmed through our analyses.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003eimmunogenicity test\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo assess whether gene-edited iPSCs exhibit immunogenicity, we conducted co-culture experiments using PBMCs from a donor whose HLA types differed from those of YiP3. We isolated TEM and TCM cells and assessed their proliferation levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Initially, we selected a donor with HLA types different from those of YiP3 for each allele. Allele 1 carried \u003cem\u003eHLA-A\u003c/em\u003e 02:01, \u003cem\u003eHLA-B\u003c/em\u003e 15:01, \u003cem\u003eHLA-C\u003c/em\u003e 01:02, and \u003cem\u003eHLA-DRB1\u003c/em\u003e 11:01, and allele 2 carried \u003cem\u003eHLA-A\u003c/em\u003e 02:07, \u003cem\u003eHLA-B\u003c/em\u003e 46:01, \u003cem\u003eHLA-C\u003c/em\u003e 04:01, and \u003cem\u003eHLA-DRB1\u003c/em\u003e 15:02 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Before co-culturing with PBMCs, both YiP3 and clones A7 and B2 were stimulated with IFN-γ for two days. We analyzed the proliferation of activated T cells in response to antigen presentation by antigen-presenting cells within PBMCs that were depleted of T cells. Co-cultures were initiated using PBMCs and carboxyfluorescein succinimidyl ester (CFSE)-labeled CD4\u0026thinsp;+\u0026thinsp;T cells, to assess the proliferation of CD4\u0026thinsp;+\u0026thinsp;TCM (CD3\u0026thinsp;+\u0026thinsp;CD4\u0026thinsp;+\u0026thinsp;CD45RO\u0026thinsp;+\u0026thinsp;CD62L+) and CD4\u0026thinsp;+\u0026thinsp;TEM (CD3\u0026thinsp;+\u0026thinsp;CD4\u0026thinsp;+\u0026thinsp;CD45RO\u0026thinsp;+\u0026thinsp;CD62L-) cells using flow cytometry. Harvesting PBMCs and CFSE-labeled CD4\u0026thinsp;+\u0026thinsp;TCM cells seven days after the initiation of co-culture revealed a slight increase in the cell population for YiP3 and clones A7 and B2, with average increases of 4.8, 4.5, and 4.7%, respectively. However, upon restimulation of YiP3 and clones A7 and B2 using IFN-γ-stimulated PBMCs after 14 and 21 days of co-culture, respectively, the proliferation of CFSE-labeled CD4\u0026thinsp;+\u0026thinsp;TCM cells increased to 12.8% (day 14, mean) and 25.2% (day 21, mean) for YiP3. In contrast, proliferation was reduced to 9.6% (day14, mean) and 19.3% (day 21, mean) for clone A7, which was significantly lower than that of YiP3 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 vs. YiP3). Clone B2 demonstrated a similar trend of increased proliferation, but the reduction was less pronounced compared to that of clone A7, with no significant difference in p-values observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003ec, d). Similar results were observed in CFSE-labeled CD4\u0026thinsp;+\u0026thinsp;TEM cells. On the 21st day of co-culture, proliferation increased to 22.7% (day 21, mean) for CD4\u0026thinsp;+\u0026thinsp;TEM cells in response to YiP3 stimulation, while clone A7 exhibited a significantly lower proliferation of 17.1% (day 21, mean) compared to that of YiP3 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 vs. YiP3). Clone B2 did not exhibit significant alterations compared with YiP3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003ec, d).\u003c/p\u003e \u003cp\u003eIn conclusion, triple-KO clone A7, with edited \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e genes, exhibited reduced immunogenicity when co-cultured with PBMCs of different HLA types, indicating its potential for immunological compatibility.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eAssessment of the HLA protein expression in EC\u003c/h2\u003e \u003cp\u003eWe differentiated clones A7 and B2 into ECs of mesoderm lineage and compared their differentiation capacities. Both YiP3 and clone A7 differentiated into ECs through the hemogenic mesoderm, displaying morphology similar to that of primary ECs. However, we observed a slightly different morphology for clone B2. Flow cytometry analysis of CD31 and VE-cadherin double-positive cells, markers for ECs, revealed percentages of 95.69, 91.9, and 0.36% for YiP3, clone A7, and clone B2, respectively. These results indicated that clone A7, with a differentiation rate of over 90% in ECs, exhibited normal differentiation ability. In contrast, clone B2 exhibited a diminished capacity to differentiate into ECs.\u003c/p\u003e \u003cp\u003eWestern blot analysis revealed that before IFN-γ stimulation, HLA-A, B, and C were not expressed in ECs derived from YiP3 and clones A7 and B2. However, following IFN-γ stimulation, HLA-A, B, and C were expressed in YiP3, whereas only HLA-C was expressed in clones A7 and B2, which indicated that HLA-A and B were not expressed. This confirmed that clone A7 retained its differentiation capacity into ECs, and under IFN-γ stimulation, HLA-A and B were not expressed, whereas HLA-C, which was not the target of gene editing, was expressed.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we aimed to generate immune-evasive iPSCs for gene editing using iPSCs with heterogeneous \u003cem\u003eHLA\u003c/em\u003e gene types. Using the CRISPR/CAS9 system, we knocked out \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e regions. While previous research has focused on editing \u003cem\u003eHLA\u003c/em\u003e genes using homozygous or partially homozygous iPSCs, the majority of iPSCs in practical applications are derived from donor somatic cells with heterozygous \u003cem\u003eHLA\u003c/em\u003e genes \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. In this study, we attempted gene editing in PBMC-derived iPSCs with heterogeneous alleles in the \u003cem\u003eHLA\u003c/em\u003e region, addressing the technical challenge of editing three genes (\u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e) that can be sliced by a common gRNA. The selected triple-KO clone (clone A7) demonstrated gene knockout at the RNA level and confirmed the absence of HLA-A, B, and DR proteins upon IFN-γ stimulation at the protein level, which was observed through flow cytometry. Additionally, we demonstrated that clone A7 retained pluripotency following gene editing. Moreover, when co-culturing CD4\u0026thinsp;+\u0026thinsp;T cells obtained from PBMCs, which have different HLA types compared to YiP3, alongside INFγ-stimulated triple KO clone A7, the proliferation of TCM and TEM cells was significantly reduced compared to that of unedited iPSC YiP3. This confirmed the absence of immune evasion in clone A7.\u003c/p\u003e \u003cp\u003eRecent research has been focused on generating universal iPSCs by editing \u003cem\u003eHLA\u003c/em\u003e genes. Additionally, studies have aimed to edit \u003cem\u003eHLA\u003c/em\u003e genes in ESCs \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e and completely eliminate MHC class I genes using \u003cem\u003eβ2M\u003c/em\u003e KO and MHC class II genes using \u003cem\u003eCIITA\u003c/em\u003e KO in iPSCs \u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Recent studies have been conducted on selecting \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e and knocking out one \u003cem\u003eHLA\u003c/em\u003e gene at a time \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. In this study, considering the risk of NK cell or macrophage attacks that may occur in cases where all \u003cem\u003eHLA\u003c/em\u003e genes are eliminated\u0026mdash;we chose to retain minor \u003cem\u003eHLA-C\u003c/em\u003e and selected \u003cem\u003eHLA-A\u003c/em\u003e and \u003cem\u003eHLA-B\u003c/em\u003e for KO, while implementing a strategy to KO \u003cem\u003eHLA-DRA\u003c/em\u003e to eliminate HLA-DR protein expression. While previous studies have focused on knocking out \u003cem\u003eHLA-DRB1\u003c/em\u003e, we disrupted the protein structure of HLA-DR by knocking out \u003cem\u003eHLA-DRA\u003c/em\u003e gene. To design gRNA for knock out, we used immuno polymorphism database-international immunogenetics information system (IPD-IMGT)/HLA database, which reflects the polymorphism of \u003cem\u003eHLA\u003c/em\u003e genes. The validation of gRNA design ensured the selection of common regions shared by both alleles.\u003c/p\u003e \u003cp\u003eTo assess the KO efficiency of gRNA candidates, we initially performed electroporation followed by Sanger sequencing. One gRNA was selected for each \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e gene. To attempt triple KO using the selected gRNAs, we determined the amount of RNP to be transfected and executed the procedure accordingly. Upon confirming the KO efficiency through Sanger sequencing, we obtained clone A7, which exhibited 1-bp insertion, 28-bp deletion, and 1-bp deletion in the \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e regions, respectively. To select the final triple KO clone, we initially selected 48 clones and confirmed clone A7 through NGS, pluripotency assays, karyotyping, and WGS \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. During the clone selection process, clones A7 and B2 emerged as strong candidates based on NGS analysis, with B3 and B11 as secondary options. Because triple-KO iPSCs should retain pluripotency following gene editing, iPSC quality control was conducted. Among the candidate clones, B3 was excluded because of its significantly low NANOG expression in protein analysis following gene editing. In contrast, B11 was disregarded because of abnormal karyotyping results. The candidate clones excluded from the clone selection process displayed normal morphology; however, they exhibited different outcomes compared to those of YiP3 in quality control parameters, such as pluripotency, karyotype, and NGS analysis. To further compare clones A7 and B2, they were differentiated into ECs of a mesoderm lineage. When comparing differentiation rates, clone A7 exhibited a differentiation rate similar to that of the pre-gene-edited YiP3, indicating that the triple KO did not affect differentiation. However, clone B2 exhibited a significantly lower efficiency in EC differentiation, resulting in its exclusion from the final clone selection.\u003c/p\u003e \u003cp\u003eHLA protein expression was not observed in iPSCs or differentiated cells. In this study, we assessed HLA expression in iPSCs upon INF-γ stimulation, which marked the first instance of this phenomenon \u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. Flow cytometry results revealed that clones A7 and B2 did not express HLA-A, B, or DR proteins upon INFγ stimulation. HLA-DR exhibited consistently low protein expression in iPSCs, which did not significantly increase upon INF-γ stimulation but was reduced following gene editing. Before INF-γ stimulation, HLA-A and B proteins were not expressed during EC differentiation \u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. However, YiP3 was expressed before gene editing, whereas clones A7 and B2 demonstrated no expression. HLA-C expression was retained throughout the study period. However, HLA-DR and DRA expression was not confirmed upon INF-γ stimulation in differentiated ECs. While HLA-DR protein expression has been documented in ECs \u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e, it was not observed in our differentiated cells. Because of its abundance in immune cells \u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e, further assessment is required.\u003c/p\u003e \u003cp\u003eTo use universal iPSCs as cell therapeutics, it is essential to conduct immunogenicity testing. In this study, we performed \u003cem\u003ein vitro\u003c/em\u003e immunogenicity tests instead of mouse models because of the challenges in studying memory T cells owing to interspecies differences \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. We used PBMCs from donors with different HLA types from the HLA type of YiP3 before gene editing. CD4\u0026thinsp;+\u0026thinsp;T cells were labeled using CFSE to assess their proliferation in response to stimulation with YiP3, and clones A7 and B2, which served as antigenic stimuli. T cell activation was initiated using IFN-γ-stimulated iPSCs two days prior, and the proliferation of central memory T cells and effector memory T cells was examined. We observed reduced proliferation levels in clone A7 compared to those in YiP3, indicating that clone A7 failed to induce T cell proliferation because of the absence of \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e expression.\u003c/p\u003e \u003cp\u003eiPSCs have the potential to differentiate into various cell types, including ECs, neurons, cardiac cells, and immune cells \u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e. Because of their ability to proliferate indefinitely and differentiate into all three germ layers, iPSCs exhibit immense potential for cell therapies. Clinical trials involving the transplantation of allogeneic iPSCs have primarily focused on immune-privileged sites, such as the eye and cartilage \u003csup\u003e\u003cspan additionalcitationids=\"CR56\" citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. However, for transplantation into tissues associated with immune responses, such as the cardiovascular system, immune cells, and kidneys, it is crucial to use hypoimmunogenic iPSCs with immunoevasive properties as the source cells \u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThis study demonstrates the selection of clones that selectively KO \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e genes through various quality control measures, indicating their suitability for therapeutic applications. These \u003cem\u003eHLA\u003c/em\u003e-KO iPSC clones hold promise for cell therapy and the development of iPSC-derived organoid therapies. While currently used for research purposes, advancing these iPSCs to clinical-grade status involves production within good manufacturing practice (GMP) facilities and adherence to regulatory science standards \u003csup\u003e\u003cspan additionalcitationids=\"CR60\" citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u003c/sup\u003e. With such advancements, it is conceivable that clinical-grade universal iPSCs may be developed for research and development purposes.\u003c/p\u003e \u003cp\u003eWe generated hypoimmunogenic iPSC clone A7 by knocking out the \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e genes in PBMC-derived iPSCs with heterozygous \u003cem\u003eHLA\u003c/em\u003e gene types. We confirmed that this clone retains the pluripotency of iPSCs and confirmed its genetic stability using various sequencing methods. Our results establish a strategy and quality standards for selectively using triple-KO iPSCs lacking \u003cem\u003eHLA-A\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e as universally accepted iPSCs devoid of immunogenicity. Our findings offer significant criteria and methodologies for the future development of clinical-grade universal iPSCs.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJK designed and performed the experiments, analyzed the results, and wrote the manuscript. YN analyzed the results, and wrote the manuscript. DJ performed the experiments and data analysis. YC performed experiments and data analysis. SC performed informatics data analysis. CH performed informatics data analysis. HJ generated iPSC. NP generated iPSC. YS performed statistical analysis. YAR helped analyze the results and Correspondence the manuscript JHJ helped analyze the results and Correspondence the manuscript. All authors read and approved the final draft of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by a grant of Tech Investor Program for Scale-up, funded and Korea Technology and Information Promotion Agency for SMEs through Ministry of SMEs and Startups (grant number: RS-2023-00302955), as well as a grant of the Korea Health Technology R\u0026amp;D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health \u0026amp; Welfare, Republic of Korea (grant number: HI23C1234). Additionally, this work was supported by the Technology Innovation Program (or Industrial Strategic Technology Development Program) funded By the Ministry of Trade, Industry \u0026amp; Energy (MOTIE, Korea) (grant number:20024297), and supported by the Ministry of Education of the Republic of Korea and the National Research Foundation of Korea (grant number: NRF-2023M3A9E4009811)\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eThanaskody, K. \u003cem\u003eet al.\u003c/em\u003e MSCs vs. iPSCs: Potential in therapeutic applications. Front. Cell Dev. Biol. 10, 1005926 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakahashi, K. \u003cem\u003eet al.\u003c/em\u003e Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861\u0026ndash;872 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBellin, M., Marchetto, M.C., Gage, F.H. \u0026amp; Mummery, C.L. Induced pluripotent stem cells: the new patient? Nat. Rev. Mol. Cell Biol. 13, 713\u0026ndash;726 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, X., Li, W., Fu, X. \u0026amp; Xu, Y. The immunogenicity and immune tolerance of pluripotent stem cell derivatives. Front. Immunol. 8, 645 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMontgomery, R.A., Tatapudi, V.S., Leffell, M.S. \u0026amp; Zachary, A.A. HLA in transplantation. Nat. Rev. Nephrol. 14, 558\u0026ndash;570 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuneton, C., Winterberg, P.D. \u0026amp; Ford, M.L. Activation and regulation of alloreactive T cell immunity in solid organ transplantation. Nat. Rev. Nephrol. 18, 663\u0026ndash;676 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetrus-Reurer, S. \u003cem\u003eet al.\u003c/em\u003e Immunological considerations and challenges for regenerative cellular therapies. Commun. Biol. 4, 798 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakamura, T., Shirouzu, T., Nakata, K., Yoshimura, N. \u0026amp; Ushigome, H. The role of major histocompatibility complex in organ transplantation-donor specific anti-major histocompatibility complex antibodies analysis goes to the next stage. Int. J. Mol. Sci. 20, 4544 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRadwan, J., Babik, W., Kaufman, J., Lenz, T.L. \u0026amp; Winternitz, J. Advances in the evolutionary understanding of MHC polymorphism. Trends. Genet. 36, 298\u0026ndash;311 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoche, P.A. \u0026amp; Furuta, K. The ins and outs of MHC class II-mediated antigen processing and presentation. Nat. Rev. Immunol. 15, 203\u0026ndash;216 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeuse, T. \u003cem\u003eet al.\u003c/em\u003e Hypoimmunogenic derivatives of induced pluripotent stem cells evade immune rejection in fully immunocompetent allogeneic recipients. Nat. Biotechnol. 37, 252\u0026ndash;258 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBray, R.A. \u003cem\u003eet al.\u003c/em\u003e National marrow donor program HLA matching guidelines for unrelated adult donor hematopoietic cell transplants. Biol. Blood Marrow Transplant. 14, 45\u0026ndash;53 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheldon, S. \u0026amp; Poulton, K. HLA typing and its influence on organ transplantation. Transplant. Immunol.: Methods and protocols 333, 157\u0026ndash;174 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMandai, M. \u003cem\u003eet al.\u003c/em\u003e Autologous induced stem-cell-derived retinal cells for macular degeneration. N. Engl. J. Med. 376, 1038\u0026ndash;1046 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchweitzer, J.S. \u003cem\u003eet al.\u003c/em\u003e Personalized iPSC-derived dopamine progenitor cells for Parkinson's disease. N. Engl. J. Med. 382, 1926\u0026ndash;1932 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRim, Y.A. \u003cem\u003eet al.\u003c/em\u003e Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. J. Tissue Eng. Regen. Med. 12, e1531-e1536 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOkita, K. \u003cem\u003eet al.\u003c/em\u003e A more efficient method to generate integration-free human iPS cells. Nat. Methods 8, 409\u0026ndash;412 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRan, F.A. \u003cem\u003eet al.\u003c/em\u003e Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281\u0026ndash;2308 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu, Y. \u003cem\u003eet al.\u003c/em\u003e Safety and feasibility of CRISPR-edited T cells in patients with refractory non-small-cell lung cancer. Nat. Med. 26, 732\u0026ndash;740 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOttaviano, G. \u003cem\u003eet al.\u003c/em\u003e Phase 1 clinical trial of CRISPR-engineered CAR19 universal T cells for treatment of children with refractory B cell leukemia. Sci. Transl. Med. 14, eabq3010 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrionfini, P. \u003cem\u003eet al.\u003c/em\u003e Hypoimmunogenic human pluripotent stem cells as a powerful tool for lLiver regenerative medicine. Int. J. Mol. Sci. 24, 11810 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB\u0026ouml;rger, A.K. \u003cem\u003eet al.\u003c/em\u003e Generation of HLA-universal iPSC-derived megakaryocytes and platelets for survival under refractoriness conditions. Mol. Med. 22, 274\u0026ndash;285 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeuse, T. \u003cem\u003eet al.\u003c/em\u003e Hypoimmune induced pluripotent stem cell-derived cell therapeutics treat cardiovascular and pulmonary diseases in immunocompetent allogeneic mice. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e 118, e20220911 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKitano, Y. \u003cem\u003eet al.\u003c/em\u003e Generation of hypoimmunogenic induced pluripotent stem cells by CRISPR-Cas9 system and detailed evaluation for clinical application. Mol. Ther. Methods Clin. Dev. 26, 15\u0026ndash;25 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeng, B.C. \u003cem\u003eet al.\u003c/em\u003e A simple, quick, and efficient CRISPR/Cas9 genome editing method for human induced pluripotent stem cells. Acta. Pharmacol. Sin. 41, 1427\u0026ndash;1432 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThongsin, N. \u0026amp; Wattanapanitch, M. Generation of B2M bi-allelic knockout human induced pluripotent stem cells (MUSIi001-A-1) using a CRISPR/Cas9 system. Stem Cell Res. 56, 102551 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuzuki, D. \u003cem\u003eet al.\u003c/em\u003e iPSC-derived platelets depleted of HLA class I are inert to anti-HLA class I and natural killer cell immunity. Stem Cell Rep. 14, 49\u0026ndash;59 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong, C. \u003cem\u003eet al.\u003c/em\u003e Generation of individualized immunocompatible endothelial cells from HLA-I-matched human pluripotent stem cells. Stem Cell Res. Ther. 13, 48 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMattapally, S. \u003cem\u003eet al.\u003c/em\u003e Human leukocyte antigen class I and II knockout human induced pluripotent stem cell-derived cells: universal donor for cell therapy. J. Am. Heart Assoc. 7, e010239 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, B. \u003cem\u003eet al.\u003c/em\u003e Generation of hypoimmunogenic T cells from genetically engineered allogeneic human induced pluripotent stem cells. Nat. Biomed. Eng. 5, 429\u0026ndash;440 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, N. \u003cem\u003eet al.\u003c/em\u003e HLA-E is a major ligand for the natural killer inhibitory receptor CD94/NKG2A. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e 95, 5199\u0026ndash;5204 (1998).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerreira, L.M.R., Meissner, T.B., Tilburgs, T. \u0026amp; Strominger, J.L. HLA-G: at the interface of maternal-fetal tolerance. Trends. Immunol. 38, 272\u0026ndash;286 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeuse, T. \u003cem\u003eet al.\u003c/em\u003e Hypoimmunogenic derivatives of induced pluripotent stem cells evade immune rejection in fully immunocompetent allogeneic recipients. Nat. Biotechnol. 37, 252\u0026ndash;258 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeuse, T. \u003cem\u003eet al.\u003c/em\u003e The SIRPα-CD47 immune checkpoint in NK cells. J. Exp. Med. 218, e20200839 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFlahou, C., Morishima, T., Takizawa, H. \u0026amp; Sugimoto, N. Fit-for-all iPSC-derived cell therapies and their evaluation in humanized mice with NK cell immunity. Front. Immunol. 12, 662360 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao, W. \u003cem\u003eet al.\u003c/em\u003e Strategies for genetically engineering hypoimmunogenic universal pluripotent stem cells. iScience. 23, 101162 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, H. \u003cem\u003eet al.\u003c/em\u003e Targeted disruption of HLA genes via CRISPR-Cas9 generates iPSCs with enhanced immune compatibility. Cell Stem Cell 24, 566\u0026ndash;578 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan, X. \u003cem\u003eet al.\u003c/em\u003e Generation of hypoimmunogenic human pluripotent stem cells. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e 116, 10441\u0026ndash;10446 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJang, Y. \u003cem\u003eet al.\u003c/em\u003e Development of immunocompatible pluripotent stem cells via CRISPR-based human leukocyte antigen engineering. Exp. Mol. Med. 51, 1\u0026ndash;11 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, A. \u003cem\u003eet al.\u003c/em\u003e Off-the-shelf, immune-compatible human embryonic stem cells generated via CRISPR-mediated genome editing. Stem Cell Rev. Rep. 17, 1053\u0026ndash;1067 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePalpant, N.J. \u003cem\u003eet al.\u003c/em\u003e Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nat. Protoc. 12, 15\u0026ndash;31 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRobinson, J. \u003cem\u003eet al.\u003c/em\u003e The IPD and IMGT/HLA database: allele variant databases. Nucleic Acids Res. 43, D423-431 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeissner, T.B., Schulze, H.S. \u0026amp; Dale, S.M. Immune editing: overcoming immune barriers in stem cell transplantation. Curr. Stem Cell Rep. 8, 206\u0026ndash;218 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoga, K., Wang, B. \u0026amp; Kaneko, S. Current status and future perspectives of HLA-edited induced pluripotent stem cells. Inflamm. Regen. 40, 23 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, X. \u003cem\u003eet al.\u003c/em\u003e Diminished expression of major histocompatibility complex facilitates the use of human induced pluripotent stem cells in monkey. Stem Cell Res. Ther. 11, 1\u0026ndash;14 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParent, A.V. \u003cem\u003eet al.\u003c/em\u003e Selective deletion of human leukocyte antigens protects stem cell-derived islets from immune rejection. Cell Rep. 36, 109538 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJo, H.Y. \u003cem\u003eet al.\u003c/em\u003e Development of genetic quality tests for good manufacturing practice-compliant induced pluripotent stem cells and their derivatives. Sci. Rep. 10, 3939 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKeskinen, P., Ronni, T., Matikainen, S., Lehtonen, A. \u0026amp; Julkunen, I. Regulation of HLA class I and II expression by interferons and influenza A virus in human peripheral blood mononuclear cells. Immunol. 91, 421\u0026ndash;429 (1997).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbrahimi, P. \u003cem\u003eet al.\u003c/em\u003e Efficient gene disruption in cultured primary human endothelial cells by CRISPR/Cas9. Circ. Res. 117, 121\u0026ndash;128 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaenaka, A. \u003cem\u003eet al.\u003c/em\u003e Interferon-γ-induced HLA Class II expression on endothelial cells is decreased by inhibition of mTOR and HMG-CoA reductase. FEBS. Open Bio. 10, 927\u0026ndash;936 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCouture, A. \u003cem\u003eet al.\u003c/em\u003e HLA-Class II artificial antigen presenting cells in CD4(+) T cell-based immunotherapy. Front. Immunol. 10, 447508 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePepper, M. \u0026amp; Jenkins, M.K. Origins of CD4(+) effector and central memory T cells. Nat. Immunol. 12, 467\u0026ndash;471 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWood, K.J., Bushell, A. \u0026amp; Hester, J. Regulatory immune cells in transplantation. Nat. Rev. Immunol. 12, 417\u0026ndash;430 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi, Y., Inoue, H., Wu, J.C. \u0026amp; Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nat. Rev. Drug Discov. 16, 115\u0026ndash;130 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSugita, S. \u003cem\u003eet al.\u003c/em\u003e Successful transplantation of retinal pigment epithelial cells from MHC homozygote iPSCs in MHC-matched models. Stem Cell Rep. 7, 635\u0026ndash;648 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbe, K. \u003cem\u003eet al.\u003c/em\u003e Engraftment of allogeneic iPS cell-derived cartilage organoid in a primate model of articular cartilage defect. Nat. Commun. 14, 804 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeinsberger, J., Reisinger, D. \u0026amp; Weber, B. Global trends in clinical trials involving pluripotent stem cells: a systematic multi-database analysis. NPJ Regen. Med. 5, 15 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtsuka, R., Wada, H., Murata, T. \u0026amp; Seino, K.I. Immune reaction and regulation in transplantation based on pluripotent stem cell technology. Inflamm. Regen. 40, 1\u0026ndash;9 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcKenna, D.H. \u0026amp; Perlingeiro, R.C.R. Development of allogeneic iPS cell-based therapy: from bench to bedside. EMBO Mol. Med. 15, e15315 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNeofytou, E., O'Brien, C.G., Couture, L.A. \u0026amp; Wu, J.C. Hurdles to clinical translation of human induced pluripotent stem cells. J. clin. Invest. 125, 2551\u0026ndash;2557 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDashnau, J.L. \u003cem\u003eet al.\u003c/em\u003e A risk-based approach for cell line development, manufacturing and characterization of genetically engineered, induced pluripotent stem cell-derived allogeneic cell therapies. Cytother. 25, 1\u0026ndash;13 (2023).\u003c/span\u003e\u003c/li\u003e \u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"experimental-and-molecular-medicine","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"emm","sideBox":"Learn more about [Experimental \u0026 Molecular Medicine](http://www.nature.com/emm/)","snPcode":"12276","submissionUrl":"https://mts-emm.nature.com/cgi-bin/main.plex","title":"Experimental \u0026 Molecular Medicine","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4354435/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4354435/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHypoimmunogenic universal induced pluripotent stem cells (iPSCs) were generated through the targeted disruption of key genes, including human leukocyte antigen (\u003cem\u003eHLA\u003c/em\u003e)-\u003cem\u003eA\u003c/em\u003e, \u003cem\u003eHLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DR alpha\u003c/em\u003e (\u003cem\u003eDRA\u003c/em\u003e), using the CRISPR/Cas9 system. This approach aimed to minimize immune recognition and enhance the potential of iPSCs for allogeneic therapy. Heterozygous iPSCs were used for guide RNA (gRNA) design and validation to facilitate the knockout (KO) of \u003cem\u003eHLA-A, HLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e genes. Electroporation of iPSCs using the selected gRNAs enabled the generation of triple-KO iPSCs, followed by single-cell cloning for clone selection. Clone A7, an iPSC with a targeted KO of \u003cem\u003eHLA-A, HLA-B\u003c/em\u003e, and \u003cem\u003eHLA-DRA\u003c/em\u003e genes, was identified as the final candidate. mRNA analysis revealed robust expression of pluripotency markers, such as octamer-binding transcription factor 4 (\u003cem\u003eOCT4\u003c/em\u003e), SRY (sex-determining region Y)-box 2 (\u003cem\u003eSOX2\u003c/em\u003e), Kr\u0026uuml;ppel-like factor 4 (\u003cem\u003eKLF4\u003c/em\u003e), Lin-28 homolog A (\u003cem\u003eLIN28\u003c/em\u003e), \u003cem\u003eand Nanog homeobox (NANOG)\u003c/em\u003e, while protein expression assays confirmed the presence of OCT4, stage-specific embryonic antigen 4 (SSEA4), NANOG, and tumor rejection antigen 1\u0026ndash;60 (TRA-1-60). Karyotype examination demonstrated no anomalies, and three germ layer differentiation assays confirmed differentiation potential. Following interferon-gamma (INF-γ) stimulation, the gene-corrected clone A7 exhibited the absence of HLA-A, HLA-B, and HLA-DR protein expression. Immunogenicity testing further confirmed the hypoimmunogenicity of Clone A7, which was evidenced by the absence of proliferation in central memory T cells (TCM) and effector memory T cells (TEM). In conclusion, Clone A7, a triple KO iPSC clone that demonstrates immune evasion properties, retained its intrinsic iPSC characteristics and exhibited no immunogenicity.\u003c/p\u003e","manuscriptTitle":"Generation of hypoimmunogenic universal iPSCs through HLA-type gene knockout","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-03 17:50:16","doi":"10.21203/rs.3.rs-4354435/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-07-22T04:37:09+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-07-03T15:02:42+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-07-02T12:50:45+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-06-21T06:14:36+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-06-18T05:40:40+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-06-17T06:49:52+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-03T00:09:42+00:00","index":"","fulltext":""},{"type":"submitted","content":"Experimental \u0026 Molecular Medicine","date":"2024-05-02T07:39:03+00:00","index":"","fulltext":""},{"type":"checksFailed","content":"","date":"2024-05-02T00:16:33+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-01T13:09:03+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"experimental-and-molecular-medicine","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"emm","sideBox":"Learn more about [Experimental \u0026 Molecular Medicine](http://www.nature.com/emm/)","snPcode":"12276","submissionUrl":"https://mts-emm.nature.com/cgi-bin/main.plex","title":"Experimental \u0026 Molecular Medicine","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3a3435a3-ee03-4378-bb4a-17b9f401bb55","owner":[],"postedDate":"July 3rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":33332732,"name":"Biological sciences/Stem cells/Pluripotent stem cells/Induced pluripotent stem cells"},{"id":33332733,"name":"Biological sciences/Biological techniques/Genetic engineering"}],"tags":[],"updatedAt":"2025-03-15T07:07:49+00:00","versionOfRecord":{"articleIdentity":"rs-4354435","link":"https://doi.org/10.1038/s12276-025-01422-3","journal":{"identity":"experimental-and-molecular-medicine","isVorOnly":false,"title":"Experimental \u0026 Molecular Medicine"},"publishedOn":"2025-03-14 04:00:00","publishedOnDateReadable":"March 14th, 2025"},"versionCreatedAt":"2024-07-03 17:50:16","video":"","vorDoi":"10.1038/s12276-025-01422-3","vorDoiUrl":"https://doi.org/10.1038/s12276-025-01422-3","workflowStages":[]},"version":"v1","identity":"rs-4354435","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4354435","identity":"rs-4354435","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}