Endogenous Retrovirus-Derived lnc-ALVE1-AS1 Exerts Antiviral Defense Against ALV-J Infection in Chicken Macrophages

Endogenous Retrovirus-Derived lnc-ALVE1-AS1 Exerts Antiviral Defense Against ALV-J Infection in Chicken Macrophages | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Endogenous Retrovirus-Derived lnc-ALVE1-AS1 Exerts Antiviral Defense Against ALV-J Infection in Chicken Macrophages Huan Luo, Xuming Hu, Huixian Wu, Gul Zaib, Wenxian Chai, Hengmi Cui This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1098883/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Endogenous retroviruses (ERVs) are remnants of ancient retroviral infections dating back many millions of years, and their derived transcripts with viral signatures are important sources of long noncoding RNAs (lncRNAs). We have previously shown that the chicken ERV-derived lncRNA lnc-ALVE1-AS1 exerts antiviral innate immunity in chicken embryo fibroblasts. However, it is not clear whether this endogenous retroviral RNA has a similar function in immune cells. Here, we found that lnc-ALVE1-AS1 was persistently inhibited in chicken macrophages after avian leukosis virus subgroup J (ALV-J) infection. Furthermore, overexpression of lnc-ALVE1-AS1 significantly inhibited the proliferation of exogenous ALV-J, whereas knockdown of lnc-ALVE1-AS1 promoted the proliferation of ALV-J in chicken macrophages. This phenomenon is attributed to the induction of antiviral innate immunity by lnc-ALVE1-AS1 in macrophages, whereas knockdown of lnc-ALVE1-AS1 had the opposite effect. Mechanistically, lnc-ALVE1-AS1 can be sensed by the cytosolic pattern recognition receptor TLR3 and trigger the type I interferons response. The present study provides novel insights into the antiviral defense of ERV-derived lncRNAs in macrophages and offers new strategies for future antiviral solutions. Veterinary Epidemiology Endogenous retroviruses lnc-ALVE1-AS1 Avian leukosis virus Macrophages Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Endogenous retroviruses (ERVs) are remnants of ancient retroviral infections dating back many millions of years, and they comprise nearly 8% of the human genome (Stoye 2012 ) and 3% of the chicken genome (Mason et al. 2016 ). Retroviral integration is an essential part of the endogenous retroviral lifestyle but is also a potential threat to the host. Recently, integrated chicken ERVs have been shown to have harmful impacts on poultry genetic traits and resistance (Mason et al. 2020 ). ERV activation has also been noted in various cancers, viral infections and autoimmunity, but whether ERVs contribute to these diseases is a highly controversial topic (Hayward and Katzourakis 2015 ). Because ERVs were once presumed to form much of the so-called redundant ‘junk’ DNA, without any function, or were recognized to have pathogenic potential and to be capable of causing harm to humans (Villarreal 2011 ), the biological effects of these endogenous retroviral elements beneficial to humans have largely been ignored and are currently not fully understood. Recently, it has been shown that certain ERVs are activated in mammalian preimplantation embryos and embryonic stem cells (Liu et al. 2019 ; Xue et al. 2013 ; Yan et al. 2013 ). They can rewire the core regulatory network of human embryonic stem cells (Kunarso et al. 2010 ) and display essential roles in pluripotency (Fort et al. 2014 ; Macfarlan et al. 2012 ) and early mammalian embryonic development (Grow et al. 2015 ; Wang et al. 2014 ). Importantly, ERV activation can be sensed by innate immune receptors and trigger antiviral innate immunity (Grandi and Tramontano 2018 ; Hurst and Magiorkinis 2015 ). Surprisingly, ERVs not only promote T cell selection and improve the sensitivity with which T cells react to retroviral infection (Young et al. 2012 ) but also mobilize B cells to rapidly produce antibodies against pathogenic antigens (Grasset and Cerutti 2014 ; Zeng et al. 2014 ). In general, ERVs have dual effects, harmful or beneficial, on host cell antiviral function. Only a few endogenous retroviral elements that have adapted to the evolution and plasticity of the host genome by positive selection have been adopted to regulate host gene expression and control cell function. These endogenous retroviral element-derived transcripts with viral signatures are important sources of noncoding RNAs (ncRNAs), which are sensed by innate immune receptors and trigger innate immunity. In mouse macrophages, a total of 1,278 full-length ERV-derived ncRNAs were identified, and among them, lnc-EPAV (ERV-derived lncRNA positively regulates antiviral responses) has been demonstrated to enhance host antiviral innate immunity (Zhou et al. 2019 ). The lnc-ALVE1-AS1 is transcribed from chicken ERVs ALVE1 was also shown to activate antiviral innate immunity and inhibit the proliferation of exogenous retrovirus ALV-J replication in nonimmune cells (Chen et al. 2019 ). However, it is not clear whether this endogenous retroviral RNA has a similar function in immune cells. Therefore, individual ERV-derived lncRNAs with these immune functions need to be extensively investigated to reveal the impacts of these lncRNAs on antiviral innate immunity in host immune cells. In this study, we explored the antiviral function of lncRNA lnc-ALVE1-AS1 derived from ALVE1 in macrophages. We found that lnc-ALVE1-AS1 was persistently inhibited in chicken macrophages after ALV-J infection. Overexpression of lnc-ALVE1-AS1 significantly inhibited the proliferation of ALV-J through the induction of antiviral innate immunity. Mechanistically, lnc-ALVE1-AS1 can be sensed by the cytosolic pattern recognition receptor TLR3 and trigger the type I interferons response. The present study provides novel insight into the antiviral defense of ERV-derived lncRNAs in macrophages. These results have important implications for the study of the antiviral function of ERVs and the development of new antiviral vaccines. Materials And Methods Cells, virus, and plasmids The chicken macrophage-like line HD11 were obtained from the Laboratory of Avian Preventive Medicine, Yangzhou University, China. HD11 cells are derived from chicken bone marrow and transformed with the avian myelocytomatosis virus MC29 (Beug et al. 1979 ). HD11 cells was cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) with 5% fetal bovine serum (FBS) at 41°C in 5% CO 2 and 95% humidity. Primary chicken embryo fibroblasts (CEFs) were prepared from 10-day-old specific pathogen-free (SPF) embryos of ALV-resistant G1 or ALV-susceptible G3 chickens obtained from Harbin Veterinary Research Institute (HVRI), the Chinese Academy of Agricultural Sciences. CEFs were cultured in DMEM with 5% FBS at 37°C in 5% CO 2 and 95% humidity. The JS09GY3 strain of ALV-J was obtained from the Laboratory of Avian Preventive Medicine, Yangzhou University, China. The plasmids pcDNA3.1- lnc-ALVE1-AS1 and pcDNA3.1-EGFP came from the plasmid bank in our laboratory. Viral infection HD11 cells were seeded into six-well plates and infected with the JS09GY3 strain of ALV-J at a multiplicity of infection (MOI) of 5. At 6, 12 and 24 h post infection (hpi), cells were collected for ALV-J proliferation analysis. CEFs were infected with the JS09GY3 strain of ALV-J at an MOI of 5 and then collected at 24 and 96 hpi for ALV-J proliferation analysis. Plasmid transfection HD11 cells were transfected with the control or lnc-ALVE1-AS1 plasmid using Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher Scientific, USA) for 36 h, and then total RNA and protein were collected for gene expression analysis. For viral infection experiments, HD11 cells were first infected with the ALV-J virus at a multiplicity of infection (MOI) of 5 for 12 h. Cells were then transfected with lnc-ALVE1-AS1 or the control plasmid using Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher Scientific, USA) for another 36 h and then collected for ALV-J proliferation analysis. RNA interference assays For knockdown of lnc-ALVE1-AS1 , HD11 cells were transfected with lnc-ALVE1-AS1 or control siRNA using Lipofectamine™ RNAiMAX Transfection Reagent (Thermo Fisher Scientific, USA) for 36 h, and then total RNA and protein were collected for gene expression analysis. For knockdown of TLR3, HD11 cells were first transfected with the control or TLR3 siRNA using Lipofectamine™ RNAiMAX Transfection Reagent for 12 h. Cells were then transfected with lnc-ALVE1-AS1 or control plasmid using Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher Scientific, USA) for another 36 h, and total RNA and cell supernatant were collected for gene expression analysis. The Stealth RNAi™ siRNAs specific for lnc-ALVE1-AS1 and chicken TLR3 siRNAs from previous studies (Chen et al. 2019 ; Hu et al. 2015 ; Hu et al. 2016a ) and the sequences of the Stealth siRNAs are described in Table 1 . Table 1 Primers used in this study Primer name Nucleotide sequence 5'-3' lnc-ALVE1-AS1 fwd GACTACTGCCATAACTAAGG lnc-ALVE1-AS1 rev CAGAAGTCACAGCCAGAT lnc-ALVE1-AS1 RT1 GATGGACAGACCGTTGAG lnc-ALVE1-AS1 RT2 CCTCATCCGTCTCGCTTA lnc-ALVE1-AS1 siRNA AS GACUCUGGAGCGGACAUCACUAUUA lnc-ALVE1-AS1 siRNA S UAAUAGUGAUGUCCGCUCCAGAGUC TLR3 Stealth_1 siRNA AS AAGUAAAUCAGAUUGCUGUACUCGG TLR3 Stealth_1 siRNA S CCGAGUACAGCAAUCUGAUUUACUU TLR3 Stealth_2 siRNA AS UGUUGCUGCAAUCCUAAAUUUGCUG TLR3 Stealth_2 siRNA S CAGCAAAUUUAGGAUUGCAGCAACA IFIH1 fwd GATTACCAGATGGAAGTTGC IFIH1 rev GGTAATGTAAACAGCCACTC TLR7 fwd CACACATTCAACTGGGGCAA TLR7 rev GGGAACGGTAGTCAGAAGGT MB21D1 fwd CGACACTGGAGCCTATTATT MB21D1 rev TTCCACGCTTTTTCCTTTTC IRF7 fwd GAGCCTCCTCCCTCAACAGT IRF7 rev AGGGACACAGGAAGGGAGTG IFN-α fwd TACGGCATCCTGCTGCTCAC IFN-α rev AGAGAAGGTGGCATCCTGGG IFN-β fwd GCCCACACACTCCAAAACACTG IFN-β rev TTGATGCTGAGGTGAGCGTTG MX1 fwd CCGCAACACAGAAATACAG MX1 rev TTATCTTGTGGCTGGTTCC OASL fwd CTGAAGGGGGAGATAGAGAA OASL rev TCTTGTTACTGTCCTTCACC IFITM3 fwd ATCGCCAAGGACTTCGTA IFITM3 rev ATGGAGAGGATGGTCACAA ALV-J env fwd TGCGTGCGTGGTATTATTTC ALV-J env rev AATGGTGAGGTCGCTGACTGT GAPDH fwd GAGAAACCAGCCAAGTATGA GAPDH rev CTGGTCCTCTGTGTATCCTA For viral infection experiments, HD11 cells were first transfected with the control or lnc-ALVE1-AS1 siRNA using Lipofectamine™ RNAiMAX Transfection Reagent (Thermo Fisher Scientific, USA) for 12 h. Cells were then infected with the ALV-J virus at a multiplicity of infection (MOI) of 5 for another 48 h and then collected for ALV-J proliferation analysis. Cell treatment After treatment with 100 µM Amlexanox (InvivoGen, California, USA) for 2 h, HD11 cells were then transfected with control or lnc-ALVE1-AS1 plasmid using Lipofectamine™ 3000 Transfection Reagent for another 36 h. Cell supernatant was then collected to detect the expression of the IFN-β gene, and total RNA was extracted to measure the expression of antiviral innate immunity-related genes. For TLR3 stimulation, HD11 cells were incubated for 24 h in medium containing TLR3 ligand (InvivoGen, California, USA), a synthetic analog of dsRNA poly (I:C) with a high molecular weight, and then collected for gene expression analysis. Reverse transcription-quantitative PCR (RT–qPCR) RT–qPCR assays were performed according to previous studies (Chen et al. 2019 ). Briefly, total RNA was extracted from chicken cells or tissues using TRIzol™ reagent (Thermo Fisher Scientific, USA) according to the manufacturer’s recommendations. The gDNA Eraser-treated RNA samples were reverse-transcribed with RT primers at 37°C for 15 minutes or strand-specific RT primers at 42°C for 15 minutes with PrimeScript® Reverse Transcriptase (TaKaRa, Japan). Quantitative PCR was then performed with gene-specific primers and SYBR Green Master Mix (TaKaRa, Japan) on the CFX Connect™ Real-Time PCR Detection System (Bio–Rad, California, USA). GAPDH RNA levels were used as internal controls to normalize gene expression. The strand-specific RT primers and gene-specific primers are listed in Table 1 . Protein extraction and immunoblotting Whole-cell lysates were prepared with Cell Lysis Buffer (Cell Signaling Technologies, USA), separated by 12% SDS–PAGE at 120 V for 90 min and transferred to polyvinylidene difluoride membranes at 50 V for 150 min. Membranes were blocked in TBST containing 5% nonfat dry milk (Bio–Rad, California, USA). Primary antibodies were incubated overnight at 4°C with agitation. The following antibodies were used to determine protein expression: rabbit anti-TLR3 (Novus Biologicals, USA), anti-GAPDH (Abcam, United Kingdom) and mouse monoclonal antibody JE9, which is specific to the envelope protein of ALV-J. After washing extensively with TBST, secondary antibodies (anti-rabbit or anti-mouse horseradish peroxidase conjugate) were incubated for 1 h at room temperature. After washing extensively with TBST, blots were developed using enhanced chemiluminescent detection reagents on the FluorChem Q imaging system (Protein Simple, USA). Immunofluorescence confocal microscopy Cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 20 min at room temperature, permeabilized with 0.25% Triton X-100 for 5 min, and blocked with 2% BSA for 30 min. Cells were then incubated with the mouse anti-ALV-J envelope protein (JE9 antibody) at room temperature for 1 h, followed by incubation with goat anti-mouse IgG conjugated with Alexa Fluor 488 dye (ab150081 Abcam, 1:200) at room temperature for 45 min. After five washes in PBST (PBS with 0.05% Tween), cells were stained with DAPI dye (Sigma, Shanghai, China) at room temperature for 10 min. Images were acquired using a Leica TCS SP8 confocal microscope, and data analysis was carried out with Leica LAS AF Lite (Leica Microsystems). RNA fluorescence in situ hybridization (FISH) RNA FISH was performed according to the manufacturer’s recommendations (RIBOBIO, Guang Zhou, China) and the previous study (Chen et al. 2019 ). Briefly, HD11 Cells were fixed with 4% paraformaldehyde in PBS for 20 min at room temperature, permeabilized with 0.25% Triton X-100 for 5 min, and blocked with 2% BSA for 30 min. Cells were then incubated overnight with the lnc-ALVE1-AS1 probe mix at 37°C. For colocalization studies, after RNA FISH, cells were subjected to immunofluorescence for TLR3 protein. The pictures were captured and merged with a Leica SP8 confocal microscope. Enzyme-linked immunosorbent assay (ELISA) The cytokine concentrations in the cell supernatants were measured with ELISA kits for chicken type I interferons IFN-α and IFN-β according to the manufacturer’s instructions (Shanghai Hengyuan Bioscience & Technology Company, China). The p27 antigen of ALV-J in the cell supernatants was measured by ELISA (IDEXX, Beijing, China) following the manufacturer’s instructions. Statistical analyses The statistical analysis was performed with the Statistical Package for the Social Sciences (version 16.0) software. Statistical significance was assessed using a two-tailed unpaired Student’s t -test with a P value threshold of < 0.05. Results ALV-J inhibits the expression of lnc-ALVE1-AS1 in macrophages The influence of exogenous virus ALV-J infection on the expression of lnc-ALVE1-AS1 in macrophages was measured by RT–qPCR. As shown in Fig. 1 , the expression of lnc-ALVE1-AS1 in the chicken macrophage cell line HD11 was persistently downregulated from 6 to 48 hpi and significantly downregulated at 24 h and 48 h after ALV-J infection. These results suggest that lnc-ALVE1-AS1 might be involved in the antiviral response to ALV-J infection in chicken macrophages. Inhibition of ALV-J proliferation by lnc-ALVE1-AS1 in macrophages To confirm the role of lnc-ALVE1-AS1 in antiviral defense, macrophages were transfected with lnc-ALVE1-AS1 after ALV-J infection, and then the influence of lnc-ALVE1-AS1 on ALV-J proliferation was assessed. Compared with the control group, transfection of lnc-ALVE-AS1 significantly inhibited the expression of the ALV-J env gene at both the mRNA and protein levels in HD11 cells (Fig. 2 a and b). TCID 50 and ELISA analysis results also showed that overexpression of lnc-ALVE-AS1 led to significant reductions in viral titers and viral protein in the culture medium of HD11 cells infected with ALV-J (Fig. 2 c and d). The confocal immunofluorescence microscopy analysis results shown in Fig. 2 e further confirmed the inhibition of lnc-ALVE-AS1 on ALV-J proliferation in chicken macrophages. Knockdown of lnc-ALVE1-AS1 can promote the replication of ALV-J in macrophages Knockdown of lnc-ALVE-AS1 by RNAi in macrophages was performed to further confirm the role of lnc-ALVE1-AS1 in antiviral defense. Conversely, knockdown of lnc-ALVE-AS1 significantly increased the expression of the ALV-J env gene at both the mRNA and protein levels in HD11 cells (Fig. 3 a and b). TCID 50 and ELISA analysis results also showed that knockdown of lnc-ALVE-AS1 led to significant increases in viral titers and viral protein levels in the culture medium of HD11 cells infected with ALV-J (Fig. 3 c and d). Our data collectively indicate that lnc-ALVE1-AS1 may possess a function in antiviral defense in chicken macrophages. lnc-ALVE1-AS1 triggers antiviral innate immunity in macrophages Since lnc-ALVE1-AS1 can block the proliferation of ALV-J in macrophages, we next investigated the influence of lnc-ALVE1-AS1 on the expression of host genes involved in antiviral innate immunity. In chicken macrophages, lnc-ALVE1-AS1 triggered an interferon response, which included type I interferons (IFN-α and IFN-β) and a panel of interferon-stimulated genes (ISGs; MX1, OASL and IFITM3) (Fig. 4 a and b). Each ISG functions predominantly in antiviral innate immunity. Generally, the key upstream gene IRF7 in the type I interferon pathway was also upregulated by lnc-ALVE1-AS1 overexpression in macrophages. ELISA analysis further confirmed that the expression of IFN-α and IFN-β was induced by overexpression of lnc-ALVE1-AS1 (Fig. 4 c). However, knockdown of lnc-ALVE1-AS1 by RNAi led to significant decreases in the expression levels of IFN-α, IFN-β, IRF7, MX1, OASL and IFITM3 (Fig. 4 d and e). Knockdown of lnc-ALVE1-AS1 also decreased the concentrations of IFN-α and IFN-β in macrophages (Fig. 4 f). These results suggested that lnc-ALVE1-AS1 is involved in antiviral innate immunity, especially the antiviral interferon response. lnc-ALVE1-AS1 is involved in antiviral innate immunity by inducing TLR3 signaling We then sought to determine the molecular mechanism by which lnc-ALVE1-AS1 induced an antiviral interferon response. Several studies in mammals have reported that endogenous retroviral RNAs can trigger signaling by the cytosolic pattern recognition receptors IFIH1 and TLR3 (Chiappinelli et al. 2015 ; Licht 2015 ; Yu et al. 2012 ), which recognize double-stranded RNA (dsRNA) associated with virus infection. In HD11 cells, we found that lnc-ALVE1-AS1 only increased the transcript levels of cytosolic sensors for dsRNA (TLR3) but not IFIH1, MB21D1 or TLR7 (Fig. 5 a and b). Consistently, knockdown of lnc-ALVE1-AS1 caused a significant decrease in the expression levels of the TLR3 gene (Fig. 5 c). Western blot results further confirmed that overexpression of lnc-ALVE1-AS1 induced the expression of TLR3 protein in HD11 cells (Fig. 5 d), whereas knockdown of lnc-ALVE1-AS1 had the opposite effect (Fig. 5 e). RNA FISH combined with confocal immunofluorescence further confirmed the colocalization of lnc-ALVE1-AS1 and TLR3 in HD11 cells (Fig. 5 f). Thus, TLR3 could be an important dsRNA recognition receptor for lnc-ALVE1-AS1 to induce an interferon response. We next investigated whether lnc-ALVE1-AS1 affects the expression of antiviral innate immunity genes through TLR3 signaling. We observed that knockdown of TLR3 by RNAi significantly blunted the lnc-ALVE1-AS1 -induced type I interferon (IFN-α and IFN-β) response in HD11 cells (Fig. 5 g). Furthermore, inhibition of the TLR3-type I interferon signaling pathway with a TBK1/IKKε inhibitor (Amlexanox) also significantly blunted the expression of IFN-α and IFN-β induced by lnc-ALVE1-AS1 (Fig. 5 h). In addition, activation of TLR3 by the TLR3 ligand induced lnc-ALVE1-AS1 expression in HD11 cells (Fig. 5 i). These results indicate that lnc-ALVE1-AS1 can be sensed by the innate immune receptor TLR3 and trigger the TLR3-induced interferon response. lnc-ALVE1-AS1 exerts innate immune resistance to ALV-J in chickens Next, we investigated the antiviral innate immune function of lnc-ALVE1-AS1 in chickens. First, we found that the expression level of lnc-ALVE-AS1 in ALV-resistant (G1) chicken immune organs (thymus, spleen, and bursa of Fabricius) was significantly higher than that in ALV-susceptible (G3) chickens (Fig. 6 a). Viral infection experiments showed that the ALV-J replication level in CEFs of ALV-resistant G1 chickens at 24 and 96 hpi was significantly lower than that in CEFs of ALV-susceptible G3 chickens, whereas the lnc-ALVE1-AS1 expression level showed the opposite results (Fig. 6 b and c). Furthermore, the expression of lnc-ALVE1-AS1 was significantly downregulated in ALV-resistant G1 and ALV-susceptible G3 chicken CEFs infected with ALV-J at 24 and 96 hpi (Fig. 6 d and e). However, the decrease in lnc-ALVE1-AS1 expression was more obvious in ALV-susceptible G3 chicken CEFs. It was further confirmed that overexpression of lnc-ALVE1-AS1 could inhibit ALV-J replication in ALV-susceptible G3 chicken CEFs (Fig. 6 f). Overexpression of lnc-ALVE1-AS1 also increased the expression levels of the dsRNA recognition receptor TLR3 and antiviral innate immune genes, including IFN-α, IFN-β and IFITM3 (Fig. 6 g-i). These results suggested that high-level expression of lnc-ALVE1-AS1 in ALV-resistant chickens is associated with host viral resistance. Discussion ERVs have adapted long-term evolutionary selection by the host and are important sources and evolutionary origins of various regulatory non-coding RNAs, including lncRNAs, microRNAs, and piRNAs. When these ERV-derived ncRNAs are activated by exogenous infections or other stimuli, they may activate the functions of immune cells, including B cells, T cells and macrophages. The long noncoding RNA lnc-ALVE1-AS1 is derived from chicken ERV ALVE1 (Chen et al. 2019 ), which contains LTR, gag, pol and env regions and is 7.5 kb in length. It is located on chromosome 1 (Tereba et al. 1979 ) and is regulated by DNA methylation (Groudine et al. 1981 ). Chicken ERV ALVE1 is highly homologous to exogenous retrovirus ALVs and thus provides a unique model for investigating the interaction between endogenous and exogenous retroviruses as well as the symbiotic relationship and interplay between ERVs and innate immunity (Chen et al. 2019 ; Hu et al. 2016b ; Hu et al. 2017 ). In this study, we found that lnc-ALVE1-AS1 inhibited the proliferation of ALV-J by activating antiviral immunity in chicken macrophages. Inhibition of virus proliferation by lncRNAs derived from ERVs was also observed in mouse macrophages (Zhou et al. 2019 ). The piRNA derived from the chicken endogenous retrovirus ALVE may be involved in resistance to ALV (Sun et al. 2017 ). Therefore, noncoding RNAs such as lncRNAs and piRNAs derived from the chicken endogenous retrovirus ALVE may be an important part of the cellular immune response to enhance the host's resistance to foreign viral infections. Activation of the type I interferon response mediated by TLR3 signaling may be an important mechanism by which lnc-ALVE1-AS1 inhibits the proliferation of ALV-J in chicken macrophages (a working model is shown in Fig. 7 ). It has been shown that lnc-ALVE1-AS1 activates TLR3 signaling in chicken CEFs (Chen et al. 2019 ). In this study, we further found that lnc-ALVE1-AS1 significantly activates the expression of antiviral innate immune genes such as TLR3 and type I interferons (IFN-α and IFN-β) in chicken macrophages. However, the effect of lnc-ALVE1-AS1 is significantly reduced after interfering with TLR3 or suppressing TLR3 signaling. Confocal localization analysis showed that lnc-ALVE1-AS1 can directly bind to TLR3 protein in macrophages. In addition, studies have also found that TLR3 ligand stimulation can induce abnormal expression of a large number of lncRNAs (Wang et al. 2016 ), suggesting that lncRNAs could be an important signal for TLR3 recognition and a regulator of innate immunity (Murphy and Medvedev 2016 ). These results indicate that the induction of TLR3 signaling is an important mechanism by which lnc-ALVE1-AS1 activates antiviral innate immunity. TLR3 is an important double-stranded RNA (dsRNA) recognition receptor and participates in the antiviral immune response (Beutler 2004 ). Studies have shown that RNAs derived from endogenous retroviruses can be recognized by TLR3 protein and activate antiviral innate immunity. Several studies in mammals have reported that endogenous retroviral RNAs can trigger interferon signaling by the cytosolic pattern recognition receptors MDA5 and TLR3 (Chiappinelli et al. 2015 ; Licht 2015 ; Yu et al. 2012 ). The past study has been shown that lnc-ALVE1-AS1 can be sensed by TLR3 in chicken CEFs (Chen et al. 2019 ). We also found that the key dsRNA recognition receptor TLR3 was significantly upregulated in macrophages transfected with lnc-ALVE1-AS1 , indicating that lnc-ALVE1-AS1 may form a dsRNA structure that can bind to TLR3. The long noncoding RNA lnc-ALVE1-AS1 is an antisense lncRNA that may form dsRNA with the sense RNA complementary to its sequences. In addition, some short dsRNA fragments may be formed in the secondary structure of lnc-ALVE1-AS1 . These dsRNAs may be recognized by TLR3 and activate antiviral innate immunity. This phenomenon is very similar to the observation that the DNA methylation inhibitor 5-Aza-dC induces an interferon response by activating endogenous retroviral dsRNA (Chiappinelli et al. 2015 ; Roulois et al. 2015 ). In addition, TLR3 can also recognize the virus-derived single-stranded RNA segments harboring stem structures with bulge/internal loops (Tatematsu et al. 2014 ; Tatematsu et al. 2013 ). However, it must be emphasized that the present study is not a simple repetition of past study although the results of lnc-ALVE1-AS1 inhibits ALV-J proliferation and activates TLR3 signaling in chicken macrophages are consistent with those in chicken CEFs (a non-immune cell). First, it is not clear whether this endogenous retroviral RNA has a similar function in immune cells before this study. Secondly, this study more comprehensively evaluated the resistance of lnc-ALVE1-AS1 to ALV-J in macrophages when compared with the single result of ALV-J inhibition by lnc-ALVE1-AS1 overexpression in chicken CEFs. Finally, the role of lnc-ALVE1-AS1 in the antiviral defense against ALV-J infection in vivo through ALV-resistant/susceptible chickens was evaluated only in this study. In conclusion, the present findings collectively show that lnc-ALVE1-AS1 exerts antiviral protective roles by triggering TLR3-induced antiviral innate immunity in macrophages. Individual lncRNAs with these immune functions remain to be extensively revealed in future research. Future advances in our understanding of ERV-derived lncRNA functions in immune cells are bound to generate new insights into the roles of these peaceful genome inhabitants in infection, inflammatory disease, autoimmunity, and cancer. Authors' Contributions All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Huan Luo, Xuming Hu, Huixian Wu, Gul Zaib, Wenxian Chai and Hengmi Cui. The first draft of the manuscript was written by Huan Luo and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Declarations Authors' Contributions All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Huan Luo, Xuming Hu, Huixian Wu, Gul Zaib, Wenxian Chai and Hengmi Cui. The first draft of the manuscript was written by Huan Luo and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Funding This study was supported by the National Natural Science Foundation of China (31602032, 81773013 and 91540117), Key Program of Changzhou Science and Technology Bureau (CE20202033) and the Priority Academic Program Development of Jiangsu Higher Education Institutions (Animal Science and Veterinary Medicine). Code or data availability All data and materials are available for publication. Ethics approval Animal experiment was performed in strict accordance with the recommendations provided in the Guide for the Care and Use of Laboratory Animals of Yangzhou University. The protocol was approved by the Committee on the Ethics of Animal Experiments of Yangzhou University (licence number: 06R015). Consent to participate Not applicable. Consent for publication Not Applicable. Conflicts of interest The authors declare that they have no competing interests. References Beug H, von Kirchbach A, Döderlein G, Conscience JF, Graf T (1979) Chicken hematopoietic cells transformed by seven strains of defective avian leukemia viruses display three distinct phenotypes of differentiation. Cell 18:375–390. https://doi.org/10.1016/0092-8674(79)90057-6 Beutler B (2004) Inferences, questions and possibilities in toll-like receptor signalling. Nature 430:257–263. https://doi.org/10.1038/nature02761 Chen S, Hu X, Cui IH et al (2019) An endogenous retroviral element exerts an antiviral innate immune function via the derived lncRNA lnc-ALVE1-AS1. Antiviral Res 170:104571. https://doi.org/10.1016/j.antiviral.2019.104571 Chiappinelli KB, Strissel PL, Desrichard A et al (2015) Inhibiting DNA methylation causes an interferon response in cancer via dsRNA including endogenous retroviruses. Cell 162:974–986. https://doi.org/10.1016/j.cell.2015.07.011 Fort A, Hashimoto K, Yamada D et al (2014) Deep transcriptome profiling of mammalian stem cells supports a regulatory role for retrotransposons in pluripotency maintenance. Nat Genet 46:558–566. https://doi.org/10.1038/ng.2965 Grandi N, Tramontano E (2018) Human endogenous retroviruses are ancient acquired elements still shaping innate immune responses. Front Immunol 9:2039. https://doi.org/10.3389/fimmu.2018.02039 Grasset EK, Cerutti A (2014) Immunology. Retroviral help for B cells. Science 346:1454–1455. https://doi.org/10.1126/science.aaa3263 Groudine M, Eisenman R, Weintraub H (1981) Chromatin structure of endogenous retroviral genes and activation by an inhibitor of DNA methylation. Nature 292:311–317. https://doi.org/10.1038/292311a0 Grow EJ, Flynn RA, Chavez SL et al (2015) Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells. Nature 522:221–225. https://doi.org/10.1038/nature14308 Hayward A, Katzourakis A (2015) Endogenous retroviruses. Curr Biol 25:R644–646. https://doi.org/10.1016/j.cub.2015.05.041 Hu X, Ye J, Qin A, Zou H, Shao H, Qian K (2015) Both microRNA-155 and virus-encoded miR-155 ortholog regulate TLR3 expression. PLoS ONE 10:e0126012. https://doi.org/10.1371/journal.pone.0126012 Hu X, Zou H, Qin A, Qian K, Shao H, Ye J (2016a) Activation of toll-like receptor 3 inhibits marek's disease virus infection in chicken embryo fibroblast cells. Arch Virol 161:521–528. https://doi.org/10.1007/s00705-015-2674-x Hu X, Zhu W, Chen S, Liu Y, Sun Z, Geng T, Wang X, Gao B, Song C, Qin A, Cui H (2016b) Expression of the env gene from the avian endogenous retrovirus ALVE and regulation by miR-155. Arch Virol 161:1623–1632. https://doi.org/10.1007/s00705-016-2833-8 Hu X, Zhu W, Chen S, Liu Y, Sun Z, Geng T, Song C, Gao B, Wang X, Qin A, Cui H (2017) Expression patterns of endogenous avian retrovirus ALVE1 and its response to infection with exogenous avian tumour viruses. Arch Virol 162:89–101. https://doi.org/10.1007/s00705-016-3086-2 Hurst TP, Magiorkinis G (2015) Activation of the innate immune response by endogenous retroviruses. J Gen Virol 96:1207–1218. https://doi.org/10.1099/jgv.0.000017 Kunarso G, Chia NY, Jeyakani J, Hwang C, Lu X, Chan YS, Ng HH, Bourque G (2010) Transposable elements have rewired the core regulatory network of human embryonic stem cells. Nat Genet 42:631–634. https://doi.org/10.1038/ng.600 Licht JD (2015) DNA methylation inhibitors in cancer therapy: the immunity dimension. Cell 162:938–939. https://doi.org/10.1016/j.cell.2015.08.005 Liu L, Leng L, Liu C et al (2019) An integrated chromatin accessibility and transcriptome landscape of human pre-implantation embryos. Nat Commun 10:364. https://doi.org/10.1038/s41467-018-08244-0 Macfarlan TS, Gifford WD, Driscoll S, Lettieri K, Rowe HM, Bonanomi D, Firth A, Singer O, Trono D, Pfaff SL (2012) Embryonic stem cell potency fluctuates with endogenous retrovirus activity. Nature 487:57–63. https://doi.org/10.1038/nature11244 Mason AS, Fulton JE, Hocking PM, Burt DW (2016) A new look at the LTR retrotransposon content of the chicken genome. BMC Genomics 17:688. https://doi.org/10.1186/s12864-016-3043-1 Mason AS, Lund AR, Hocking PM, Fulton JE, Burt DW (2020) Identification and characterisation of endogenous Avian Leukosis Virus subgroup E (ALVE) insertions in chicken whole genome sequencing data. Mob DNA 11:22. https://doi.org/10.1186/s13100-020-00216-w Murphy MB, Medvedev AE (2016) Long noncoding RNAs as regulators of toll-like receptor signaling and innate immunity. J Leukoc Biol 99:839–850. https://doi.org/10.1189/jlb.2RU1215-575R Roulois D, Loo Yau H, Singhania R et al (2015) DNA-demethylating agents target colorectal cancer cells by inducing viral mimicry by endogenous transcripts. Cell 162:961–973. https://doi.org/10.1016/j.cell.2015.07.056 Stoye JP (2012) Studies of endogenous retroviruses reveal a continuing evolutionary saga. Nat Rev Microbiol 10:395–406. https://doi.org/10.1038/nrmicro2783 Sun YH, Xie LH, Zhuo X, Chen Q, Ghoneim D, Zhang B, Jagne J, Yang C, Li XZ (2017) Domestic chickens activate a piRNA defense against avian leukosis virus. Elife 6:e24695. https://doi.org/10.7554/eLife.24695 Tatematsu M, Seya T, Matsumoto M (2014) Beyond dsRNA: toll-like receptor 3 signalling in RNA-induced immune responses. Biochem J 458:195–201. https://doi.org/10.1042/BJ20131492 Tatematsu M, Nishikawa F, Seya T, Matsumoto M (2013) Toll-like receptor 3 recognizes incomplete stem structures in single-stranded viral RNA. Nat Commun 4:1833. https://doi.org/10.1038/ncomms2857 Tereba A, Lai MM, Murti KG (1979) Chromosome 1 contains the endogenous RAV-0 retrovirus sequences in chicken cells. Proc Natl Acad Sci U S A 76:6486–6490. https://doi.org/10.1073/pnas.76.12.6486 Villarreal LP (2011) Viral ancestors of antiviral systems. Viruses 3: 1933-1958. https://doi.org/10.3390/v3101933 Wang J, Xie G, Singh M et al (2014) Primate-specific endogenous retrovirus-driven transcription defines naive-like stem cells. Nature 516:405–409. https://doi.org/10.1038/nature13804 Wang S, Li X, Zhao RC (2016) Transcriptome analysis of long noncoding RNAs in toll-like receptor 3-activated mesenchymal stem cells. Stem Cells Int 2016: 6205485. https://doi.org/10.1155/2016/6205485 Xue Z, Huang K, Cai C et al (2013) Genetic programs in human and mouse early embryos revealed by single-cell RNA sequencing. Nature 500:593–597. https://doi.org/10.1038/nature12364 Yan L, Yang M, Guo H et al (2013) Single-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells. Nat Struct Mol Biol 20:1131–1139. https://doi.org/10.1038/nsmb.2660 Young GR, Ploquin MJ, Eksmond U, Wadwa M, Stoye JP, Kassiotis G (2012) Negative selection by an endogenous retrovirus promotes a higher-avidity CD4+ T cell response to retroviral infection. PLoS Pathog 8:e1002709. https://doi.org/10.1371/journal.ppat.1002709 Yu P, Lübben W, Slomka H et al (2012) Nucleic acid-sensing toll-like receptors are essential for the control of endogenous retrovirus viremia and ERV-induced tumors. Immunity 37:867–879. https://doi.org/10.1016/j.immuni.2012.07.018 Zeng M, Hu Z, Shi X et al (2014) MAVS, cGAS, and endogenous retroviruses in T-independent B cell responses. Science 346:1486–1492. https://doi.org/10.1126/science.346.6216.1486 Zhou B, Qi F, Wu F et al (2019) Endogenous retrovirus-derived long noncoding RNA enhances innate immune responses via derepressing RELA expression. mBio 10:e00937–e00919. https://doi.org/10.1128/mBio.00937-19 Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 20 Dec, 2021 Reviewers invited by journal 19 Dec, 2021 Editor assigned by journal 17 Dec, 2021 First submitted to journal 16 Dec, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1098883","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":71144232,"identity":"b51086e3-aba1-4350-a9d0-472e94fa4200","order_by":0,"name":"Huan Luo","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Huan","middleName":"","lastName":"Luo","suffix":""},{"id":71144233,"identity":"fd431ff6-572b-41f7-a4f7-6009c95582db","order_by":1,"name":"Xuming Hu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAArUlEQVRIiWNgGAWjYBACAwYGxgcQZgLxWpgNSNbCJkGaFnOJ7LRqnj+HGfjZcwwYfu4gQotlz9ltt3l4DjNI9rwxYOw9Q4zDjvcCtUgcZjC4kWPAzNhGjJbDvNuKeQwOM9gTrwVoCzNPAtAWCaK1nDm7WXLOgXQeiTPPCg72EqXlRu7GD2/+WMvxtydvfPCTGC0gwMTDwMADYhwgUgMwxfwgWukoGAWjYBSMSAAAO2Qz00nzToQAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-6973-8252","institution":"Yangzhou University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xuming","middleName":"","lastName":"Hu","suffix":""},{"id":71144234,"identity":"96c6a046-a635-49c0-979b-1a38e1d0b43d","order_by":2,"name":"Huixian Wu","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Huixian","middleName":"","lastName":"Wu","suffix":""},{"id":71144235,"identity":"adfdfdd4-7a24-4952-a4a0-a030c047e4b5","order_by":3,"name":"Gul Zaib","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Gul","middleName":"","lastName":"Zaib","suffix":""},{"id":71144236,"identity":"b838a952-7f9e-4dfd-8247-5324218c5a6a","order_by":4,"name":"Wenxian Chai","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wenxian","middleName":"","lastName":"Chai","suffix":""},{"id":71144237,"identity":"dae421f2-f65f-4b7a-bcb1-f8d8aee51b7d","order_by":5,"name":"Hengmi Cui","email":"","orcid":"","institution":"Yangzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hengmi","middleName":"","lastName":"Cui","suffix":""}],"badges":[],"createdAt":"2021-11-20 15:12:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1098883/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1098883/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":16629606,"identity":"057f3ae1-5609-45e2-b210-67dba0dfadb6","added_by":"auto","created_at":"2021-12-20 19:39:58","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2817819,"visible":true,"origin":"","legend":"\u003cp\u003eALV-J inhibited the expression of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e in chicken macrophage cell line HD11. RT-qPCR\u003cstrong\u003e (a) \u003c/strong\u003eand Western blotting (\u003cstrong\u003eb\u003c/strong\u003e) analysis of ALV-J \u003cem\u003eenv \u003c/em\u003egene expression in HD11 cells at 6, 12, 24 and 48 hpi. \u003cstrong\u003e(c) \u003c/strong\u003eRT-qPCR analysis of \u003cem\u003elnc-ALVE1-AS1 expression\u003c/em\u003e in HD11 cells at 6, 12, 24 and 48 hpi. Error bars represent the s.d., n=3. *P \u0026lt; 0.05 and **P \u0026lt; 0.01 (two-tailed Student’s t-test).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-1098883/v1/057304d32cb6f4006ce4b52f.png"},{"id":16629611,"identity":"3b5eb260-6c15-4fe9-a0dd-59f4dc28a780","added_by":"auto","created_at":"2021-12-20 19:39:58","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":23017448,"visible":true,"origin":"","legend":"\u003cp\u003eOverexpression of \u003cem\u003elnc-ALVE1-AS1 \u003c/em\u003einhibited the proliferation of ALV-J in HD11 cells. HD11 cells were firstly infected with the ALV-J virus at MOI of 5 for 12 h and then transfected with \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e or the control for another 36 h.\u003cstrong\u003e \u003c/strong\u003eRT-qPCR\u003cstrong\u003e (a)\u003c/strong\u003e, Western blotting (\u003cstrong\u003eb\u003c/strong\u003e) and TCID\u003csub\u003e50\u003c/sub\u003e \u003cstrong\u003e(c) \u003c/strong\u003eanalysis of ALV-J \u003cem\u003eenv \u003c/em\u003egene expression in HD11 cells. \u003cstrong\u003e(d) \u003c/strong\u003eELISA analysis of ALV-J p27 protein expression in the supernatant of HD11 cells. \u003cstrong\u003e(e)\u003c/strong\u003e Confocal immunofluorescence microscopy analysis of ALV-J \u003cem\u003eenv \u003c/em\u003egene expression in HD11 cells. HD11 cells were incubated with the anti-ALV-J envelope protein (JE9 antibody) and then stained with goat anti-mouse IgG conjugated with the Alexa Fluor 488 dye (Sigma-Aldrich). The nuclei were stained with DAPI dye (Sigma-Aldrich). The pictures were captured and merged with a Leica SP8 confocal microscope (20×). Error bars represent the s.d., n=3. *P \u0026lt; 0.05 and **P \u0026lt; 0.01 (two-tailed Student’s t-test).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-1098883/v1/3fe1beb33a711814468de3f7.png"},{"id":16629693,"identity":"9d84cb7a-6c93-4f07-bb43-750b14dffcf1","added_by":"auto","created_at":"2021-12-20 19:42:58","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":7538261,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of \u003cem\u003elnc-ALVE1-AS1 \u003c/em\u003epromoted the proliferation of ALV-J in HD11 cells.\u003cstrong\u003e \u003c/strong\u003eHD11 cells were firstly transfected with the control or lnc-ALVE1-AS1 siRNA for 12 h and then infected with the ALV-J virus at a MOI of 5 for another 48 h.\u003cstrong\u003e \u003c/strong\u003eRT-qPCR\u003cstrong\u003e (a)\u003c/strong\u003e, Western blotting \u003cstrong\u003e(b) \u003c/strong\u003eand TCID\u003csub\u003e50\u003c/sub\u003e \u003cstrong\u003e(c) \u003c/strong\u003eanalysis of ALV-J \u003cem\u003eenv \u003c/em\u003egene expression in HD11 cells. \u003cstrong\u003e(d) \u003c/strong\u003eELISA analysis of ALV-J p27 protein expression in the supernatant of HD11 cells. Error bars represent the s.d., n=3. *P \u0026lt; 0.05 and **P \u0026lt; 0.01 (two-tailed Student’s t-test).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-1098883/v1/3672b1ff24afe1bde2e78d68.png"},{"id":16629607,"identity":"08cde595-0372-4b5f-8b84-7810dc419ab5","added_by":"auto","created_at":"2021-12-20 19:39:58","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":5038655,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e triggered antiviral innate immunity in macrophage.\u003cstrong\u003e \u003c/strong\u003eRelative expression analysis of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e \u003cstrong\u003e(a) \u003c/strong\u003eand innate immunity genes \u003cstrong\u003e(b)\u003c/strong\u003e in HD11 cells transfected with \u003cem\u003elnc-ALVE1-AS1 \u003c/em\u003efor 36 h. \u003cstrong\u003e(c) \u003c/strong\u003eELISA analysis of IFN-α and IFN-β expression in HD11 cells transfected with \u003cem\u003elnc-ALVE1-AS1 \u003c/em\u003efor 36 h. Relative expression analysis of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e \u003cstrong\u003e(d) \u003c/strong\u003eand innate immunity genes \u003cstrong\u003e(e)\u003c/strong\u003e in HD11 cells transfected with the \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e siRNA or control siRNA for 48 h. \u003cstrong\u003e(f) \u003c/strong\u003eELISA analysis of IFN-α and IFN-β expression in HD11 cells transfected with the \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e siRNA or control siRNA for 48 h. Error bars represent the s.d., n=3. *P \u0026lt; 0.05 and **P \u0026lt; 0.01 (two-tailed Student’s t-test).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-1098883/v1/0a809541364be15b09a9291c.png"},{"id":16629610,"identity":"3f409f37-5997-4236-ac55-5b81f71089b7","added_by":"auto","created_at":"2021-12-20 19:39:58","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":14863329,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e involved in antiviral innate immunity induced by TLR3 signalling. \u003cstrong\u003e(a) \u003c/strong\u003eRelative expression analysis of IFIH1, MB21D1 and TLR7 genes in HD11 cells transfected with \u003cem\u003elnc-ALVE1-AS1 \u003c/em\u003efor 36 h.\u003cstrong\u003e (b) \u003c/strong\u003eRelative expression analysis of TLR3 gene in HD11 cells transfected with \u003cem\u003elnc-ALVE1-AS1 \u003c/em\u003efor 36 h. \u003cstrong\u003e(c) \u003c/strong\u003eRelative expression analysis of TLR3 gene in HD11 cells transfected with the \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e siRNA or control siRNA for 48 h. Western blotting analysis of TLR3 protein expression in HD11 cells transfected with \u003cem\u003elnc-ALVE1-AS1 \u003c/em\u003efor 36 h \u003cstrong\u003e(d) \u003c/strong\u003eor with the \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e siRNA or control siRNA for 48 h \u003cstrong\u003e(e)\u003c/strong\u003e. \u003cstrong\u003e(f) \u003c/strong\u003eCo-localization of the \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e RNA with TLR3 protein in HD11 cells detected by the RNA FISH and immunofluorescence confocal microscopy assay. The pictures were captured and merged with a Leica SP8 confocal microscope (100×). \u003cstrong\u003e(g) \u003c/strong\u003eGene expression analysis of IFN-α and IFN-β genes in HD11 cells, which were firstly transfected with the control or TLR3 siRNA for 12 h and then transfected with \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e or the control for another 36 h. \u003cstrong\u003e(h) \u003c/strong\u003eGene expression analysis of IFN-α and IFN-β genes in the Amlexanox-mediated TLR3 pathway inhibition of HD11 cells, which firstly treated with 100 µM Amlexanox (TBK1/IKKε inhibitor) for 2 h and then transfected with the control or \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e for another 36 h. \u003cstrong\u003e(i) \u003c/strong\u003eRelative expression analysis of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e in HD11 cells incubated with TLR3 ligand (a synthetic analogue of dsRNA poly (I:C) with a high molecular weight) for 24 h. Error bars represent the s.d., n=3. *P \u0026lt; 0.05 and **P \u0026lt; 0.01 (two-tailed Student’s t-test).\u003c/p\u003e\u003cp\u003e\u0026nbsp;\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-1098883/v1/94ade43644b4b11266179da1.png"},{"id":16629609,"identity":"e9212306-a735-4fca-a0d4-3efc2d0b2ca0","added_by":"auto","created_at":"2021-12-20 19:39:58","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":9572274,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e exerts innate immune resistance to ALV-J in chickens. \u003cstrong\u003e(a) \u003c/strong\u003eRT-qPCR analysis of \u003cem\u003elnc-ALVE1-AS1 expression\u003c/em\u003e in the immune organs (thymus, spleen, and bursa of fabricius) of ALV resistant (G1) and susceptible (G3) chickens. \u003cstrong\u003e(b) \u003c/strong\u003eRT-qPCR analysis of ALV-J \u003cem\u003eenv \u003c/em\u003egene expression in CEF cells from ALV resistant (G1) and susceptible (G3) chickens. \u003cstrong\u003e(c)\u003c/strong\u003e RT-qPCR analysis of \u003cem\u003elnc-ALVE1-AS1 expression\u003c/em\u003e in CEF cells from ALV resistant (G1) and susceptible (G3) chickens. \u003cstrong\u003e(d) \u003c/strong\u003eRT-qPCR analysis of \u003cem\u003elnc-ALVE1-AS1 expression\u003c/em\u003e in the ALV resistant (G1) chicken CEF cells infected with ALV-J at 24 and 96 hpi. (\u003cstrong\u003ee) \u003c/strong\u003eRT-qPCR analysis of \u003cem\u003elnc-ALVE1-AS1 expression\u003c/em\u003e in the susceptible (G3) chicken CEF cells infected with ALV-J at 24 and 96 hpi.\u003cstrong\u003e (f) \u003c/strong\u003eRT-qPCR\u003cstrong\u003e \u003c/strong\u003eanalysis of ALV-J \u003cem\u003eenv \u003c/em\u003egene expression in the ALV susceptible (G3) chicken CEF cells, which firstly infected with the ALV-J virus at MOI of 5 for 12 h and then transfected with \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e or the control for another 36 h. RT-qPCR analysis of \u003cem\u003elnc-ALVE1-AS1 \u003c/em\u003e\u003cstrong\u003e(g)\u003c/strong\u003e and innate immunity genes \u003cstrong\u003e(h) \u003c/strong\u003eexpression in the ALV susceptible (G3) chicken CEF cells transfected with \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e or the control for 36 h. \u003cstrong\u003e(i) \u003c/strong\u003eELISA analysis of IFN-α and IFN-β expression in the ALV susceptible (G3) chicken CEF cells transfected with \u003cem\u003elnc-ALVE1-AS1 \u003c/em\u003efor 36 h. Error bars represent the s.d., n=3. *P \u0026lt; 0.05 and **P \u0026lt; 0.01 (two-tailed Student’s t-test).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-1098883/v1/8f172a488dd8cf49cf0f3a8e.png"},{"id":16629608,"identity":"db84644e-5b17-4f89-8b86-acd611282f31","added_by":"auto","created_at":"2021-12-20 19:39:58","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":383494,"visible":true,"origin":"","legend":"\u003cp\u003eA working model of TLR3-mediated antiviral interferons response triggered by \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e in macrophages. Chicken ERVs derived lncRNA \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e are sensed by TLR3, which recruit TRIF (Toll-IL1 receptor domain-containing adaptor inducing IFN-β) protein to the TIR domain of the receptor. This is followed by activation of IRF7 and led to production of interferons, which further induces the expression of interferon stimulated genes (ISGs). Ultimately, signals from TLR3 sensor promote antiviral innate immunity and inhibit the proliferation of ALV-J in chicken macrophages.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-1098883/v1/812b652137644bf1c84b50e6.png"},{"id":16629694,"identity":"55027b7a-a953-4c8a-9df0-26aaedccf27d","added_by":"auto","created_at":"2021-12-20 19:43:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":440040,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1098883/v1/94ffcb18-4f05-484c-a649-dd2e3fc856bc.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eEndogenous Retrovirus-Derived \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e Exerts Antiviral Defense Against ALV-J Infection in Chicken Macrophages\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEndogenous retroviruses (ERVs) are remnants of ancient retroviral infections dating back many millions of years, and they comprise nearly 8% of the human genome (Stoye \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) and 3% of the chicken genome (Mason et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Retroviral integration is an essential part of the endogenous retroviral lifestyle but is also a potential threat to the host. Recently, integrated chicken ERVs have been shown to have harmful impacts on poultry genetic traits and resistance (Mason et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). ERV activation has also been noted in various cancers, viral infections and autoimmunity, but whether ERVs contribute to these diseases is a highly controversial topic (Hayward and Katzourakis \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Because ERVs were once presumed to form much of the so-called redundant \u0026lsquo;junk\u0026rsquo; DNA, without any function, or were recognized to have pathogenic potential and to be capable of causing harm to humans (Villarreal \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), the biological effects of these endogenous retroviral elements beneficial to humans have largely been ignored and are currently not fully understood.\u003c/p\u003e \u003cp\u003eRecently, it has been shown that certain ERVs are activated in mammalian preimplantation embryos and embryonic stem cells (Liu et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Xue et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Yan et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). They can rewire the core regulatory network of human embryonic stem cells (Kunarso et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) and display essential roles in pluripotency (Fort et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Macfarlan et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) and early mammalian embryonic development (Grow et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Importantly, ERV activation can be sensed by innate immune receptors and trigger antiviral innate immunity (Grandi and Tramontano \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Hurst and Magiorkinis \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Surprisingly, ERVs not only promote T cell selection and improve the sensitivity with which T cells react to retroviral infection (Young et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) but also mobilize B cells to rapidly produce antibodies against pathogenic antigens (Grasset and Cerutti \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Zeng et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn general, ERVs have dual effects, harmful or beneficial, on host cell antiviral function. Only a few endogenous retroviral elements that have adapted to the evolution and plasticity of the host genome by positive selection have been adopted to regulate host gene expression and control cell function. These endogenous retroviral element-derived transcripts with viral signatures are important sources of noncoding RNAs (ncRNAs), which are sensed by innate immune receptors and trigger innate immunity. In mouse macrophages, a total of 1,278 full-length ERV-derived ncRNAs were identified, and among them, lnc-EPAV (ERV-derived lncRNA positively regulates antiviral responses) has been demonstrated to enhance host antiviral innate immunity (Zhou et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e is transcribed from chicken ERVs ALVE1 was also shown to activate antiviral innate immunity and inhibit the proliferation of exogenous retrovirus ALV-J replication in nonimmune cells (Chen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, it is not clear whether this endogenous retroviral RNA has a similar function in immune cells. Therefore, individual ERV-derived lncRNAs with these immune functions need to be extensively investigated to reveal the impacts of these lncRNAs on antiviral innate immunity in host immune cells.\u003c/p\u003e \u003cp\u003eIn this study, we explored the antiviral function of lncRNA \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e derived from ALVE1 in macrophages. We found that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e was persistently inhibited in chicken macrophages after ALV-J infection. Overexpression of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e significantly inhibited the proliferation of ALV-J through the induction of antiviral innate immunity. Mechanistically, \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e can be sensed by the cytosolic pattern recognition receptor TLR3 and trigger the type I interferons response. The present study provides novel insight into the antiviral defense of ERV-derived lncRNAs in macrophages. These results have important implications for the study of the antiviral function of ERVs and the development of new antiviral vaccines.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCells, virus, and plasmids\u003c/h2\u003e \u003cp\u003eThe chicken macrophage-like line HD11 were obtained from the Laboratory of Avian Preventive Medicine, Yangzhou University, China. HD11 cells are derived from chicken bone marrow and transformed with the avian myelocytomatosis virus MC29 (Beug et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1979\u003c/span\u003e). HD11 cells was cultured in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM; Gibco) with 5% fetal bovine serum (FBS) at 41\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e and 95% humidity. Primary chicken embryo fibroblasts (CEFs) were prepared from 10-day-old specific pathogen-free (SPF) embryos of ALV-resistant G1 or ALV-susceptible G3 chickens obtained from Harbin Veterinary Research Institute (HVRI), the Chinese Academy of Agricultural Sciences. CEFs were cultured in DMEM with 5% FBS at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e and 95% humidity. The JS09GY3 strain of ALV-J was obtained from the Laboratory of Avian Preventive Medicine, Yangzhou University, China. The plasmids pcDNA3.1-\u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e and pcDNA3.1-EGFP came from the plasmid bank in our laboratory.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eViral infection\u003c/h2\u003e \u003cp\u003eHD11 cells were seeded into six-well plates and infected with the JS09GY3 strain of ALV-J at a multiplicity of infection (MOI) of 5. At 6, 12 and 24 h post infection (hpi), cells were collected for ALV-J proliferation analysis. CEFs were infected with the JS09GY3 strain of ALV-J at an MOI of 5 and then collected at 24 and 96 hpi for ALV-J proliferation analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePlasmid transfection\u003c/h2\u003e \u003cp\u003eHD11 cells were transfected with the control or \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e plasmid using Lipofectamine\u0026trade; 3000 Transfection Reagent (Thermo Fisher Scientific, USA) for 36 h, and then total RNA and protein were collected for gene expression analysis. For viral infection experiments, HD11 cells were first infected with the ALV-J virus at a multiplicity of infection (MOI) of 5 for 12 h. Cells were then transfected with \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e or the control plasmid using Lipofectamine\u0026trade; 3000 Transfection Reagent (Thermo Fisher Scientific, USA) for another 36 h and then collected for ALV-J proliferation analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eRNA interference assays\u003c/h2\u003e \u003cp\u003eFor knockdown of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e, HD11 cells were transfected with \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e or control siRNA using Lipofectamine\u0026trade; RNAiMAX Transfection Reagent (Thermo Fisher Scientific, USA) for 36 h, and then total RNA and protein were collected for gene expression analysis. For knockdown of TLR3, HD11 cells were first transfected with the control or TLR3 siRNA using Lipofectamine\u0026trade; RNAiMAX Transfection Reagent for 12 h. Cells were then transfected with \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e or control plasmid using Lipofectamine\u0026trade; 3000 Transfection Reagent (Thermo Fisher Scientific, USA) for another 36 h, and total RNA and cell supernatant were collected for gene expression analysis. The Stealth RNAi\u0026trade; siRNAs specific for \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e and chicken TLR3 siRNAs from previous studies (Chen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Hu et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Hu et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2016a\u003c/span\u003e) and the sequences of the Stealth siRNAs are described in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNucleotide sequence 5'-3'\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACTACTGCCATAACTAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGAAGTCACAGCCAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e RT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATGGACAGACCGTTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e RT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTCATCCGTCTCGCTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003elnc-ALVE1-AS1 siRNA AS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACUCUGGAGCGGACAUCACUAUUA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003elnc-ALVE1-AS1 siRNA S\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eUAAUAGUGAUGUCCGCUCCAGAGUC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTLR3 Stealth_1 siRNA AS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGUAAAUCAGAUUGCUGUACUCGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTLR3 Stealth_1 siRNA S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGAGUACAGCAAUCUGAUUUACUU\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTLR3 Stealth_2 siRNA AS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eUGUUGCUGCAAUCCUAAAUUUGCUG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTLR3 Stealth_2 siRNA S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGCAAAUUUAGGAUUGCAGCAACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFIH1 fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATTACCAGATGGAAGTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFIH1 rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTAATGTAAACAGCCACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTLR7 fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACACATTCAACTGGGGCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTLR7 rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGAACGGTAGTCAGAAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMB21D1 fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGACACTGGAGCCTATTATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMB21D1 rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCCACGCTTTTTCCTTTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIRF7 fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGCCTCCTCCCTCAACAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIRF7 rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGACACAGGAAGGGAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFN-α fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACGGCATCCTGCTGCTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFN-α rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAGAAGGTGGCATCCTGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFN-β fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCCACACACTCCAAAACACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFN-β rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGATGCTGAGGTGAGCGTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMX1 fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGCAACACAGAAATACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMX1 rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTATCTTGTGGCTGGTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOASL fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGAAGGGGGAGATAGAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOASL rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTTGTTACTGTCCTTCACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFITM3 fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCGCCAAGGACTTCGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFITM3 rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGAGAGGATGGTCACAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALV-J \u003cem\u003eenv\u003c/em\u003e fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCGTGCGTGGTATTATTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALV-J \u003cem\u003eenv\u003c/em\u003e rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATGGTGAGGTCGCTGACTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGAAACCAGCCAAGTATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGTCCTCTGTGTATCCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eFor viral infection experiments, HD11 cells were first transfected with the control or \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e siRNA using Lipofectamine\u0026trade; RNAiMAX Transfection Reagent (Thermo Fisher Scientific, USA) for 12 h. Cells were then infected with the ALV-J virus at a multiplicity of infection (MOI) of 5 for another 48 h and then collected for ALV-J proliferation analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCell treatment\u003c/h2\u003e \u003cp\u003eAfter treatment with 100 \u0026micro;M Amlexanox (InvivoGen, California, USA) for 2 h, HD11 cells were then transfected with control or \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e plasmid using Lipofectamine\u0026trade; 3000 Transfection Reagent for another 36 h. Cell supernatant was then collected to detect the expression of the IFN-β gene, and total RNA was extracted to measure the expression of antiviral innate immunity-related genes. For TLR3 stimulation, HD11 cells were incubated for 24 h in medium containing TLR3 ligand (InvivoGen, California, USA), a synthetic analog of dsRNA poly (I:C) with a high molecular weight, and then collected for gene expression analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eReverse transcription-quantitative PCR (RT\u0026ndash;qPCR)\u003c/h2\u003e \u003cp\u003eRT\u0026ndash;qPCR assays were performed according to previous studies (Chen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Briefly, total RNA was extracted from chicken cells or tissues using TRIzol\u0026trade; reagent (Thermo Fisher Scientific, USA) according to the manufacturer\u0026rsquo;s recommendations. The gDNA Eraser-treated RNA samples were reverse-transcribed with RT primers at 37\u0026deg;C for 15 minutes or strand-specific RT primers at 42\u0026deg;C for 15 minutes with PrimeScript\u0026reg; Reverse Transcriptase (TaKaRa, Japan). Quantitative PCR was then performed with gene-specific primers and SYBR Green Master Mix (TaKaRa, Japan) on the CFX Connect\u0026trade; Real-Time PCR Detection System (Bio\u0026ndash;Rad, California, USA). GAPDH RNA levels were used as internal controls to normalize gene expression. The strand-specific RT primers and gene-specific primers are listed in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eProtein extraction and immunoblotting\u003c/h2\u003e \u003cp\u003eWhole-cell lysates were prepared with Cell Lysis Buffer (Cell Signaling Technologies, USA), separated by 12% SDS\u0026ndash;PAGE at 120 V for 90 min and transferred to polyvinylidene difluoride membranes at 50 V for 150 min. Membranes were blocked in TBST containing 5% nonfat dry milk (Bio\u0026ndash;Rad, California, USA). Primary antibodies were incubated overnight at 4\u0026deg;C with agitation. The following antibodies were used to determine protein expression: rabbit anti-TLR3 (Novus Biologicals, USA), anti-GAPDH (Abcam, United Kingdom) and mouse monoclonal antibody JE9, which is specific to the envelope protein of ALV-J. After washing extensively with TBST, secondary antibodies (anti-rabbit or anti-mouse horseradish peroxidase conjugate) were incubated for 1 h at room temperature. After washing extensively with TBST, blots were developed using enhanced chemiluminescent detection reagents on the FluorChem Q imaging system (Protein Simple, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence confocal microscopy\u003c/h2\u003e \u003cp\u003eCells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 20 min at room temperature, permeabilized with 0.25% Triton X-100 for 5 min, and blocked with 2% BSA for 30 min. Cells were then incubated with the mouse anti-ALV-J envelope protein (JE9 antibody) at room temperature for 1 h, followed by incubation with goat anti-mouse IgG conjugated with Alexa Fluor 488 dye (ab150081 Abcam, 1:200) at room temperature for 45 min. After five washes in PBST (PBS with 0.05% Tween), cells were stained with DAPI dye (Sigma, Shanghai, China) at room temperature for 10 min. Images were acquired using a Leica TCS SP8 confocal microscope, and data analysis was carried out with Leica LAS AF Lite (Leica Microsystems).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eRNA fluorescence in situ hybridization (FISH)\u003c/h2\u003e \u003cp\u003eRNA FISH was performed according to the manufacturer\u0026rsquo;s recommendations (RIBOBIO, Guang Zhou, China) and the previous study (Chen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Briefly, HD11 Cells were fixed with 4% paraformaldehyde in PBS for 20 min at room temperature, permeabilized with 0.25% Triton X-100 for 5 min, and blocked with 2% BSA for 30 min. Cells were then incubated overnight with the \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e probe mix at 37\u0026deg;C. For colocalization studies, after RNA FISH, cells were subjected to immunofluorescence for TLR3 protein. The pictures were captured and merged with a Leica SP8 confocal microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003eThe cytokine concentrations in the cell supernatants were measured with ELISA kits for chicken type I interferons IFN-α and IFN-β according to the manufacturer\u0026rsquo;s instructions (Shanghai Hengyuan Bioscience \u0026amp; Technology Company, China). The p27 antigen of ALV-J in the cell supernatants was measured by ELISA (IDEXX, Beijing, China) following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analyses\u003c/h2\u003e \u003cp\u003eThe statistical analysis was performed with the Statistical Package for the Social Sciences (version 16.0) software. Statistical significance was assessed using a two-tailed unpaired Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test with a \u003cem\u003eP\u003c/em\u003e value threshold of \u0026lt; 0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eALV-J inhibits the expression of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003elnc-ALVE1-AS1\u003c/span\u003e \u003cb\u003ein macrophages\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe influence of exogenous virus ALV-J infection on the expression of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e in macrophages was measured by RT\u0026ndash;qPCR. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, the expression of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e in the chicken macrophage cell line HD11 was persistently downregulated from 6 to 48 hpi and significantly downregulated at 24 h and 48 h after ALV-J infection. These results suggest that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e might be involved in the antiviral response to ALV-J infection in chicken macrophages.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eInhibition of ALV-J proliferation by\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003elnc-ALVE1-AS1\u003c/span\u003e \u003cb\u003ein macrophages\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo confirm the role of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e in antiviral defense, macrophages were transfected with \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e after ALV-J infection, and then the influence of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e on ALV-J proliferation was assessed. Compared with the control group, transfection of \u003cem\u003elnc-ALVE-AS1\u003c/em\u003e significantly inhibited the expression of the ALV-J \u003cem\u003eenv\u003c/em\u003e gene at both the mRNA and protein levels in HD11 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea and b). TCID\u003csub\u003e50\u003c/sub\u003e and ELISA analysis results also showed that overexpression of \u003cem\u003elnc-ALVE-AS1\u003c/em\u003e led to significant reductions in viral titers and viral protein in the culture medium of HD11 cells infected with ALV-J (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec and d). The confocal immunofluorescence microscopy analysis results shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee further confirmed the inhibition of \u003cem\u003elnc-ALVE-AS1\u003c/em\u003e on ALV-J proliferation in chicken macrophages.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eKnockdown of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003elnc-ALVE1-AS1\u003c/span\u003e \u003cb\u003ecan promote the replication of ALV-J in macrophages\u003c/b\u003e\u003c/p\u003e \u003cp\u003eKnockdown of \u003cem\u003elnc-ALVE-AS1\u003c/em\u003e by RNAi in macrophages was performed to further confirm the role of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e in antiviral defense. Conversely, knockdown of \u003cem\u003elnc-ALVE-AS1\u003c/em\u003e significantly increased the expression of the ALV-J \u003cem\u003eenv\u003c/em\u003e gene at both the mRNA and protein levels in HD11 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea and b). TCID\u003csub\u003e50\u003c/sub\u003e and ELISA analysis results also showed that knockdown of \u003cem\u003elnc-ALVE-AS1\u003c/em\u003e led to significant increases in viral titers and viral protein levels in the culture medium of HD11 cells infected with ALV-J (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec and d). Our data collectively indicate that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e may possess a function in antiviral defense in chicken macrophages.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003elnc-ALVE1-AS1\u003c/span\u003e \u003cb\u003etriggers antiviral innate immunity in macrophages\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSince \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e can block the proliferation of ALV-J in macrophages, we next investigated the influence of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e on the expression of host genes involved in antiviral innate immunity. In chicken macrophages, \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e triggered an interferon response, which included type I interferons (IFN-α and IFN-β) and a panel of interferon-stimulated genes (ISGs; MX1, OASL and IFITM3) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea and b). Each ISG functions predominantly in antiviral innate immunity. Generally, the key upstream gene IRF7 in the type I interferon pathway was also upregulated by \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e overexpression in macrophages. ELISA analysis further confirmed that the expression of IFN-α and IFN-β was induced by overexpression of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). However, knockdown of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e by RNAi led to significant decreases in the expression levels of IFN-α, IFN-β, IRF7, MX1, OASL and IFITM3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed and e). Knockdown of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e also decreased the concentrations of IFN-α and IFN-β in macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef). These results suggested that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e is involved in antiviral innate immunity, especially the antiviral interferon response.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003elnc-ALVE1-AS1\u003c/span\u003e \u003cb\u003eis involved in antiviral innate immunity by inducing TLR3 signaling\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe then sought to determine the molecular mechanism by which lnc-ALVE1-AS1 induced an antiviral interferon response. Several studies in mammals have reported that endogenous retroviral RNAs can trigger signaling by the cytosolic pattern recognition receptors IFIH1 and TLR3 (Chiappinelli et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Licht \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Yu et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), which recognize double-stranded RNA (dsRNA) associated with virus infection. In HD11 cells, we found that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e only increased the transcript levels of cytosolic sensors for dsRNA (TLR3) but not IFIH1, MB21D1 or TLR7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea and b). Consistently, knockdown of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e caused a significant decrease in the expression levels of the TLR3 gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). Western blot results further confirmed that overexpression of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e induced the expression of TLR3 protein in HD11 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed), whereas knockdown of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e had the opposite effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee). RNA FISH combined with confocal immunofluorescence further confirmed the colocalization of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e and TLR3 in HD11 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef). Thus, TLR3 could be an important dsRNA recognition receptor for \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e to induce an interferon response.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe next investigated whether \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e affects the expression of antiviral innate immunity genes through TLR3 signaling. We observed that knockdown of TLR3 by RNAi significantly blunted the \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e-induced type I interferon (IFN-α and IFN-β) response in HD11 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg). Furthermore, inhibition of the TLR3-type I interferon signaling pathway with a TBK1/IKKε inhibitor (Amlexanox) also significantly blunted the expression of IFN-α and IFN-β induced by \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eh). In addition, activation of TLR3 by the TLR3 ligand induced \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e expression in HD11 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ei). These results indicate that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e can be sensed by the innate immune receptor TLR3 and trigger the TLR3-induced interferon response.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003elnc-ALVE1-AS1\u003c/span\u003e \u003cb\u003eexerts innate immune resistance to ALV-J in chickens\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNext, we investigated the antiviral innate immune function of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e in chickens. First, we found that the expression level of \u003cem\u003elnc-ALVE-AS1\u003c/em\u003e in ALV-resistant (G1) chicken immune organs (thymus, spleen, and bursa of Fabricius) was significantly higher than that in ALV-susceptible (G3) chickens (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). Viral infection experiments showed that the ALV-J replication level in CEFs of ALV-resistant G1 chickens at 24 and 96 hpi was significantly lower than that in CEFs of ALV-susceptible G3 chickens, whereas the \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e expression level showed the opposite results (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb and c). Furthermore, the expression of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e was significantly downregulated in ALV-resistant G1 and ALV-susceptible G3 chicken CEFs infected with ALV-J at 24 and 96 hpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ed and e). However, the decrease in \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e expression was more obvious in ALV-susceptible G3 chicken CEFs. It was further confirmed that overexpression of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e could inhibit ALV-J replication in ALV-susceptible G3 chicken CEFs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef). Overexpression of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e also increased the expression levels of the dsRNA recognition receptor TLR3 and antiviral innate immune genes, including IFN-α, IFN-β and IFITM3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eg-i). These results suggested that high-level expression of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e in ALV-resistant chickens is associated with host viral resistance.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eERVs have adapted long-term evolutionary selection by the host and are important sources and evolutionary origins of various regulatory non-coding RNAs, including lncRNAs, microRNAs, and piRNAs. When these ERV-derived ncRNAs are activated by exogenous infections or other stimuli, they may activate the functions of immune cells, including B cells, T cells and macrophages. The long noncoding RNA \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e is derived from chicken ERV ALVE1 (Chen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), which contains LTR, gag, pol and env regions and is 7.5 kb in length. It is located on chromosome 1 (Tereba et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1979\u003c/span\u003e) and is regulated by DNA methylation (Groudine et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1981\u003c/span\u003e). Chicken ERV ALVE1 is highly homologous to exogenous retrovirus ALVs and thus provides a unique model for investigating the interaction between endogenous and exogenous retroviruses as well as the symbiotic relationship and interplay between ERVs and innate immunity (Chen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Hu et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016b\u003c/span\u003e; Hu et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study, we found that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e inhibited the proliferation of ALV-J by activating antiviral immunity in chicken macrophages. Inhibition of virus proliferation by lncRNAs derived from ERVs was also observed in mouse macrophages (Zhou et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The piRNA derived from the chicken endogenous retrovirus ALVE may be involved in resistance to ALV (Sun et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Therefore, noncoding RNAs such as lncRNAs and piRNAs derived from the chicken endogenous retrovirus ALVE may be an important part of the cellular immune response to enhance the host's resistance to foreign viral infections.\u003c/p\u003e \u003cp\u003eActivation of the type I interferon response mediated by TLR3 signaling may be an important mechanism by which \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e inhibits the proliferation of ALV-J in chicken macrophages (a working model is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). It has been shown that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e activates TLR3 signaling in chicken CEFs (Chen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In this study, we further found that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e significantly activates the expression of antiviral innate immune genes such as TLR3 and type I interferons (IFN-α and IFN-β) in chicken macrophages. However, the effect of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e is significantly reduced after interfering with TLR3 or suppressing TLR3 signaling. Confocal localization analysis showed that lnc-ALVE1-AS1 can directly bind to TLR3 protein in macrophages. In addition, studies have also found that TLR3 ligand stimulation can induce abnormal expression of a large number of lncRNAs (Wang et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), suggesting that lncRNAs could be an important signal for TLR3 recognition and a regulator of innate immunity (Murphy and Medvedev \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). These results indicate that the induction of TLR3 signaling is an important mechanism by which \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e activates antiviral innate immunity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTLR3 is an important double-stranded RNA (dsRNA) recognition receptor and participates in the antiviral immune response (Beutler \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Studies have shown that RNAs derived from endogenous retroviruses can be recognized by TLR3 protein and activate antiviral innate immunity. Several studies in mammals have reported that endogenous retroviral RNAs can trigger interferon signaling by the cytosolic pattern recognition receptors MDA5 and TLR3 (Chiappinelli et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Licht \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Yu et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The past study has been shown that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e can be sensed by TLR3 in chicken CEFs (Chen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). We also found that the key dsRNA recognition receptor TLR3 was significantly upregulated in macrophages transfected with \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e, indicating that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e may form a dsRNA structure that can bind to TLR3. The long noncoding RNA \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e is an antisense lncRNA that may form dsRNA with the sense RNA complementary to its sequences. In addition, some short dsRNA fragments may be formed in the secondary structure of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e. These dsRNAs may be recognized by TLR3 and activate antiviral innate immunity. This phenomenon is very similar to the observation that the DNA methylation inhibitor 5-Aza-dC induces an interferon response by activating endogenous retroviral dsRNA (Chiappinelli et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Roulois et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In addition, TLR3 can also recognize the virus-derived single-stranded RNA segments harboring stem structures with bulge/internal loops (Tatematsu et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Tatematsu et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHowever, it must be emphasized that the present study is not a simple repetition of past study although the results of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e inhibits ALV-J proliferation and activates TLR3 signaling in chicken macrophages are consistent with those in chicken CEFs (a non-immune cell). First, it is not clear whether this endogenous retroviral RNA has a similar function in immune cells before this study. Secondly, this study more comprehensively evaluated the resistance of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e to ALV-J in macrophages when compared with the single result of ALV-J inhibition by \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e overexpression in chicken CEFs. Finally, the role of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e in the antiviral defense against ALV-J infection \u003cem\u003ein vivo\u003c/em\u003e through ALV-resistant/susceptible chickens was evaluated only in this study.\u003c/p\u003e \u003cp\u003eIn conclusion, the present findings collectively show that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e exerts antiviral protective roles by triggering TLR3-induced antiviral innate immunity in macrophages. Individual lncRNAs with these immune functions remain to be extensively revealed in future research. Future advances in our understanding of ERV-derived lncRNA functions in immune cells are bound to generate new insights into the roles of these peaceful genome inhabitants in infection, inflammatory disease, autoimmunity, and cancer.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAuthors' Contributions\u003c/b\u003e All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Huan Luo, Xuming Hu, Huixian Wu, Gul Zaib, Wenxian Chai and Hengmi Cui. The first draft of the manuscript was written by Huan Luo and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; Contributions\u003c/strong\u003e All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Huan Luo, Xuming Hu, Huixian Wu, Gul Zaib, Wenxian Chai and Hengmi Cui. The first draft of the manuscript was written by Huan Luo and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e This study was supported by the National Natural Science Foundation of China (31602032, 81773013 and 91540117), Key Program of Changzhou Science and Technology Bureau (CE20202033) and the Priority Academic Program Development of Jiangsu Higher Education Institutions (Animal Science and Veterinary Medicine).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode or data availability\u003c/strong\u003e All data and materials are available for publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003eAnimal experiment was performed in strict accordance with the recommendations provided in the Guide for the Care and Use of Laboratory Animals of Yangzhou University. The protocol was approved by the Committee on the Ethics of Animal Experiments of Yangzhou University (licence number: 06R015).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e Not Applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest\u003c/strong\u003e The authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBeug H, von Kirchbach A, D\u0026ouml;derlein G, Conscience JF, Graf T (1979) Chicken hematopoietic cells transformed by seven strains of defective avian leukemia viruses display three distinct phenotypes of differentiation. Cell 18:375\u0026ndash;390. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0092-8674(79)90057-6\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeutler B (2004) Inferences, questions and possibilities in toll-like receptor signalling. Nature 430:257\u0026ndash;263. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature02761\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen S, Hu X, Cui IH et al (2019) An endogenous retroviral element exerts an antiviral innate immune function via the derived lncRNA lnc-ALVE1-AS1. Antiviral Res 170:104571. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.antiviral.2019.104571\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChiappinelli KB, Strissel PL, Desrichard A et al (2015) Inhibiting DNA methylation causes an interferon response in cancer via dsRNA including endogenous retroviruses. Cell 162:974\u0026ndash;986. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2015.07.011\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFort A, Hashimoto K, Yamada D et al (2014) Deep transcriptome profiling of mammalian stem cells supports a regulatory role for retrotransposons in pluripotency maintenance. Nat Genet 46:558\u0026ndash;566. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ng.2965\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrandi N, Tramontano E (2018) Human endogenous retroviruses are ancient acquired elements still shaping innate immune responses. Front Immunol 9:2039. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2018.02039\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrasset EK, Cerutti A (2014) Immunology. Retroviral help for B cells. Science 346:1454\u0026ndash;1455. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.aaa3263\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGroudine M, Eisenman R, Weintraub H (1981) Chromatin structure of endogenous retroviral genes and activation by an inhibitor of DNA methylation. Nature 292:311\u0026ndash;317. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/292311a0\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrow EJ, Flynn RA, Chavez SL et al (2015) Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells. Nature 522:221\u0026ndash;225. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature14308\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHayward A, Katzourakis A (2015) Endogenous retroviruses. Curr Biol 25:R644\u0026ndash;646. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cub.2015.05.041\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu X, Ye J, Qin A, Zou H, Shao H, Qian K (2015) Both microRNA-155 and virus-encoded miR-155 ortholog regulate TLR3 expression. PLoS ONE 10:e0126012. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0126012\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu X, Zou H, Qin A, Qian K, Shao H, Ye J (2016a) Activation of toll-like receptor 3 inhibits marek's disease virus infection in chicken embryo fibroblast cells. Arch Virol 161:521\u0026ndash;528. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00705-015-2674-x\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu X, Zhu W, Chen S, Liu Y, Sun Z, Geng T, Wang X, Gao B, Song C, Qin A, Cui H (2016b) Expression of the env gene from the avian endogenous retrovirus ALVE and regulation by miR-155. Arch Virol 161:1623\u0026ndash;1632. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00705-016-2833-8\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu X, Zhu W, Chen S, Liu Y, Sun Z, Geng T, Song C, Gao B, Wang X, Qin A, Cui H (2017) Expression patterns of endogenous avian retrovirus ALVE1 and its response to infection with exogenous avian tumour viruses. Arch Virol 162:89\u0026ndash;101. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00705-016-3086-2\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHurst TP, Magiorkinis G (2015) Activation of the innate immune response by endogenous retroviruses. J Gen Virol 96:1207\u0026ndash;1218. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1099/jgv.0.000017\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKunarso G, Chia NY, Jeyakani J, Hwang C, Lu X, Chan YS, Ng HH, Bourque G (2010) Transposable elements have rewired the core regulatory network of human embryonic stem cells. Nat Genet 42:631\u0026ndash;634. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ng.600\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLicht JD (2015) DNA methylation inhibitors in cancer therapy: the immunity dimension. Cell 162:938\u0026ndash;939. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2015.08.005\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Leng L, Liu C et al (2019) An integrated chromatin accessibility and transcriptome landscape of human pre-implantation embryos. Nat Commun 10:364. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-018-08244-0\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMacfarlan TS, Gifford WD, Driscoll S, Lettieri K, Rowe HM, Bonanomi D, Firth A, Singer O, Trono D, Pfaff SL (2012) Embryonic stem cell potency fluctuates with endogenous retrovirus activity. Nature 487:57\u0026ndash;63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature11244\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMason AS, Fulton JE, Hocking PM, Burt DW (2016) A new look at the LTR retrotransposon content of the chicken genome. BMC Genomics 17:688. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12864-016-3043-1\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMason AS, Lund AR, Hocking PM, Fulton JE, Burt DW (2020) Identification and characterisation of endogenous Avian Leukosis Virus subgroup E (ALVE) insertions in chicken whole genome sequencing data. Mob DNA 11:22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13100-020-00216-w\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurphy MB, Medvedev AE (2016) Long noncoding RNAs as regulators of toll-like receptor signaling and innate immunity. J Leukoc Biol 99:839\u0026ndash;850. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1189/jlb.2RU1215-575R\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoulois D, Loo Yau H, Singhania R et al (2015) DNA-demethylating agents target colorectal cancer cells by inducing viral mimicry by endogenous transcripts. Cell 162:961\u0026ndash;973. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2015.07.056\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStoye JP (2012) Studies of endogenous retroviruses reveal a continuing evolutionary saga. Nat Rev Microbiol 10:395\u0026ndash;406. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrmicro2783\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun YH, Xie LH, Zhuo X, Chen Q, Ghoneim D, Zhang B, Jagne J, Yang C, Li XZ (2017) Domestic chickens activate a piRNA defense against avian leukosis virus. Elife 6:e24695. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7554/eLife.24695\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTatematsu M, Seya T, Matsumoto M (2014) Beyond dsRNA: toll-like receptor 3 signalling in RNA-induced immune responses. Biochem J 458:195\u0026ndash;201. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1042/BJ20131492\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTatematsu M, Nishikawa F, Seya T, Matsumoto M (2013) Toll-like receptor 3 recognizes incomplete stem structures in single-stranded viral RNA. Nat Commun 4:1833. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ncomms2857\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTereba A, Lai MM, Murti KG (1979) Chromosome 1 contains the endogenous RAV-0 retrovirus sequences in chicken cells. Proc Natl Acad Sci U S A 76:6486\u0026ndash;6490. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.76.12.6486\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVillarreal LP (2011) Viral ancestors of antiviral systems. Viruses 3: 1933-1958. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/v3101933\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Xie G, Singh M et al (2014) Primate-specific endogenous retrovirus-driven transcription defines naive-like stem cells. Nature 516:405\u0026ndash;409. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature13804\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang S, Li X, Zhao RC (2016) Transcriptome analysis of long noncoding RNAs in toll-like receptor 3-activated mesenchymal stem cells. Stem Cells Int 2016: 6205485. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2016/6205485\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue Z, Huang K, Cai C et al (2013) Genetic programs in human and mouse early embryos revealed by single-cell RNA sequencing. Nature 500:593\u0026ndash;597. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature12364\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan L, Yang M, Guo H et al (2013) Single-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells. Nat Struct Mol Biol 20:1131\u0026ndash;1139. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nsmb.2660\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoung GR, Ploquin MJ, Eksmond U, Wadwa M, Stoye JP, Kassiotis G (2012) Negative selection by an endogenous retrovirus promotes a higher-avidity CD4+ T cell response to retroviral infection. PLoS Pathog 8:e1002709. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.ppat.1002709\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu P, L\u0026uuml;bben W, Slomka H et al (2012) Nucleic acid-sensing toll-like receptors are essential for the control of endogenous retrovirus viremia and ERV-induced tumors. Immunity 37:867\u0026ndash;879. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.immuni.2012.07.018\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng M, Hu Z, Shi X et al (2014) MAVS, cGAS, and endogenous retroviruses in T-independent B cell responses. Science 346:1486\u0026ndash;1492. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.346.6216.1486\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou B, Qi F, Wu F et al (2019) Endogenous retrovirus-derived long noncoding RNA enhances innate immune responses via derepressing RELA expression. mBio 10:e00937\u0026ndash;e00919. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/mBio.00937-19\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"veterinary-research-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"verc","sideBox":"Learn more about [Veterinary Research Communications](https://www.springer.com/journal/11259)","snPcode":"11259","submissionUrl":"https://submission.nature.com/new-submission/11259/3","title":"Veterinary Research Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Endogenous retroviruses, lnc-ALVE1-AS1, Avian leukosis virus, Macrophages","lastPublishedDoi":"10.21203/rs.3.rs-1098883/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1098883/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEndogenous retroviruses (ERVs) are remnants of ancient retroviral infections dating back many millions of years, and their derived transcripts with viral signatures are important sources of long noncoding RNAs (lncRNAs). We have previously shown that the chicken ERV-derived lncRNA \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e exerts antiviral innate immunity in chicken embryo fibroblasts. However, it is not clear whether this endogenous retroviral RNA has a similar function in immune cells. Here, we found that \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e was persistently inhibited in chicken macrophages after avian leukosis virus subgroup J (ALV-J) infection. Furthermore, overexpression of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e significantly inhibited the proliferation of exogenous ALV-J, whereas knockdown of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e promoted the proliferation of ALV-J in chicken macrophages. This phenomenon is attributed to the induction of antiviral innate immunity by \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e in macrophages, whereas knockdown of \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e had the opposite effect. Mechanistically, \u003cem\u003elnc-ALVE1-AS1\u003c/em\u003e can be sensed by the cytosolic pattern recognition receptor TLR3 and trigger the type I interferons response. The present study provides novel insights into the antiviral defense of ERV-derived lncRNAs in macrophages and offers new strategies for future antiviral solutions.\u003c/p\u003e","manuscriptTitle":"Endogenous Retrovirus-Derived lnc-ALVE1-AS1 Exerts Antiviral Defense Against ALV-J Infection in Chicken Macrophages","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-12-20 19:39:56","doi":"10.21203/rs.3.rs-1098883/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2021-12-20T15:25:15+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2021-12-19T11:40:02+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2021-12-17T05:44:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"Veterinary Research Communications","date":"2021-12-16T21:13:25+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"veterinary-research-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"verc","sideBox":"Learn more about [Veterinary Research Communications](https://www.springer.com/journal/11259)","snPcode":"11259","submissionUrl":"https://submission.nature.com/new-submission/11259/3","title":"Veterinary Research Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"3ecf7635-7194-4e42-bd4f-5d95c2fbaaa7","owner":[],"postedDate":"December 20th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":9271611,"name":"Veterinary Epidemiology"}],"tags":[],"updatedAt":"2022-06-14T14:42:34+00:00","versionOfRecord":[],"versionCreatedAt":"2021-12-20 19:39:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1098883","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1098883","identity":"rs-1098883","version":["v1"]},"buildId":"oE6Zbj460LM0Up2FdVbMZ","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}