Selective packaging of viroid RNAs into plant exosomes, mediated by host proteins, enables efficient cross-kingdom transmission

Selective packaging of viroid RNAs into plant exosomes, mediated by host proteins, enables efficient cross-kingdom transmission | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Selective packaging of viroid RNAs into plant exosomes, mediated by host proteins, enables efficient cross-kingdom transmission Neha Devi, Nisha Devi, Vasudha Sharma, Ravi Gupta, Sunny Dhir, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7544331/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: The plant apoplast and extracellular vesicles (EVs) contain diverse RNA species, including small RNAs, long non-coding RNAs, and circular RNAs, many of which cross kingdom boundaries through EV-mediated transport. Viroid RNAs particularly Apple Scar Skin Viroid (ASSVd) are known to move from plants to fungi and insects, though the mechanism remains unclear. Results: Using cucumber as a host and Apple scar skin viroid (ASSVd) as the pathogen, we demonstrate through RT-PCR and northern blot analyses that multiple forms of viroid RNAs are present within cucumber-derived EVs. Transmission assays show that these EVs retain viroid infectivity, successfully transmitting the viroid to healthy plants and whiteflies via artificial diets supplemented with viroid-positive EVs. Proteomic analyses identify tetraspanin 8 (CsTET8) as a conserved EV marker, and reveal CsPP2—a phloem lectin with RNA-binding capacity—as a novel EV-associated protein. Co-immunoprecipitation and enrichment assays further confirm the co-localization of CsPP2 and ASSVd within CsTET8-positive EVs, along with direct interactions between CsPP2, CsTET8, and ASSVd. Conclusions: In summary, this study demonstrates that cucumber-derived EVs can carry infectious ASSVd RNA, which remains transmissible to healthy plants and insect vectors under experimental conditions. The EVs are marked by CsTET8, and CsPP2 is identified as a novel RNA-binding protein associated with viroid-containing EVs, directly interacting with both CsTET8 and ASSVd. These findings propose a potential EV-mediated pathway for viroid movement and transmission in plants and establish viroid RNAs as a model system to study the molecular basis of RNA trafficking across biological kingdoms. Extracellular vesicles Apple Scar Skin Viroid Phloem Protein 2 Tetraspanin 8 Cross-kingdom trafficking Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background The role of the apoplast and EVs in mediating cross-kingdom RNA trafficking has gained attention recently [1, 2] EVs are small, membrane-bound vesicles secreted by cells that can encapsulate a variety of biomolecules, including RNA [1, 3-5]. Plants are known to contain three classes of EVs[6] . The first class is represented by exosomes with sizes ranging from 30-150nm which are specifically enriched in tetraspanin 8 (TET8), an ortholog of mammalian CD63, CD81, and CD151 [7, 8]The second class is represented by micro-vesicles with sizes ranging from 150-300nm and are associated with syntaxins proteins, of which Penetration 1 (PEN1) is well characterized[9] The third class is represented by EXPO vesicles which are double membrane bodies fused with the plasma membrane (PM), releasing a single membrane vesicle into the cell wall[2]. Exo70E2 is essential for exocyst subunit recruitment and EXPO formation in both plants and animals [10] Plant apoplast and EVs are enriched in various RNA species, such as long non-coding RNAs (lncRNA), circular RNAs, (circRNA) micro RNAs (miRNAs), and tasiRNAs [4]. The process of cross-kingdom RNA transfer via EVs was first observed during the interaction between Arabidopsis and Botrytis cinerea , where pathogen-derived small RNAs (sRNAs) were shown to travel across kingdoms and interact with plant argonaute (AGO) to target mitogen-activated protein kinase transcripts, promoting pathogen colonization [11]. Subsequent studies revealed that plants can send their small RNAs in TET8-specific exosomes to suppress fungal virulence genes[12]. In addition, they also carry mRNAs that are translated into fungi and reduce their pathogenicity [5]. Recent studies have identified various mechanisms involved in the loading of RNA into EVs. Specifically, RNA-binding proteins such as AGO1, annexins, and RNA helicases play significant roles in the incorporation of plant small RNAs into TET8-specific exosomes [3, 4, 12]. Furthermore, glycine-rich binding protein (GRP7) and AGO2 have been linked to the secretion of N6-methyladenosine (m6A) modified circular and long non-coding RNAs, as well as small RNAs in the apoplast [13]. Similar to the animals, circular RNAs in the plant apoplast are notably enriched with m6A modifications. [4, 14]. Certain factors have been identified in animals and plants that could assist the sorting of RNAs inside the vesicles. These factors encompass characteristics such as a high GC content, the presence of an EXOmotif (a motif known to facilitate preferential sorting of RNA into exosomes or EVs), and their ability to modify RNAs and interact with RNA binding proteins [14-17]. A class of non-coding circular RNAs is represented by viroids which are RNA-only pathogens infecting plants with distinct structural and functional properties. [18, 19] [20]. Despite their small size (246-401nts) and non-coding properties, they autonomously replicate within infected plant cells and cause a variety of diseases. The ability of viroids to infect plants is enabled by their secondary structure [21-25] which is crucial for their replication and movement and allows hijacking of plant cellular machinery for their propagation [26-29] . Recent studies have shown that viroids are not limited to infecting plants but can also affect other biological kingdoms, including fungi, insects, and bacteria [30-33]. This cross-kingdom infection potential suggests that viroids, much like other RNA entities, can traverse biological barriers and may play a role in complex ecological interactions [5, 12]. For example, research on apple scar skin viroid (ASSVd) demonstrated that viroids get transmitted from infected apple trees to fungi, such as Alternaria alternata , a common plant pathogen[33]. We have previously reported that the glass-house whitefly, Trialeurodes vaporariorum , mediates the transmission of ASSVd and cucumber PP2 assists in its acquisition and transmission [30]. Moreover, certain aphid species and codling moth larvae, which feed directly on infected apple trees, were found to transmit apple chlorotic fruit spot viroid (ACFSVd), highlighting the role of insect vectors in cross-kingdom viroid transmission [31]. Potato spindle tuber viroid (PSTVd) transmission from infected plants to Phytophthora infestans also emphasizes the inter-kingdom dynamics of viroid spread [32]. All these findings together suggest that viroids, as circular non-coding RNAs, may take advantage of RNA sorting and encapsulation mechanisms within EVs to facilitate their intercellular movement and potential cross-kingdom dissemination. By associating with EVs, viroids could bypass the hostile intracellular environment of the host, enabling long-distance transport or transmission across different organisms. In the present study, we show that different ASSVd RNAs are present in cucumber EVs. A phloem protein, CsPP2, binds ASSVd and interacts with EV marker CsTET8, suggesting it helps load RNA into EVs. Whiteflies can acquire and transmit viroid-containing EVs, revealing a cross-kingdom RNA transmission route. Results EV-encapsulated ASSVd RNA is efficiently delivered via mechanical inoculation and is readily acquired and transmitted by whiteflies To identify that the viroid forms inside EVs are biologically active we carried out mechanical inoculation of healthy cucumber plants with EVs. For this, we inoculated healthy cucumber plants with intact EVs (Digested with Trypsin followed by RNase to remove RNA associated with EV surface), AWF ((apoplast with EV fractions depleted) and water. At 14 dpi, RT-PCR on the plants confirmed the presence of ASSVd infection, showing that both the apoplast and EVs of infected plants contained infectious forms of the viroid (Fig. 2g). In contrast, plants inoculated with water showed no viroid-specific amplification. Furthermore, to identify whether whitefly can aquire viroid RNA from the EVs and transmit to healthy plants, we conducted an experiment where a group of ten whiteflies ( Trialeurodes vaporariorum ) were fed for 48 hours with three different treatments: intact EVs, AWF and water (as described above), supplemented with artificial diet [36]. After the feeding period, five whiteflies were analyzed for ASSVd presence using RT-PCR, while the remaining five were allowed to feed on healthy cucumber plants. The RT-PCR results revealed that whiteflies were able to acquire ASSVd from the intact EVs (Fig. 2h). Interestingly, a form of infectious ASSVd was also present in the apoplast that had been depleted of EVs, and whiteflies were able to acquire it from there as well. However, the PCR signal was significantly stronger for RNA acquired from intact EVs compared to that from the apoplast, indicating that the viroid is more stable and protected from RNases when encapsulated within EVs. This suggests that EVs might facilitate more efficient acquisition of the viroid by whiteflies compared to naked RNA. No ASSVd was detected in whiteflies fed with water. Subsequently, plants that were fed with viroid-carrying whiteflies were tested for viroid transmission at 14dpi using RT-PCR, which confirmed that the viroid could be actively acquired and transmitted from EVs through the whiteflies (Fig. 2i). Viroid Infection Alters the Molecular Landscape of Cucumber EVs For the identification of protein changes in EVs upon viroid stress, EVs from AWF were isolated from ASSVd-infected cucumber plants and mock plants three weeks post viroid infection as described above. The morphology of the isolated EVs was analyzed using TEM and DLS which revealed EVs of size varying from 50nm to 1000nm (Fig. 3a and 3b). Protein identification of the infected and healthy EVs revealed proteins specific to exosomes such as tetraspanins (Tet16/PLAT/LH2 domain-containing lipoxygenase family protein) in healthy EVs, and lipoxygenase 3 (orthologue of TET8 in cucumber) in infected EVs (Table 1). Additionally, markers for microvesicles, including syntaxins (SYP21/71/31, SNARE-like superfamily protein) and target SNARE coiled-coil domain protein in healthy EVs, and SYP124/21/42/71 and SNARE-like super-family proteins were also found in infected EVs. Proteins associated with EXPO vesicles, such as exocyst complex components (SEC84B, SEC15B, SEC5, EXO70 family protein in healthy EVs, and SEC10, SEC15B in infected EVs) were also identified. These findings align with the TEM data, which confirmed that EVs isolated through SEC had a size of 50-500nm consistent with the size of exosomes, micro-vesicles, and EXPO vesicles in plants. Notably, enrichment of RNA-binding proteins including Argonaute family proteins (AGO2, AGO3, and AGO7), DEAD-box RNA helicases, sorting nexins, and glycine-rich RNA-binding proteins was also observed in both healthy and infected plant EVs. Apart from these RNA-binding proteins, chaperonins such as heat shock proteins (HSP60/70/81/89.1/70, DnaJ) were also identified in the EVs (Table 1). Interestingly, a phloem protein -CsPP2 was also identified in the cucumber EVs which is known to be involved in viroid transmission to whiteflies [36](Walia et al. 2015) and contains a dsRNA binding motif. The absence of markers for the trans-Golgi network (syntaxin 61, SYP61), late endosomes (Ara6), Golgi bodies (GmMan149), and plasma membrane (LTI6) confirmed the integrity of the EVs and EV-specificity of the identified proteins (Table 1, File: S1 and S2). Further, the cellular component enrichment analysis revealed that both healthy and infected EVs shared several core categories, including the endomembrane system, organelle membrane, membrane-enclosed lumen, extracellular region, and protein-containing complexes (Fig. 4b). These shared categories reflect conserved EV biogenesis and structure across conditions. However, viroid-infected EVs exhibited a prominent shift in the composition and diversity of cellular origins. Increased enrichment of membrane-associated compartments such as the endoplasmic reticulum, outer membrane, and plasma membrane projections was observed in infected EVs, suggesting the involvement of expanded membrane systems in EV formation during stress. Additionally, components associated with cell projections and supramolecular fibers were uniquely enriched in infected EVs, which may support altered trafficking or facilitate intercellular or cross-kingdom communication. In contrast, symplast-related and junctional components (e.g., symplast, cell-cell junction, anchoring junction) were more prominent in healthy EVs and showed reduced representation in infected samples, suggesting a shift from symplastic transport to apoplastic or EV-mediated viroid dissemination. These findings indicate that viroid infection triggers a remodeling of EVs toward more stress-adaptive and extracellularly focused functions, likely to support viroid movement and stability. In the biological process category, a marked divergence was observed between healthy and infected EVs (Fig. 4d). Healthy EVs were enriched in pathways related to cellular organization and signaling, such as: Regulation of Ras and small GTPase-mediated signal transduction, Cytoskeleton organization, Chromatin remodelling, Organelle organization and Symplastic communication. These patterns indicate a role for healthy EVs in intracellular regulation, cell-cell communication, and homeostatic signaling. In contrast Viroid-Infected EVs displayed profound shifts in biological function, including: Strong enrichment of cytoskeleton-dependent intracellular transport and microtubule-based movement, suggesting heightened vesicle dynamics under infection. RNA silencing-related processes such as post-transcriptional gene silencing (PTGS) and basal gene silencing by RNA were highly enriched, consistent with a host response to suppress viroid replication. RNA metabolism and processing, including splicing, catabolism, and RNA-binding activities, were prominent, reflecting the reallocation of RNA regulatory machinery to EVs. Infected EVs were also enriched in metabolic pathways, particularly carbohydrate, amino acid, and fatty acid biosynthesis, suggesting viroid-induced metabolic reprogramming. Additional terms linked to development, embryogenesis, and stress responses (e.g., detoxification, oxidative stress) highlight a broader reorganization of cellular priorities under infection. These results suggest that EVs from viroid-infected plants are selectively loaded with RNA-regulatory and defense-related proteins, likely to aid in containing, transporting, or responding to viroid RNA. Together, these data reveal that ASSVd infection significantly remodels the proteomic and functional landscape of cucumber EVs. Healthy EVs maintain a homeostatic role, supporting cellular communication and signaling. In contrast, viroid-infected EVs acquire a specialized cargo enriched in RNA-processing, silencing, and stress-response proteins, along with expanded membrane-associated components. These infection-induced changes likely represent an adaptive host response and may also facilitate viroid systemic movement, protection from degradation, and vector-mediated transmission via EV-mediated packaging and delivery mechanism. Table 2 : Displays the list of proteins identified in mass spectrometry data from both viroid-infected and healthy EVs. It includes plant EV-related proteins such as Syntaxins, Tetraspanins, and Expo proteins. Additionally, RNA-binding proteins and Heat shock proteins, previously reported to be associated with plant EVs, are also included. The table further highlights PP2 proteins identified specifically in the EVs from viroid-infected plants. Healthy Infected A ccession No. Protein name A ccession No Protein name Syntaxins related AT5G16830 Syntaxin of plants 21 (PEP12 VACULAOR TRANSPORT) AT1G61290 Syntaxin of plants 124 AT3G09740 Syntaxin of plants 71 AT5G16830 Syntaxin of plants 21 AT5G05760 Syntaxin of plants 31 AT4G02195 Syntaxin of plants 42 AT5G02280 SNARE-like superfamily protein AT5G02280 SNARE-like superfamily protein AT1G15370 SNARE-like superfamily protein AT2G35190 novel plant snare 11 AT1G16230 Target SNARE coiled-coil domain AT1G16230 Target SNARE coiled-coil domain protein AT3G09740 syntaxin of plants 71 Tetraspanin related AT3G22400 Lox5/PLAT/LH2 domain AT1G17420 Lipoxygenase 3 (PLAT/LH2 domain) AT1G18510 tetraspanin 16 (TET8 RELATED) AT4G02380 Senescence-associated gene 21 AT4G02380 Senescence-associated gene 21 AT2G29350 Senescence-associated gene 13 AT2G29350 Senescence-associated gene 13 EXPO Related AT5G49830 Exocyst complex component 84B AT5G12370 Exocyst complex component sec10 AT4G02350 Exocyst complex component sec15B AT2G32750 Exostosin family protein AT2G28110 Exostosin family protein AT4G02350 Exocyst complex component sec15B AT1G21170 Exocyst complex component SEC5 AT5G58430 Exocyst subunit exo70 family protein B1 RNA binding proteins AT1G69440 Argonaute family protein AT1G31280 Argonaute family protein AT1G31290 ARGONAUTE 3 AT1G31290 ARGONAUTE 3 AT1G69440 Argonaute family protein AT3G01540 DEAD box RNA helicase 1 AT5G26742 DEAD box RNA helicase (RH3) AT5G07120 Sorting nexin 2B AT5G07120 Sorting nexin 2B AT1G15240 Sorting nexin, C-terminal AT5G58440 Sorting nexin 2A AT3G23830 Glycine-rich RNA-binding protein 4 AT3G23830 Glycine-rich RNA-binding protein 4 Heat Shock proteins AT3G07770 HEAT SHOCK PROTEIN 89.1 AT3G13860 Heat shock protein 60-3A AT1G11660 Heat shock protein 70 (Hsp 70) AT1G11660 Heat shock protein 70 (Hsp 70) AT4G02100 Heat shock protein DnaJ AT3G07770 HEAT SHOCK PROTEIN 89.1 AT3G13860 Heat shock protein 60-3A AT4G24280 Chloroplast heat shock protein 70-1 AT3G12580 Heat shock protein 70 AT3G23990 Heat shock protein 60 AT5G56030 Heat shock protein 81-2 AT3G08970 DNAJ heat shock N-terminal Proteasome components AT3G61140 Rpn7 AT1G04810 Rpn2/Psmd1 subunit AT1G77440 20S Proteasome beta subunit C2 AT5G42790 Proteasome alpha subunit F1 AT1G13060 20S Proteasome beta subunit E1 AT3G13330 Proteasome activating protein 200 Phloem Proteins AT1G10155 Phloem protein 2-A10 AT1G65390 Phloem protein 2 A5 Cs TET8 is a conserved EV marker protein in cucumber while Cs PP2 is a newly identified RNA-binding protein localized within EVs Mass-spectrometry results showed the presence of tetraspanins in cucumber EVs. We further confirmed the presence of TET8 (CsTET8) in cucumber EVs using immunoblotting with AtTET8 antibodies. The cross reactivity of the CsTET8 with AtTET8 was separately confirmed (Fig. 4a and Fig. S2a, S2b, S2c and S2d). Further, immunoblotting revealed the presence of CsTET8 in AWF (Fig.4b) and subsequently to investigate the association of CsTET8 with cucumber EVs, various SEC fractions were analyzed by immunoblotting. These fractions underwent a protease protection assay: initially treated with trypsin to digest proteins exposed on the surface of EVs, followed by detergent treatment to disrupt the vesicle membrane and release intravesicular proteins. To further confirm the internal localization of specific proteins, EVs were first lysed with detergent and then treated with trypsin, ensuring that only proteins within the vesicles would be degraded. CsTET8 was detected in EV-containing fractions F9 and F11, with the highest abundance in F11 (Fig. 4c, upper blot, first panel), indicating its presence within EVs. Trypsin treatment alone did not significantly reduce the CsTET8 signal, particularly in F11, suggesting the protein is protected from enzymatic digestion and therefore not exposed on the EV surface (Figs. 4c). However, following vesicle disruption with detergent and subsequent trypsin treatment, CsTET8 bands were degraded, confirming its intravesicular localization (Fig. 4c, upper blot, second panel). Further validation came from the western blot analysis of pooled EV fractions (F9+F11), which showed a strong CsTET8 signal on SDS-PAGE. This signal was significantly reduced after detergent and trypsin treatment (Figs. 4d), and reflected in the corresponding intensities, reinforcing that CsTET8 is sequestered within the EVs. These findings support that CsTET8 is an integral, protected component of cucumber EVs, consistent with a conserved role across plant species. Another protein of interest was Phloem Protein 2 (CsPP2) which we proceeded further to explore its association with the EVs. CsPP2 is a phloem lectin previously shown to interact with ASSVd and assist in its cross-kingdom trafficking[36] . Western blotting of cucumber cell lysate and AWF confirmed the presence of CsPP2 in both intracellular and apoplastic compartments (Fig. 4b). Analysis of SEC fractions revealed that CsPP2 co-eluted with CsTET8 in fractions F9 and F11 (Fig. 4c, lower panel). The protease protection assay demonstrated that CsPP2 also resides within EVs: the intact band persisted after trypsin treatment but was degraded when EVs were pre-lysed with detergent before enzyme exposure (Figs. 4c and 4d). Furthermore, to validate the CsPP2 localization in EVs, we transiently expressed CsPP2 fused with GFP in Nicotiana benthamiana and isolated EVs from the apoplast at 48 hpi. Fluorescence microscopy of the isolated EVs showed a distinct presence of GFP-CsPP2 in the EV fraction, in contrast to mock-treated plants (Fig. 4e and Fig. S2e). Characteristic small, cup-shaped EV structures expressing GFP-CsPP2 were clearly observed. These findings collectively suggest that CsPP2 localizes both to the apoplast and within cucumber EVs, and when expressed in N. benthamiana , it retains the ability to associate with EVs. Notably, the western blot analysis using plant Actin as a control confirmed the absence of Actin protein in both apoplastic and EV samples, verifying the purity of the EV preparations (Fig. 4a and 4b). CsPP2 may aid in the sorting of viroid and other plant RNAs into CsTET8-specific exosomes As CsPP2 is an RNA binding protein and AtTET8 associated exosomes are known to be enriched with RNA binding proteins. Therfore, the co-localization of CsTET8 and CsPP2 in the same EV fractions indicated a potential interaction between these two. To validate this, we carried out immunoprecipitation of CsPP2 using CsPP2 antibody [36] from the total cell lysate and AWF (treated with detergent to release the EV proteins) of viroid-infected plants and detected the presence of CsTET8 in the pull-down sample. Our immunoblot analysis revealed the presence of CsTET8 protein in the CsPP2 immunoprecipitated from the cell lysate as well as extracellular fluid (Figs. 5a and 5b). To further validate the interaction, we performed a co-immunoprecipitation assay by transiently co-expressing CsTET8 fused to GFP and CsPP2 fused to an HA tag using the binary vectors pSITE2CA and HApBA, respectively. Immunoprecipitation of GFP-CsTET8 with anti-GFP-conjugated beads resulted in a clear co-enrichment of HA-CsPP2, as detected by immunoblotting with an anti-HA antibody, thereby confirming the interaction between the two proteins (Fig. 5c-upper panel). The GFP pull-down alone did not immunoprecipitate the HA-PP2 (Fig. 5c-lower panel). Additionally, Bimolecular Fluorescence Complementation (BiFC) assays also revealed that the interaction between CsPP2 and CsTET8 (Fig. 5d). Interestingly we observed a punctate-like appearance near the plasma membrane indicating the interactions between the two at plasma membrane (Fig. 5d). These punctate like appearance were also observed when GFP-TET8 and GFP-PP2 were individually transiently expressed in N. benthamiana plants (Fig. 5d). In addition, the AlphaFold3 tool predicted a pTM score of 0.47 (close to a good structure score of 0.5) for the CsP2-CsTET8 interaction (Fig. 4e). The CsTET8 ortholog in Arabidopsis, TET8_ARATH, contains an extracellular domain (EC2) spanning amino acids 97-235 and the CsPP2 likely interact with CsTET8 at its EC2 domain (Fig. 5e). Overall, together these results validate the interaction between CsTET8 and CsPP2 in the cucumber cell and apoplastic space. Considering that CsPP2 is an RNA-binding protein, the interaction between CsTET8 and CsPP2 suggests that CsPP2 may play a role in sorting RNAs into CsTET8 exosomes. To explore this interaction, total RNA was isolated from CsPP2-immunoprecipitated samples and the presence of ASSVd RNA was detected by RT-PCR. The results confirmed the co-immunoprecipitation of ASSVd RNA along with CsPP2 from the total cell lysate and apoplast (Fig. 5a and Fig. 5b). Hence, these results suggested that CsPP2, ASSVd, and CsTET8 might exist as a trimeric complex in cucumber plants. To get a deeper insight into this interaction we specifically carried out immuno-enrichment of CsTET8 labeled exosomes from the total EV pool as reported in the arabidopsis[3]. Following enrichment, the exosomes were disrupted using detergent and subjected to immunoblotting and RNA extraction. Immunoblot analysis of the enriched CsTET8 exosomes revealed the co-presence of CsPP2, while RT-PCR of the same extracts confirmed the presence of ASSVd within the CsTET8-specific exosomes (Fig. 5f). Interestingly, when the enriched CsTET8 exosomes were analyzed without detergent-mediated disruption, immunoblotting still detected CsPP2, but RT-PCR failed to detect ASSVd. This suggests that ASSVd resides within the exosomes and that there is no direct interaction between CsTET8 and ASSVd (Data not shown). We further validated this model through interactions using Alphafold3, which revealed the tripartite interaction, in which CsPP2 interacts with the viroid RNA on one side and CsTET8 on the other (Fig.5e ). However, CsTET8 did not show any direct interaction with the viroid RNA. The model predicted the central conserved region (CCR) of the viroid RNA, spanning nucleotides 81-96, was in closest proximity to CsPP2 at amino acids 1-8, 41-47, and 91-101, with CsPP2 motifs spanning amino acids 41-47 and 91-101 containing known double-stranded RNA-binding motifs (dsRBM). Additionally, CsTET8 protein motifs 186-193 and 208-211 were in close proximity to CsPP2 regions 78-86, 107-111, and 202-206, which lie within the EC2 of CsTET8 (Fig. 5e). Thus, using a combination of biochemical and bioinformatic tools, we demonstrate that CsTET8 specific exosomes harbor ASSVd and CsPP2 where CsPP2-CsTET8 directly interact with each other at EC2 domain of CsTET8 but there is no direct interaction between ASSVd-CsTET8 further supporting the notion that CsPP2 might facilitate loading of RNAs in CsTET8 specific exosomes. Discussion Viroids, unlike bacteria and fungi, are intracellular pathogens that replicate within the nucleus or chloroplast of the cell. They traffic cell to cell through cytoplasmic connections, plasmodesmata, and through phloem-mediated routes for their long-distance movement. Our previous studies have highlighted the potential role of viroids in cross-kingdom trafficking, such as the acquisition and transmission of ASSVd RNA by whiteflies to neighboring plants (Walia et al. 2015). Later, this phenomenon was also reported in natural interactions between apple plants and their fungal pathogens[33] . These observations, combined with research on the role of EVs in RNA trafficking during plant-fungal interactions [5, 12], raised important questions about whether the viroid RNAs, typically considered intracellular pathogens, could also be transported in EVs. Our study aimed to investigate the presence of ASSVd RNA in the extracellular space including EVs. Interestingly, our results revealed that viroid RNA also exists in the apoplast, and different forms of ASSVd RNA—circular, linear, and small RNAs—are packaged into the EVs of cucumber plants. This indicated that viroids may employ EVs for in planta and cross-kingdom trafficking, as EVs could protect the RNA from host RNases and help viroids cross biological barriers. In animals, certain factors have been identified that assist in the selective loading of RNAs into EVs. For example, certain sequences have been identified in animals that code for the loading of microRNAs into EVs [15]. These motifs are referred to as EXOmotifs. In search for the identification of such factors that could preferentially facilitate the transport and packaging of viroid RNAs inside EVs, we observed an enrichment of five EXOmotifs in the ASSVd genome. Interestingly, sequence-specific screening of most of the viroids revealed a pattern of exomotif enrichment in their genomes (Fig. S3a). Interestingly, ASSVd revealed an enrichment of five EXOmotifs in the ASSVd genome viz. UCCC, CUCC, CCCU, UGUG, and GGUG (Fig. S3b). The UCCC and UGUG motifs lie in the terminal left domain, CUCC and CCCU lie in the central conserved region whereas GGUG lies in the pathogenicity domain of ASSVd (Fig.S3c). Addtionally, we observed that the UGUG motif is present in 24 out of 30 viroids, CGGGAG in 2 out of 30, CCGGGG in 16 out of 30, and CCGGUG in 20 out of 30. Notably, the majority of viroids, on average, possess five enriched exomotifs in their genomes. Furthermore, the 25-nt long ACCCUGCCGCCUGGACUCCGCCUGU motif is specifically present in TASVd, which is known to be transmitted by bumblebees through encapsulation in potato leaf roll virus. Apart from the presence of EXOmotifs, in animals as well as in plants, the m6A modification of RNA has been linked to the sorting of RNAs into EVs. For example, it has been reported that m6A modification of miRNAs alters their binding affinity to AGO1 protein and increases their association with RNA-binding proteins subsequently facilitating their extracellular export [14]. In plants, the apoplastic localized circular RNAs and long noncoding RNAs are enriched in m6A which likely facilitates their export into EVs [4]. Some viroid RNAs are known to undergo reversible modifications, such as m6A methylation[37], thus it is plausible that ASSVd RNA is modified with m6A to enhance its export. Hence, it is possible that it might have implications on viroid encapsulation within the EVs. An intriguing finding of our study is the identification of CsPP2, a phloem-specific protein, in the apoplast and EVs of cucumber. A recent study examining the enrichment of the 26S proteasome from melon EVs reported the presence of PP2 in EVs from aphid-infested plants [38]. This suggests that the localization of PP2 in the EVs of the Cucurbitaceae species could represent a conserved phenomenon. CsPP2 is a phloem lectin with dsRNA binding motifs, capable of increasing the size exclusion limit of plasmodesmata, and has been implicated in the movement of various endogenous and pathogenic RNAs within the phloem[39] . In our previous work, we demonstrated that the viroid-PP2 complex is more efficiently acquired and transmitted by whiteflies compared to the naked viroid RNAs ( [36]. In the current study, through a feeding assay of EVs to whiteflies, we observed that viroid RNA is acquired and transmitted more efficiently by the whiteflies when packaged into EVs rather than naked RNA or as an RNP complex. This suggests that although viroid RNA can be acquired by whiteflies in various forms—either as a free RNA molecule, an RNP complex or encapsulated within EVs—the transmission through EVs provides a dual advantage: protection from host RNases and a safer route into new host kingdoms. Interestingly, it has been proposed that cross-kingdom trafficking of RNAs can occur via both EVs and RNP complexes. One research group reported that RNA-binding proteins such as AGO1, RNA helicases, and annexins can mediate RNA loading into vesicles and facilitate subsequent cross-kingdom trafficking[3, 5, 12]. Additionally, another group demonstrated that apoplast-localized proteins like GRP7 and AGO2 can bind to the RNAs in the apoplast, potentially aiding in the cross-kingdom movement of RNAs as RNP complexes [4]. Combining these findings, we show using viroid RNA as a model, that cross-kingdom trafficking of RNAs can occur both as RNP complexes and via EVs, although potentially at different intensities. However, the relevance and function of viroid RNAs and CsPP2 within EVs, as well as the potential for viroids to be transmitted through EV encapsulation, require further investigation. The presence of the CsPP2-viroid complex in the apoplast and its association with CsTET8 suggests that CsPP2 may be a novel protein that assists in sorting RNA into EVs in Cucurbitaceae plants. Interestingly like TET8, CsPP2 also exhibits the presence of a transmemberane domain in its structure which supports its presence in the extracellular space and EVs (Fig. S2f). It is quite possible that viroids can channelize the EV-mediated route for their systemic movement inside plants, as hypothesized for the movement of endogenous RNAs and viral RNAs in plants [40]. The EV proteins from viroid-infected plants implicated changes in nuclear proteins specifically related to non-coding RNA-related biological processes. Viroids are nuclear-replicating pathogens and their effect on nuclear protein turnover and their subsequent export via autophagy or extracellular vesicles warrant further investigation. These findings correlate with cancer disease progression, where genomic DNA and nuclear components are exported by the formation of amphisome-like structures and their fusion to vesicles [41]. It is quite possible that viroids may influence similar processes during infection, and hence, characterization of DNA and RNA from EVs during viroid infection might shed light on these unexplored processes related to viroid pathogenicity in plants. The induced expression of CsTET8 and CsPP2 proteins suggests that it acts as a positive regulator of viroid stress and could be used as a marker protein for viroid stress. Overall, through our study using ASSVd as the model RNA system, cucumber as its host, and whitefly as its vector, we propose that viroid RNAs are exported into the plant apoplast and packaged into EVs from where they can be acquired by the whiteflies (Fig. 6). They may use EVs as a means of cross-kingdom trafficking and their interactions with RNA-binding proteins such as CsPP2 could assist their loading into exosomes which improve their transmission efficiency. Moreover, we hypothesize that the presence of factors like EXOmotifs may assist viroid RNA in their packaging inside EVs. Additionally modifications in RNA like m6A modification might also assist in its packaging inside the EVs. The precise sequences and functional roles of small RNAs in EVs, particularly those derived from viroids and their characterization, remain unclear. These small RNAs may influence the plant's immune response or aid in the viroid's transmission to other organisms, such as insects or fungi. Understanding the mechanisms by which viroids and other RNA molecules are sorted into vesicles and transferred across biological boundaries will offer valuable insights into cross-kingdom RNA trafficking, with implications for viroid biology, RNA-based inter-organism communication, and the ecological impact of RNA transfer. Conclusion This study provides compelling evidence that ASSVd RNA is not only present in the apoplastic space of cucumber plants but also actively associates with EVs, in both surface-bound and intravesicular forms. Through a combination of RT-PCR, northern blotting, and protease protection assays, we demonstrate that various forms of ASSVd RNA are enriched within cucumber-derived EVs. Interestingly, small RNA species were exclusively detected inside EVs, suggesting selective packaging or stabilization of these viroid-derived small RNAs within vesicles. Functional assays confirmed that EV-associated viroid RNA remains biologically active. Mechanical inoculation of healthy cucumber plants with purified EVs led to successful infection, and whiteflies feeding on EV-supplemented artificial diets were able to acquire and transmit the viroid to naïve plants. While both apoplastic and EV-associated ASSVd could be acquired, viroid RNA encapsulated within EVs was more efficiently taken up and transmitted, indicating a protective and facilitating role of EVs in vector-mediated transmission. Proteomic analyses revealed key differences in the EV cargo between healthy and viroid-infected plants. EVs from infected plants showed enrichment of RNA-binding proteins, chaperonins, and components involved in RNA metabolism, suggesting that viroid infection alters EV content in favor of RNA stabilization and transport. Among these, tetraspanin 8 (CsTET8) was identified as a conserved EV marker protein, and phloem protein 2 (CsPP2), known for its RNA-binding ability and involvement in viroid transport, emerged as a novel EV-associated protein. Subcellular fractionation and immuno-localization studies confirmed that both CsTET8 and CsPP2 reside within cucumber EVs. Co-immunoprecipitation and BiFC assays further demonstrated that CsPP2 directly interacts with CsTET8, specifically at the EC2 extracellular domain of CsTET8, suggesting a stable protein-protein interaction within the vesicle environment. Notably, CsPP2 also co-precipitates with ASSVd RNA, establishing its role as a molecular bridge that connects viroid RNA to the EV cargo-loading machinery. Further supporting this model, CsTET8-specific exosomes immuno-enriched from infected cucumber plants were shown to contain both CsPP2 and encapsulated ASSVd RNA. Structural modeling using AlphaFold3 revealed a tripartite complex, where CsPP2 binds to both the CCR of the viroid RNA and the EC2 domain of CsTET8. Interestingly, no direct interaction between CsTET8 and ASSVd RNA was detected, reinforcing the hypothesis that CsPP2 acts as a selective adaptor for RNA loading into CsTET8-specific exosomes. Together, these findings elucidate a novel mechanism for viroid packaging and transmission in plants, where EVs serve as protective carriers of infectious RNA, and specific host proteins like CsPP2 facilitate the selective sorting of viroid RNAs into exosomes via interactions with structural EV components such as CsTET8. This study expands our understanding of RNA trafficking in plants and offers insights into how pathogens like viroids exploit host-derived EVs for mobility and cross-kingdom transmission. Material and Methods Plant Growth Cucumis sativus (Var. Summer Green) and Nicotiana benthamiana seeds were purchased from the local market (Durga Seeds, Chandigarh) and cultivated in pots containing a mixture of cocopeat, compost, and vermiculite/Perlite in a 1:1:1 ratio. The plants were kept in an insect-proof plant growth chamber equipped with fluorescent tubes under controlled conditions with a temperature of 24±2°C, relative humidity of 70-80%, and a 12-hour light/12-hour dark cycle. In vitro synthesis of dimeric ASSVd (+) RNA and transcript inoculation To generate positive-sense RNA transcripts of ASSVd, recombinant plasmids containing the dimeric ASSVd insert in the correct positive orientation within the pGEMT-easy vector were linearized using Spe I. In vitro transcription was carried out using the T7 Highscribe Kit (NEB, USA) according to the manufacturer's protocol. Approximately 100 ng of the RNA transcripts were subsequently used to infect the first true leaf of cucumber plants through mechanical inoculation using carborundum-dust. The water-inoculated plants were used as controls in all experiments. RNA extraction and RT-PCR for ASSVd detection Total RNA was extracted from 100 mg of cucumber leaves using the RNAiso plus (TakaraBio, USA; [42]). Briefly, 100mg of the cucumber leaves (viroid infected and mock) were frozen in liquid nitrogen, ground in Trizol buffer, and incubated with chloroform. After centrifugation, the supernatant was mixed with isopropanol for RNA precipitation and stored at -20°C. The RNA pellet was then washed with 75% ethanol and eluted in 20 µL of nuclease-free water. The RNA was quantified using Quantus™ Fluorometer (Promega) and 1µg of RNA was used for RT-PCR with viroid-specific primers ASSVdICc and ASSVdICh (Table S1)[30] . Reverse transcription was performed using verso cDNA synthesis kit (Thermo Scientific, USA) at 42°C for 60 minutes, followed by PCR using Phusion DNA polymerase (Thermo Scientific, USA) under specified cycling conditions for ASSVd detection [34]. The PCR products were analyzed on 1.5% agarose gel electrophoresis. Isolation of AWF Apoplastic washing fluid (AWF) from cucumber leaves was isolated as described previously [35]. The leaf petioles were excised, followed by washing and drying the leaves (Fig. S1a). The leaves were placed in a 60 mL syringe filled with an infiltration buffer (20mM MES, 2mM CaCl 2 , 0.1M NaCl, pH 6.0). Carefully without damaging the leaves, a negative pressure was created by pulling the plunger gently until the leaves turned dark green. The leaves were removed and dried and 3-4 leaves rolled were placed in a 12 mL syringe inside a 50 mL falcon tube. The tube was wrapped with parafilm and centrifuged at 4,000 rpm for 30 minutes to collect the AWF. Trypan blue staining of leaves after AWF isolation for cell death analysis The integrity of the isolated AWF was confirmed by cell death assay by staining the leaves in trypan blue solution using the protocol as described (http://resources.rothamsted.ac.uk). RNA isolation and RT-PCR detection of ASSVd from AWF One ml of isolated AWF was concentrated to 100µl using an Amicon® Ultra Centrifugal Filter, 10 kDa MWCO (Millipore, USA). RNA was isolated using RNAiso plus (Takara Bio, USA). Briefly, 1ml of RNAiso plus was added to 100µl of AWF followed by the addition of the chloroform. The RNA was precipitated using isopropanol and suspended in 30µl of RNase-free water. One microgram of RNA was used for RT-PCR as mentioned earlier. Isolation of EVs Pure-EVs SEC columns were used to isolate EVs from cucumber plants (mock/viroid infected). For EV isolation, 20 mL of isolated AWF was concentrated to 2 mL using an Amicon filter unit (10kDa cutoff) (Millipore, USA) and was subjected to Pure-EVs SEC columns (Hansa Biomed Life Sciences, Estonia) according to the manufacturer's instructions. Briefly, the column was washed with 3 volumes of 1× PBS buffer to remove preservative buffer residues. The sample containing EVs (up to 2 mL) was then loaded into the column and eluted with 1× PBS buffer as the mobile phase. Fractions collected were labeled 1-7 as void volume, 8-13 as the EV fraction, and 14-23 as the protein sample (Fig. S1b). Dynamic Light Scattering (DLS) analyses of EVs The DLS analyses were performed in a Litesizer 500 (Anton Paar, Germany). 10 µL of isolated EVs were suspended in 990 µL of 1× sterile PBS buffer, loaded into a disposable cuvette, and placed in the litesizer 500. For reproducibility, and standardization, the parameter values were fixed as follows; Temp-25℃, equilibration time-30s, processed runs-5, and Time for each run 10s. The size or homogeneity of exosomes was recognized through the radius or the % Intensity, respectively. Transmission electron microscopy of EVs Purified EVs (10 µl) were diluted with an equal volume of 4% paraformaldehyde at 4°C for 30 min, and then carefully placed on a carbon-coated 300-mesh copper grid for 20 min, followed by fixed by 1% glutaraldehyde for 5 min. After two washings, the grids were contrasted with 2% uranyl acetate and then washed again two times. The morphology of isolated exosomes was visualized with TEM (MAKE: JEOL MODEL: JEM 2100 plus). Trypsin, RNase treatment, RNA isolation, and RT-PCR from EVs To determine whether the viroid RNA was present inside or outside EVs, RNase protection assays were performed. Briefly, 100µl of Purified EVs were treated with 25 µg/µL trypsin (Sigma Life Sciences, USA). Samples were incubated at 37°C for 16-18 hours, followed by the addition of 1U of Proteinase K (Invitrogen, USA)/1mM of PMSF (Sigma, USA) to inactivate trypsin. For isolating the RNA from the EV surface the above EV samples were precipitated with 3 volume ethanol and 1/10 sodium acetate overnight followed by isolation of RNA with RNAiso plus next day. For isolating the RNA inside EVs the purified EVs (100µL) were treated with trypsin + trypsin inhibitor + RNaseA + RNase inhibitor to degrade the outside RNA followed by treatment with 1% (v/v) Triton X-100 (Himedia) to rupture the EVs. RNA isolation using RNAiso plus was carried out to isolate the RNA inside EVs. The isolated RNA was quantified and 200ng of the total RNA was used for RT-PCR from the detection of ASSVd from EV O and EV I as described above. The concentration of trypsin and RNase used in the assays was standardized by taking different dilutions of trypsin and RNase for protein degradation and RNA degradation, respectively (Fig. S1c). Urea PAGE and Northern Blot for ASSVd detection Viroid-infected samples from total leaf, AWF, and EVs (EV O and EV I ) along with mock RNA from leaf were analyzed using Denaturing Polyacrylamide gel electrophoresis (15% polyacrylamide and 7M Urea). The RNA samples (3µg for infected AWF, EV O , EV I and CL from cell lyaste) were denatured at 65°C in 2x RNA dye (Thermo Scientific, USA) for 10 minutes and were separated in 0.5× TBE buffer for 2h at 90V. The total RNAs were visualized by staining with Diamond Nucleic acid stain (Promega) and then transferred onto a nylon membrane using 1× TBE transfer buffer. The RNAs were cross-linked on a nylon membrane in a UV crosslinker followed by pre-hybridization at 65°C for 3hrs. The membrane was incubated overnight at 65°C in hybridization buffer with gentle shaking along with a 3’ labeled biotin probe. The membrane was rinsed with washing buffer (1× SSC. 0.1% SDS) thrice for 10 minutes at room temperature and blocked in a blocking buffer (0.1% Malic acid buffer (Roche). The membrane was incubated with HRP-conjugated anti-streptavidin antibody (Sigma, USA) at 1:5000 dilutions for 1h. After a final wash in maleic acid and 0.3% Tween-20 containing buffer, the blot was visualized using ChemiDoc (Protein Simple, Biotechne, USA). Generation of negative sense 3’-biotin labeled ASSVd probe A 3’-biotin-labeled RNA probe was prepared and used for viroid detection using northern hybridization. For probe synthesis, a PCR was carried out using ASSVd plasmid as a template and primers FP1 and RP4 to generate negative sense viroid amplicon along with the T7 promoter sequence. The desired amplicon of 330bp was cut and eluted. Two micrograms of gel eluted product was directly used to generate RNA transcript using a T7 in vitro RNA transcription kit (Thermo Scientific, USA). The transcript at the 3’ end was ligated to pcp-biotin (Jena Biosciences) using T4 RNA Ligase (Promega, USA). The reaction was kept at 16ºC overnight. The labeled transcript was purified using a Monarch RNA cleanup column (New England Biolabs, USA) and was used for hybridization at a concentration of 100ng/10ml of hybridization buffer (Fig. S1d). Mass spectrometry EVs fraction (100µl) was treated with trypsin followed by incubation with trypsin inhibitor and were then treated with 0.1% Triton X-100. The proteins were TCA precipitated and partially resolved by polyacrylamide gel electrophoresis till they entered the resolving gel. The region was excised and sequenced using HR-LCMS, SAIF facility at IIT-BOMBAY. Briefly, the gel slices were subjected to in-gel trypsin digestion followed by desalting and subjected to LC/MS/MS analysis in Q-Exactive Plus Orbitrap high-resolution MS (Thermo Scientific). The MS spectra were acquired at a resolution of 70,000 in a mass range of 350-2500 m/z. Eluted samples were used for MS/MS events (resolution of 17,500), measured in a data-dependent mode for the 15 most abundant peaks (Top15 method). Protein identification and GO enrichment tools The raw MS/MS spectra were analyzed using the software Thermo Proteome Discoverer 2.2 against the Arabidopsis (TAIR) and cucumber database (Cucurbit genomics- http://cucurbitgenomics.org/). The ShinyGO v0.82 (ShinyGO 0.82 (sdstate.edu)) and string tools were used (STRING: functional protein association networks (string-db.org) for GO analyses. Venn diagram was constructed using the software Bioinformatics & Evolutionary Genomics (Draw Venn Diagram (ugent.be). Immunoblots For immunoblots, cell lysate was prepared by grinding 50mg of leaf tissue in 500ųl of protein extraction buffer (50mM Tris HCl pH 7.5, 150mM NaCl, 10mM MgCl 2 , 2.5mM EDTA, 1mM DTT, 10% Glycerol, 1x protease inhibitor, 1mM PMSF). 20ųl of cell lysate, concentrated AWF, and EVs (EVO and EVI) were mixed with 3 µL of 6× SDS loading buffer, heated at 99°C for 10 minutes, and loaded onto a 15% PAGE, and after run proteins were transferred to a nitrocellulose membrane (for dot blots, the dots were applied on the nitrocellulose membrane directly without the SDS dye). Membranes were blocked with 5% skim milk in TBST and incubated overnight at 4°C with primary antibodies (1:1000 for TET8 (PhytoAb-PHY2750A), 1:10000 for CsPP2 [30], 1:10000 anti-GFP (BioBharati Life Science, India) and 1:3000 anti-HA (BioBharati, Life Science, India), anti-actin (Sigma) mouse monoclonal 1:20000 dilution. Membranes were washed and incubated with 1:10000 goat anti-rabbit/anti-mouse HRP-conjugated secondary antibodies (BioBharati, Life Science, India). After a final wash, proteins were visualized using the ECL substrate (Biorad, USA) and imaged with a ChemiDoc system (Protein Simple, Biotechne, USA) or X-ray film. RNA immunoprecipitation assay (RIP assay) For RNA immunoprecipitation from the leaf, 1g/ml of viroid-infected leaf tissue was ground in protein extraction buffer supplemented with RNase inhibitor, and 500µl of lysate was used for RNA immunoprecipitation assay. For RNA immunoprecipitation from infected AWF, 5ml of AWF isolated from viroid-infected leaves was concentrated to 500µl solution using an Amicon filter. Both the lysate and AWF were incubated with 5mg of CsPP2 antibody for 4h at 4℃ with rotation followed by the addition of protein A/G agarose beads overnight. The next day the beads were pelleted with centrifugation at 3000 rpm for 5 minutes and washed three times with protein extraction buffer supplemented with RNase inhibitor. The beads were eluted in 100ul of RNAse-free water. Half of the beads were heated at 100℃ for 10 minutes to release bead-bound proteins for subsequent immunoblot. The rest of the beads were proceeded for RNA isolation using RNAiso plus. The RNA was quantified and used for the detection of ASSVd by RT-PCR or loaded on 15% denaturing PAGE to visualize the total immunoprecipitated RNAs using Diamond Nucleic acid stain (Promega) as described earlier. Immunoenrichment of TET8 exosomes The isolated intact EVs were treated with trypsin overnight, followed by the addition of a trypsin inhibitor. Next, RNase was added for one hour, and then RNase inhibitor was used to inactivate the RNase. The intact EVs were incubated with anti-AtTET8 antibody in IP buffer without NP-40 for 4 hours at 4°C with rotation, followed by the addition of protein A/G agarose beads overnight. The next day, the beads were pelleted and washed with IP buffer containing 1%Triton X-100 and RNase inhibitor. The beads were then eluted in RNase-free water, with part of the eluate used for RNA isolation as previously described. The isolated RNA was tested for the presence of ASSVd by RT-PCR, as described earlier. The remaining beads were heated and loaded onto an SDS-PAGE gel for immunoblotting with anti-AtTET8 and anti-CsPP2 antibodies. Co-Immunoprecipitation assay: For co-immunoprecipitation assays involving GFP-TET8 and HA-PP2, Nicotiana benthamiana leaves were harvested 48 hours post agroinfiltration. Tissue extracts were homogenized in Protein extraction buffer (PEB) [5 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10 mM MgCl₂, 1 mM EDTA, 1% NP-40, and 1X protease inhibitor cocktail (Sigma-Aldrich, USA)]. After centrifugation to remove cell debris, the supernatant was pre-cleared using IgG agarose beads (Biobharti Life Sciences, India) for 1 hour at 4°C with rotation. The mixture was centrifuged again, and the IgG agarose bead pellet, used as a non-specific binding control, was collected. The resulting supernatant was incubated overnight at 4°C with anti-GFP agarose beads (BioBharati Life Sciences, India). Following centrifugation, the beads were washed three times with PEB buffer, resuspended in 1× SDS loading dye, and prepared for immunoblot analysis. Subcellular Localization and Bi-molecular Fluorescence Complementation (BiFC) Assays Agrobacterium tumefaciens strain GV3101 harboring CsTET8 fused to GFP in the binary vector pSITE2CA was infiltrated into mature N . benthamiana leaves. At 48 hours post-infiltration (hpi), tissue sections from infiltrated areas were examined using a confocal microscope (NIKON, AIR PLUS). Images were captured using both bright-field and YFP filter settings. For BiFC assays, GV3101 strains carrying CsTET8 and CsPP2 in BiFC-compatible binary vectors (nVENUS and cCFP) were co-infiltrated into N. benthamiana leaves in the indicated combinations. Leaf sections were observed under a confocal microscope at 48 hpi. Images were captured using both bright-field and YFP filter settings. Dynamics of CsTET8 and CsPP2 upon viroid infection Three cucumber plants were infected with ASSVd transcripts along with mock as control. The samples were harvested at 7dpi, 14dpi, 21dpi and 28dpi. The lysates were prepared in 8M urea, mixed with SDS dye, heated, and loaded on 15% PAGE. The proteins were transferred to the membrane and immunoblotted with CsPP2 and AtTET8 antibodies as described earlier. Bioinformatic analysis of the ASSVd- Cs PP2- Cs TE8 interactions The amino acid sequences of the proteins were obtained from the following accession numbers in GenBank: Tetraspanin-8 (TET8) Cucumis sativus Accession XP_004151158.1, Lectin (phloem protein 2) Cucumis sativus Accession NP_001292700.1, and ASSVd RNA sequence was of an isolate from Solan with Accession FM178284. The models were generated from the above-mentioned sequences by the Alphafold2 algorithm[43]. The quality was assessed using pLDDT scores. The models were visualized using ChimeraX software v 1.7.1[44] . The interactions of PP2 with TET8 and trimeric interaction of PP2 and TET8 with viroid RNA was studied using AlphaFold3 [6]( (https://alphafoldserver.com/fold/20a59528fa980c38) that allows structural modeling and interactions of protein and RNA. The quality was assessed using pTM scores. The models were visualized using ChimeraX software v. 1.7.1[44] . Densitometric analysis - Densitometry was carried out using freely available ImageJ software (https:// ImageJ .net/ij/) EV acquisition and viroid transmission assay The whiteflies used for the experiment were glasshouse whiteflies ( Trialeurodos vaprorarium ) [36] that were maintained on healthy cucumber and tomato plants in an insect-proof cage. For ASSVd acquisition by whiteflies, ten whiteflies were fed each with AWF (depleted of EVs) and EV (depleted of outside RNAs) and water as control. The whiteflies were trapped in 50ml falcon tubes with their top covered with stretched parafilm. The AWF, EV, and water were placed on the parafilm along with food color (turmeric) and covered with a coverslip ( [36]. The tubes were kept in a growth rack under 14h light and 10h dark period for 48h and the whiteflies were allowed to feed on the solution. After 48h the five whiteflies were killed using the cold shock method and RNA isolation and RT-PCR for ASSVd detection was done as described earlier. The remaining five whiteflies were made to feed on healthy cucumber plants (five plants) in an insect-proof rack. The whitefly-fed plants were pooled P1 (1+2) and P2 (3+4+5) checked for the viroid presence using RT-PCR method with ASSVd-specific primers as described above. For transmission assay using viroid-infected EVs and AWF, three cucumber plants each with AWF (depleted of EVs) and EV (depleted of outside RNAs) were sap inoculated along with leaf sap as positive control and water as negative control. The plants were pooled for individual treatment and checked for the ASSVd presence at 14dpi by RT-PCR method as described earlier. Statistical analysis. All data presented here are representative of at least three biological and technical replicates for each. Statistical analysis details are mentioned in the respective figure legends. Abbreviations Abbreviation Full Form ACFSVd Apple Chlorotic Fruit Spot Viroid AGO Argonaute Proteins Ara6 ADP-Ribosylation Factor-Like Protein 6 ASSVd Apple Scar Skin Viroid TET8 Tetraspanin 8 AWF Apoplastic Wash Fluid / Apoplastic Washing Fluid CCR Central Conserved Region (of viroid RNA) circRNA Circular RNA CsPP2 Cucumis sativus Phloem Protein 2 DLS Dynamic Light Scattering dsRBM Double-Stranded RNA-Binding Motif dsRNA Double-Stranded RNA EC2 Extracellular Loop 2 EVs Extracellular Vesicle(s) EXPO Exocyst Positive Organelle GFP Green Fluorescent Protein GRP7 Glycine-Rich RNA-Binding Protein 7 HSP60 Heat Shock Proteins LC-MS/MS Liquid Chromatography - Tandem Mass Spectrometry lncRNA Long Non-Coding RNA LTI6 Low Temperature-Induced Protein 6 m6A N6-Methyladenosine miRNA Micro RNA PEN1 Penetration 1 PSTVd Potato Spindle Tuber Viroid RIP RNA Immunoprecipitation RNP Complex Ribonucleoprotein Complex RBP RNA-Binding Protein sRNA Small RNA SEC10 / SEC15B / SEC5 / SEC84B Exocyst Complex Components SYP21 / 31 / 42 / 71 / 124 Syntaxin Proteins (SNARE family) TASVd Tomato Apical Stunt Viroid tasiRNA Trans-Acting Small Interfering RNA TEM Transmission Electron Microscopy Declarations Acknowledgments We would like to thank the Management MMDU, for providing necessary research facilities. We would like to acknowledge iSTEM facility at SAIF, IIT Bombay for mass-spectrometry analysis and CIL facility at Panjab University Chandigarh for TEM imaging and Confocal analysis. We would also like to thank I-STEM facility at Jamia Hamdard, New Delhi for confocal microscopy. We acknowledge special thanks to Dr. Vipin Hallan, CSIR-IHBT Palampur for providing CsPP2 antibodies. Author contributions ND: Formal analysis, methodology, and validation. VS : Formal analysis and methodology. NDe: Formal analysis and methodology. RG: writing-reviewing, and editing (supporting). SD: conceptualization, data analysis, investigation, methodology, supervision (equal), writing- review and editing. YW: conceptualization (lead), data curation and analysis (lead), investigation (lead), methodology, supervision (equal), validation, writing- original draft, writing- review and editing, funding acquisition. Funding The work was supported by State University Research Excellence Award to Dr. Yashika Walia and Dr. Sunny Dhir by Anusandhan National Research Foundation (ANRF), Government of India through project number SUR/2022/001747. We also thanks to Department of Biotechnology, and Government of India through EMR grant BT/PR40936/AGIII/103/1255/2020 to Dr. Sunny Dhir and to Bayer for providing MEDHA fellowship to Ms. Nisha Devi. Data availability statement: All data generated or analysed during this study are included in this published article [and its supplementary information files] Ethical approval and consent to participate: not applicable Consent for publication: not applicable Competing Interest: The authors report no competing of interest Author details: 1 Molecular Plant Virology Group, R&D Lab, Department of Bio-Sciences & Technology, Maharishi Markandeshwar (Deemed to be University), Mullana, Ambala-133207 HR India. 2 Plant Stress Physiology and Proteomics Laboratory, College of General Education, Kookmin University, Seoul, South Korea References Zhang, M., et al., Plant derived edible nanoparticles as a new therapeutic approach against diseases. Tissue Barriers, 2016. 4 (2): p. e1134415. Wang, J., et al., EXPO, an exocyst-positive organelle distinct from multivesicular endosomes and autophagosomes, mediates cytosol to cell wall exocytosis in Arabidopsis and tobacco cells. 2010. 22 (12): p. 4009-4030. He, B., et al., RNA-binding proteins contribute to small RNA loading in plant extracellular vesicles. 2021. 7 (3): p. 342-352. Zand Karimi, H., et al., Arabidopsis apoplastic fluid contains sRNA- and circular RNA-protein complexes that are located outside extracellular vesicles. Plant Cell, 2022. 34 (5): p. 1863-1881. Wang, S., et al., Plant mRNAs move into a fungal pathogen via extracellular vesicles to reduce infection. Cell Host Microbe, 2024. 32 (1): p. 93-105.e6. Abramson, J., et al., Accurate structure prediction of biomolecular interactions with AlphaFold 3. 2024. 630 (8016): p. 493-500. Jankovičová, J., et al., Tetraspanins, more than markers of extracellular vesicles in reproduction. 2020. 21 (20): p. 7568. Chen, K., et al., Tetraspanins in digestive‑system cancers: Expression, function and therapeutic potential. 2024. 30 (5): p. 200. Rutter, B.D. and R.W.J.P.p. Innes, Extracellular vesicles isolated from the leaf apoplast carry stress-response proteins. 2017. 173 (1): p. 728-741. Ding, Y., et al., Exo70E2 is essential for exocyst subunit recruitment and EXPO formation in both plants and animals. 2014. 25 (3): p. 412-426. Weiberg, A., et al., Fungal small RNAs suppress plant immunity by hijacking host RNA interference pathways. Science, 2013. 342 (6154): p. 118-23. Cai, Q., et al., Plants send small RNAs in extracellular vesicles to fungal pathogen to silence virulence genes. 2018. 360 (6393): p. 1126-1129. Zand Karimi, H., et al., Arabidopsis apoplastic fluid contains sRNA-and circular RNA–protein complexes that are located outside extracellular vesicles. The Plant Cell, 2022. 34 (5): p. 1863-1881. Garbo, S., et al., m6A modification inhibits miRNAs’ intracellular function, favoring their extracellular export for intercellular communication. 2024. 43 (6). Garcia-Martin, R., et al., MicroRNA sequence codes for small extracellular vesicle release and cellular retention. 2022. 601 (7893): p. 446-451. O’Grady, T., et al., Sorting and packaging of RNA into extracellular vesicles shape intracellular transcript levels. 2022. 20 (1): p. 72. Liu, Y.-f., et al., CYP2A6 suppresses hepatocellular carcinoma via inhibiting SRC/Wnt/β-Catenin pathway. 2025: p. 1-12. Flores, R., R.A. Owens, and J.J.C.o.i.v. Taylor, Pathogenesis by subviral agents: viroids and hepatitis delta virus. 2016. 17 : p. 87-94. Navarro, B., R. Flores, and F.J.A.R.o.V. Di Serio, Advances in viroid-host interactions. 2021. 8 (1): p. 305-325. Hammond, R.W., Economic significance of viroids in vegetable and field crops , in Viroids and satellites . 2017, Elsevier. p. 5-13. Branch, A.D. and H.D.J.S. Robertson, A replication cycle for viroids and other small infectious RNA's. 1984. 223 (4635): p. 450-455. Daròs, J.-A., et al., Replication of avocado sunblotch viroid: evidence for a symmetric pathway with two rolling circles and hammerhead ribozyme processing. 1994. 91 (26): p. 12813-12817. Warrilow, D. and R.H. Symons, Citrus exocortis viroid RNA is associated with the largest subunit of RNA polymerase II in tomato in vivo. Arch Virol, 1999. 144 (12): p. 2367-75. Navarro, J.A. and R.J.T.E.J. Flores, Characterization of the initiation sites of both polarity strands of a viroid RNA reveals a motif conserved in sequence and structure. 2000. Rodio, M.-E., et al., A viroid RNA with a specific structural motif inhibits chloroplast development. 2007. 19 (11): p. 3610-3626. Schnölzer, M., et al., Correlation between structure and pathogenicity of potato spindle tuber viroid (PSTV). Embo j, 1985. 4 (9): p. 2181-90. Sano, T., et al., Identification of multiple structural domains regulating viroid pathogenicity. 1992. 89 (21): p. 10104-10108. Reanwarakorn, K. and J.J.J.o.G.V. Semancik, Regulation of pathogenicity in hop stunt viroid-related group II citrus viroids. 1998. 79 (12): p. 3163-3171. SCHMITZ, A. and D.J.R. RIESNER, Correlation between bending of the VM region and pathogenicity of different potato spindle tuber viroid strains. 1998. 4 (10): p. 1295-1303. Walia, Y., et al., Apple scar skin viroid naked RNA is actively transmitted by the whitefly Trialeurodes vaporariorum. Rna Biology, 2015. 12 (10): p. 1131-1138. Leichtfried, T., et al., Apple chlorotic fruit spot viroid: a putative new pathogenic viroid on apple characterized by next-generation sequencing. 2019. 164 (12): p. 3137-3140. Afanasenko, O., et al., Transmission of potato spindle tuber viroid between Phytophthora infestans and host plants. 2022. 26 (3): p. 272. Tian, M., et al., Natural cross-kingdom spread of apple scar skin viroid from apple trees to fungi. 2022. 11 (22): p. 3686. Walia, Y., et al., Identification of the herbaceous host range of Apple scar skin viroid and analysis of its progeny variants. 2014. 63 (3): p. 684-690. O'Leary, B.M., et al., The infiltration-centrifugation technique for extraction of apoplastic fluid from plant leaves using Phaseolus vulgaris as an example. 2014(94): p. 52113. Walia, Y., et al., Apple scar skin viroid naked RNA is actively transmitted by the whitefly Trialeurodes vaporariorum. 2015. 12 (10): p. 1131-1138. Vopalensky, P., et al., Exploring RNA modifications in infectious non-coding circular RNAs. 2025. 22 (1): p. 1-9. Sánchez‐López, C.M., et al., Phloem sap from melon plants contains extracellular vesicles that carry active proteasomes which increase in response to aphid infestation. 2024. 13 (10): p. e12517. Gomez, G., H. Torres, and V.J.T.P.J. Pallas, Identification of translocatable RNA‐binding phloem proteins from melon, potential components of the long‐distance RNA transport system. 2005. 41 (1): p. 107-116. Kehr, J. and F. Kragler, Long distance RNA movement. New Phytologist, 2018. 218 (1): p. 29-40. Yokoi, A., et al., Mechanisms of nuclear content loading to exosomes. Sci Adv, 2019. 5 (11): p. eaax8849. Walia, Y., et al., Arabidopsis inositol polyphosphate kinases regulate COP9 signalosome deneddylase functions in phosphate-homeostasis. 2020: p. 2020.10. 02.323584. Jumper, J., et al., Highly accurate protein structure prediction with AlphaFold. 2021. 596 (7873): p. 583-589. Pettersen, E.F., et al., UCSF ChimeraX: Structure visualization for researchers, educators, and developers. 2021. 30 (1): p. 70-82. Additional Declarations No competing interests reported. Supplementary Files Fig.S1..tif Fig.S2..tif Fig.S3..tif TableS1.docx Supportingdata.docx Additionaldata.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7544331","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":526181814,"identity":"04936489-d5e0-4dc1-ba09-8dbd9aa35682","order_by":0,"name":"Neha Devi","email":"","orcid":"","institution":"Maharishi Markandeshwar (Deemed to be University)","correspondingAuthor":false,"prefix":"","firstName":"Neha","middleName":"","lastName":"Devi","suffix":""},{"id":526181819,"identity":"dbda3dab-ed42-4436-a948-67d156925bdf","order_by":1,"name":"Nisha Devi","email":"","orcid":"","institution":"Maharishi Markandeshwar (Deemed to be University)","correspondingAuthor":false,"prefix":"","firstName":"Nisha","middleName":"","lastName":"Devi","suffix":""},{"id":526181821,"identity":"3b15d9cd-5ef6-4b6a-8abb-8aa0282d3c2c","order_by":2,"name":"Vasudha Sharma","email":"","orcid":"","institution":"Maharishi Markandeshwar (Deemed to be University)","correspondingAuthor":false,"prefix":"","firstName":"Vasudha","middleName":"","lastName":"Sharma","suffix":""},{"id":526181823,"identity":"f47a57e0-f626-4432-9088-c4fdd93ba040","order_by":3,"name":"Ravi Gupta","email":"","orcid":"","institution":"Kookmin University","correspondingAuthor":false,"prefix":"","firstName":"Ravi","middleName":"","lastName":"Gupta","suffix":""},{"id":526181824,"identity":"b09f53c3-b5bd-42c2-ba60-39f330fa94c4","order_by":4,"name":"Sunny Dhir","email":"","orcid":"","institution":"Maharishi Markandeshwar (Deemed to be University)","correspondingAuthor":false,"prefix":"","firstName":"Sunny","middleName":"","lastName":"Dhir","suffix":""},{"id":526181826,"identity":"ec650481-7c63-4c4d-ab5b-fb55dc34156f","order_by":5,"name":"Yashika Walia","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+UlEQVRIiWNgGAWjYHACNoaEA0CKnbGB4QOIy060FmbGBsYZIC4zMVoYwFqAiIcBwsALDI4ff/bgwRm7xP5m5sbPNr+2yfMxMzB++JiDR8uZHHODhBvJiTMOMzZL5/bdNmxjZmCWnLkNj5YDOWwSCR+YcxsOMzZI5/bcZgRqYWPmxafl/PNnQC31ufOBtvy27LltT1jLjQQziYQbh3M3HGZsk2b4cTuRoBbJG2+AWs4cr98I1GLZ23A7uY2ZsRmvX/jOpz+T/HGs2ljuePvjGz/+3Lad39588MNHPFoUDiDzGNvAZANu9UAgjyr9B6/iUTAKRsEoGKEAAFdEWIBh/5kQAAAAAElFTkSuQmCC","orcid":"","institution":"Maharishi Markandeshwar (Deemed to be University)","correspondingAuthor":true,"prefix":"","firstName":"Yashika","middleName":"","lastName":"Walia","suffix":""}],"badges":[],"createdAt":"2025-09-05 12:38:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7544331/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7544331/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":93063918,"identity":"fa98e077-5d59-41af-94f7-9d84cf531fe0","added_by":"auto","created_at":"2025-10-08 16:39:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":442945,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIsolation and characterization of EVs from cucumber apoplast\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Coomassie staining of SDS PAGE with total protein extract isolated from AWF and whole cell lysate (CL). Absence of Rubisco protein at 55kDa in AWF fraction compared to CL indicate purity of AWF and absence of cytosolic contamination.\u003c/p\u003e\n\u003cp\u003e(b) Trypan blue staining of leaves used for AWF isolation. Absence of any cell damage as indicated by clear leaves suggest purity of isolated AWF free from cellular content.\u003c/p\u003e\n\u003cp\u003e(c) TEM images illustrating the morphology of EVs isolated from cucumber plants infected with ASSVd using the SEC method. EVs are observed to range in size from 50 nm to 500 nm.\u003c/p\u003e\n\u003cp\u003e(d) DLS analysis of the isolated EVs showing particle sizes between 10 nm and 1000 nm, consistent with the sizes observed in TEM.\u003c/p\u003e\n\u003cp\u003e(Each experiment was repeated thrice for validation)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/253145acc199fe9cefe75bab.png"},{"id":93063955,"identity":"32409ee2-62b0-4da3-a2cf-dc02264714dd","added_by":"auto","created_at":"2025-10-08 16:39:29","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":438261,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDetection of ASSVd from apoplast and EVs and active transmission of ASSVd to healthy plants and whiteflies via infected EVs.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a)\u0026nbsp;\u0026nbsp; Graphical method illustrating the protocol followed for isolation of RNA from outside surface of EVs and from EVs inside.\u003c/p\u003e\n\u003cp\u003e(b)\u0026nbsp; \u0026nbsp;RT-PCR detection of ASSVd in the ASSVd infected AWF and mock as control.\u003c/p\u003e\n\u003cp\u003e(c)\u0026nbsp;\u0026nbsp; RT-PCR detection of ASSVd in the total EV fraction obtained via SEC (EV), EV\u003csup\u003eO\u003c/sup\u003e fraction after trypsin treatment and RNA isolation without EV disruption, and EV\u003csup\u003eI\u003c/sup\u003e fraction after trypsin, RNase and detergent treatment followed by RNA isolation from inside the EVs.\u003c/p\u003e\n\u003cp\u003e(d)\u0026nbsp; dot blot detection of ASSVd in the AWF, total EV fraction obtained via SEC (EV), EV\u003csup\u003eO\u003c/sup\u003e fraction after trypsin treatment and RNA isolation without EV disruption, and EV\u003csup\u003eI\u003c/sup\u003e fraction after trypsin, RNase and detergent treatment followed by RNA isolation from inside the EVs.\u003c/p\u003e\n\u003cp\u003e(e)\u0026nbsp;\u0026nbsp; EtBr-stained gel showing RNA from infected leaves and their corresponding AWF and EV fractions, with mock leaf RNA as a control\u003c/p\u003e\n\u003cp\u003e(f)\u0026nbsp;\u0026nbsp; Northern blot of the same gel using a 3’-labeled biotin-negative sense ASSVd probe, revealing both circular and linear forms of ASSVd in AWF and inside and outside EVs. Small RNAs of ASSVd are distinctly visible within the EV fraction.\u003c/p\u003e\n\u003cp\u003e(g)\u0026nbsp; RT-PCR showing detection of the viroid within EVs, whiteflies fed with intact EVs, apoplast lacking EVs, and water as the mock control.\u003c/p\u003e\n\u003cp\u003e(h)\u0026nbsp; RT-PCR showing detection of ASSVd in plants fed with whiteflies that were pre-fed on viroid-infected EVs, with water serving as the control.\u003c/p\u003e\n\u003cp\u003e(i)\u0026nbsp;\u0026nbsp;\u0026nbsp; RT-PCR analysis of cucumber plant sap inoculated with leaf tissue, AWF, and EVs from viroid-infected plants, revealing a 330 bp amplification corresponding to the ASSVd genome using viroid-specific primers. Plants inoculated with water, used as a mock control, did not show the presence of the viroid, serving as a negative control in the assay. (Each experiment was repeated at-least three times for validation)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/843fb1f2e9f74c7ed23a0184.png"},{"id":93066071,"identity":"3523b1cc-81cd-4e60-9361-3ef016438310","added_by":"auto","created_at":"2025-10-08 16:47:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":401243,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCharacterization of EV proteome for healthy and viroid infected cucumber apoplast\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Showing the diameter of particles in nanometre and particle distribution in percentage of EVs isolated from healthy cucumber apoplast and viroid infected cucumber apoplast.\u003c/p\u003e\n\u003cp\u003e(b) TEM images illustrating the morphology of EVs isolated from cucumber plants infected with ASSVd and healthy plants using the SEC method.\u003c/p\u003e\n\u003cp\u003e(c) Pi chart showing classification of viroid infected and healthy EV proteome based on sub-cellular component\u003c/p\u003e\n\u003cp\u003e(d) Bar graph showing the classification of viroid infected and healthy EV proteome based on biological processes with notable enrichment of proteins related to non-coding RNA processes in viroid infected EVs compared to healthy EVs. (Each sample is pool of at least 50 biological replicates).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/e122536dc470a47ebcb47274.png"},{"id":93064013,"identity":"701eedb6-c180-4081-af41-ed3791b9ff8c","added_by":"auto","created_at":"2025-10-08 16:39:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":406360,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCharacterization of CsTET8 and CsPP2 from EVs infected with ASSVd.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Western blot detection of TET8 in arabidopsis cell lysate (At-CL) cucumber cell lysates (Cs-CL) using Arabidopsis anti-AtTET8 antibody, revealing a band around 30 kDa, which corresponds to the size of TET8 in both Arabidopsis and cucumber CL (lower panel) western blot of the same extracts with anti-Actin antibody.\u003c/p\u003e\n\u003cp\u003e(b) Western blot of cucumber CL and AWF with anti-AtTET8 and anti-CsPP2 antibody. Western blot of the same extract with anti-actin antibody are used as loading controls.\u003c/p\u003e\n\u003cp\u003e(c) Western blot analysis of EV fractions (8-11) isolated by SEC, using AtTET8 antibodies to detect CsTET8 and CsPP2 in fractions 9 and 11 (upper lane in upper and lower blot). The fractions were treated with trypsin to degrade the surface proteins of the EVs, followed by detergent-induced rupture before loading onto the membrane. The lower lane shows the degradation of CsTET8 and CsPP2 from inside the EVs when ruptured with detergent before trypsin digestion, suggesting both proteins are localized inside the EVs.\u003c/p\u003e\n\u003cp\u003e(d) Western blot analysis using anti-AtTET8 and anti-CsPP2 antibodies of pooled EV fractions (9 and 11) with different treatments—no treatment, trypsin followed by detergent, and detergent followed by trypsin—indicating that CsTET8 and CsPP2 are localized both inside and outside the EVs. Western blot of the same extract with anti-actin antibody are used as loading controls. (Each experiment was repeated three to four times for validation).\u003c/p\u003e\n\u003cp\u003eFluorescence microscopy of EVs isolated from GFP-CsPP2 expressing \u003cem\u003eN.benthamiana\u003c/em\u003eplants under GFP Filter and Bright field (Scale bar 5ųm and 2ųm).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/fd24240b61e5dc0bf05140f6.png"},{"id":93063895,"identity":"85befcd7-4d78-4a78-b2fe-059c95c35012","added_by":"auto","created_at":"2025-10-08 16:39:19","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":573322,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInteraction between CsPP2- CsTET8 and ASSVd in cytosol and extracellular space\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Western blot analysis showing detection of CsPP2 in its immunoprecipitates from cell lysates (upper panel), along with co-detection of CsTET8 by western blot and ASSVd RNA by RT-PCR from the same sample.\u003c/p\u003e\n\u003cp\u003e(b) Western blot showing CsPP2 immunoprecipitated from the apoplast + EVs fraction, with CsTET8 detected via western blot and ASSVd RNA via RT-PCR from the same sample.\u003c/p\u003e\n\u003cp\u003e(c) Western blot of a co-immunoprecipitation assay demonstrating the interaction between GFP-TET8 and HA-PP2 when transiently expressed in \u003cem\u003eN. benthamiana\u003c/em\u003e, using anti-GFP and anti-HA antibodies.\u003c/p\u003e\n\u003cp\u003e(d) (Left Panel) Subcellular localization of GFP-CsTET8 and GFP-CsPP2 in \u003cem\u003eN. benthamiana\u003c/em\u003e. Speckles are observed on plasma membrane for both CsTET8 and CsPP2 hinting towards its association with membranous bodies. (Right Panel) BiFC images showing the interaction between CC-CsTET8 and NV-CsPP2 observed under a YFP filter. Controls include CsTET8 and NV alone. Bright-field images are shown alongside. A magnified image highlights punctate interaction near the plasma membrane in a single cell.\u003c/p\u003e\n\u003cp\u003e(e) Structural prediction of the CsTET8–CsPP2 interaction using AlphaFold 3, with a pTM score of 0.47, suggesting a structure close to the true model.\u003c/p\u003e\n\u003cp\u003e(f) Western blot showing immuno-enrichment of CsTET8-containing exosomes from the total EV pool, with co-detection of CsPP2 in the same sample. ASSVd RNA was also detected in the immuno-enriched exosomes using RT-PCR.\u003c/p\u003e\n\u003cp\u003eThe predicted interaction model of CsTET8, CsPP2, and ASSVd using AlphaFold 3, with a pTM score of 0.33, indicating a model approaching structural accuracy. RT-PCR confirmed the presence of ASSVd in infected samples.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/e4345f30fed63612944eabc0.png"},{"id":93063991,"identity":"21e5d7b0-d32b-4ae5-9419-f5e68c7236f8","added_by":"auto","created_at":"2025-10-08 16:39:32","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":372285,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA graphical summary of the key findings from the study.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eASSVd RNA (both circular and linear forms) and VdsRNAs can be packaged into EVs. PP2 interacts with ASSVd RNA and the EC2 domain of TET8 within the cell, potentially facilitating the packaging of ASSVd RNAs into EVs. Additionally, ASSVd RNA is modified with m6A inside the cell and contains exomotifs that may aid in its loading into EVs. Once inside the EVs, the viroid RNA is transported to the extracellular space via these vesicles. Viroid RNAs also exist in the apoplast independently of EVs, either as naked RNA species or as RNP complexes. These viroid RNAs can be acquired by whiteflies, and likely by fungi as well, in the form of EV-encapsulated RNA or naked RNAs as RNP complexes, and then transmitted to healthy plants.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/58f34e3d570121f7518b8d23.png"},{"id":103229014,"identity":"e2623880-54d5-47b3-9526-0fabfbf7540f","added_by":"auto","created_at":"2026-02-23 11:42:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4239423,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/cf27ee57-6cd5-4109-9a11-8b0b0401de89.pdf"},{"id":93063996,"identity":"fab47359-4f6c-4a20-82bc-8c27f263d276","added_by":"auto","created_at":"2025-10-08 16:39:34","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":30924198,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S1..tif","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/a2f68c34399ce68226486782.tif"},{"id":93063919,"identity":"d7f4fab7-6ffe-4fc6-b47c-7ab64bdd8a1e","added_by":"auto","created_at":"2025-10-08 16:39:25","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":31776138,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S2..tif","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/775193bac0950dd3aa53fa51.tif"},{"id":93063901,"identity":"56559158-3ae1-4faf-a3fc-572281067d4c","added_by":"auto","created_at":"2025-10-08 16:39:21","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":31233642,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S3..tif","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/2c82a7f8877ab42ffb4dc677.tif"},{"id":93063892,"identity":"79ae79fd-01c3-4dc3-b5ac-096bee709372","added_by":"auto","created_at":"2025-10-08 16:39:18","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":13420,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/e1adecc1809e15af17eef158.docx"},{"id":93063922,"identity":"51ae3e30-b226-417d-9175-d44d2111ab46","added_by":"auto","created_at":"2025-10-08 16:39:27","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":20242,"visible":true,"origin":"","legend":"","description":"","filename":"Supportingdata.docx","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/79797bc7140f6b1ff3a1a6e0.docx"},{"id":93063896,"identity":"9952baa8-7904-46a4-81c2-d1ebe38b543d","added_by":"auto","created_at":"2025-10-08 16:39:20","extension":"pdf","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":1628855,"visible":true,"origin":"","legend":"","description":"","filename":"Additionaldata.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7544331/v1/722964cff7fd3853e08e787a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Selective packaging of viroid RNAs into plant exosomes, mediated by host proteins, enables efficient cross-kingdom transmission","fulltext":[{"header":"Background","content":"\u003cp\u003eThe role of the apoplast and EVs in mediating cross-kingdom RNA trafficking has gained attention recently [1, 2] \u0026nbsp; EVs are small, membrane-bound vesicles secreted by cells that can encapsulate a variety of biomolecules, including RNA [1, 3-5]. Plants are known to contain three classes of EVs[6] . \u0026nbsp;The first class is represented by exosomes with sizes ranging from 30-150nm which are specifically enriched in tetraspanin 8 (TET8), an ortholog of mammalian CD63, CD81, and CD151 [7, 8]The second class is represented by micro-vesicles with sizes ranging from 150-300nm and are associated with syntaxins proteins, of which Penetration 1 (PEN1) is well characterized[9] The third class is represented by EXPO vesicles which are double membrane bodies fused with the plasma membrane (PM), releasing a single membrane vesicle into the cell wall[2]. Exo70E2 is essential for exocyst subunit recruitment and EXPO formation in both plants and animals [10]\u003c/p\u003e\n\u003cp\u003ePlant apoplast and EVs are enriched in various RNA species, such as long non-coding RNAs (lncRNA), circular RNAs, (circRNA) micro RNAs (miRNAs), and tasiRNAs [4]. The process of cross-kingdom RNA transfer via EVs was first observed during the interaction between Arabidopsis and \u003cem\u003eBotrytis cinerea\u003c/em\u003e, where pathogen-derived small RNAs (sRNAs) were shown to travel across kingdoms and interact with plant argonaute (AGO) to target mitogen-activated protein kinase transcripts, promoting pathogen colonization [11]. Subsequent studies revealed that plants can send their small RNAs in TET8-specific exosomes to suppress fungal virulence genes[12]. In addition, they also carry mRNAs that are translated into fungi and reduce their pathogenicity [5]. Recent studies have identified various mechanisms involved in the loading of RNA into EVs. Specifically, RNA-binding proteins such as AGO1, annexins, and RNA helicases play significant roles in the incorporation of plant small RNAs into TET8-specific exosomes [3, 4, 12]. Furthermore, glycine-rich binding protein (GRP7) and AGO2 have been linked to the secretion of N6-methyladenosine (m6A) modified circular and long non-coding RNAs, as well as small RNAs in the apoplast\u0026nbsp;[13]. Similar to the animals, circular RNAs in the plant apoplast are notably enriched with m6A modifications.\u0026nbsp;[4, 14]. Certain factors have been identified in animals and plants that could assist the sorting of RNAs inside the vesicles. These factors encompass characteristics such as a high GC content, the presence of an EXOmotif (a motif known to facilitate preferential sorting of RNA into exosomes or EVs), and their ability to modify RNAs and interact with RNA binding proteins\u0026nbsp;[14-17].\u003c/p\u003e\n\u003cp\u003eA class of non-coding circular RNAs is represented by viroids which are RNA-only pathogens infecting plants with distinct structural and functional properties. [18, 19] [20]. Despite their small size (246-401nts) and non-coding properties, they autonomously replicate within infected plant cells and cause a variety of diseases. The ability of viroids to infect plants is enabled by their secondary structure [21-25] \u0026nbsp; which is crucial for their replication and movement and allows hijacking of plant cellular machinery for their propagation [26-29] . Recent studies have shown that viroids are not limited to infecting plants but can also affect other biological kingdoms, including fungi, insects, and bacteria [30-33]. This cross-kingdom infection potential suggests that viroids, much like other RNA entities, can traverse biological barriers and may play a role in complex ecological interactions [5, 12]. For example, research on apple scar skin viroid (ASSVd) demonstrated that viroids get transmitted from infected apple trees to fungi, such as \u003cem\u003eAlternaria alternata\u003c/em\u003e, a common plant pathogen[33]. We have previously reported that the glass-house whitefly, \u003cem\u003eTrialeurodes vaporariorum\u003c/em\u003e, mediates the transmission of ASSVd and cucumber PP2 assists in its acquisition and transmission [30]. Moreover, certain aphid species and codling moth larvae, which feed directly on infected apple trees, were found to transmit apple chlorotic fruit spot viroid (ACFSVd), highlighting the role of insect vectors in cross-kingdom viroid transmission [31]. Potato spindle tuber viroid (PSTVd) transmission from infected plants to \u003cem\u003ePhytophthora infestans\u003c/em\u003e also emphasizes the inter-kingdom dynamics of viroid spread [32].\u003c/p\u003e\n\u003cp\u003eAll these findings together suggest that viroids, as circular non-coding RNAs, may take advantage of RNA sorting and encapsulation mechanisms within EVs to facilitate their intercellular movement and potential cross-kingdom dissemination. By associating with EVs, viroids could bypass the hostile intracellular environment of the host, enabling long-distance transport or transmission across different organisms. In the present study, we show that different ASSVd RNAs are present in cucumber EVs. A phloem protein, CsPP2, binds ASSVd and interacts with EV marker CsTET8, suggesting it helps load RNA into EVs. Whiteflies can acquire and transmit viroid-containing EVs, revealing a cross-kingdom RNA transmission route.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eEV-encapsulated ASSVd RNA is efficiently delivered via mechanical inoculation and is readily acquired and transmitted by whiteflies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo identify that the viroid forms inside EVs are biologically active we carried out mechanical inoculation of healthy cucumber plants with EVs. For this, we inoculated healthy cucumber plants with intact EVs (Digested with Trypsin followed by RNase to remove RNA associated with EV surface), AWF ((apoplast with EV fractions depleted) and water. At 14 dpi, RT-PCR on the plants confirmed the presence of ASSVd infection, showing that both the apoplast and EVs of infected plants contained infectious forms of the viroid (Fig. 2g). In contrast, plants inoculated with water showed no viroid-specific amplification. Furthermore, to identify whether whitefly can aquire viroid RNA from the EVs and transmit to healthy plants, we conducted an experiment where a group of ten whiteflies (\u003cem\u003eTrialeurodes vaporariorum\u003c/em\u003e) were fed for 48 hours with three different treatments: intact EVs, AWF and water (as described above), supplemented with artificial diet [36]. After the feeding period, five whiteflies were analyzed for ASSVd presence using RT-PCR, while the remaining five were allowed to feed on healthy cucumber plants. The RT-PCR results revealed that whiteflies were able to acquire ASSVd from the intact EVs (Fig. 2h). Interestingly, a form of infectious ASSVd was also present in the apoplast that had been depleted of EVs, and whiteflies were able to acquire it from there as well. However, the PCR signal was significantly stronger for RNA acquired from intact EVs compared to that from the apoplast, indicating that the viroid is more stable and protected from RNases when encapsulated within EVs. This suggests that EVs might facilitate more efficient acquisition of the viroid by whiteflies compared to naked RNA. No ASSVd was detected in whiteflies fed with water. Subsequently, plants that were fed with viroid-carrying whiteflies were tested for viroid transmission at 14dpi using RT-PCR, which confirmed that the viroid could be actively acquired and transmitted from EVs through the whiteflies (Fig. 2i).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eViroid Infection Alters the Molecular Landscape of Cucumber EVs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the identification of protein changes in EVs upon viroid stress, EVs from AWF were isolated from ASSVd-infected cucumber plants and mock plants three weeks post viroid infection as described above. The morphology of the isolated EVs was analyzed using TEM and DLS which revealed EVs of size varying from 50nm to 1000nm (Fig. 3a and 3b). Protein identification of the infected and healthy EVs revealed proteins specific to exosomes such as tetraspanins (Tet16/PLAT/LH2 domain-containing lipoxygenase family protein) in healthy EVs, and lipoxygenase 3 (orthologue of TET8 in cucumber) in infected EVs (Table 1). Additionally, markers for microvesicles, including syntaxins (SYP21/71/31, SNARE-like superfamily protein) and target SNARE coiled-coil domain protein in healthy EVs, and SYP124/21/42/71 and SNARE-like super-family proteins were also found in infected EVs. Proteins associated with EXPO vesicles, such as exocyst complex components (SEC84B, SEC15B, SEC5, EXO70 family protein in healthy EVs, and SEC10, SEC15B in infected EVs) were also identified. These findings align with the TEM data, which confirmed that EVs isolated through SEC had a size of 50-500nm consistent with the size of exosomes, micro-vesicles, and EXPO vesicles in plants. Notably, enrichment of RNA-binding proteins including Argonaute family proteins (AGO2, AGO3, and AGO7), DEAD-box RNA helicases, sorting nexins, and glycine-rich RNA-binding proteins was also observed in both healthy and infected plant EVs. Apart from these RNA-binding proteins, chaperonins such as heat shock proteins (HSP60/70/81/89.1/70, DnaJ) were also identified in the EVs (Table 1). Interestingly, a phloem protein -CsPP2 was also identified in the cucumber EVs which is known to be involved in viroid transmission to whiteflies [36](Walia et al. 2015) and contains a dsRNA binding motif. The absence of markers for the trans-Golgi network (syntaxin 61, SYP61), late endosomes (Ara6), Golgi bodies (GmMan149), and plasma membrane (LTI6) confirmed the integrity of the EVs and EV-specificity of the identified proteins (Table 1, File: S1 and S2). Further, the cellular component enrichment analysis revealed that both healthy and infected EVs shared several core categories, including the endomembrane system, organelle membrane, membrane-enclosed lumen, extracellular region, and protein-containing complexes (Fig. 4b). These shared categories reflect conserved EV biogenesis and structure across conditions. However, viroid-infected EVs exhibited a prominent shift in the composition and diversity of cellular origins. Increased enrichment of membrane-associated compartments such as the endoplasmic reticulum, outer membrane, and plasma membrane projections was observed in infected EVs, suggesting the involvement of expanded membrane systems in EV formation during stress. Additionally, components associated with cell projections and supramolecular fibers were uniquely enriched in infected EVs, which may support altered trafficking or facilitate intercellular or cross-kingdom communication. In contrast, symplast-related and junctional components (e.g., symplast, cell-cell junction, anchoring junction) were more prominent in healthy EVs and showed reduced representation in infected samples, suggesting a shift from symplastic transport to apoplastic or EV-mediated viroid dissemination. These findings indicate that viroid infection triggers a remodeling of EVs toward more stress-adaptive and extracellularly focused functions, likely to support viroid movement and stability.\u003c/p\u003e\n\u003cp\u003eIn the biological process category, a marked divergence was observed between healthy and infected EVs (Fig. 4d). Healthy EVs were enriched in pathways related to cellular organization and signaling, such as: Regulation of Ras and small GTPase-mediated signal transduction, Cytoskeleton organization, Chromatin remodelling, Organelle organization and Symplastic communication. These patterns indicate a role for healthy EVs in intracellular regulation, cell-cell communication, and homeostatic signaling. In contrast Viroid-Infected EVs displayed profound shifts in biological function, including: Strong enrichment of cytoskeleton-dependent intracellular transport and microtubule-based movement, suggesting heightened vesicle dynamics under infection. RNA silencing-related processes such as post-transcriptional gene silencing (PTGS) and basal gene silencing by RNA were highly enriched, consistent with a host response to suppress viroid replication. RNA metabolism and processing, including splicing, catabolism, and RNA-binding activities, were prominent, reflecting the reallocation of RNA regulatory machinery to EVs. Infected EVs were also enriched in metabolic pathways, particularly carbohydrate, amino acid, and fatty acid biosynthesis, suggesting viroid-induced metabolic reprogramming. Additional terms linked to development, embryogenesis, and stress responses (e.g., detoxification, oxidative stress) highlight a broader reorganization of cellular priorities under infection. These results suggest that EVs from viroid-infected plants are selectively loaded with RNA-regulatory and defense-related proteins, likely to aid in containing, transporting, or responding to viroid RNA.\u003c/p\u003e\n\u003cp\u003eTogether, these data reveal that ASSVd infection significantly remodels the proteomic and functional landscape of cucumber EVs. Healthy EVs maintain a homeostatic role, supporting cellular communication and signaling. In contrast, viroid-infected EVs acquire a specialized cargo enriched in RNA-processing, silencing, and stress-response proteins, along with expanded membrane-associated components. These infection-induced changes likely represent an adaptive host response and may also facilitate viroid systemic movement, protection from degradation, and vector-mediated transmission via EV-mediated packaging and delivery mechanism.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e Displays the list of proteins identified in mass spectrometry data from both viroid-infected and healthy EVs. It includes plant EV-related proteins such as Syntaxins, Tetraspanins, and Expo proteins. Additionally, RNA-binding proteins and Heat shock proteins, previously reported to be associated with plant EVs, are also included. The table further highlights PP2 proteins identified specifically in the EVs from viroid-infected plants.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"599\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHealthy\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eInfected\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eA\u003c/strong\u003e\u003cstrong\u003eccession\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;No.\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eProtein name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e\u003cstrong\u003eccession\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;No\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eProtein name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSyntaxins related\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT5G16830\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eSyntaxin of plants \u0026nbsp;21 (PEP12 VACULAOR TRANSPORT)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT1G61290\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eSyntaxin of plants 124\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT3G09740\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eSyntaxin of plants 71\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT5G16830\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eSyntaxin of plants \u0026nbsp;21\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT5G05760\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eSyntaxin of plants 31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT4G02195\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eSyntaxin of plants 42\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT5G02280\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eSNARE-like superfamily protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT5G02280\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eSNARE-like superfamily protein\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT1G15370\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eSNARE-like superfamily protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT2G35190\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003enovel plant snare 11\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT1G16230\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eTarget SNARE coiled-coil domain\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT1G16230\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eTarget SNARE coiled-coil domain protein\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT3G09740\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003esyntaxin of plants 71\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTetraspanin related\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT3G22400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eLox5/PLAT/LH2 domain\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT1G17420\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eLipoxygenase 3 (PLAT/LH2 domain)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT1G18510\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003etetraspanin 16 (TET8 RELATED)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT4G02380\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eSenescence-associated gene 21\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT4G02380\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eSenescence-associated gene 21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT2G29350\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eSenescence-associated gene 13\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT2G29350\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eSenescence-associated gene 13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eEXPO Related\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT5G49830\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eExocyst complex component 84B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT5G12370\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eExocyst complex component sec10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT4G02350\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eExocyst complex component sec15B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT2G32750\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eExostosin family protein\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT2G28110\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eExostosin family protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT4G02350\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eExocyst complex component sec15B\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT1G21170\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eExocyst complex component SEC5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT5G58430\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eExocyst subunit exo70 family protein B1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRNA binding proteins\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT1G69440\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eArgonaute family protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT1G31280\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eArgonaute family protein\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT1G31290\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eARGONAUTE 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT1G31290\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eARGONAUTE 3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT1G69440\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eArgonaute family protein\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT3G01540\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eDEAD box RNA helicase 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT5G26742\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eDEAD box RNA helicase (RH3)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT5G07120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eSorting nexin 2B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT5G07120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eSorting nexin 2B\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT1G15240\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eSorting nexin, C-terminal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT5G58440\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eSorting nexin 2A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT3G23830\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eGlycine-rich RNA-binding protein 4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT3G23830\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eGlycine-rich RNA-binding protein 4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHeat Shock proteins\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT3G07770\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eHEAT SHOCK PROTEIN 89.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT3G13860\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eHeat shock protein 60-3A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT1G11660\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eHeat shock protein 70 (Hsp 70)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT1G11660\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eHeat shock protein 70 (Hsp 70)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT4G02100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eHeat shock protein DnaJ\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT3G07770\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eHEAT SHOCK PROTEIN 89.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT3G13860\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eHeat shock protein 60-3A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT4G24280\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eChloroplast heat shock protein 70-1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT3G12580\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eHeat shock protein 70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT3G23990\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eHeat shock protein 60\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT5G56030\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eHeat shock protein 81-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT3G08970\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eDNAJ heat shock N-terminal\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eProteasome components\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT3G61140\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003e\u0026nbsp;Rpn7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT1G04810\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;Rpn2/Psmd1 subunit\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT1G77440\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003e20S\u0026nbsp;Proteasome beta subunit C2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT5G42790\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003eProteasome alpha subunit F1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT1G13060\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003e20S\u0026nbsp;Proteasome beta subunit E1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 97px;\"\u003e\n \u003cp\u003eAT3G13330\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 175px;\"\u003e\n \u003cp\u003eProteasome activating protein 200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhloem Proteins\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT1G10155\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003ePhloem protein 2-A10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 121px;\"\u003e\n \u003cp\u003eAT1G65390\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 205px;\"\u003e\n \u003cp\u003ePhloem protein 2 A5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 205px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eCs\u003c/strong\u003e\u003cstrong\u003eTET8 is a conserved EV marker protein in cucumber while\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eCs\u003c/strong\u003e\u003cstrong\u003ePP2 is a newly identified RNA-binding protein localized within EVs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMass-spectrometry results showed the presence of tetraspanins in cucumber EVs. We further confirmed the presence of TET8 (CsTET8) in cucumber EVs using immunoblotting with AtTET8 antibodies. The cross reactivity of the CsTET8 with AtTET8 was separately confirmed (Fig. 4a and Fig. S2a, S2b, S2c and S2d). Further, immunoblotting revealed the presence of CsTET8 in AWF (Fig.4b) and subsequently to investigate the association of CsTET8 with cucumber EVs, various SEC fractions were analyzed by immunoblotting. These fractions underwent a protease protection assay: initially treated with trypsin to digest proteins exposed on the surface of EVs, followed by detergent treatment to disrupt the vesicle membrane and release intravesicular proteins. To further confirm the internal localization of specific proteins, EVs were first lysed with detergent and then treated with trypsin, ensuring that only proteins within the vesicles would be degraded. CsTET8 was detected in EV-containing fractions F9 and F11, with the highest abundance in F11 (Fig. 4c, upper blot, first panel), indicating its presence within EVs. Trypsin treatment alone did not significantly reduce the CsTET8 signal, particularly in F11, suggesting the protein is protected from enzymatic digestion and therefore not exposed on the EV surface (Figs. 4c). However, following vesicle disruption with detergent and subsequent trypsin treatment, CsTET8 bands were degraded, confirming its intravesicular localization (Fig. 4c, upper blot, second panel).\u003c/p\u003e\n\u003cp\u003eFurther validation came from the western blot analysis of pooled EV fractions (F9+F11), which showed a strong CsTET8 signal on SDS-PAGE. This signal was significantly reduced after detergent and trypsin treatment\u0026nbsp;(Figs. 4d), and reflected in the corresponding intensities, reinforcing that CsTET8 is sequestered within the EVs. These findings support that CsTET8 is an integral, protected component of cucumber EVs, consistent with a conserved role across plant species.\u003c/p\u003e\n\u003cp\u003eAnother protein of interest was Phloem Protein 2 (CsPP2) which we proceeded further to explore its association with the EVs. CsPP2 is a phloem lectin previously shown to interact with ASSVd and assist in its cross-kingdom trafficking[36] . Western blotting of cucumber cell lysate and AWF confirmed the presence of CsPP2 in both intracellular and apoplastic compartments (Fig. 4b). Analysis of SEC fractions revealed that CsPP2 co-eluted with CsTET8 in fractions F9 and F11 (Fig. 4c, lower panel). The protease protection assay demonstrated that CsPP2 also resides within EVs: the intact band persisted after trypsin treatment but was degraded when EVs were pre-lysed with detergent before enzyme exposure (Figs. 4c and 4d). Furthermore, to validate the CsPP2 localization in EVs, we transiently expressed CsPP2 fused with GFP in \u003cem\u003eNicotiana benthamiana\u003c/em\u003e and isolated EVs from the apoplast at 48 hpi. Fluorescence microscopy of the isolated EVs showed a distinct presence of GFP-CsPP2 in the EV fraction, in contrast to mock-treated plants (Fig. 4e and Fig. S2e). Characteristic small, cup-shaped EV structures expressing GFP-CsPP2 were clearly observed. These findings collectively suggest that CsPP2 localizes both to the apoplast and within cucumber EVs, and when expressed in \u003cem\u003eN. benthamiana\u003c/em\u003e, it retains the ability to associate with EVs. Notably, the western blot analysis using plant Actin as a control confirmed the absence of Actin protein in both apoplastic and EV samples, verifying the purity of the EV preparations (Fig. 4a and 4b).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCsPP2 may aid in the sorting of viroid and other plant RNAs into CsTET8-specific exosomes\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs CsPP2 is an RNA binding protein and AtTET8 associated exosomes are known to be enriched with RNA binding proteins. Therfore, the co-localization of CsTET8 and CsPP2 in the same EV fractions indicated a potential interaction between these two. To validate this, we carried out immunoprecipitation of CsPP2 using CsPP2 antibody [36] from the total cell lysate and AWF (treated with detergent to release the EV proteins) of viroid-infected plants and detected the presence of CsTET8 in the pull-down sample. Our immunoblot analysis revealed the presence of CsTET8 protein in the CsPP2 immunoprecipitated from the cell lysate as well as extracellular fluid (Figs. 5a and 5b). To further validate the interaction, we performed a co-immunoprecipitation assay by transiently co-expressing CsTET8 fused to GFP and CsPP2 fused to an HA tag using the binary vectors pSITE2CA and HApBA, respectively. Immunoprecipitation of GFP-CsTET8 with anti-GFP-conjugated beads resulted in a clear co-enrichment of HA-CsPP2, as detected by immunoblotting with an anti-HA antibody, thereby confirming the interaction between the two proteins (Fig. 5c-upper panel). The GFP pull-down alone did not immunoprecipitate the HA-PP2 (Fig. 5c-lower panel). Additionally, Bimolecular Fluorescence Complementation (BiFC) assays also revealed that the interaction between CsPP2 and CsTET8 (Fig.\u0026nbsp;5d). Interestingly we observed a punctate-like appearance near the plasma membrane indicating the interactions between the two at plasma membrane (Fig. 5d). \u0026nbsp;These punctate like appearance were also observed when GFP-TET8 and GFP-PP2 were individually transiently expressed in \u003cem\u003eN. benthamiana\u003c/em\u003e plants (Fig. 5d). In addition, the AlphaFold3 tool predicted a pTM score of 0.47 (close to a good structure score of 0.5) for the CsP2-CsTET8 interaction (Fig. 4e). The CsTET8 ortholog in Arabidopsis, TET8_ARATH, contains an extracellular domain (EC2) spanning amino acids 97-235 and the CsPP2 likely interact with CsTET8 at its EC2 domain (Fig. 5e). Overall, together these results validate the interaction between CsTET8 and CsPP2 in the cucumber cell and apoplastic space.\u003c/p\u003e\n\u003cp\u003eConsidering that CsPP2 is an RNA-binding protein, the interaction between CsTET8 and CsPP2 suggests that CsPP2 may play a role in sorting RNAs into CsTET8 exosomes. To explore this interaction, total RNA was isolated from CsPP2-immunoprecipitated samples and the presence of ASSVd RNA was detected by RT-PCR. The results confirmed the co-immunoprecipitation of ASSVd RNA along with CsPP2 from the total cell lysate and apoplast (Fig. 5a and Fig. 5b). Hence, these results suggested that CsPP2, ASSVd, and CsTET8 might exist as a trimeric complex in cucumber plants. To get a deeper insight into this interaction we specifically carried out immuno-enrichment of CsTET8 labeled exosomes from the total EV pool as reported in the arabidopsis[3]. Following enrichment, the exosomes were disrupted using detergent and subjected to immunoblotting and RNA extraction. Immunoblot analysis of the enriched CsTET8 exosomes revealed the co-presence of CsPP2, while RT-PCR of the same extracts confirmed the presence of ASSVd within the CsTET8-specific exosomes (Fig. 5f). Interestingly, when the enriched CsTET8 exosomes were analyzed without detergent-mediated disruption, immunoblotting still detected CsPP2, but RT-PCR failed to detect ASSVd. This suggests that ASSVd resides within the exosomes and that there is no direct interaction between CsTET8 and ASSVd (Data not shown). We further validated this model through interactions using Alphafold3, which revealed the tripartite interaction, in which CsPP2 interacts with the viroid RNA on one side and CsTET8 on the other (Fig.5e ). However, CsTET8 did not show any direct interaction with the viroid RNA. The model predicted the central conserved region (CCR) of the viroid RNA, spanning nucleotides 81-96, was in closest proximity to CsPP2 at amino acids 1-8, 41-47, and 91-101, with CsPP2 motifs spanning amino acids 41-47 and 91-101 containing known double-stranded RNA-binding motifs (dsRBM). Additionally, CsTET8 protein motifs 186-193 and 208-211 were in close proximity to CsPP2 regions 78-86, 107-111, and 202-206, which lie within the EC2 of CsTET8 (Fig. 5e). Thus, using a combination of biochemical and bioinformatic tools, we demonstrate that CsTET8 specific exosomes harbor ASSVd and CsPP2 where CsPP2-CsTET8 directly interact with each other at EC2 domain of CsTET8 but there is no direct interaction between ASSVd-CsTET8 further supporting the notion that CsPP2 might facilitate loading of RNAs in CsTET8 specific exosomes. \u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eViroids, unlike bacteria and fungi, are intracellular pathogens that replicate within the nucleus or chloroplast of the cell. They traffic cell to cell through cytoplasmic connections, plasmodesmata, and through phloem-mediated routes for their long-distance movement. Our previous studies have highlighted the potential role of viroids in cross-kingdom trafficking, such as the acquisition and transmission of ASSVd RNA by whiteflies to neighboring plants (Walia et al. 2015). Later, this phenomenon was also reported in natural interactions between apple plants and their fungal pathogens[33] . These observations, combined with research on the role of EVs in RNA trafficking during plant-fungal interactions [5, 12], raised important questions about whether the viroid RNAs, typically considered intracellular pathogens, could also be transported in EVs. Our study aimed to investigate the presence of ASSVd RNA in the extracellular space including EVs. Interestingly, our results revealed that viroid RNA also exists in the apoplast, and different forms of ASSVd RNA—circular, linear, and small RNAs—are packaged into the EVs of cucumber plants. This indicated that viroids may employ EVs for \u003cem\u003ein planta\u003c/em\u003e and cross-kingdom trafficking, as EVs could protect the RNA from host RNases and help viroids cross biological barriers. In animals, certain factors have been identified that assist in the selective loading of RNAs into EVs. For example, certain sequences have been identified in animals that code for the loading of microRNAs into EVs [15]. These motifs are referred to as EXOmotifs. In search for the identification of such factors that could preferentially facilitate the transport and packaging of viroid RNAs inside EVs, we observed an enrichment of five EXOmotifs in the ASSVd genome. Interestingly, sequence-specific screening of most of the viroids revealed a pattern of exomotif enrichment in their genomes (Fig. S3a). Interestingly, ASSVd revealed an enrichment of five EXOmotifs in the ASSVd genome viz. UCCC, CUCC, CCCU, UGUG, and GGUG (Fig. S3b). The UCCC and UGUG motifs lie in the terminal left domain, CUCC and CCCU lie in the central conserved region whereas GGUG lies in the pathogenicity domain of ASSVd (Fig.S3c). Addtionally, we observed that the UGUG motif is present in 24 out of 30 viroids, CGGGAG in 2 out of 30, CCGGGG in 16 out of 30, and CCGGUG in 20 out of 30. Notably, the majority of viroids, on average, possess five enriched exomotifs in their genomes. Furthermore, the 25-nt long ACCCUGCCGCCUGGACUCCGCCUGU motif is specifically present in TASVd, which is known to be transmitted by bumblebees through encapsulation in potato leaf roll virus. Apart from the presence of EXOmotifs, in animals as well as in plants, the m6A modification of RNA has been linked to the sorting of RNAs into EVs. For example, it has been reported that m6A modification of miRNAs alters their binding affinity to AGO1 protein and increases their association with RNA-binding proteins subsequently facilitating their extracellular export [14]. In plants, the apoplastic localized circular RNAs and long noncoding RNAs are enriched in m6A which likely facilitates their export into EVs [4]. Some viroid RNAs are known to undergo reversible modifications, such as m6A methylation[37], thus it is plausible that ASSVd RNA is modified with m6A to enhance its export. Hence, it is possible that it might have implications on viroid encapsulation within the EVs.\u003c/p\u003e\n\u003cp\u003eAn intriguing finding of our study is the identification of CsPP2, a phloem-specific protein, in the apoplast and EVs of cucumber. A recent study examining the enrichment of the 26S proteasome from melon EVs reported the presence of PP2 in EVs from aphid-infested plants [38]. This suggests that the localization of PP2 in the EVs of the \u003cem\u003eCucurbitaceae\u003c/em\u003e species could represent a conserved phenomenon. CsPP2 is a phloem lectin with dsRNA binding motifs, capable of increasing the size exclusion limit of plasmodesmata, and has been implicated in the movement of various endogenous and pathogenic RNAs within the phloem[39] . In our previous work, we demonstrated that the viroid-PP2 complex is more efficiently acquired and transmitted by whiteflies compared to the naked viroid RNAs ( [36]. In the current study, through a feeding assay of EVs to whiteflies, we observed that viroid RNA is acquired and transmitted more efficiently by the whiteflies when packaged into EVs rather than naked RNA or as an RNP complex. This suggests that although viroid RNA can be acquired by whiteflies in various forms—either as a free RNA molecule, an RNP complex or encapsulated within EVs—the transmission through EVs provides a dual advantage: protection from host RNases and a safer route into new host kingdoms. Interestingly, it has been proposed that cross-kingdom trafficking of RNAs can occur via both EVs and RNP complexes. One research group reported that RNA-binding proteins such as AGO1, RNA helicases, and annexins can mediate RNA loading into vesicles and facilitate subsequent cross-kingdom trafficking[3, 5, 12]. Additionally, another group demonstrated that apoplast-localized proteins like GRP7 and AGO2 can bind to the RNAs in the apoplast, potentially aiding in the cross-kingdom movement of RNAs as RNP complexes [4]. Combining these findings, we show using viroid RNA as a model, that cross-kingdom trafficking of RNAs can occur both as RNP complexes and via EVs, although potentially at different intensities. However, the relevance and function of viroid RNAs and CsPP2 within EVs, as well as the potential for viroids to be transmitted through EV encapsulation, require further investigation. The presence of the CsPP2-viroid complex in the apoplast and its association with CsTET8 suggests that CsPP2 may be a novel protein that assists in sorting RNA into EVs in \u003cem\u003eCucurbitaceae\u003c/em\u003e plants. Interestingly like TET8, CsPP2 also exhibits the presence of a transmemberane domain in its structure which supports its presence in the extracellular space and EVs (Fig. S2f). It is quite possible that viroids can channelize the EV-mediated route for their systemic movement inside plants, as hypothesized for the movement of endogenous RNAs and viral RNAs in plants [40].\u003c/p\u003e\n\u003cp\u003eThe EV proteins from viroid-infected plants implicated changes in nuclear proteins specifically related to non-coding RNA-related biological processes. Viroids are nuclear-replicating pathogens and their effect on nuclear protein turnover and their subsequent export via autophagy or extracellular vesicles warrant further investigation. These findings correlate with cancer disease progression, where genomic DNA and nuclear components are exported by the formation of amphisome-like structures and their fusion to vesicles [41]. It is quite possible that viroids may influence similar processes during infection, and hence, characterization of DNA and RNA from EVs during viroid infection might shed light on these unexplored processes related to viroid pathogenicity in plants. The induced expression of CsTET8 and CsPP2 proteins suggests that it acts as a positive regulator of viroid stress and could be used as a marker protein for viroid stress. Overall, through our study using ASSVd as the model RNA system, cucumber as its host, and whitefly as its vector, we propose that viroid RNAs are exported into the plant apoplast and packaged into EVs from where they can be acquired by the whiteflies (Fig. 6). They may use EVs as a means of cross-kingdom trafficking and their interactions with RNA-binding proteins such as CsPP2 could assist their loading into exosomes which improve their transmission efficiency. Moreover, we hypothesize that the presence of factors like EXOmotifs may assist viroid RNA in their packaging inside EVs. Additionally modifications in RNA like m6A modification might also assist in its packaging inside the EVs. The precise sequences and functional roles of small RNAs in EVs, particularly those derived from viroids and their characterization, remain unclear. These small RNAs may influence the plant's immune response or aid in the viroid's transmission to other organisms, such as insects or fungi. Understanding the mechanisms by which viroids and other RNA molecules are sorted into vesicles and transferred across biological boundaries will offer valuable insights into cross-kingdom RNA trafficking, with implications for viroid biology, RNA-based inter-organism communication, and the ecological impact of RNA transfer.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study provides compelling evidence that ASSVd RNA is not only present in the apoplastic space of cucumber plants but also actively associates with EVs, in both surface-bound and intravesicular forms. Through a combination of RT-PCR, northern blotting, and protease protection assays, we demonstrate that various forms of ASSVd RNA are enriched within cucumber-derived EVs. Interestingly, small RNA species were exclusively detected inside EVs, suggesting selective packaging or stabilization of these viroid-derived small RNAs within vesicles.\u003c/p\u003e\n\u003cp\u003eFunctional assays confirmed that EV-associated viroid RNA remains biologically active. Mechanical inoculation of healthy cucumber plants with purified EVs led to successful infection, and whiteflies feeding on EV-supplemented artificial diets were able to acquire and transmit the viroid to naïve plants. While both apoplastic and EV-associated ASSVd could be acquired, viroid RNA encapsulated within EVs was more efficiently taken up and transmitted, indicating a protective and facilitating role of EVs in vector-mediated transmission.\u003c/p\u003e\n\u003cp\u003eProteomic analyses revealed key differences in the EV cargo between healthy and viroid-infected plants. EVs from infected plants showed enrichment of RNA-binding proteins, chaperonins, and components involved in RNA metabolism, suggesting that viroid infection alters EV content in favor of RNA stabilization and transport. Among these, tetraspanin 8 (CsTET8) was identified as a conserved EV marker protein, and phloem protein 2 (CsPP2), known for its RNA-binding ability and involvement in viroid transport, emerged as a novel EV-associated protein.\u003c/p\u003e\n\u003cp\u003eSubcellular fractionation and immuno-localization studies confirmed that both CsTET8 and CsPP2 reside within cucumber EVs. Co-immunoprecipitation and BiFC assays further demonstrated that CsPP2 directly interacts with CsTET8, specifically at the EC2 extracellular domain of CsTET8, suggesting a stable protein-protein interaction within the vesicle environment. Notably, CsPP2 also co-precipitates with ASSVd RNA, establishing its role as a molecular bridge that connects viroid RNA to the EV cargo-loading machinery.\u003c/p\u003e\n\u003cp\u003eFurther supporting this model, CsTET8-specific exosomes immuno-enriched from infected cucumber plants were shown to contain both CsPP2 and encapsulated ASSVd RNA. Structural modeling using AlphaFold3 revealed a tripartite complex, where CsPP2 binds to both the CCR of the viroid RNA and the EC2 domain of CsTET8. Interestingly, no direct interaction between CsTET8 and ASSVd RNA was detected, reinforcing the hypothesis that CsPP2 acts as a selective adaptor for RNA loading into CsTET8-specific exosomes.\u003c/p\u003e\n\u003cp\u003eTogether, these findings elucidate a novel mechanism for viroid packaging and transmission in plants, where EVs serve as protective carriers of infectious RNA, and specific host proteins like CsPP2 facilitate the selective sorting of viroid RNAs into exosomes via interactions with structural EV components such as CsTET8. This study expands our understanding of RNA trafficking in plants and offers insights into how pathogens like viroids exploit host-derived EVs for mobility and cross-kingdom transmission.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003e\u003cstrong\u003ePlant Growth\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCucumis sativus\u003c/em\u003e (Var. Summer Green) and \u003cem\u003eNicotiana benthamiana\u003c/em\u003e seeds were purchased from the local market (Durga Seeds, Chandigarh) and cultivated in pots containing a mixture of cocopeat, compost, and vermiculite/Perlite in a 1:1:1 ratio. The plants were kept in an insect-proof plant growth chamber equipped with fluorescent tubes under controlled conditions with a temperature of 24±2°C, relative humidity of 70-80%, and a 12-hour light/12-hour dark cycle.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eIn vitro\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;synthesis of dimeric ASSVd (+) RNA and transcript inoculation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo generate positive-sense RNA transcripts of ASSVd, recombinant plasmids containing the dimeric ASSVd insert in the correct positive orientation within the pGEMT-easy vector were linearized using \u003cem\u003eSpe\u003c/em\u003eI. In vitro transcription was carried out using the T7 Highscribe Kit (NEB, USA) according to the manufacturer's protocol. Approximately 100 ng of the RNA transcripts were subsequently used to infect the first true leaf of cucumber plants through mechanical inoculation using carborundum-dust. The water-inoculated plants were used as controls in all experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA extraction and RT-PCR for ASSVd detection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from 100 mg of cucumber leaves using the RNAiso plus (TakaraBio, USA; [42]). Briefly, 100mg of the cucumber leaves (viroid infected and mock) were frozen in liquid nitrogen, ground in Trizol buffer, and incubated with chloroform. After centrifugation, the supernatant was mixed with isopropanol for RNA precipitation and stored at -20°C. The RNA pellet was then washed with 75% ethanol and eluted in 20 µL of nuclease-free water. The RNA was quantified using Quantus™ Fluorometer (Promega) and 1µg of RNA was used for RT-PCR with viroid-specific primers ASSVdICc and ASSVdICh (Table S1)[30] . Reverse transcription was performed using verso cDNA synthesis kit (Thermo Scientific, USA) at 42°C for 60 minutes, followed by PCR using Phusion DNA polymerase (Thermo Scientific, USA) under specified cycling conditions for ASSVd detection [34]. The PCR products were analyzed on 1.5% agarose gel electrophoresis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation of AWF\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eApoplastic washing fluid (AWF) from cucumber leaves was isolated as described previously [35]. The leaf petioles were excised, followed by washing and drying the leaves (Fig. S1a). The leaves were placed in a 60 mL syringe filled with an infiltration buffer (20mM MES, 2mM CaCl\u003csub\u003e2\u003c/sub\u003e, 0.1M NaCl, pH 6.0). Carefully without damaging the leaves, a negative pressure was created by pulling the plunger gently until the leaves turned dark green. The leaves were removed and dried and 3-4 leaves rolled were placed in a 12 mL syringe inside a 50 mL falcon tube. The tube was wrapped with parafilm and centrifuged at 4,000 rpm for 30 minutes to collect the AWF.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTrypan blue staining of leaves after AWF isolation for cell death analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe integrity of the isolated AWF was confirmed by cell death assay by staining the leaves in trypan blue solution using the protocol as described (http://resources.rothamsted.ac.uk).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA isolation and RT-PCR detection of ASSVd from AWF\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOne ml of isolated AWF was concentrated to 100µl using an Amicon® Ultra Centrifugal Filter, 10 kDa MWCO (Millipore, USA). RNA was isolated using RNAiso plus (Takara Bio, USA). Briefly, 1ml of RNAiso plus was added to 100µl of AWF followed by the addition of the chloroform. The RNA was precipitated using isopropanol and suspended in 30µl of RNase-free water. One microgram of RNA was used for RT-PCR as mentioned earlier.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation of EVs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePure-EVs SEC columns were used to isolate EVs from cucumber plants (mock/viroid infected). For EV isolation, 20 mL of isolated AWF was concentrated to 2 mL using an Amicon filter unit (10kDa cutoff) (Millipore, USA) and was subjected to Pure-EVs SEC columns (Hansa Biomed Life Sciences, Estonia) according to the manufacturer's instructions. Briefly, the column was washed with 3 volumes of 1× PBS buffer to remove preservative buffer residues. The sample containing EVs (up to 2 mL) was then loaded into the column and eluted with 1× PBS buffer as the mobile phase. Fractions collected were labeled 1-7 as void volume, 8-13 as the EV fraction, and 14-23 as the protein sample (Fig. S1b).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDynamic Light Scattering (DLS) analyses of EVs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe DLS analyses were performed in a Litesizer 500 (Anton Paar, Germany). 10 µL of isolated EVs were suspended in 990 µL of 1× sterile PBS buffer, loaded into a disposable cuvette, and placed in the litesizer 500. For reproducibility, and standardization, the parameter values were fixed as follows; Temp-25℃, equilibration time-30s, processed runs-5, and Time for each run 10s. The size or homogeneity of exosomes was recognized through the radius or the % Intensity, respectively.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTransmission electron microscopy of EVs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePurified EVs (10 µl) were diluted with an equal volume of 4% paraformaldehyde at 4°C for 30 min, and then carefully placed on a carbon-coated 300-mesh copper grid for 20 min, followed by fixed by 1% glutaraldehyde for 5 min. After two washings, the grids were contrasted with 2% uranyl acetate and then washed again two times. The morphology of isolated exosomes was visualized with TEM (MAKE: JEOL MODEL: JEM 2100 plus).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTrypsin, RNase treatment, RNA isolation, and RT-PCR from EVs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine whether the viroid RNA was present inside or outside EVs, RNase protection assays were performed. Briefly, 100µl of Purified EVs were treated with 25 µg/µL trypsin (Sigma Life Sciences, USA). Samples were incubated at 37°C for 16-18 hours, followed by the addition of 1U of Proteinase K (Invitrogen, USA)/1mM of PMSF (Sigma, USA) to inactivate trypsin. For isolating the RNA from the EV surface the above EV samples were precipitated with 3 volume ethanol and 1/10 sodium acetate overnight followed by isolation of RNA with RNAiso plus next day. For isolating the RNA inside EVs the purified EVs (100µL) were treated with trypsin + trypsin inhibitor + RNaseA + RNase inhibitor to degrade the outside RNA followed by treatment with 1% (v/v) Triton X-100 (Himedia) to rupture the EVs. RNA isolation using RNAiso plus was carried out to isolate the RNA inside EVs. The isolated RNA was quantified and 200ng of the total RNA was used for RT-PCR from the detection of ASSVd from EV\u003csup\u003eO\u003c/sup\u003e and EV\u003csup\u003eI\u003c/sup\u003e as described above. The concentration of trypsin and RNase used in the assays was standardized by taking different dilutions of trypsin and RNase for protein degradation and RNA degradation, respectively (Fig. S1c).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eUrea PAGE and Northern Blot for ASSVd detection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eViroid-infected samples from total leaf, AWF, and EVs (EV\u003csup\u003eO\u003c/sup\u003e and EV\u003csup\u003eI\u003c/sup\u003e) along with mock RNA from leaf were analyzed using Denaturing Polyacrylamide gel electrophoresis (15% polyacrylamide and 7M Urea). The RNA samples (3µg for infected AWF, EV\u003csup\u003eO\u003c/sup\u003e, EV\u003csup\u003eI\u003c/sup\u003e and CL from cell lyaste) were denatured at 65°C in 2x RNA dye (Thermo Scientific, USA) for 10 minutes and were separated in 0.5× TBE buffer for 2h at 90V. The total RNAs were visualized by staining with Diamond Nucleic acid stain (Promega) and then transferred onto a nylon membrane using 1× TBE transfer buffer. The RNAs were cross-linked on a nylon membrane in a UV crosslinker followed by pre-hybridization at 65°C for 3hrs. The membrane was incubated overnight at 65°C in hybridization buffer with gentle shaking along with a 3’ labeled biotin probe. The membrane was rinsed with washing buffer (1× SSC. 0.1% SDS) thrice for 10 minutes at room temperature and blocked in a blocking buffer (0.1% Malic acid buffer (Roche). The membrane was incubated with HRP-conjugated anti-streptavidin antibody (Sigma, USA) at 1:5000 dilutions for 1h. After a final wash in maleic acid and 0.3% Tween-20 containing buffer, the blot was visualized using ChemiDoc (Protein Simple, Biotechne, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGeneration of negative sense 3’-biotin labeled ASSVd probe\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA 3’-biotin-labeled RNA probe was prepared and used for viroid detection using northern hybridization. For probe synthesis, a PCR was carried out using ASSVd plasmid as a template and primers FP1 and RP4 to generate negative sense viroid amplicon along with the T7 promoter sequence. The desired amplicon of 330bp was cut and eluted. Two micrograms of gel eluted product was directly used to generate RNA transcript using a T7 in vitro RNA transcription kit (Thermo Scientific, USA). The transcript at the 3’ end was ligated to pcp-biotin (Jena Biosciences) using T4 RNA Ligase (Promega, USA). The reaction was kept at 16ºC overnight. The labeled transcript was purified using a Monarch RNA cleanup column (New England Biolabs, USA) and was used for hybridization at a concentration of 100ng/10ml of hybridization buffer (Fig. S1d).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMass spectrometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEVs fraction (100µl) was treated with trypsin followed by incubation with trypsin inhibitor and were then treated with 0.1% Triton X-100. The proteins were TCA precipitated and partially resolved by polyacrylamide gel electrophoresis till they entered the resolving gel. The region was excised and sequenced using HR-LCMS, SAIF facility at IIT-BOMBAY. Briefly, the gel slices were subjected to in-gel trypsin digestion followed by desalting and subjected to LC/MS/MS analysis in Q-Exactive Plus Orbitrap high-resolution MS (Thermo Scientific). The MS spectra were acquired at a resolution of 70,000 in a mass range of 350-2500 m/z. Eluted samples were used for MS/MS events (resolution of 17,500), measured in a data-dependent mode for the 15 most abundant peaks (Top15 method).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtein identification and GO enrichment tools\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw MS/MS spectra were analyzed using the software Thermo Proteome Discoverer 2.2 against the Arabidopsis (TAIR) and cucumber database (Cucurbit genomics- http://cucurbitgenomics.org/). The ShinyGO v0.82 (ShinyGO 0.82 (sdstate.edu)) and string tools were used (STRING: functional protein association networks (string-db.org) for GO analyses. Venn diagram was constructed using the software Bioinformatics \u0026amp; Evolutionary Genomics (Draw Venn Diagram (ugent.be).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunoblots\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor immunoblots,\u0026nbsp;cell lysate\u0026nbsp;was prepared by grinding 50mg of leaf tissue in 500ųl of protein extraction buffer (50mM Tris HCl pH 7.5, 150mM NaCl, 10mM MgCl\u003csub\u003e2\u003c/sub\u003e, 2.5mM EDTA, 1mM DTT, 10% Glycerol, 1x protease inhibitor, 1mM PMSF). 20ųl of cell lysate, concentrated AWF, and EVs (EVO and EVI) were mixed with 3 µL of 6× SDS loading buffer, heated at 99°C for 10 minutes, and loaded onto a 15% PAGE, and after run proteins were transferred to a nitrocellulose membrane (for dot blots, the dots were applied on the nitrocellulose membrane directly without the SDS dye). \u0026nbsp;Membranes were blocked with 5% skim milk in TBST and incubated overnight at 4°C with primary antibodies (1:1000 for TET8 (PhytoAb-PHY2750A), 1:10000 for CsPP2 [30], 1:10000 anti-GFP (BioBharati Life Science, India) and 1:3000 anti-HA (BioBharati, Life Science, India), anti-actin (Sigma) mouse monoclonal 1:20000 dilution. Membranes were washed and incubated with 1:10000 goat anti-rabbit/anti-mouse HRP-conjugated secondary antibodies (BioBharati, Life Science, India). After a final wash, proteins were visualized using the ECL substrate (Biorad, USA) and imaged with a ChemiDoc system (Protein Simple, Biotechne, USA) or X-ray film.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA immunoprecipitation assay (RIP assay)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor RNA immunoprecipitation from the leaf, 1g/ml of viroid-infected leaf tissue was ground in protein extraction buffer supplemented with RNase inhibitor, and 500µl of lysate was used for RNA immunoprecipitation assay. For RNA immunoprecipitation from infected AWF, 5ml of AWF isolated from viroid-infected leaves was concentrated to 500µl solution using an Amicon filter. Both the lysate and AWF were incubated with 5mg of CsPP2 antibody for 4h at 4℃ with rotation followed by the addition of protein A/G agarose beads overnight. The next day the beads were pelleted with centrifugation at 3000 rpm for 5 minutes and washed three times with protein extraction buffer supplemented with RNase inhibitor. The beads were eluted in 100ul of RNAse-free water. Half of the beads were heated at 100℃ for 10 minutes to release bead-bound proteins for subsequent immunoblot. The rest of the beads were proceeded for RNA isolation using RNAiso plus. The RNA was quantified and used for the detection of ASSVd by RT-PCR or loaded on 15% denaturing PAGE to visualize the total immunoprecipitated RNAs using Diamond Nucleic acid stain (Promega) as described earlier.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunoenrichment of TET8 exosomes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe isolated intact EVs were treated with trypsin overnight, followed by the addition of a trypsin inhibitor. Next, RNase was added for one hour, and then RNase inhibitor was used to inactivate the RNase. The intact EVs were incubated with anti-AtTET8 antibody in IP buffer without NP-40 for 4 hours at 4°C with rotation, followed by the addition of protein A/G agarose beads overnight. The next day, the beads were pelleted and washed with IP buffer containing 1%Triton X-100 and RNase inhibitor. The beads were then eluted in RNase-free water, with part of the eluate used for RNA isolation as previously described. The isolated RNA was tested for the presence of ASSVd by RT-PCR, as described earlier. The remaining beads were heated and loaded onto an SDS-PAGE gel for immunoblotting with anti-AtTET8 and anti-CsPP2 antibodies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCo-Immunoprecipitation assay:\u0026nbsp;\u003c/strong\u003eFor co-immunoprecipitation assays involving GFP-TET8 and HA-PP2, \u003cem\u003eNicotiana benthamiana\u003c/em\u003e leaves were harvested 48 hours post agroinfiltration. Tissue extracts were homogenized in Protein extraction buffer (PEB) [5 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10 mM MgCl₂, 1 mM EDTA, 1% NP-40, and 1X protease inhibitor cocktail (Sigma-Aldrich, USA)]. After centrifugation to remove cell debris, the supernatant was pre-cleared using IgG agarose beads (Biobharti Life Sciences, India) for 1 hour at 4°C with rotation. The mixture was centrifuged again, and the IgG agarose bead pellet, used as a non-specific binding control, was collected. The resulting supernatant was incubated overnight at 4°C with anti-GFP agarose beads (BioBharati Life Sciences, India). Following centrifugation, the beads were washed three times with PEB buffer, resuspended in 1× SDS loading dye, and prepared for immunoblot analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSubcellular Localization and Bi-molecular Fluorescence Complementation (BiFC) Assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAgrobacterium tumefaciens\u0026nbsp;\u003c/em\u003estrain GV3101 harboring CsTET8 fused to GFP in the binary vector pSITE2CA was infiltrated into mature \u003cem\u003eN\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e\u003cem\u003e\u0026nbsp;benthamiana\u003c/em\u003e leaves. At 48 hours post-infiltration (hpi), tissue sections from infiltrated areas were examined using a confocal microscope (NIKON, AIR PLUS). Images were captured using both bright-field and YFP filter settings. For BiFC assays, GV3101 strains carrying\u0026nbsp;CsTET8 and CsPP2 in BiFC-compatible binary vectors (nVENUS and cCFP) were co-infiltrated into \u003cem\u003eN. benthamiana\u003c/em\u003e leaves in the indicated combinations. Leaf sections were observed under a confocal microscope at 48 hpi. Images were captured using both bright-field and YFP filter settings.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDynamics of CsTET8 and CsPP2 upon viroid infection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThree cucumber plants were infected with ASSVd transcripts along with mock as control. The samples were harvested at 7dpi, 14dpi, 21dpi and 28dpi. The lysates were prepared in 8M urea, mixed with SDS dye, heated, and loaded on 15% PAGE. The proteins were transferred to the membrane and immunoblotted with CsPP2 and AtTET8 antibodies as described earlier.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBioinformatic analysis of the ASSVd-\u003c/strong\u003e\u003cstrong\u003eCs\u003c/strong\u003e\u003cstrong\u003ePP2-\u003c/strong\u003e\u003cstrong\u003eCs\u003c/strong\u003e\u003cstrong\u003eTE8 interactions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe amino acid sequences of the proteins were obtained from the following accession numbers in GenBank: Tetraspanin-8 (TET8) \u003cem\u003eCucumis sativus\u003c/em\u003e Accession XP_004151158.1, Lectin (phloem protein 2) \u003cem\u003eCucumis sativus\u003c/em\u003e Accession NP_001292700.1, and ASSVd RNA sequence was of an isolate from Solan with Accession FM178284. The models were generated from the above-mentioned sequences by the Alphafold2 algorithm[43]. The quality was assessed using pLDDT scores. The models were visualized using ChimeraX software v 1.7.1[44] . The interactions of PP2 with TET8 and trimeric interaction of PP2 and TET8 with viroid RNA was studied using AlphaFold3 [6]( (https://alphafoldserver.com/fold/20a59528fa980c38) that allows structural modeling and interactions of protein and RNA. The quality was assessed using pTM scores. The models were visualized using ChimeraX software v. 1.7.1[44] .\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDensitometric analysis\u003c/strong\u003e- Densitometry was carried out using freely available ImageJ software (https://\u003ca href=\"https://imagej.net/ij/\"\u003eImageJ\u003c/a\u003e.net/ij/)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEV acquisition and viroid transmission assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe whiteflies used for the experiment were glasshouse whiteflies (\u003cem\u003eTrialeurodos vaprorarium\u003c/em\u003e) [36] that were maintained on healthy cucumber and tomato plants in an insect-proof cage. For ASSVd acquisition by whiteflies, ten whiteflies were fed each with AWF (depleted of EVs) and EV (depleted of outside RNAs) and water as control. The whiteflies were trapped in 50ml falcon tubes with their top covered with stretched parafilm. The AWF, EV, and water were placed on the parafilm along with food color (turmeric) and covered with a coverslip ( [36]. The tubes were kept in a growth rack under 14h light and 10h dark period for 48h and the whiteflies were allowed to feed on the solution. After 48h the five whiteflies were killed using the cold shock method and RNA isolation and RT-PCR for ASSVd detection was done as described earlier. The remaining five whiteflies were made to feed on healthy cucumber plants (five plants) in an insect-proof rack. The whitefly-fed plants were pooled P1 (1+2) and P2 (3+4+5) checked for the viroid presence using RT-PCR method with ASSVd-specific primers as described above.\u003c/p\u003e\n\u003cp\u003eFor transmission assay using viroid-infected EVs and AWF, three cucumber plants each with AWF (depleted of EVs) and EV (depleted of outside RNAs) were sap inoculated along with leaf sap as positive control and water as negative control. The plants were pooled for individual treatment and checked for the ASSVd presence at 14dpi by RT-PCR method as described earlier.\u003c/p\u003e\n\u003cp\u003eStatistical analysis. All data presented here are representative of at least three biological and technical replicates for each. Statistical analysis details are mentioned in the respective figure legends.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"3\" cellpadding=\"0\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eAbbreviation\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eFull Form\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eACFSVd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eApple Chlorotic Fruit Spot Viroid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAGO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eArgonaute Proteins\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAra6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eADP-Ribosylation Factor-Like Protein 6\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eASSVd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eApple Scar Skin Viroid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTET8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTetraspanin 8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAWF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eApoplastic Wash Fluid / Apoplastic Washing Fluid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCentral Conserved Region (of viroid RNA)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ecircRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCircular RNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCsPP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCucumis sativus Phloem Protein 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eDLS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eDynamic Light Scattering\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003edsRBM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eDouble-Stranded RNA-Binding Motif\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003edsRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eDouble-Stranded RNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eEC2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eExtracellular Loop 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eEVs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eExtracellular Vesicle(s)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eEXPO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eExocyst Positive Organelle\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGFP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGreen Fluorescent Protein\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGRP7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGlycine-Rich RNA-Binding Protein 7\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eHSP60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHeat Shock Proteins\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eLC-MS/MS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eLiquid Chromatography - Tandem Mass Spectrometry\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003elncRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eLong Non-Coding RNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eLTI6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eLow Temperature-Induced Protein 6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003em6A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eN6-Methyladenosine\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003emiRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMicro RNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePEN1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePenetration 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePSTVd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePotato Spindle Tuber Viroid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eRIP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eRNA Immunoprecipitation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eRNP Complex\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eRibonucleoprotein Complex\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eRBP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eRNA-Binding Protein\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003esRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eSmall RNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSEC10 / SEC15B / SEC5 / SEC84B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eExocyst Complex Components\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSYP21 / 31 / 42 / 71 / 124\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eSyntaxin Proteins (SNARE family)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTASVd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTomato Apical Stunt Viroid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003etasiRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTrans-Acting Small Interfering RNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTEM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTransmission Electron Microscopy\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank the Management MMDU, for providing necessary research facilities. We would like to acknowledge iSTEM facility at SAIF, IIT Bombay for mass-spectrometry analysis and CIL facility at Panjab University Chandigarh for TEM imaging and Confocal analysis. We would also like to thank I-STEM facility at Jamia Hamdard, New Delhi for confocal microscopy. We acknowledge special thanks to Dr. Vipin Hallan, CSIR-IHBT Palampur for providing CsPP2 antibodies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eND:\u0026nbsp;\u003c/strong\u003eFormal analysis, methodology, and validation. \u003cstrong\u003eVS\u003c/strong\u003e: Formal analysis and methodology. \u003cstrong\u003eNDe:\u003c/strong\u003e Formal analysis and methodology. \u003cstrong\u003eRG:\u003c/strong\u003e writing-reviewing, and editing (supporting). \u003cstrong\u003eSD:\u003c/strong\u003e conceptualization, data analysis, investigation, methodology, supervision (equal), writing- review and editing. \u003cstrong\u003eYW:\u003c/strong\u003e conceptualization (lead), data curation and analysis (lead), investigation (lead), methodology, supervision (equal), validation, writing- original draft, writing- review and editing, funding acquisition.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe work was supported by State University Research Excellence Award to Dr. Yashika Walia and Dr. Sunny Dhir by Anusandhan National Research Foundation (ANRF), Government of India through project number SUR/2022/001747. We also thanks to Department of Biotechnology, and Government of India through EMR grant BT/PR40936/AGIII/103/1255/2020 to Dr. Sunny Dhir and to Bayer for providing MEDHA fellowship to Ms. Nisha Devi.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement:\u0026nbsp;\u003c/strong\u003eAll data generated or analysed during this study are included in this published article [and its supplementary information files]\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval and consent to participate: not applicable\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication: not applicable\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interest:\u0026nbsp;\u003c/strong\u003eThe authors report no competing of interest\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details:\u003c/strong\u003e\u003csup\u003e\u0026nbsp;1\u003c/sup\u003eMolecular Plant Virology Group, R\u0026amp;D Lab, Department of Bio-Sciences \u0026amp; Technology, Maharishi Markandeshwar (Deemed to be University), Mullana, Ambala-133207 HR India. \u003csup\u003e2\u003c/sup\u003ePlant Stress Physiology and Proteomics Laboratory, College of General Education, Kookmin University, Seoul, South Korea\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eZhang, M., et al., \u003cem\u003ePlant derived edible nanoparticles as a new therapeutic approach against diseases.\u003c/em\u003e Tissue Barriers, 2016. \u003cstrong\u003e4\u003c/strong\u003e(2): p. e1134415.\u003c/li\u003e\n\u003cli\u003eWang, J., et al., \u003cem\u003eEXPO, an exocyst-positive organelle distinct from multivesicular endosomes and autophagosomes, mediates cytosol to cell wall exocytosis in Arabidopsis and tobacco cells.\u003c/em\u003e 2010. \u003cstrong\u003e22\u003c/strong\u003e(12): p. 4009-4030.\u003c/li\u003e\n\u003cli\u003eHe, B., et al., \u003cem\u003eRNA-binding proteins contribute to small RNA loading in plant extracellular vesicles.\u003c/em\u003e 2021. \u003cstrong\u003e7\u003c/strong\u003e(3): p. 342-352.\u003c/li\u003e\n\u003cli\u003eZand Karimi, H., et al., \u003cem\u003eArabidopsis apoplastic fluid contains sRNA- and circular RNA-protein complexes that are located outside extracellular vesicles.\u003c/em\u003e Plant Cell, 2022. \u003cstrong\u003e34\u003c/strong\u003e(5): p. 1863-1881.\u003c/li\u003e\n\u003cli\u003eWang, S., et al., \u003cem\u003ePlant mRNAs move into a fungal pathogen via extracellular vesicles to reduce infection.\u003c/em\u003e Cell Host Microbe, 2024. \u003cstrong\u003e32\u003c/strong\u003e(1): p. 93-105.e6.\u003c/li\u003e\n\u003cli\u003eAbramson, J., et al., \u003cem\u003eAccurate structure prediction of biomolecular interactions with AlphaFold 3.\u003c/em\u003e 2024. \u003cstrong\u003e630\u003c/strong\u003e(8016): p. 493-500.\u003c/li\u003e\n\u003cli\u003eJankovičov\u0026aacute;, J., et al., \u003cem\u003eTetraspanins, more than markers of extracellular vesicles in reproduction.\u003c/em\u003e 2020. \u003cstrong\u003e21\u003c/strong\u003e(20): p. 7568.\u003c/li\u003e\n\u003cli\u003eChen, K., et al., \u003cem\u003eTetraspanins in digestive‑system cancers: Expression, function and therapeutic potential.\u003c/em\u003e 2024. \u003cstrong\u003e30\u003c/strong\u003e(5): p. 200.\u003c/li\u003e\n\u003cli\u003eRutter, B.D. and R.W.J.P.p. Innes, \u003cem\u003eExtracellular vesicles isolated from the leaf apoplast carry stress-response proteins.\u003c/em\u003e 2017. \u003cstrong\u003e173\u003c/strong\u003e(1): p. 728-741.\u003c/li\u003e\n\u003cli\u003eDing, Y., et al., \u003cem\u003eExo70E2 is essential for exocyst subunit recruitment and EXPO formation in both plants and animals.\u003c/em\u003e 2014. \u003cstrong\u003e25\u003c/strong\u003e(3): p. 412-426.\u003c/li\u003e\n\u003cli\u003eWeiberg, A., et al., \u003cem\u003eFungal small RNAs suppress plant immunity by hijacking host RNA interference pathways.\u003c/em\u003e Science, 2013. \u003cstrong\u003e342\u003c/strong\u003e(6154): p. 118-23.\u003c/li\u003e\n\u003cli\u003eCai, Q., et al., \u003cem\u003ePlants send small RNAs in extracellular vesicles to fungal pathogen to silence virulence genes.\u003c/em\u003e 2018. \u003cstrong\u003e360\u003c/strong\u003e(6393): p. 1126-1129.\u003c/li\u003e\n\u003cli\u003eZand Karimi, H., et al., \u003cem\u003eArabidopsis apoplastic fluid contains sRNA-and circular RNA\u0026ndash;protein complexes that are located outside extracellular vesicles.\u003c/em\u003e The Plant Cell, 2022. \u003cstrong\u003e34\u003c/strong\u003e(5): p. 1863-1881.\u003c/li\u003e\n\u003cli\u003eGarbo, S., et al., \u003cem\u003em6A modification inhibits miRNAs\u0026rsquo; intracellular function, favoring their extracellular export for intercellular communication.\u003c/em\u003e 2024. \u003cstrong\u003e43\u003c/strong\u003e(6).\u003c/li\u003e\n\u003cli\u003eGarcia-Martin, R., et al., \u003cem\u003eMicroRNA sequence codes for small extracellular vesicle release and cellular retention.\u003c/em\u003e 2022. \u003cstrong\u003e601\u003c/strong\u003e(7893): p. 446-451.\u003c/li\u003e\n\u003cli\u003eO\u0026rsquo;Grady, T., et al., \u003cem\u003eSorting and packaging of RNA into extracellular vesicles shape intracellular transcript levels.\u003c/em\u003e 2022. \u003cstrong\u003e20\u003c/strong\u003e(1): p. 72.\u003c/li\u003e\n\u003cli\u003eLiu, Y.-f., et al., \u003cem\u003eCYP2A6 suppresses hepatocellular carcinoma via inhibiting SRC/Wnt/\u0026beta;-Catenin pathway.\u003c/em\u003e 2025: p. 1-12.\u003c/li\u003e\n\u003cli\u003eFlores, R., R.A. Owens, and J.J.C.o.i.v. Taylor, \u003cem\u003ePathogenesis by subviral agents: viroids and hepatitis delta virus.\u003c/em\u003e 2016. \u003cstrong\u003e17\u003c/strong\u003e: p. 87-94.\u003c/li\u003e\n\u003cli\u003eNavarro, B., R. Flores, and F.J.A.R.o.V. Di Serio, \u003cem\u003eAdvances in viroid-host interactions.\u003c/em\u003e 2021. \u003cstrong\u003e8\u003c/strong\u003e(1): p. 305-325.\u003c/li\u003e\n\u003cli\u003eHammond, R.W., \u003cem\u003eEconomic significance of viroids in vegetable and field crops\u003c/em\u003e, in \u003cem\u003eViroids and satellites\u003c/em\u003e. 2017, Elsevier. p. 5-13.\u003c/li\u003e\n\u003cli\u003eBranch, A.D. and H.D.J.S. Robertson, \u003cem\u003eA replication cycle for viroids and other small infectious RNA\u0026apos;s.\u003c/em\u003e 1984. \u003cstrong\u003e223\u003c/strong\u003e(4635): p. 450-455.\u003c/li\u003e\n\u003cli\u003eDar\u0026ograve;s, J.-A., et al., \u003cem\u003eReplication of avocado sunblotch viroid: evidence for a symmetric pathway with two rolling circles and hammerhead ribozyme processing.\u003c/em\u003e 1994. \u003cstrong\u003e91\u003c/strong\u003e(26): p. 12813-12817.\u003c/li\u003e\n\u003cli\u003eWarrilow, D. and R.H. Symons, \u003cem\u003eCitrus exocortis viroid RNA is associated with the largest subunit of RNA polymerase II in tomato in vivo.\u003c/em\u003e Arch Virol, 1999. \u003cstrong\u003e144\u003c/strong\u003e(12): p. 2367-75.\u003c/li\u003e\n\u003cli\u003eNavarro, J.A. and R.J.T.E.J. Flores, \u003cem\u003eCharacterization of the initiation sites of both polarity strands of a viroid RNA reveals a motif conserved in sequence and structure.\u003c/em\u003e 2000.\u003c/li\u003e\n\u003cli\u003eRodio, M.-E., et al., \u003cem\u003eA viroid RNA with a specific structural motif inhibits chloroplast development.\u003c/em\u003e 2007. \u003cstrong\u003e19\u003c/strong\u003e(11): p. 3610-3626.\u003c/li\u003e\n\u003cli\u003eSchn\u0026ouml;lzer, M., et al., \u003cem\u003eCorrelation between structure and pathogenicity of potato spindle tuber viroid (PSTV).\u003c/em\u003e Embo j, 1985. \u003cstrong\u003e4\u003c/strong\u003e(9): p. 2181-90.\u003c/li\u003e\n\u003cli\u003eSano, T., et al., \u003cem\u003eIdentification of multiple structural domains regulating viroid pathogenicity.\u003c/em\u003e 1992. \u003cstrong\u003e89\u003c/strong\u003e(21): p. 10104-10108.\u003c/li\u003e\n\u003cli\u003eReanwarakorn, K. and J.J.J.o.G.V. Semancik, \u003cem\u003eRegulation of pathogenicity in hop stunt viroid-related group II citrus viroids.\u003c/em\u003e 1998. \u003cstrong\u003e79\u003c/strong\u003e(12): p. 3163-3171.\u003c/li\u003e\n\u003cli\u003eSCHMITZ, A. and D.J.R. RIESNER, \u003cem\u003eCorrelation between bending of the VM region and pathogenicity of different potato spindle tuber viroid strains.\u003c/em\u003e 1998. \u003cstrong\u003e4\u003c/strong\u003e(10): p. 1295-1303.\u003c/li\u003e\n\u003cli\u003eWalia, Y., et al., \u003cem\u003eApple scar skin viroid naked RNA is actively transmitted by the whitefly Trialeurodes vaporariorum.\u003c/em\u003e Rna Biology, 2015. \u003cstrong\u003e12\u003c/strong\u003e(10): p. 1131-1138.\u003c/li\u003e\n\u003cli\u003eLeichtfried, T., et al., \u003cem\u003eApple chlorotic fruit spot viroid: a putative new pathogenic viroid on apple characterized by next-generation sequencing.\u003c/em\u003e 2019. \u003cstrong\u003e164\u003c/strong\u003e(12): p. 3137-3140.\u003c/li\u003e\n\u003cli\u003eAfanasenko, O., et al., \u003cem\u003eTransmission of potato spindle tuber viroid between Phytophthora infestans and host plants.\u003c/em\u003e 2022. \u003cstrong\u003e26\u003c/strong\u003e(3): p. 272.\u003c/li\u003e\n\u003cli\u003eTian, M., et al., \u003cem\u003eNatural cross-kingdom spread of apple scar skin viroid from apple trees to fungi.\u003c/em\u003e 2022. \u003cstrong\u003e11\u003c/strong\u003e(22): p. 3686.\u003c/li\u003e\n\u003cli\u003eWalia, Y., et al., \u003cem\u003eIdentification of the herbaceous host range of Apple scar skin viroid and analysis of its progeny variants.\u003c/em\u003e 2014. \u003cstrong\u003e63\u003c/strong\u003e(3): p. 684-690.\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Leary, B.M., et al., \u003cem\u003eThe infiltration-centrifugation technique for extraction of apoplastic fluid from plant leaves using Phaseolus vulgaris as an example.\u003c/em\u003e 2014(94): p. 52113.\u003c/li\u003e\n\u003cli\u003eWalia, Y., et al., \u003cem\u003eApple scar skin viroid naked RNA is actively transmitted by the whitefly Trialeurodes vaporariorum.\u003c/em\u003e 2015. \u003cstrong\u003e12\u003c/strong\u003e(10): p. 1131-1138.\u003c/li\u003e\n\u003cli\u003eVopalensky, P., et al., \u003cem\u003eExploring RNA modifications in infectious non-coding circular RNAs.\u003c/em\u003e 2025. \u003cstrong\u003e22\u003c/strong\u003e(1): p. 1-9.\u003c/li\u003e\n\u003cli\u003eS\u0026aacute;nchez‐L\u0026oacute;pez, C.M., et al., \u003cem\u003ePhloem sap from melon plants contains extracellular vesicles that carry active proteasomes which increase in response to aphid infestation.\u003c/em\u003e 2024. \u003cstrong\u003e13\u003c/strong\u003e(10): p. e12517.\u003c/li\u003e\n\u003cli\u003eGomez, G., H. Torres, and V.J.T.P.J. Pallas, \u003cem\u003eIdentification of translocatable RNA‐binding phloem proteins from melon, potential components of the long‐distance RNA transport system.\u003c/em\u003e 2005. \u003cstrong\u003e41\u003c/strong\u003e(1): p. 107-116.\u003c/li\u003e\n\u003cli\u003eKehr, J. and F. Kragler, \u003cem\u003eLong distance RNA movement.\u003c/em\u003e New Phytologist, 2018. \u003cstrong\u003e218\u003c/strong\u003e(1): p. 29-40.\u003c/li\u003e\n\u003cli\u003eYokoi, A., et al., \u003cem\u003eMechanisms of nuclear content loading to exosomes.\u003c/em\u003e Sci Adv, 2019. \u003cstrong\u003e5\u003c/strong\u003e(11): p. eaax8849.\u003c/li\u003e\n\u003cli\u003eWalia, Y., et al., \u003cem\u003eArabidopsis inositol polyphosphate kinases regulate COP9 signalosome deneddylase functions in phosphate-homeostasis.\u003c/em\u003e 2020: p. 2020.10. 02.323584.\u003c/li\u003e\n\u003cli\u003eJumper, J., et al., \u003cem\u003eHighly accurate protein structure prediction with AlphaFold.\u003c/em\u003e 2021. \u003cstrong\u003e596\u003c/strong\u003e(7873): p. 583-589.\u003c/li\u003e\n\u003cli\u003ePettersen, E.F., et al., \u003cem\u003eUCSF ChimeraX: Structure visualization for researchers, educators, and developers.\u003c/em\u003e 2021. \u003cstrong\u003e30\u003c/strong\u003e(1): p. 70-82.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Extracellular vesicles, Apple Scar Skin Viroid, Phloem Protein 2, Tetraspanin 8, Cross-kingdom trafficking","lastPublishedDoi":"10.21203/rs.3.rs-7544331/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7544331/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e The plant apoplast and extracellular vesicles (EVs) contain diverse RNA species, including small RNAs, long non-coding RNAs, and circular RNAs, many of which cross kingdom boundaries through EV-mediated transport. Viroid RNAs particularly Apple Scar Skin Viroid (ASSVd) are known to move from plants to fungi and insects, though the mechanism remains unclear.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e Using cucumber as a host and Apple scar skin viroid (ASSVd) as the pathogen, we demonstrate through RT-PCR and northern blot analyses that multiple forms of viroid RNAs are present within cucumber-derived EVs. Transmission assays show that these EVs retain viroid infectivity, successfully transmitting the viroid to healthy plants and whiteflies via artificial diets supplemented with viroid-positive EVs. Proteomic analyses identify tetraspanin 8 (CsTET8) as a conserved EV marker, and reveal CsPP2—a phloem lectin with RNA-binding capacity—as a novel EV-associated protein. Co-immunoprecipitation and enrichment assays further confirm the co-localization of CsPP2 and ASSVd within CsTET8-positive EVs, along with direct interactions between CsPP2, CsTET8, and ASSVd.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e In summary, this study demonstrates that cucumber-derived EVs can carry infectious ASSVd RNA, which remains transmissible to healthy plants and insect vectors under experimental conditions. The EVs are marked by CsTET8, and CsPP2 is identified as a novel RNA-binding protein associated with viroid-containing EVs, directly interacting with both CsTET8 and ASSVd. These findings propose a potential EV-mediated pathway for viroid movement and transmission in plants and establish viroid RNAs as a model system to study the molecular basis of RNA trafficking across biological kingdoms.\u003c/p\u003e","manuscriptTitle":"Selective packaging of viroid RNAs into plant exosomes, mediated by host proteins, enables efficient cross-kingdom transmission","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-08 16:15:08","doi":"10.21203/rs.3.rs-7544331/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"366a357c-6000-40bb-b07f-212af455e1b5","owner":[],"postedDate":"October 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-02-23T11:41:07+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-08 16:15:08","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7544331","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7544331","identity":"rs-7544331","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}