Potential common molecular mechanisms between inflammatory bowel disease and erectile dysfunction in men: genetic screening and in vivo validation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Potential common molecular mechanisms between inflammatory bowel disease and erectile dysfunction in men: genetic screening and in vivo validation Ya-jie Wang, Lin Xiao, Yi-sheng Pan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4492451/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose: To explore Potential common molecular mechanisms between inflammatory bowel disease and erectile dysfunction in men. Method: First, differentially expressed genes in GSE10804 dataset and GSE191234 dataset were identified. qRT-PCR to verify the expression of differential genes. Enrichment analysis was performed in GO, KEGG and PPI. Result: From public GEO datasets of IBD and ED, we mined 15 genes that work together on both diseases and validated them in mice with inflammatory bowel disease, finding the importance of several genes. Among them, the common KEGG pathway of the DEGs in the two datasets includes calcium signaling pathway and cell adhesion molecules, cytoskeleton in muscle cells, protein digestion and absorption, and tyrosine metabolism. In vivo, ABAC8, ADGRF5, CLGN, GRM1, NUAK1, PDE1A, SLC39A8 were verified by statistical difference. Conclusion: Potential common genes interaction between inflammatory bowel disease and erectile dysfunction may be related to ABAC8, ADGRF5, CLGN, GRM1, NUAK1, PDE1A, SLC39A. calcium signaling pathway and cell adhesion molecules, cytoskeleton in muscle cells, protein digestion and absorption, and tyrosine metabolism may be the potential mechanism. Health sciences/Diseases/Gastrointestinal diseases Health sciences/Diseases/Urogenital diseases inflammatory bowel disease erectile dysfunction GEO bioanalysis Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Inflammatory bowel disease (IBD) encompasses a spectrum of chronic inflammatory conditions of the gastrointestinal tract, notably ulcerative colitis (UC) and Crohn's disease (CD). This complex condition arises from the interplay of environmental and genetic factors [1]. The symptoms of IBD are diverse and may include diarrhea, fatigue, abdominal pain, rectal bleeding, and weight loss. Recent studies have also highlighted that during active IBD, patients may experience anxiety, depression, and sexual dysfunction, which are important considerations[2-4]. Erectile dysfunction (ED) is a prevalent condition predominantly affecting men over 40 years of age. Beyond traditional causes such as diabetes mellitus and hypertension, several lifestyle factors, including obesity, sedentary lifestyle, and lower urinary tract symptoms, have been implicated in the development of ED[5]. Clinical evidence from the United States indicates that men with IBD, regardless of surgical intervention, exhibit a higher incidence of erectile dysfunction medication use compared to those without IBD, as demonstrated in a nationwide cohort study[6]. The impact of IBD on male sexual function is primarily characterized by ED, with endothelial dysfunction thought to be a key contributor, particularly systemic vascular dysfunction[7][8]. The endothelium not only serves as a barrier but also regulates muscle tone and vascular circulation. The gut contains endothelial cells, including those in the blood vessels and lymphatic system. Damage to the intestinal endothelium often leads to inflammation and immune disorders. During the acute phase of IBD, blood vessels exhibit increased permeability, which may diminish or disappear during remission [9]. Obtaining intestinal epithelial tissue from IBD patients is relatively straightforward, whereas penile tissue specimens from IBD patients are more challenging to obtain. Therefore, we sought to identify differentially expressed genes between non-ED and ED tissues by screening mRNA microarray datasets from the Gene Expression Omnibus (GEO), a public repository for functional genomics data that provides chips, microarrays, and high-throughput gene expression data [10, 11]. To further elucidate the relationship between IBD and ED, we have employed bioinformatics analysis, microarray technology, and other methodologies. Pathway enrichment analyses of protein-protein interaction (PPI) networks, the Kyoto Encyclopedia of Genes and Genomes (KEGG), and Gene Ontology (GO) have been utilized to explore the shared pathogenesis of IBD and ED patients. Methods Microarray data GSE10804 dataset[12] and GSE191234 dataset[13] were downloaded from GEO. The probes were transformed into the corresponding gene symbols on the basis of annotation information on the platform. The GSE10804 dataset had 3 groups: 4 samples are cultured human corpus cavernosum endothelial cells (HCCEC) from a donor with erectile dysfunction; 1 sample is cultured human corpus cavernosum endothelial cells (HCCEC) from a donor without erectile dysfunction; 3 samples are cultured human umbilical vein endothelial cells (HUVEC) from a donor without erectile dysfunction, and 4 samples are cultured human coronary artery endothelial cells (HCAEC) from a donor without erectile dysfunction. We have standardized that the 4 ED samples compared to the 8 non-ED samples as a whole. The GSE191234 dataset had 6 groups including 54 biopsy-derived endothelial cells: 10 Human intestinal blood endothelial cells (HIBEC) samples are from CD patients, 8 HIBEC samples are from UC patients, 10 Human lymphatic endothelial cells (HILEC) samples are from CD patients, 8 HILEC samples are from UC patients, 10 HIBEC samples are samples are from healthy people, n=8 HILEC samples are healthy people. We have standardized that the 36 IBD samples compared to the 18 non-IBD samples as a whole. Identification of DEGs We identified differentiated expressed genes (DEGs) using count data from genes as input to the R package DESeq2 [14]. Then we defined the DEGs which had a higher absolute log2 (fold-change) value than 2 and tested significantly (p value < 0.05). Selection and analysis of Hub genes Genes that were simultaneously up-regulated or down-regulated in the differential expression of the two datasets were selected as key genes. Analysis of GO enrichment and KEGG networks for DEGs Gene Ontology (GO)[15], a significant bioinformatics tool enables us to annotate genes according to biological processes. On the other hand, Kyoto Encyclopedia of Genes and Genomes (KEGG) [16] is a capable platform that is a knowledge base for systematic analysis of gene functions, linking genomic information with higher-order functional information. We performed a series of gene functional enrichment analyses, including GO, and KEGG to identify major biological models. Construction of PPI networks and module analyses In this study, the STRING database (STRING: http://string-db.org ) was taken to predict the PPI network to determine protein-protein interactions, and to investigate the molecular basis of diseases. The interactions with an average score of greater than 0.7 were chosen the cut-off for statistical significance. Animal model construction An inflammatory bowel disease (IBD) model in mice was established, and the mice in the IBD group were provided with 3% dextran sulfate sodium (DSS) in their drinking water following a 7-day acclimatization period. On the eighth day of culture, the presence of bloody stools and diarrhea in the mice signaled the successful establishment of the IBD model. The mice were then euthanized by inhaling carbon dioxide as the concentration gradient increases, and their penile tissues were collected for subsequent analysis[17]. All animal experiments were conducted in compliance with the regulations of the International Committee for Animal Protection in Medical Sciences and the National Guidelines for the Care and Use of Laboratory Animals. The protocol was reviewed and approved by the Ethics Committee for Animal Experiments at the First Hospital of Peking University (approval number: 2022029). Quantitative Real-Time PCR (qRT–PCR) The TRIzol reagent kit (Thermo Fisher Scientific, USA) was applied for the extraction of total RNA from mice penis tissues. The RNA was reverse-transcribed using a PrimeScript® RT Reagent Kit (Takara, Japan). After that, qRT–PCR was performed using a StepOne Plus System (Applied Biosystems, USA) with a SYBR Premix ExTaq II (TliRNase HPlus) kit (Takara, Japan). The 2 −ΔΔCt method was applied to process the experimental data. The expression of related genes was normalized to the quantity of GAPDH in each sample to correct for sample variability. Validation of S100P and TTTY14 were excluded because both genes were not expressed in mice. All primers are listed in Table 1. Table1 Primers for qRT-PCR. Gene symbol Sequences ABCA8 Forward primer CCGTGATTAAATGGTGCGGC Reverse primer GAGCTCACCCACTCCATCAA AURKC Forward Primer GGGCGTGTGTACTTGGCTC Reverse Primer AAGTTGGTGCTCCAATCCCTC CHGB Forward Primer AGCTCCAGTGGATAACAGGGA Reverse Primer GATAGGGCATTTGAGAGGACTTC CLGN Forward Primer CCAGGGTGTTGGACTATGTTTG Reverse Primer CCCCGAGGAAGGTTCATCTTTA PDE1A Forward Primer CCGGGATTGGTTGGCTTCAA Reverse Primer AATGCTGCGAAACTTTGGTTTT PLS1 Forward Primer AGGAGAGGACATTCCGCAACT Reverse Primer GGTACGGAGGCTTGTTCACC SLC39A8 Forward Primer GATGTGCTGAGCGTGTTCG Reverse Primer GAAGTTCGAGCTGGTTATCTGG ADGRF5 Forward primer GAGTGGCCAGACCTGTTCAT Reverse primer CTGAGTGGCTTCGCCTGTC GRM1 Forward Primer GAGGCCATGTTCCACACATTA Reverse Primer CCAGCAATAGGCTTCTTAGTCCT LRRC17 Forward Primer CTGCTGAGCCTCGCAAGTC Reverse Primer CCTGGTGCATAGCGTTTGA NUAK1 Forward Primer TCCAACCTGTACCAGAAGGAC Reverse Primer GGGCATCGTTCCATAAATGAGA PSCA Forward Primer GGACCAGCACAGTTGCTTTAC Reverse Primer GTAGTTCTCCGAGTCATCCTCA RASA4 Forward Primer CGCTGTCCATCCGAATCGTAG Reverse Primer GATCACATCGTCCCGGCTAA Statistical Analysis Two-tailed Student's t-test (unpaired) was used to analyze differences in mean values between groups (GraphPad Prism version 10.0 for Macbook, GraphPad Software, USA). A p-value < 0.05 was used to indicate the statistical significance. All results were expressed as the means ± standard error of the mean (SEM), and all experiments were repeated at least three times to ensure reproducibility. Results Identification of DEGs in the GSE10804 and GSSE191234 DEGs (581 in GSE10804) were identified (Fig 1.A) after standardizing the microarray data. The dataset consisted of 285 down-regulated genes and 296 up-regulated genes between ED endothelial cells and non-ED endothelial cells. DEGs (777 in GSE191234) were identified (Fig 1.B) after standardizing the microarray data. The dataset consisted of 419 down-regulated genes and 358 up-regulated genes between ED endothelial cells and non-ED endothelial cells. Selection of key genes After the intersection of the differentially-expressed genes in the above two datasets, we found 6 up-regulated genes ADGRF5, GRM1, LRRC17, NUAK1, PSCA, RASA4, and 9 down-regulated genes ABCA8, AURKC, CHGB, CLGN, PDE1A, PLS1. S100P, SLC39A8, TTTY14 (Table 2). We took these 15 differentially expressed genes as key genes for the study. Table 2 Fifteen common differential genes in GSE10804 and GSE191234 gene logFC P.Value dataset change ABCA8 -1.2667799 0.01535401 GSE10804 down AURKC -1.0548671 0.04169207 GSE10804 down CHGB -1.3520567 0.03191383 GSE10804 down CLGN -2.2291115 0.03591628 GSE10804 down PDE1A 1.35297044 0.00856546 GSE10804 down PLS1 -1.3450405 0.01265455 GSE10804 down S100P -1.0476937 0.00774011 GSE10804 down SLC39A8 -1.2275987 0.02237304 GSE10804 down TTTY14 -1.8917446 0.02210652 GSE10804 down ADGRF5 2.34879288 0.02675972 GSE10804 up GRM1 1.21155417 0.00503481 GSE10804 up LRRC17 1.63126642 0.00479406 GSE10804 up NUAK1 1.17394876 0.02280052 GSE10804 up PSCA 2.07792214 0.01202469 GSE10804 up RASA4 1.15349435 0.00282333 GSE10804 up ABCA8 -1.5338835 0.00842707 GSE191234 down PDE1A -1.362995 0.00086744 GSE191234 down PLS1 -0.9664784 0.00133755 GSE191234 down S100P -0.9243563 0.01416089 GSE191234 down SLC39A8 -0.800117 9.62E-05 GSE191234 down TTTY14 -1.1713513 0.0129671 GSE191234 down AURKC -0.6846483 0.00152663 GSE191234 down CHGB -0.5563726 0.01220286 GSE191234 down CLGN -1.1692837 0.00287008 GSE191234 down NUAK1 0.55243469 0.02502592 GSE191234 up PSCA 0.65805049 0.0314162 GSE191234 up RASA4 1.03831142 0.00071851 GSE191234 up ADGRF5 0.82059026 0.00422924 GSE191234 up GRM1 0.67399507 0.03746743 GSE191234 up LRRC17 1.63601615 0.0409431 GSE191234 up Animal experiment verification By giving oral 3% DSS aqueous solution, the mouse model of IBD was constructed (Fig 2.A), and the penile spongy tissues of the two groups of mice were taken for qRT-PCR to verify the expression of differential genes. In vivo, ABAC8, ADGRF5, CLGN, GRM1, NUAK1, PDE1A, SLC39A8 were verified by statistical difference (Fig 2.B-N). KEGG and GO enrichment analyses of DEGs In the DEGs of GSE10804, the Results of GO analyses (Fig 3. A) showed that the remarkable enhancement of changes in BP was in the ameboidal-type cell migration, negative regulation of immune system process and mesenchyme development extracellular matrix. Changes in CC were greatly improved in collagen- containing, extrasellar matrix, endoplasmic reticulum lumen. Changes in MF primarily emerged in the signaling receptor activator activity, receptor ligand activity and cytokine activity. KEGG pathway analysis revealed that the DEGs were mainly enhanced in the cytokine-cytokine receptor pathway, PI3K-Akt signaling pathway, and neuroactive ligand-receptor interactions (Fig 3. C). In the DEGs of GSE191234, the Results of GO analyses demonstrated that the nephron epithelium development, nephron tubule development, and ureteric bud development had changes in BP (Fig 3. B). KEGG pathway analysis revealed that the DEGs were mainly enhanced in the calcium signaling pathway, cell adhesion molecules, and motor proteins (Fig 3. D). Among them, the common KEGG pathway of the DEGs in the two datasets includes calcium signaling pathway and cell adhesion molecules, cytoskeleton in muscle cells, protein digestion and absorption, and tyrosine metabolism. Construction of PPI networks The constructed PPI networks of DEGs are shown in Fig 4. A-B, and the most significant module was obtained and shown in Fig 4. C-D. The DAVID tools were applied in the functional analyses of genes associated with this module. We found that the protein interaction networks of the two datasets were not closely aligned. Discussion IBD mostly occurs in young people aged 15-30 years. In recent years, the peak age of the onset of IBD has moved forward and the incidence has increased year by year. This group of people is the main force of reproduction, so the reproductive function of IBD patients is an inevitable problem to be faced. Most male IBD patients are complicated with impaired erectile function[18], which inevitably affects patients' fertility and quality of life, but clinicians have little understanding of this and have not paid enough attention to it. There are few studies on the association between the two diseases at the genetic and molecular levels. In previous studies, the association between chronic gastrointestinal diseases and sexual dysfunction may be related to Damage to the pudendal nerve in specific treatments, such as proctectomy for inflammatory bowel disease[19-22]. In fact, whether it is intestinal inflammation or erectile dysfunction, there is an important role - endothelial cells. Dysfunction of intestinal endothelial cells leads to intestinal inflammation, and dysfunction of cavernous endothelial cells leads to poor erectile function. Endothelial cell dysfunction is regarded as a important cause of a variety of pathologic Settings such as cardiovascular disease, erectile dysfunction, and intestinal injury[23, 24]. The correlation between IBD and ED found in some clinical studies also seemed to indicate that the two diseases are related at the genetic and molecular level, which prompts us to look for genetic answers from the GEO database. Therefore, this study extracts the data sets of inflammatory bowel disease and male erectile dysfunction in geo database and conducts difference analysis, so as to intersection the common differential genes of the two diseases, extract Hub genes, and study the related disease signaling pathways. The differential genes were verified in DSS-induced IBD mice. Bioinformatics analysis from public databases is a good tool for understanding gene and protein interactions. From public GEO datasets of IBD and ED, we mined 15 genes that work together on both diseases and validated them in mice with inflammatory bowel disease, finding the importance of several genes. Among them, the common KEGG pathway of the DEGs in the two datasets includes calcium signaling pathway and cell adhesion molecules, cytoskeleton in muscle cells, protein digestion and absorption, and tyrosine metabolism. However, we found that the protein interaction networks of the two datasets were not closely aligned. In exploring inflammatory bowel disease and erectile dysfunction, depression is a part that cannot be ignored[25]. Inflammatory bowel patients are often complicated by depression, and studies have found that the rate of depression and anxiety in newly diagnosed inflammatory bowel patients is even higher than that in newly diagnosed colon cancer patients[26]. On the other hand, drugs used to treat depression may lead to sexual dysfunction, and depression itself may aggravate existing sexual dysfunction. Intervention and treatment of depression can successfully alleviate the symptoms of male sexual dysfunction and avoid surgical treatment [27]. A study involving 153 men with inflammatory bowel disease and age-matched healthy controls showed that depression was the most important determinant of low sexual function [28]. The prevalence of ED decreased significantly after IBD remission or surgical treatment. Meagher et al. followed up 689 male UC patients after IPAA for an average of 6.5 years, and only 10 patients had ED[29]. Many studies have found that the sexual function of male UC patients can be significantly improved after IPAA[30], and the earlier the age of surgery, the lower the postoperative ED complication rate[29]. Therefore, an aggressive and correct treatment program seeking long-term remission is the right way to manage IBD with ED. Conclusions Potential common genes interaction between inflammatory bowel disease and erectile dysfunction may be related to ABAC8, ADGRF5, CLGN, GRM1, NUAK1, PDE1A, SLC39A. calcium signaling pathway and cell adhesion molecules, cytoskeleton in muscle cells, protein digestion and absorption, and tyrosine metabolism may be the potential mechanism. Declarations Ethics approval The study is reported in accordance with ARRIVE guidelines. All animal experiments were performed according to the regulations of the International Committee for Animal Protection of Medical Sciences and the Guide for the National Guidelines for the Feeding and Use of Laboratory Animals. The protocol was approved by the Peking University First Hospital Ethics Committee of Animal Experiments (approval number: 2022029). Consent for publication All the authors agreed in the publication policy. Data availability The following information was supplied regarding data availability: Raw data is available at NCBI GEO: GSE10804, GSE191234. Competing interests The authors declare that they have no competing interests. Funding Not applicable. Authors' contributions Yi-sheng Pan conceived the project. Ya-jie Wang implemented the majority of the experiments and collected the data. Lin Xiao performed statistical analysis. Ya-jie Wang wrote the manuscript, which was edited by all authors. Acknowledgements Not applicable References Flynn S, Eisenstein S: Inflammatory Bowel Disease Presentation and Diagnosis. Surg Clin North Am 2019, 99(6):1051-1062. Giese LA, Terrell L: Sexual health issues in inflammatory bowel disease. Gastroenterol Nurs 1996, 19(1):12-17. Bel LG, Vollebregt AM, Van der Meulen-de Jong AE, Fidder HH, Ten Hove WR, Vliet-Vlieland CW, Ter Kuile MM, de Groot HE, Both S: Sexual Dysfunctions in Men and Women with Inflammatory Bowel Disease: The Influence of IBD-Related Clinical Factors and Depression on Sexual Function. J Sex Med 2015, 12(7):1557-1567. Geiss T, Schaefert RM, Berens S, Hoffmann P, Gauss A: Risk of depression in patients with inflammatory bowel disease. J Dig Dis 2018, 19(8):456-467. Shamloul R, Ghanem H: Erectile dysfunction. Lancet 2013, 381(9861):153-165. Friedman S, Magnussen B, OʼToole A, Fedder J, Larsen MD, Nørgård BM: Increased Use of Medications for Erectile Dysfunction in Men With Ulcerative Colitis and Crohn's Disease Compared to Men Without Inflammatory Bowel Disease: A Nationwide Cohort Study. Am J Gastroenterol 2018, 113(9):1355. Donovan MJ, O'Hara ET: Sexual function following surgery for ulcerative colitis. N Engl J Med 1960, 262:719-720. Gerber RE, Vita JA, Ganz P, Wager CG, Araujo AB, Rosen RC, Kupelian V: Association of peripheral microvascular dysfunction and erectile dysfunction. J Urol 2015, 193(2):612-617. Langer V, Vivi E, Regensburger D, Winkler TH, Waldner MJ, Rath T, Schmid B, Skottke L, Lee S, Jeon NL et al: IFN-γ drives inflammatory bowel disease pathogenesis through VE-cadherin-directed vascular barrier disruption. J Clin Invest 2019, 129(11):4691-4707. Edgar R, Domrachev M, Lash AE: Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res 2002, 30(1):207-210. Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M et al: NCBI GEO: archive for functional genomics data sets--update. Nucleic Acids Res 2013, 41(Database issue):D991-995. Wessells H, Sullivan CJ, Tsubota Y, Engel KL, Kim B, Olson NE, Thorner D, Chitaley K: Transcriptional profiling of human cavernosal endothelial cells reveals distinctive cell adhesion phenotype and role for claudin 11 in vascular barrier function. Physiol Genomics 2009, 39(2):100-108. IBD HIBEC and HILEC transcriptome compendium (human [https://www.ncbi.nlm.nih.gov/bioproject/?term=gse191234] Love MI, Huber W, Anders S: Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology 2014, 15(12):550. Gene Ontology Consortium: going forward. Nucleic Acids Res 2015, 43(Database issue):D1049-1056. Kanehisa M, Goto S: KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res 2000, 28(1):27-30. Cheng Y, Hall TR, Xu X, Yung I, Souza D, Zheng J, Schiele F, Hoffmann M, Mbow ML, Garnett JP et al: Targeting uPA-uPAR interaction to improve intestinal epithelial barrier integrity in inflammatory bowel disease. EBioMedicine 2022, 75:103758. Rivière P, Zallot C, Desobry P, Sabaté JM, Vergniol J, Zerbib F, Peyrin-Biroulet L, Laharie D, Poullenot F: Frequency of and Factors Associated With Sexual Dysfunction in Patients With Inflammatory Bowel Disease. J Crohns Colitis 2017, 11(11):1347-1352. Timmer A, Bauer A, Kemptner D, Fürst A, Rogler G: Determinants of male sexual function in inflammatory bowel disease: a survey-based cross-sectional analysis in 280 men. Inflamm Bowel Dis 2007, 13(10):1236-1243. Berndtsson I, Oresland T, Hultén L: Sexuality in patients with ulcerative colitis before and after restorative proctocolectomy: a prospective study. Scand J Gastroenterol 2004, 39(4):374-379. Tiainen J, Matikainen M, Hiltunen KM: Ileal J-pouch--anal anastomosis, sexual dysfunction, and fertility. Scand J Gastroenterol 1999, 34(2):185-188. Yoshida K, Araki T, Uchida K, Okita Y, Fujikawa H, Inoue M, Tanaka K, Inoue Y, Mohri Y, Kusunoki M: Sexual activity after ileal pouch-anal anastomosis in Japanese patients with ulcerative colitis. Surg Today 2014, 44(1):73-79. Pincus J, Sandoval V, Dick B, Sanekommu G, Rajasekaran R, Ramasamy R, Raheem O: E-Cigarette-Associated Endothelial Damage: A Potential Mechanism for Erectile Dysfunction. Sex Med Rev 2022, 10(1):168-173. Wang X, Chen S, Xiang H, Wang X, Xiao J, Zhao S, Shu Z, Ouyang J, Liang Z, Deng M et al: S1PR2/RhoA/ROCK1 pathway promotes inflammatory bowel disease by inducing intestinal vascular endothelial barrier damage and M1 macrophage polarization. Biochem Pharmacol 2022, 201:115077. Bokemeyer B, Hardt J, Hüppe D, Prenzler A, Conrad S, Düffelmeyer M, Hartmann P, Hoffstadt M, Klugmann T, Schmidt C et al: Clinical status, psychosocial impairments, medical treatment and health care costs for patients with inflammatory bowel disease (IBD) in Germany: an online IBD registry. J Crohns Colitis 2013, 7(5):355-368. Filipović BR, Filipović BF, Kerkez M, Milinić N, Randelović T: Depression and anxiety levels in therapy-naive patients with inflammatory bowel disease and cancer of the colon. World J Gastroenterol 2007, 13(3):438-443. Wylie K: Erectile dysfunction. Adv Psychosom Med 2008, 29:33-49. Timmer A, Bauer A, Dignass A, Rogler G: Sexual function in persons with inflammatory bowel disease: a survey with matched controls. Clin Gastroenterol Hepatol 2007, 5(1):87-94. Meagher AP, Farouk R, Dozois RR, Kelly KA, Pemberton JH: J ileal pouch-anal anastomosis for chronic ulcerative colitis: complications and long-term outcome in 1310 patients. Br J Surg 1998, 85(6):800-803. Marín L, Mañosa M, Garcia-Planella E, Gordillo J, Zabana Y, Cabré E, Domènech E: Sexual function and patients' perceptions in inflammatory bowel disease: a case-control survey. J Gastroenterol 2013, 48(6):713-720. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4492451","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":313323277,"identity":"e51127e0-891a-4d4e-b0a8-f7ab2f0a92b3","order_by":0,"name":"Ya-jie Wang","email":"","orcid":"","institution":"Peking University First Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ya-jie","middleName":"","lastName":"Wang","suffix":""},{"id":313323278,"identity":"ba970b03-882a-475e-a8d0-79b531e5f609","order_by":1,"name":"Lin Xiao","email":"","orcid":"","institution":"Peking University First Hospital","correspondingAuthor":false,"prefix":"","firstName":"Lin","middleName":"","lastName":"Xiao","suffix":""},{"id":313323280,"identity":"2490fb80-2815-4aff-bda6-8ca2df00e9a1","order_by":2,"name":"Yi-sheng Pan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA30lEQVRIiWNgGAWjYDACZgY2GJPxQUKFDWlamA0enEkjyh64FjbJh22HCKs3OM7+7MHHHbUM5uxnj1UksB1g4G/vTsCv5TCPueHMM8cZLHvy0m4k8NxhkDhzdgMhLWzSvG3HGAwO5JjdSJB4xmAgkUtIC/sz6b8gLeffmBUkGBwmRguDmTRjWw2DwY0cM4aEBCK0SB7mMZPsbTvAYDnjjbFEwoE0HoJ+4Tt//JnEz7Y6BnP+HMOPP//ZyPG39+LXonAATB2uhynjwascBOQbwFQdgwFBpaNgFIyCUTBiAQAY7En1QATP3wAAAABJRU5ErkJggg==","orcid":"","institution":"Peking University First Hospital","correspondingAuthor":true,"prefix":"","firstName":"Yi-sheng","middleName":"","lastName":"Pan","suffix":""}],"badges":[],"createdAt":"2024-05-28 17:18:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4492451/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4492451/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":58212596,"identity":"8705324d-b96a-42cb-87e5-fec922e18da6","added_by":"auto","created_at":"2024-06-12 13:56:34","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2368171,"visible":true,"origin":"","legend":"\u003cp\u003e(A)Volcano map of DEGs in GSE10804. (B)Volcano map of DEGs in GSE191234. (C)Heat map of DEGs in GSE10804. (D)Heat map of DEGs in GSE191234.\u003c/p\u003e","description":"","filename":"fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4492451/v1/a9cfa0ab7eb26e56168e4d62.jpg"},{"id":58212593,"identity":"8aa7b934-a425-4407-918d-15a26bdf9cea","added_by":"auto","created_at":"2024-06-12 13:56:32","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1192542,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Construction of mouse model of inflammatory bowel disease (IBD). (B-N) mRNA expression of penile spongy tissues between control and IBD groups.\u003c/p\u003e","description":"","filename":"fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4492451/v1/0072d338241e401ac7458d43.jpg"},{"id":58212592,"identity":"52f76db9-ee45-4ed6-8414-80aeeffeaeb0","added_by":"auto","created_at":"2024-06-12 13:56:32","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1681608,"visible":true,"origin":"","legend":"\u003cp\u003e(A)GO pathway enrichment analysis of DEGs in GSE10804. (B) GO pathway enrichment analysis of DEGs in GSE191234. (C) KEGG pathway enrichment analysis of DEGs in GSE10804. (D) KEGG pathway enrichment analysis of DEGs in GSE191234\u003c/p\u003e","description":"","filename":"fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4492451/v1/180b583f050dc582b463bf7e.jpg"},{"id":58212600,"identity":"abc984ec-8485-4edd-9328-449ccb045a96","added_by":"auto","created_at":"2024-06-12 13:56:35","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1763569,"visible":true,"origin":"","legend":"\u003cp\u003e(A, B) The constructed PPI networks of DEGs in GSE10804 and GSE191234. (C, D) The most significant module of PPI networks of DEGs in GSE10804 and GSE191234.\u003c/p\u003e","description":"","filename":"fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4492451/v1/e5b74c82f15ecf9034402906.jpg"},{"id":61304730,"identity":"dc8655d9-46f5-4516-ab3e-57330da71374","added_by":"auto","created_at":"2024-07-29 09:46:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7512899,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4492451/v1/495a74a3-9000-4e59-aa6b-423ea731f97f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Potential common molecular mechanisms between inflammatory bowel disease and erectile dysfunction in men: genetic screening and in vivo validation","fulltext":[{"header":"Introduction","content":"\u003cp\u003eInflammatory bowel disease (IBD) encompasses a spectrum of chronic inflammatory conditions of the gastrointestinal tract, notably ulcerative colitis (UC) and Crohn\u0026apos;s disease (CD). This complex condition arises from the interplay of environmental and genetic factors\u0026nbsp;[1]. The symptoms of IBD are diverse and may include diarrhea, fatigue, abdominal pain, rectal bleeding, and weight loss. Recent studies have also highlighted that during active IBD, patients may experience anxiety, depression, and sexual dysfunction, which are important considerations[2-4].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eErectile dysfunction (ED) is a prevalent condition predominantly affecting men over 40 years of age. Beyond traditional causes such as diabetes mellitus and hypertension, several lifestyle factors, including obesity, sedentary lifestyle, and lower urinary tract symptoms, have been implicated in the development of ED[5].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eClinical evidence from the United States indicates that men with IBD, regardless of surgical intervention, exhibit a higher incidence of erectile dysfunction medication use compared to those without IBD, as demonstrated in a nationwide cohort study[6].\u0026nbsp;The impact of IBD on male sexual function is primarily characterized by ED, with endothelial dysfunction thought to be a key contributor, particularly systemic vascular dysfunction[7][8]. The endothelium not only serves as a barrier but also regulates muscle tone and vascular circulation. The gut contains endothelial cells, including those in the blood vessels and lymphatic system. Damage to the intestinal endothelium often leads to inflammation and immune disorders. During the acute phase of IBD, blood vessels exhibit increased permeability, which may diminish or disappear during remission\u0026nbsp;[9].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eObtaining intestinal epithelial tissue from IBD patients is relatively straightforward, whereas penile tissue specimens from IBD patients are more challenging to obtain. Therefore, we sought to identify differentially expressed genes between non-ED and ED tissues by screening mRNA microarray datasets from the Gene Expression Omnibus (GEO), a public repository for functional genomics data that provides chips, microarrays, and high-throughput gene expression data [10, 11]. To further elucidate the relationship between IBD and ED, we have employed bioinformatics analysis, microarray technology, and other methodologies. Pathway enrichment analyses of protein-protein interaction (PPI) networks, the Kyoto Encyclopedia of Genes and Genomes (KEGG), and Gene Ontology (GO) have been utilized to explore the shared pathogenesis of IBD and ED patients.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eMicroarray data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGSE10804\u0026nbsp;dataset[12]\u0026nbsp;and GSE191234 dataset[13]\u0026nbsp;were downloaded from GEO. The probes were transformed into the corresponding gene symbols on the basis of annotation information on the platform.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe\u0026nbsp;GSE10804\u0026nbsp;dataset had 3 groups:\u0026nbsp;4 samples are cultured human corpus cavernosum endothelial cells (HCCEC) from a donor with erectile dysfunction;\u0026nbsp;1 sample is cultured human corpus cavernosum endothelial cells (HCCEC) from a donor without erectile dysfunction; 3 samples are cultured human umbilical vein endothelial cells (HUVEC) from a donor without erectile dysfunction, and 4 samples are cultured human coronary artery endothelial cells (HCAEC) from a donor without erectile dysfunction. We have standardized that the 4 ED samples compared to the 8 non-ED samples as a whole.\u003c/p\u003e\n\u003cp\u003eThe GSE191234 dataset had 6 groups including 54 biopsy-derived endothelial cells: 10 Human intestinal blood endothelial cells (HIBEC) samples are from CD patients, 8 HIBEC samples are from UC patients, 10 Human lymphatic endothelial cells (HILEC) samples are from CD patients, 8 HILEC samples are from UC patients, 10 HIBEC samples are samples are from healthy people, n=8 HILEC samples are healthy people. We have standardized that the 36 IBD samples compared to the 18 non-IBD samples as a whole.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIdentification of DEGs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe identified differentiated expressed genes (DEGs) using count data from genes as input to the R package DESeq2\u0026nbsp;[14]. Then we defined the DEGs which had a higher absolute log2 (fold-change) value than 2 and tested significantly (p value \u0026lt; 0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSelection and analysis of Hub genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenes that were simultaneously up-regulated or down-regulated in the differential expression of the two datasets were selected as key genes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalysis of GO enrichment and KEGG networks for DEGs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGene Ontology (GO)[15], a significant bioinformatics tool enables us to annotate genes according to biological processes. On the other hand, Kyoto Encyclopedia of Genes and Genomes (KEGG)\u0026nbsp;[16]\u0026nbsp;is a capable platform that is a knowledge base for systematic analysis of gene functions, linking genomic information with higher-order functional information. We performed a series of gene functional enrichment analyses, including GO, and KEGG to identify major biological models.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConstruction of PPI networks and module analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, the STRING database (STRING:\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ehttp://string-db.org\u003cstrong\u003e)\u003c/strong\u003e was taken to predict the PPI network to determine protein-protein interactions, and to investigate the molecular basis of diseases. The interactions with an average score of greater than 0.7 were chosen the cut-off for statistical significance.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal model construction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAn inflammatory bowel disease (IBD) model in mice was established, and the mice in the IBD group were provided with 3% dextran sulfate sodium (DSS) in their drinking water following a 7-day acclimatization period. On the eighth day of culture, the presence of bloody stools and diarrhea in the mice signaled the successful establishment of the IBD model. The mice were then euthanized by inhaling carbon dioxide as the concentration gradient increases, and their penile tissues were collected for subsequent analysis[17].\u0026nbsp;All animal experiments were conducted in compliance with the regulations of the International Committee for Animal Protection in Medical Sciences and the National Guidelines for the Care and Use of Laboratory Animals. The protocol was reviewed and approved by the Ethics Committee for Animal Experiments at the First Hospital of Peking University (approval number: 2022029).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative Real-Time PCR (qRT\u0026ndash;PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe TRIzol reagent kit (Thermo Fisher Scientific, USA) was applied for the extraction of total RNA from mice penis tissues. The RNA was reverse-transcribed using a PrimeScript\u0026reg; RT Reagent Kit (Takara, Japan). After that, qRT\u0026ndash;PCR was performed using a StepOne Plus System (Applied Biosystems, USA) with a SYBR Premix ExTaq II (TliRNase HPlus) kit (Takara, Japan). The 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method was applied to process the experimental data. The expression of related genes was normalized to the quantity of GAPDH in each sample to correct for sample variability. Validation of S100P and TTTY14 were excluded because both genes were not expressed in mice. All primers are listed in Table 1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable1\u0026nbsp;Primers for qRT-PCR.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"433\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003eGene symbol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eSequences\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003eABCA8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward primer \u0026nbsp; \u0026nbsp; \u0026nbsp;CCGTGATTAAATGGTGCGGC\u003c/p\u003e\n \u003cp\u003eReverse primer \u0026nbsp; \u0026nbsp; \u0026nbsp; GAGCTCACCCACTCCATCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003eAURKC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;GGGCGTGTGTACTTGGCTC\u003c/p\u003e\n \u003cp\u003eReverse Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;AAGTTGGTGCTCCAATCCCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003eCHGB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;AGCTCCAGTGGATAACAGGGA\u003c/p\u003e\n \u003cp\u003eReverse Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;GATAGGGCATTTGAGAGGACTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003eCLGN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;CCAGGGTGTTGGACTATGTTTG\u003c/p\u003e\n \u003cp\u003eReverse Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;CCCCGAGGAAGGTTCATCTTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003ePDE1A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;CCGGGATTGGTTGGCTTCAA\u003c/p\u003e\n \u003cp\u003eReverse Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;AATGCTGCGAAACTTTGGTTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003ePLS1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;AGGAGAGGACATTCCGCAACT\u003c/p\u003e\n \u003cp\u003eReverse Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;GGTACGGAGGCTTGTTCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003eSLC39A8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;GATGTGCTGAGCGTGTTCG\u003c/p\u003e\n \u003cp\u003eReverse Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;GAAGTTCGAGCTGGTTATCTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003eADGRF5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward primer \u0026nbsp; \u0026nbsp; \u0026nbsp;GAGTGGCCAGACCTGTTCAT\u003c/p\u003e\n \u003cp\u003eReverse primer \u0026nbsp; \u0026nbsp; \u0026nbsp; CTGAGTGGCTTCGCCTGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003eGRM1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;GAGGCCATGTTCCACACATTA\u003c/p\u003e\n \u003cp\u003eReverse Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;CCAGCAATAGGCTTCTTAGTCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003eLRRC17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;CTGCTGAGCCTCGCAAGTC\u003c/p\u003e\n \u003cp\u003eReverse Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;CCTGGTGCATAGCGTTTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003eNUAK1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;TCCAACCTGTACCAGAAGGAC\u003c/p\u003e\n \u003cp\u003eReverse Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;GGGCATCGTTCCATAAATGAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003ePSCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;GGACCAGCACAGTTGCTTTAC\u003c/p\u003e\n \u003cp\u003eReverse Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;GTAGTTCTCCGAGTCATCCTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.868360277136258%\"\u003e\n \u003cp\u003eRASA4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"71.13163972286374%\"\u003e\n \u003cp\u003eForward Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;CGCTGTCCATCCGAATCGTAG\u003c/p\u003e\n \u003cp\u003eReverse Primer \u0026nbsp; \u0026nbsp; \u0026nbsp;GATCACATCGTCCCGGCTAA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwo-tailed Student\u0026apos;s t-test (unpaired) was used to analyze differences in mean values between groups (GraphPad Prism version 10.0 for Macbook, GraphPad Software, USA). A p-value \u0026lt; 0.05 was used to indicate the statistical significance. All results were expressed as the means \u0026plusmn; standard\u0026thinsp;error\u0026thinsp;of\u0026thinsp;the\u0026thinsp;mean (SEM), and all experiments were repeated at least three times to ensure reproducibility.\u0026nbsp;\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eIdentification of DEGs in the GSE10804 and GSSE191234\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDEGs (581 in\u0026nbsp;GSE10804)\u0026nbsp;were identified (Fig 1.A) after standardizing the microarray data. The dataset consisted of 285 down-regulated genes and 296 up-regulated genes between ED endothelial cells and non-ED endothelial cells.\u003c/p\u003e\n\u003cp\u003eDEGs (777 in GSE191234) were identified (Fig 1.B) after standardizing the microarray data. The dataset consisted of 419 down-regulated genes and 358 up-regulated genes between ED endothelial cells and non-ED endothelial cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSelection of key genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter the intersection of the differentially-expressed genes in the above two datasets, we found 6 up-regulated genes ADGRF5, GRM1, LRRC17, NUAK1, PSCA, RASA4, and 9 down-regulated genes ABCA8, AURKC, CHGB, CLGN, PDE1A, PLS1. S100P, SLC39A8, TTTY14 (Table 2). We took these 15 differentially expressed genes as key genes for the study.\u003c/p\u003e\n\u003cp\u003eTable 2 Fifteen common differential genes in GSE10804 and GSE191234\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"433\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003egene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003elogFC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eP.Value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003edataset\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003echange\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eABCA8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e-1.2667799\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.01535401\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003edown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eAURKC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e-1.0548671\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.04169207\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003edown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eCHGB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e-1.3520567\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.03191383\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003edown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eCLGN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e-2.2291115\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.03591628\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003edown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003ePDE1A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e1.35297044\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.00856546\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003edown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003ePLS1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e-1.3450405\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.01265455\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003edown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eS100P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e-1.0476937\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.00774011\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003edown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eSLC39A8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e-1.2275987\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.02237304\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003edown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eTTTY14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e-1.8917446\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.02210652\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003edown\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eADGRF5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e2.34879288\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.02675972\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGRM1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e1.21155417\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.00503481\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eLRRC17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e1.63126642\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.00479406\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eNUAK1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e1.17394876\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.02280052\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003ePSCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e2.07792214\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.01202469\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eRASA4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e1.15349435\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e0.00282333\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eGSE10804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003eup\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eABCA8\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e-1.5338835\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.00842707\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003edown\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003ePDE1A\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e-1.362995\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.00086744\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003edown\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003ePLS1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e-0.9664784\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.00133755\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003edown\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eS100P\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e-0.9243563\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.01416089\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003edown\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eSLC39A8\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e-0.800117\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e9.62E-05\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003edown\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eTTTY14\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e-1.1713513\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.0129671\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003edown\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eAURKC\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e-0.6846483\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.00152663\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003edown\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eCHGB\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e-0.5563726\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.01220286\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003edown\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eCLGN\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e-1.1692837\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.00287008\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003edown\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eNUAK1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.55243469\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.02502592\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eup\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003ePSCA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.65805049\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.0314162\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eup\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eRASA4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e1.03831142\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.00071851\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eup\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eADGRF5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.82059026\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.00422924\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eup\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGRM1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.67399507\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.03746743\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eup\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eLRRC17\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e1.63601615\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003e0.0409431\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eGSE191234\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20%\"\u003e\n \u003cp\u003e\u003cem\u003eup\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal experiment verification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBy giving oral 3% DSS aqueous solution, the mouse model of IBD was constructed (Fig 2.A), and the penile spongy tissues of the two groups of mice were taken for qRT-PCR to verify the expression of differential genes. In vivo, ABAC8, ADGRF5, CLGN, GRM1, NUAK1, PDE1A, SLC39A8 were verified by statistical difference (Fig 2.B-N).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eKEGG and GO enrichment analyses of DEGs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the DEGs of GSE10804, the Results of GO analyses (Fig 3. A) showed that the remarkable enhancement of changes in BP was in the ameboidal-type cell migration, negative regulation of immune system process and mesenchyme development extracellular matrix. Changes in CC were greatly improved in collagen- containing, extrasellar matrix, endoplasmic reticulum lumen. Changes in MF primarily emerged in the signaling receptor activator activity, receptor ligand activity and cytokine activity. KEGG pathway analysis revealed that the DEGs were mainly enhanced in the cytokine-cytokine receptor pathway, PI3K-Akt signaling pathway, and neuroactive ligand-receptor interactions (Fig 3. C).\u003c/p\u003e\n\u003cp\u003eIn the DEGs of GSE191234, the Results of GO analyses demonstrated that the nephron epithelium development, nephron tubule development, and ureteric bud development had changes in BP (Fig 3. B). KEGG pathway analysis revealed that the DEGs were mainly enhanced in the calcium signaling pathway, cell adhesion molecules, and motor proteins (Fig 3. D).\u003c/p\u003e\n\u003cp\u003eAmong them, the common KEGG pathway of the DEGs in the two datasets includes calcium signaling pathway and cell adhesion molecules, cytoskeleton in muscle cells, protein digestion and absorption, and tyrosine metabolism.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConstruction of PPI networks\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe constructed PPI networks of DEGs are shown in Fig 4. A-B, and the most significant module was obtained and shown in Fig 4. C-D. The DAVID tools were applied in the functional analyses of genes associated with this module. We found that the protein interaction networks of the two datasets were not closely aligned.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIBD mostly occurs in young people aged 15-30 years. In recent years, the peak age of the onset of IBD has moved forward and the incidence has increased year by year. This group of people is the main force of reproduction, so the reproductive function of IBD patients is an inevitable problem to be faced. Most male IBD patients are complicated with impaired erectile function[18], which inevitably affects patients\u0026apos; fertility and quality of life, but clinicians have little understanding of this and have not paid enough attention to it. There are few studies on the association between the two diseases at the genetic and molecular levels.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn previous studies, the association between chronic gastrointestinal diseases and sexual dysfunction may be related to Damage to the pudendal nerve in specific treatments, such as proctectomy for inflammatory bowel disease[19-22]. In fact, whether it is intestinal inflammation or erectile dysfunction, there is an important role - endothelial cells. Dysfunction of intestinal endothelial cells leads to intestinal inflammation, and dysfunction of cavernous endothelial cells leads to poor erectile function.\u0026nbsp;Endothelial cell dysfunction is regarded as a important cause of a variety of pathologic Settings such as cardiovascular disease, erectile dysfunction, and intestinal injury[23, 24]. The correlation between IBD and ED found in some clinical studies also seemed to indicate that the two diseases are related at the genetic and molecular level, which prompts us to look for genetic answers from the GEO database.\u003c/p\u003e\n\u003cp\u003eTherefore, this study extracts the data sets of inflammatory bowel disease and male erectile dysfunction in geo database and conducts difference analysis, so as to intersection the common differential genes of the two diseases, extract Hub genes, and study the related disease signaling pathways. The differential genes were verified in DSS-induced IBD mice.\u003c/p\u003e\n\u003cp\u003eBioinformatics analysis from public databases is a good tool for understanding gene and protein interactions. From public GEO datasets of IBD and ED, we mined 15 genes that work together on both diseases and validated them in mice with inflammatory bowel disease, finding the importance of several genes. Among them, the common KEGG pathway of the DEGs in the two datasets includes calcium signaling pathway and cell adhesion molecules, cytoskeleton in muscle cells, protein digestion and absorption, and tyrosine metabolism. However, we found that the protein interaction networks of the two datasets were not closely aligned.\u003c/p\u003e\n\u003cp\u003eIn exploring inflammatory bowel disease and erectile dysfunction, depression is a part that cannot be ignored[25]. Inflammatory bowel patients are often complicated by depression, and studies have found that the rate of depression and anxiety in newly diagnosed inflammatory bowel patients is even higher than that in newly diagnosed colon cancer patients[26]. On the other hand, drugs used to treat depression may lead to sexual dysfunction, and depression itself may aggravate existing sexual dysfunction. Intervention and treatment of depression can successfully alleviate the symptoms of male sexual dysfunction and avoid surgical treatment\u0026nbsp;[27]. A study involving 153 men with inflammatory bowel disease and age-matched healthy controls showed that depression was the most important determinant of low sexual function\u0026nbsp;[28].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe prevalence of ED decreased significantly after IBD remission or surgical treatment. Meagher et al. followed up 689 male UC patients after IPAA for an average of 6.5 years, and only 10 patients had ED[29]. Many studies have found that the sexual function of male UC patients can be significantly improved after IPAA[30], and the earlier the age of surgery, the lower the postoperative ED complication rate[29]. Therefore, an aggressive and correct treatment program seeking long-term remission is the right way to manage IBD with ED.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003ePotential common genes interaction between inflammatory bowel disease and erectile dysfunction may be related to ABAC8, ADGRF5, CLGN, GRM1, NUAK1, PDE1A, SLC39A. calcium signaling pathway and cell adhesion molecules, cytoskeleton in muscle cells, protein digestion and absorption, and tyrosine metabolism may be the potential mechanism.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study is reported in accordance with ARRIVE guidelines. All animal experiments were performed according to the regulations of the International Committee for Animal Protection of Medical Sciences and the Guide for the National Guidelines for the Feeding and Use of Laboratory Animals. The protocol was approved by the Peking University First Hospital Ethics Committee of Animal Experiments (approval number: 2022029).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the authors agreed in the publication policy.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe following information was supplied regarding data availability: Raw data is available at NCBI GEO: GSE10804, GSE191234.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYi-sheng Pan conceived the project. Ya-jie Wang implemented the majority of the experiments and collected the data. Lin Xiao performed statistical analysis. Ya-jie Wang wrote the manuscript, which was edited by all authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eFlynn S, Eisenstein S: Inflammatory Bowel Disease Presentation and Diagnosis. Surg Clin North Am 2019, 99(6):1051-1062.\u003c/li\u003e\n\u003cli\u003eGiese LA, Terrell L: Sexual health issues in inflammatory bowel disease. Gastroenterol Nurs 1996, 19(1):12-17.\u003c/li\u003e\n\u003cli\u003eBel LG, Vollebregt AM, Van der Meulen-de Jong AE, Fidder HH, Ten Hove WR, Vliet-Vlieland CW, Ter Kuile MM, de Groot HE, Both S: Sexual Dysfunctions in Men and Women with Inflammatory Bowel Disease: The Influence of IBD-Related Clinical Factors and Depression on Sexual Function. J Sex Med 2015, 12(7):1557-1567.\u003c/li\u003e\n\u003cli\u003eGeiss T, Schaefert RM, Berens S, Hoffmann P, Gauss A: Risk of depression in patients with inflammatory bowel disease. J Dig Dis 2018, 19(8):456-467.\u003c/li\u003e\n\u003cli\u003eShamloul R, Ghanem H: Erectile dysfunction. Lancet 2013, 381(9861):153-165.\u003c/li\u003e\n\u003cli\u003eFriedman S, Magnussen B, OʼToole A, Fedder J, Larsen MD, N\u0026oslash;rg\u0026aring;rd BM: Increased Use of Medications for Erectile Dysfunction in Men With Ulcerative Colitis and Crohn\u0026apos;s Disease Compared to Men Without Inflammatory Bowel Disease: A Nationwide Cohort Study. Am J Gastroenterol 2018, 113(9):1355.\u003c/li\u003e\n\u003cli\u003eDonovan MJ, O\u0026apos;Hara ET: Sexual function following surgery for ulcerative colitis. N Engl J Med 1960, 262:719-720.\u003c/li\u003e\n\u003cli\u003eGerber RE, Vita JA, Ganz P, Wager CG, Araujo AB, Rosen RC, Kupelian V: Association of peripheral microvascular dysfunction and erectile dysfunction. J Urol 2015, 193(2):612-617.\u003c/li\u003e\n\u003cli\u003eLanger V, Vivi E, Regensburger D, Winkler TH, Waldner MJ, Rath T, Schmid B, Skottke L, Lee S, Jeon NL et al: IFN-\u0026gamma; drives inflammatory bowel disease pathogenesis through VE-cadherin-directed vascular barrier disruption. J Clin Invest 2019, 129(11):4691-4707.\u003c/li\u003e\n\u003cli\u003eEdgar R, Domrachev M, Lash AE: Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res 2002, 30(1):207-210.\u003c/li\u003e\n\u003cli\u003eBarrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M et al: NCBI GEO: archive for functional genomics data sets--update. Nucleic Acids Res 2013, 41(Database issue):D991-995.\u003c/li\u003e\n\u003cli\u003eWessells H, Sullivan CJ, Tsubota Y, Engel KL, Kim B, Olson NE, Thorner D, Chitaley K: Transcriptional profiling of human cavernosal endothelial cells reveals distinctive cell adhesion phenotype and role for claudin 11 in vascular barrier function. Physiol Genomics 2009, 39(2):100-108.\u003c/li\u003e\n\u003cli\u003eIBD HIBEC and HILEC transcriptome compendium (human [https://www.ncbi.nlm.nih.gov/bioproject/?term=gse191234]\u003c/li\u003e\n\u003cli\u003eLove MI, Huber W, Anders S: Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology 2014, 15(12):550.\u003c/li\u003e\n\u003cli\u003eGene Ontology Consortium: going forward. Nucleic Acids Res 2015, 43(Database issue):D1049-1056.\u003c/li\u003e\n\u003cli\u003eKanehisa M, Goto S: KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res 2000, 28(1):27-30.\u003c/li\u003e\n\u003cli\u003eCheng Y, Hall TR, Xu X, Yung I, Souza D, Zheng J, Schiele F, Hoffmann M, Mbow ML, Garnett JP et al: Targeting uPA-uPAR interaction to improve intestinal epithelial barrier integrity in inflammatory bowel disease. EBioMedicine 2022, 75:103758.\u003c/li\u003e\n\u003cli\u003eRivi\u0026egrave;re P, Zallot C, Desobry P, Sabat\u0026eacute; JM, Vergniol J, Zerbib F, Peyrin-Biroulet L, Laharie D, Poullenot F: Frequency of and Factors Associated With Sexual Dysfunction in Patients With Inflammatory Bowel Disease. J Crohns Colitis 2017, 11(11):1347-1352.\u003c/li\u003e\n\u003cli\u003eTimmer A, Bauer A, Kemptner D, F\u0026uuml;rst A, Rogler G: Determinants of male sexual function in inflammatory bowel disease: a survey-based cross-sectional analysis in 280 men. Inflamm Bowel Dis 2007, 13(10):1236-1243.\u003c/li\u003e\n\u003cli\u003eBerndtsson I, Oresland T, Hult\u0026eacute;n L: Sexuality in patients with ulcerative colitis before and after restorative proctocolectomy: a prospective study. Scand J Gastroenterol 2004, 39(4):374-379.\u003c/li\u003e\n\u003cli\u003eTiainen J, Matikainen M, Hiltunen KM: Ileal J-pouch--anal anastomosis, sexual dysfunction, and fertility. Scand J Gastroenterol 1999, 34(2):185-188.\u003c/li\u003e\n\u003cli\u003eYoshida K, Araki T, Uchida K, Okita Y, Fujikawa H, Inoue M, Tanaka K, Inoue Y, Mohri Y, Kusunoki M: Sexual activity after ileal pouch-anal anastomosis in Japanese patients with ulcerative colitis. Surg Today 2014, 44(1):73-79.\u003c/li\u003e\n\u003cli\u003ePincus J, Sandoval V, Dick B, Sanekommu G, Rajasekaran R, Ramasamy R, Raheem O: E-Cigarette-Associated Endothelial Damage: A Potential Mechanism for Erectile Dysfunction. Sex Med Rev 2022, 10(1):168-173.\u003c/li\u003e\n\u003cli\u003eWang X, Chen S, Xiang H, Wang X, Xiao J, Zhao S, Shu Z, Ouyang J, Liang Z, Deng M et al: S1PR2/RhoA/ROCK1 pathway promotes inflammatory bowel disease by inducing intestinal vascular endothelial barrier damage and M1 macrophage polarization. Biochem Pharmacol 2022, 201:115077.\u003c/li\u003e\n\u003cli\u003eBokemeyer B, Hardt J, H\u0026uuml;ppe D, Prenzler A, Conrad S, D\u0026uuml;ffelmeyer M, Hartmann P, Hoffstadt M, Klugmann T, Schmidt C et al: Clinical status, psychosocial impairments, medical treatment and health care costs for patients with inflammatory bowel disease (IBD) in Germany: an online IBD registry. J Crohns Colitis 2013, 7(5):355-368.\u003c/li\u003e\n\u003cli\u003eFilipović BR, Filipović BF, Kerkez M, Milinić N, Randelović T: Depression and anxiety levels in therapy-naive patients with inflammatory bowel disease and cancer of the colon. World J Gastroenterol 2007, 13(3):438-443.\u003c/li\u003e\n\u003cli\u003eWylie K: Erectile dysfunction. Adv Psychosom Med 2008, 29:33-49.\u003c/li\u003e\n\u003cli\u003eTimmer A, Bauer A, Dignass A, Rogler G: Sexual function in persons with inflammatory bowel disease: a survey with matched controls. Clin Gastroenterol Hepatol 2007, 5(1):87-94.\u003c/li\u003e\n\u003cli\u003eMeagher AP, Farouk R, Dozois RR, Kelly KA, Pemberton JH: J ileal pouch-anal anastomosis for chronic ulcerative colitis: complications and long-term outcome in 1310 patients. Br J Surg 1998, 85(6):800-803.\u003c/li\u003e\n\u003cli\u003eMar\u0026iacute;n L, Ma\u0026ntilde;osa M, Garcia-Planella E, Gordillo J, Zabana Y, Cabr\u0026eacute; E, Dom\u0026egrave;nech E: Sexual function and patients\u0026apos; perceptions in inflammatory bowel disease: a case-control survey. J Gastroenterol 2013, 48(6):713-720.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"inflammatory bowel disease, erectile dysfunction, GEO, bioanalysis","lastPublishedDoi":"10.21203/rs.3.rs-4492451/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4492451/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003ePurpose: \u003c/strong\u003eTo explore Potential common molecular mechanisms between inflammatory bowel disease and erectile dysfunction in men.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethod: \u003c/strong\u003eFirst, differentially expressed genes in GSE10804 dataset and GSE191234 dataset were identified. qRT-PCR to verify the expression of differential genes. Enrichment analysis was performed in GO, KEGG and PPI.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResult:\u003c/strong\u003e From public GEO datasets of IBD and ED, we mined 15 genes that work together on both diseases and validated them in mice with inflammatory bowel disease, finding the importance of several genes. Among them, the common KEGG pathway of the DEGs in the two datasets includes calcium signaling pathway and cell adhesion molecules, cytoskeleton in muscle cells, protein digestion and absorption, and tyrosine metabolism. In vivo, ABAC8, ADGRF5, CLGN, GRM1, NUAK1, PDE1A, SLC39A8 were verified by statistical difference.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003ePotential common genes interaction between inflammatory bowel disease and erectile dysfunction may be related to ABAC8, ADGRF5, CLGN, GRM1, NUAK1, PDE1A, SLC39A. calcium signaling pathway and cell adhesion molecules, cytoskeleton in muscle cells, protein digestion and absorption, and tyrosine metabolism may be the potential mechanism.\u003c/p\u003e","manuscriptTitle":"Potential common molecular mechanisms between inflammatory bowel disease and erectile dysfunction in men: genetic screening and in vivo validation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-12 13:55:14","doi":"10.21203/rs.3.rs-4492451/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4bb17559-78a8-4af8-bf02-672f6a702759","owner":[],"postedDate":"June 12th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":33127190,"name":"Health sciences/Diseases/Gastrointestinal diseases"},{"id":33127191,"name":"Health sciences/Diseases/Urogenital diseases"}],"tags":[],"updatedAt":"2024-07-29T09:37:57+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-12 13:55:14","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4492451","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4492451","identity":"rs-4492451","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.