GSK3β regulates a novel β-Catenin degradation pathway via the GID complex in Wnt signaling. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article GSK3β regulates a novel β-Catenin degradation pathway via the GID complex in Wnt signaling. Hiroshi Shibuya, Masahiro Shimizu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7182831/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The canonical Wnt signaling pathway plays a pivotal role in regulating cell proliferation, differentiation, and tissue homeostasis. These functions are largely regulated through the degradation of β-Catenin. Under Wnt-off conditions, β-Catenin is phosphorylated by the destruction complex, including GSK3β, and subsequently ubiquitinated by the E3 ligase βTrCP, leading to proteasomal degradation. In this study, we identified a regulatory mechanism in which suppression of GSK3β promotes β-Catenin degradation via the GID complex, a conserved multi-subunit E3 ubiquitin ligase. GSK3β knockdown increased β-Catenin ubiquitination and decreased its protein levels in both the cytoplasm and nucleus, independent of βTrCP. This degradation was rescued by knockdown of GID components MAEA and RMND5A, but not by suppression of βTrCP. Furthermore, Wnt stimulation promoted the interaction between GSK3β and the GID E3 ligases, disrupting the association between MAEA and β-Catenin and thereby stabilizing β-Catenin. Together, these findings reveal a GSK3β-dependent mechanism of β-Catenin regulation mediated by the GID complex. Biological sciences/Cell biology/Cell signalling/Growth factor signalling Biological sciences/Cell biology/Proteolysis/Ubiquitin ligases Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The Wnt signaling pathway is a crucial regulatory mechanism in multicellular organisms, known to be involved in cell proliferation, differentiation, and the maintenance of homeostasis 1 , 2 . In the canonical Wnt pathway, β-Catenin acts as a central mediator, and the precise regulation of its protein levels is a key process in signaling pathway. Under Wnt-off conditions, β-Catenin is phosphorylated by the destruction complex composed of AXIN1, Adenomatous Polyposis Coli (APC), Casein Kinase 1 (CK1) and Glycogen Synthase Kinase 3β (GSK3β), and is subsequently ubiquitinated by the E3 ubiquitin ligase βTrCP. The ubiquitinated β-Catenin is degraded by the proteasome, maintaining basal β-Catenin levels 3 , 4 . Wnt signaling is activated upon binding of Wnt ligand to a receptor complex 3 , which inhibits the destruction complex, leading to β-Catenin accumulation in the cytoplasm. The accumulated β-Catenin translocates into the nucleus, where it activates transcription of Wnt target genes 4 . Although βTrCP-mediated degradation is a well-established mechanism, recent studies have identified several alternative E3 ligases involved in β-Catenin turnover 5 – 7 . These findings suggest that β-Catenin stability is regulated through multiple distinct ubiquitination pathways, likely contributing to the pathway’s context-specific modulation. However, the functional coordination between these alternative pathways and canonical regulators such as GSK3β remains largely unexplored. The glucose-induced degradation deficient (GID) complex is a conserved multi-subunit E3 ubiquitin ligase initially identified in Saccharomyces cerevisiae , where it mediates nutrient-responsive degradation of metabolic enzymes 8 , 9 . Recent studies have elucidated subunit proteins, structural organization and distinct mechanisms of target substrate of GID complex 10 – 12 . Within the GID complex, MAEA and RMND5A function as E3 ubiquitin ligases containing RING domains, and several ubiquitinated substrates have been reported 13 – 16 . We previously identified β-Catenin as a substrate of GID complex and demonstrated that WNK kinases modulate β-Catenin stability by interfering with its interaction with MAEA 17 . Notably, GSK3β, a core component of the β-Catenin destruction complex, has also been reported to interact with WNK kinases and positively regulate WNK signaling 18 . These data raise the intriguing possibility that GSK3β may not only regulate the βTrCP-mediated β-Catenin degradation, but also influence alternative degradation routes involving the GID complex. However, the mechanistic relationship between GSK3β and the GID complex remains poorly understood. Although GSK3β has classically been regarded as a kinase that promotes β-Catenin degradation, our findings challenge this paradigm by showing that suppression of GSK3β can also enhance β-Catenin degradation via the GID complex. This paradox highlights a layer of complexity in Wnt signaling regulation. Furthermore, understanding GID-mediated β-Catenin degradation could illuminate context-dependent regulatory switches in Wnt signaling, with implications for developmental biology, stem cell maintenance, and disease pathogenesis such as cancer. In this study, we demonstrated that suppression of GSK3β expression promoted β-Catenin degradation in both the cytoplasm and nucleus through the GID complex, independently of βTrCP. We further show that the activation of Wnt signaling enhances the interaction between GSK3β and GID E3 ligases MAEA and RMND5A, which in turn disrupts the association between MAEA and β-Catenin, stabilizing β-Catenin. These findings reveal a GSK3β-dependent regulatory mechanism of β-Catenin and uncover an important role of the GID complex in Wnt signaling pathway. Results Suppression of GSK3β expression reduces β-Catenin expression. To investigate the effect of GSK3β on GID complex-mediated β-Catenin degradation, we first treated HEK293T cells with GSK3β siRNA. GSK3β is known to phosphorylate β-Catenin within the destruction complex, thereby promoting β-Catenin ubiquitination and degradation. Thus, the inhibition of GSK3β typically results in β-Catenin stabilization and activation of Wnt signaling 19 , 20 . Contrary to this expectation, knockdown of GSK3β by siRNA reduced β-Catenin protein level, and this reduction was rescued by treatment with the proteasome inhibitor MG132 (Fig. 1 A). Consistent with this result, GSK3β knockdown led to an increase in β-Catenin ubiquitination (Fig. 1 B). Furthermore, RT-PCR analysis revealed that GSK3β knockdown significantly impaired the induction of Wnt target genes AXIN2 and c-Jun (Fig. 1 C). Notably, β-Catenin mRNA levels remained unchanged under GSK3β siRNA treatment, indicating that the observed reduction in β-Catenin expression induced by GSK3β knockdown occurs at the post-translational level (Fig. 1 C). GID complex, but not βTrCP, induces β-Catenin ubiquitination and degradation upon GSK3β knockdown. To examine whether the proteasomal degradation of β-Catenin induced by GSK3β suppression is mediated by the GID complex or βTrCP E3 ligases, we assessed the effects of siRNA-mediated knockdown of these E3 ligases on β-Catenin expression. Suppression of either GID genes ( MAEA and RMND5A ) or βTrCP genes ( βTrCP and FBXW11 (also known as βTrCP2 )) slightly increased β-Catenin protein levels in HEK293T cells (Fig. S1 A, B). In addition, Wnt stimulation led to a modest increase in β-Catenin levels compared to treatment with control medium (Fig. S1 A, B). Analysis of Wnt target gene expression revealed that knockdown of GID genes enhanced AXIN2 expression and accelerated the induction of c-Jun (Fig. S1 C). In contrast, knockdown of βTrCP genes also increased AXIN2 expression but had little effect on c-Jun expression (Fig. S1 D). We next examined the ability of GID or βTrCP knockdown to rescue the reduction in β-Catenin expression induced by GSK3β knockdown. The reduction in β-Catenin expression caused by GSK3β knockdown was rescued by the knockdown of GID genes, but not by the knockdown of βTrCP genes (Fig. 2 A). Consistently, the increase in β-Catenin ubiquitination observed under GSK3β knockdown was reversed by the suppression of GID genes (Fig. 2 B). In contrast, the knockdown of the βTrCP genes did not restore the ubiquitination levels of β-Catenin (Fig. 2 B). To further validate these findings, we analyzed the effects of GID or βTrCP genes knockout on β-Catenin expression and ubiquitination under GSK3β knockdown conditions. In HEK293T cells, MAEA and RMND5A ( GID -KO) or βTrCP ( βTrCP -KO) were knocked out by transient expression of respective target gRNAs along with Cas9-D10A mutant. Single-cell clones were isolated, and successful disruption of MAEA , RMND5A , and βTrCP was confirmed by RT-PCR (Fig. 2 E). Using these knockout clones, we analyzed β-Catenin expression and found that the reduction in β-Catenin expression caused by GSK3β knockdown was rescued in GID- KO cells, but not in βTrCP -KO cells (Fig. 2 C). Moreover, β-Catenin ubiquitination levels were also restored by the knockout of GID genes (Fig. 2 D). Next, we examined the expression of Wnt target genes using these knockout clones yielded results consistent with those from siRNA experiments (Fig. S1 E). Notably, c-Jun induction was more enhanced in GID -KO cells (Fig. S1 E). As shown earlier, Wnt stimulation induced the expression of AXIN2 and c-Jun , but this induction was suppressed by GSK3β siRNA treatment (Fig. 2 E). Consistent with β-Catenin expression and ubiquitination data, Wnt target gene induction was not restore βTrCP -KO cells (Fig. 2 E). In contrast, in GID -KO cells, Wnt target gene expression was markedly enhanced upon Wnt stimulation even in the presence of GSK3β knockdown conditions (Fig. 2 E). These results indicate that the GID complex, but not βTrCP, is involved in the ubiquitination and degradation of β-Catenin upon GSK3β suppression. Supporting this conclusion, GSK3β knockdown increased the interaction between MAEA and β-Catenin, while the interaction between βTrCP and β-Catenin remained unchanged (Fig. 2 F, G). The GID complex targets both cytoplasmic and nuclear β-Catenin. It has been previously reported that the GID E3 ligase component MAEA is predominantly localized in the nucleus and targets nuclear transcription factors 9 , 21 . To determine whether the GID complex targets cytoplasmic or nuclear β-Catenin upon GSK3β knockdown, we performed subcellular fractionation. To confirm the validity of the subcellular fractionation, GAPDH was used as a cytoplasmic marker and PARP as a nuclear marker. We first examined the expression of β-Catenin in cytoplasmic and nuclear fractions following the knockdown of GID genes. β-Catenin levels increased in both compartments, and this accumulation was further enhanced by Wnt stimulation compared to treatment with control medium (Fig. S2A). Similar result was obtained in GID -KO cells (Fig. S2B). In contrast, suppression of βTrCP genes led to β-Catenin accumulation only in the cytoplasm, with no apparent change in nuclear β-Catenin, at least during short-term Wnt stimulation (Fig. S2C). To further investigate the subcellular distribution of β-Catenin following GSK3β knockdown, we examined β-Catenin expression in both cytoplasmic and nuclear fractions. Notably, GSK3β was predominantly localized in the cytoplasm, and the effect of GSK3β siRNA was observed only in the cytoplasmic fraction; non-specific bands were detected in the nuclear fraction (Fig. S2D). Despite this, β-Catenin levels were reduced in both the cytoplasmic and nuclear compartments upon GSK3β knockdown, and this reduction was reversed by the treatment with the proteasome inhibitor MG132 (Fig. S2D). Consistently, GSK3β knockdown led to an increase in β-Catenin ubiquitination in both fractions (Fig. S2E). These results suggest that even a modest reduction in nuclear GSK3β expression is sufficient to induce the degradation of nuclear β-Catenin. Knockdown of GID genes restored β-Catenin levels in both compartments, whereas knockdown of βTrCP genes had no effect (Fig. 3 A). Similar findings were obtained in GID -KO and βTrCP -KO cells (Fig. 3 B). We next examined the ubiquitination status of β-Catenin in these compartments. In GID -KO cells, β-Catenin ubiquitination was reduced in both the cytoplasmic and nuclear fractions. In contrast, in βTrCP -KO cells, a reduction in β-Catenin ubiquitination was observed only in the cytoplasmic fraction (Fig. S2F). Furthermore, the knockdown of GSK3β led to increased β-Catenin ubiquitination in cytoplasm and nucleus, and this increase was substantially suppressed in GID -KO cells, but not in βTrCP -KO cells (Fig. 3 C). Additionally, we analyzed the interaction between MAEA and β-Catenin and found that GSK3β knockdown enhanced their binding in both the cytoplasm and nucleus (Fig. 3 D). These findings indicate that the GID complex mediates β-Catenin ubiquitination and degradation in both cytoplasmic and nuclear compartments upon GSK3β knockdown. Wnt stimulation enhances the interaction of GSK3β with GID E3 ligases and inhibits the binding of β-Catenin to the GID complex. We next examined the interaction between GSK3β and the GID E3 ligase components MAEA and RMND5A. Co-immunoprecipitation assays revealed that both MAEA and RMND5A associated with GSK3β (Fig. 4 A, B). To investigate whether Wnt stimulation affects the interaction between GSK3β and the GID E3 ligases, we analyzed their binding under Wnt-treated conditions. The results showed that Wnt stimulation enhanced the interaction of GSK3β with both MAEA and RMND5A (Fig. 4 C, D). Furthermore, Wnt stimulation reduced the interaction between MAEA and β-Catenin (Fig. 4 E). These findings suggest that Wnt signaling promotes the association between GSK3β and the GID complex, thereby interfering with the binding between the GID complex and β-Catenin. To determine whether Wnt stimulation can rescue β-Catenin degradation mediated by the GID complex under GSK3β knockdown, we analyzed β-Catenin expression following Wnt treatment. Wnt stimulation increased β-Catenin levels and attenuated its degradation induced by GSK3β siRNA treatment (Fig. 4 F). Additionally, Wnt stimulation suppressed β-Catenin ubiquitination, and this suppression was observed even under GSK3β knockdown conditions (Fig. 4 G). As shown in Fig. 2 , the knockdown of GSK3β enhances the interaction between MAEA and β-Catenin. In contrast, Wnt stimulation decreased the binding of MAEA to β-Catenin (Fig. 4 E). These findings suggest that Wnt signaling antagonizes the MAEA–β-Catenin interaction induced by GSK3β knockdown, thereby contributing to β-Catenin stabilization. Indeed, our analysis revealed that Wnt treatment not only reduced the basal binding of β-Catenin to MAEA, and also suppressed the enhancement of this interaction caused by GSK3β knockdown (Fig. 4 H). Wnt stimulation rescues GID-mediated β-Catenin degradation in both cytoplasmic and nuclear compartments following GSK3β knockdown. We finally investigated whether Wnt stimulation could suppress the GID-mediated degradation of β-Catenin in the cytoplasm and nucleus that is induced by GSK3β knockdown. As described earlier, knockdown of GSK3β reduced β-Catenin levels in both cytoplasm and nucleus, and Wnt treatment restored β-Catenin expression in both compartments (Fig. 5 A). We then examined the interaction of GSK3β with the E3 ligases MAEA and RMND5A in the cytoplasmic and nuclear fractions and found that both E3 ligases were associated with GSK3β in both compartments (Fig. 5 B, C). Furthermore, Wnt stimulation enhanced the interaction between GSK3β and MAEA in both cytoplasm and nucleus (Fig. 5 B), whereas its effect on the GSK3β-RMND5A interaction was observed only in the nucleus (Fig. 5 C). Analysis of the interaction between MAEA and β-Catenin revealed that Wnt treatment reduced their interaction in both cytoplasmic and nuclear fractions (Fig. 5 D). These results suggest that Wnt signaling promotes the association of GSK3β with MAEA in both cytoplasmic and nuclear compartments, thereby interfering with the ability of MAEA E3 ligase to bind β-Catenin. To examine whether Wnt stimulation could reversed the enhanced interaction between MAEA and β-Catenin caused by GSK3β knockdown, we performed binding assays in both the cytoplasm and nucleus. As shown in Fig. 5 E, Wnt treatment suppressed the GSK3β knockdown-induced increase in MAEA–β-Catenin binding in both compartments. We also investigated β-Catenin ubiquitination and found that the increased ubiquitination observed in both compartments upon GSK3β knockdown was attenuated by Wnt treatment (Fig. 5 F). Collectively, these results demonstrate that Wnt stimulation counteracts GSK3β knockdown-induced GID-mediated degradation of β-Catenin in both the cytoplasm and nucleus. Discussion In Wnt signaling, GSK3β phosphorylates β-Catenin within the destruction complex, promoting its ubiquitination by βTrCP and subsequent proteasomal degradation. Accordingly, inhibition of GSK3β is generally associated with β-Catenin stabilization and activation of Wnt signaling 20 . However, in this study, we found that suppression of GSK3β expression led to a reduction in β-Catenin protein levels and inhibition of Wnt signaling. This reduction in β-Catenin levels caused by GSK3β knockdown was rescued by treatment with a proteasome inhibitor (Fig. 1 A), and RT-PCR analysis confirmed that β-Catenin mRNA levels remained unchanged (Fig. 1 C), indicating that the reduction in β-Catenin expression by GSK3β knockdown occurs at the post-translational level. Notably, suppression or knockout of βTrCP did not restore β-Catenin levels (Fig. 2 A-D), whereas suppression or knockout of MAEA and RMND5A , components of the GID complex, effectively rescued β-Catenin expression (Fig. 2 A-D). Furthermore, we found that GSK3β interacts with these GID E3 ligases, and this interaction is enhanced by Wnt stimulation (Fig. 4 A-D). Enhanced GSK3β–GID association corresponded with reduced binding between MAEA and β-Catenin and a suppression of β-Catenin ubiquitination (Fig. 4 E and G). These findings suggest that GSK3β can inhibit β-Catenin degradation by binding to the GID complex and interfering with its interaction with β-Catenin. In our previous study, we proposed that WNK kinases similarly attenuate the ubiquitination of β-Catenin by interfering with its interaction with the GID complex in the Wnt signaling pathway 17 . Moreover, we also reported that GSK3β is bound to WNK kinases 18 . Based on these observations, we speculate that WNK kinases and GSK3β cooperatively regulate β-Catenin stability via the GID complex. Interestingly, Wnt stimulation enhanced the association between WNK kinases and MAEA, similar to the effects observed with GSK3β (Fig. S3A, B). Although Wnt stimulation did not affect the interaction between WNK1 and GSK3β, it did increase the binding between WNK4 and GSK3β (Fig. S3C, D). These results suggest that WNK4 may play a key role in the GID complex-mediated degradation of β-catenin in response to GSK3β suppression. However, further studies are needed to clarify the precise mechanisms involved. Accumulating evidence has identified several E3 ligases that contribute to β-Catenin turnover through distinct regulatory mechanisms. Among them, Wnt-responsive E3 ligases such as Jade-1, c-Cbl and Mule have been reported to regulate β-Catenin degradation in a context-dependent manner 22 – 24 . Notably, Jade-1 promotes β-Catenin degradation during the Wnt-off phase, whereas c-Cbl and Mule are involved in targeting β-Catenin under condition of active Wnt signaling. In the present study, we demonstrated that Wnt signaling inhibits β-Catenin ubiquitination and degradation mediated by the GID complex (Fig. 4 F and G). Therefore, similar to Jade-1 and βTrCP, the GID complex likely targets β-Catenin predominantly under Wnt-off conditions. However, the mechanism appears to differ from those of other E3 ligases. While E3 ligases such as βTrCP require active GSK3β for β-Catenin degradation, GID-mediated degradation instead depends on the reduction of GSK3β expression under Wnt-off conditions. These findings suggest that the contribution of each E3 ligase to β-Catenin turnover is modulated by the status of GSK3β—its activity, localization, and expression level. Intriguingly, unlike other E3 ligases, overexpression of the EDD E3 ligase has been reported to stabilize β-catenin, promote its nuclear accumulation, and activate Wnt signaling in a manner dependent on GSK3β activity 25 . Furthermore, nuclear GSK3β itself has also been shown to activate Wnt signaling independently of β-Catenin degradation 26 . Collectively, these observations underscore the complex and multifaceted role of GSK3β in the regulation of Wnt signaling. The inhibition of GSK3β has been widely explored as a potential therapeutic strategy in various cancers 27 . Notably, recent studies have also reported that GSK3β inhibition is effective against tumors driven by mutant KRas 28 . In such KRas-dependent tumors, apoptosis is induced via upregulation of β-Catenin expression. In contrast, tumors lacking KRas mutations do not exhibit increased β-Catenin levels or apoptosis upon GSK3β inhibition. In our study, however, suppression of GSK3β in non-cancerous HEK293T cells resulted in enhanced degradation of β-Catenin, rather than its stabilization. This discrepancy suggests that the presence or absence of KRas mutations may critically influence the cellular response to GSK3β inhibition. Further studies are needed to elucidate the molecular mechanisms underlying this context-dependent effect. In this study, suppression of GSK3β expression promoted the degradation of β-Catenin in both the cytoplasm and the nucleus. Recent studies have identified the lysine demethylases KDM2a and KDM2b as regulators of β-Catenin methylation 29 . These enzymes demethylate nuclear β-Catenin, thereby facilitating its ubiquitination and subsequent degradation. In addition to nuclear regulation, membrane-associated β-Catenin subject to distinct control mechanisms. The E3 ubiquitin ligase Hakai regulates β-Catenin at the membrane in coordination with E-cadherin 30 , while the muscle-specific E3 ligase Ozz has also been implicated in β-Catenin degradation at the membrane compartment 31 . Together, these findings suggest that β-Catenin turnover is governed by multiple spatially distinct mechanisms. Elucidating the substrate specificity, subcellular localization, and regulatory mechanisms of the E3 ubiquitin ligases involved in β-Catenin degradation is crucial for understanding the fine-tuned control of Wnt signaling. Such insights may ultimately contribute to the development of targeted therapies for Wnt-related diseases. Materials and Methods Cell culture and treatment HEK293T cell was cultured in DMEM (Gibco, Waltham, MA, USA) containing 10% foetal bovine serum (FBS). The control and Wnt3a-conditioned medium (CM) were prepared from control or Wnt3a -expressing L cell, respectively. HEK293T cells were treated these medium for indicated time after transfection of plasmid or siRNA. Antibodies Anti-DDDDK, anti-Myc and anti-HA polyclonal antibodies were obtained from Medical & Biological Laboratories (Japan). Anti-GAPDH (5A12) monoclonal antibody was purchased from FUJIFILM Wako (Japan). Anti-GSK3βand Anti-β-Catenin monoclonal antibodies were obtained from BD Transduction Laboratories (Franklin Lakes, NJ, USA). Anti-Ub (P4G7) monoclonal antibody was obtained from COVANCE. Anti-PARP1 polyclonal antibody was purchased from Proteintech (Rosemont, IL, USA). For immunoprecipitation, Anti-β-Catenin (D10A8) monoclonal antibody (Cell Signaling Technology, Danvers, MA, USA), Anti-Myc monoclonal antibody (9B11, Cell Signaling Technology) and Anti-Flag (M2) monoclonal antibody (Sigma-Aldrich, St. Louis, MO, USA) were used at 1/500. Transfection of expression vectors and siRNA Flag-GSK3β, Myc-β-Catenin, Flag-MAEA, Myc-MAEA, Flag-RMND5A, Myc-RMND5A, Flag-βTrCP, Myc-WNK1, HA-WNK1 and Myc-WNK4 in pRK5 were transfected with polyethyleneimine (Polysciences, Warrington, PA, USA) in cultured cells. We also performed transfection of siRNA using TransIT-X2 Dynamic Delivery System (Mirus Bio, Madison, WI, USA). siRNA target sequences were: MAEA 5′-ACGACUUUAUCAUCUUGAC-3′ (NM_001017405.3 1135–2753 bp), RMND5A 5′-UAUUUAACUCCACAAAUGG-3′ (NM_022780.4 834–852 bp), βTrCP 5′-AGAUUCUAUUGUCUCAAUG-3′ (NM_001256856.2 772–790 bp), FBXW11 5′-UCUUAAUAGAAUUAUCUCG-3′ (NM_001378974.1 971–989 bp) and GSK3β 5′-UUAAUACAGCAGUAUCAGG-3′ (NM_001146156.2 1584–1602 bp). Reverse-transcription polymerase chain reaction (RT-PCR) analysis Total RNA was isolated using TRI Reagent (Molecular Research Center, Cincinnati, OH, USA). Double-strand cDNA was prepared from total RNA using oligonucleotide (dT), random primers and Moloney murine leukaemia virus reverse transcriptase (Invitrogen, Carlsbad, CA, USA). GAPDH was used to normalize the cDNA samples. The intensity of each band was quantified using ImageJ software. For quantification, the intensity of the GAPDH band was used to normalize each DNA signal. The sequences of the primer pairs for PCR were as follows: GAPDH 5’- GCCATCACTGCCACCCAGAAGACTG − 3′ and 5’- CATGAGGTCCACCACCCTGTTGCTG − 3′, β-Catenin 5′- AAGACATCACTGAGCCTGCCATCTG-3′ and 5′- TGGCTCCCTCAGCTTCAATAGCTTC-3′, βTrCP 5′- AGCGAATTCTCACAGGCCATACAGG-3′ and 5′- GTCCCTGTACTGCAAACAGGCAATG-3′, FBXW11 5′- GCAGCGAGTGATCTCAGAAGGAATG-3′ and 5′- GAACAGGTCACCATCAGTCCATTGC-3′, MAEA 5′- TCGAGCACCTCAAAGAGCATAGCAG-3′ and 5′- GTTGTCGTACCGGAACTGCTGGATC-3′, RMND5A 5′- AGACATCCACAGCAGTGTTTCTCGG-3′ and 5′- CACAGATATCAGCCCACTGGTTTGC-3′, GSK3β 5′- GCAGCAAGGTAACCACAGTAGTGGC-3′ and 5′-TGGTGCCCTGTAGTACCGAGAACAG-3′, AXIN2 5′- ACAACAGCATTGTCTCCAAGCAGC-3′ and 5′- GTCATGGACATGGAATCATCCGTC-3′, c-Jun 5′- AACCTCAGCAACTTCAACCC − 3′ and 5′- ACCTGTTCCCTGAGCATGTT-3′, Quantitative real-time PCR Quantitative PCR was performed using a 7300 Real-Time PCR Cycler (Applied Biosystems) and THUNDERBIRD SYBR qPCR Mix (TOYOBO, Japan). The primer sequences were as follows: GAPDH 5’-ATGACATCAAGAAGGTGGTG-3′ and 5’-CATACCAGGAAATGAGCTTG-3′, AXIN2 5’-ATCAAGACGGTGCTTACCTGTTCCG-3′ and 5’-CCTTCAGGTTCATCTGCCTGAATCC-3′, c-Jun 5’-GAAACGACCTTCTATGACGATGCCC-3′ and 5’-GGTTCAGGGTCATGCTCTGTTTCAG-3’. GAPDH was used to normalize the cDNA samples. Immunoprecipitation and immunoblot analysis Cells were lysed with TNE buffer [10 mM Tris-HCl (pH 7.4), 0.1% NP-40, 150 mM NaCl, 1 mM EDTA, 1 mM DTT and protease inhibitor cocktail cOmplete (Roche, Switzerland)]. Lysates were pre-cleared with Protein A/G PLUS-agarose (Santa Cruz Biotechnology, Dallas, TX, USA) and immunoprecipitated with the indicated antibodies. For immunoblot analysis, cell lysates or immunoprecipitates were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene difluoride membranes (Merck Millipore, Germany). The membranes were probed with primary antibodies, followed by incubation with horseradish peroxidase-conjugated mouse or rabbit immunoglobulin G (GE Healthcare) and visualized using Immobilon Western (Merck Millipore). The protein bands were digitalized using the image analyzer LAS-4000 Mini (Fujifilm, Japan), and the intensity of each band was quantified using ImageJ software. For quantification, the intensity of the GAPDH or PARP band was used to normalize each protein signal. Gene knockout by CRISPR-Cas9 For gene knockout, pSpCas9n(BB)-2A-Puro (PX462) V2.0 vector was obtained from Addgene (Addgene plasmid # 62987, Cambridge, Massachusetts) and target sequences were cloned into PX462 vector following Zhang lab protocols. gRNA target sequences were: MAEA gRNA1: CCGGTCAATGTTCTTCTGAG and MAEA gRNA2: GACCAGCCACGTCACCATGG, RMND5A gRNA1: TCACCTCATTGAGAAGCCTT and RMND5A gRNA2: GTGGAGCACTTCTTTCGACA, βTrCP gRNA1: CACATAGTGATTTGGCATCC and βTrCP gRNA2: CTGAACTTGTGTGCAAGGAA. These gRNA1 and gRNA2 constructs were equally transfected into HEK293T cells using Lipofectamine 2000 reagent (Thermo Fisher Scientific, Waltham, Massachusetts) for 3 days. After transfection, cells were treated with puromycin (Nacalai Tesque, Japan) for selection, and the puromycin-resistance cells were plated in 96 well plate at the density of one cell per well. Single clones were collected and knockout of each gene was confirmed by RT-PCR using primer sets as described above. Extraction of cytoplasmic and nuclear fraction Cytoplasmic and nuclear fractions of cultured cells were extracted using LysoPure(TM) Nuclear and Cytoplasmic Extractor Kit (FUJIFILM Wako). Only cytoplasmic fraction was diluted 10 times with TNE buffer for immunoblotting and immunoprecipitation. GAPDH was used as a cytoplasmic marker and PARP was used as a nuclear marker. Declarations Conflict of interest The authors declare that they have no competing interests. Author contributions M.S. and H.S. designed the study, analyzed the data, and wrote the manuscript. M.S. performed the all experiments. M.S. and H.S. discussed the data. Acknowledgments This work was supported by Grants-in-Aid for scientific research (C) from the Ministry of Education, Science, Sports and Culture of Japan (MEXT/JSPS KAKEN Grant Number 24K10280) and Nanken-Kyoten, Science Tokyo. Data availability The data are available from the corresponding author upon request. References Steinhart, Z. & Angers, S. Wnt signaling in development and tissue homeostasis. Development 145 , 1–8 (2018). Majidinia, M., Aghazadeh, J., Jahanban-Esfahlani, R. & Yousefi, B. The roles of Wnt/β-catenin pathway in tissue development and regenerative medicine. J. Cell. Physiol. 233 , 5598–5612 (2018). MacDonald, B. T., Tamai, K. & He, X. Wnt/β-Catenin Signaling: Components, Mechanisms, and Diseases. Dev. Cell 17 , 9–26 (2009). Clevers, H. & Nusse, R. Wnt/β-catenin signaling and disease. Cell 149 , 1192–1205 (2012). Winston, J. T. et al. Erratum: The SCF(β-TRCP)-ubiquitin ligase complex associates specifically with phosphorylated destruction motifs in Iκbα and β-catenin and stimulates Iκbα ubiquitination in vitro (Genes and Development (1999) 17 (270-283)). Genes Dev. 13 , 1050 (1999). Dimitrova, Y. N. et al. Direct ubiquitination of β-catenin by Siah-1 and regulation by the exchange factor TBL1. J. Biol. Chem. 285 , 13507–13516 (2010). Qu, Y. et al. Axitinib blocks Wnt/β-catenin signaling and directs asymmetric cell division in cancer. Proc. Natl. Acad. Sci. U. S. A. 113 , 9339–9344 (2016). Sophie Mokas, J. R. M. et al. The Yeast GID Complex, a Novel Ubiquitin Ligase (E3) Involved in the Regulation of Carbohydrate Metabolism. Mol. Biol. Cell 20 , 2673–2683 (2009). Francis, O., Han, F. & Adams, J. C. Molecular Phylogeny of a RING E3 Ubiquitin Ligase, Conserved in Eukaryotic Cells and Dominated by Homologous Components, the Muskelin/RanBPM/CTLH Complex. PLoS One 8 , (2013). Sherpa, D., Chrustowicz, J. & Schulman, B. A. How the ends signal the end: Regulation by E3 ubiquitin ligases recognizing protein termini. Mol. Cell 82 , 1424–1438 (2022). Maitland, M. E. R., Lajoie, G. A., Shaw, G. S. & Schild-Poulter, C. Structural and Functional Insights into GID/CTLH E3 Ligase Complexes. Int. J. Mol. Sci. 23 , (2022). Mohamed, W. I. et al. The human GID complex engages two independent modules for substrate recruitment. EMBO Rep. 22 , 1–15 (2021). Lampert, F. et al. The multi-subunit GID/CTLH e3 ubiquitin ligase promotes cell proliferation and targets the transcription factor Hbp1 for degradation. Elife 7 , 1–23 (2018). Maitland, M. E. R. et al. The mammalian CTLH complex is an E3 ubiquitin ligase that targets its subunit muskelin for degradation. Sci. Rep. 9 , 1–14 (2019). Zhen, R. et al. Wdr26 regulates nuclear condensation in developing erythroblasts. Blood 135 , 208–219 (2020). Maitland, M. E. R., Kuljanin, M., Wang, X., Lajoie, G. A. & Schild-Poulter, C. Proteomic analysis of ubiquitination substrates reveals a CTLH E3 ligase complex-dependent regulation of glycolysis. FASEB J. 35 , 1–16 (2021). Sato, A. et al. WNK regulates Wnt signalling and β-Catenin levels by interfering with the interaction between β-Catenin and GID. Commun. Biol. 3 , 1–10 (2020). Sato, A. & Shibuya, H. Glycogen synthase kinase 3ß functions as a positive effector in the WNK signaling pathway. PLoS One 13 , 1–11 (2018). Law, S. M. & Zheng, J. J. Premise and peril of Wnt signaling activation through GSK-3β inhibition. iScience 25 , 104159 (2022). Liu, J. et al. Wnt/β-catenin signalling: function, biological mechanisms, and therapeutic opportunities. Signal Transduct. Target. Ther. 7 , (2022). Kobayashi, N. et al. RanBPM, Muskelin, p48EMLP, p44CTLH, and the armadillo-repeat proteins ARMC8α and ARMC8β are components of the CTLH complex. Gene 396 , 236–247 (2007). Chitalia, V. C. et al. Jade-1 inhibits Wnt signalling by ubiquitylating β-catenin and mediates Wnt pathway inhibition by pVHL. Nat. Cell Biol. 10 , 1208–1216 (2008). Chitalia, V. et al. C-Cbl, a ubiquitin E3 ligase that targets active β-Catenin: A novel layer of Wnt signaling regulation. J. Biol. Chem. 288 , 23505–23517 (2013). Dominguez-Brauer, C. et al. E3 ubiquitin ligase Mule targets β-catenin under conditions of hyperactive Wnt signaling. Proc. Natl. Acad. Sci. U. S. A. 114 , E1148–E1157 (2017). Hay-Koren, A., Caspi, M., Zilberberg, A. & Rosin-Arbesfeld, R. The EDD E3 ubiquitin ligase ubiquitinates and up-regulates β-catenin. Mol. Biol. Cell 22 , 399–411 (2011). Caspi, M., Zilberberg, A., Eldar-Finkelman, H. & Rosin-Arbesfeld, R. Nuclear GSK-3β inhibits the canonical Wnt signalling pathway in a β-catenin phosphorylation-independent manner. Oncogene 27 , 3546–3555 (2008). Thapa, R. et al. A review of Glycogen Synthase Kinase-3 (GSK3) inhibitors for cancers therapies. Int. J. Biol. Macromol. 253 , 127375 (2023). Kazi, A. et al. GSK3 suppression upregulates β-catenin and c-Myc to abrogate KRas-dependent tumors. Nat. Commun. 9 , 1–9 (2018). Lu, L. et al. Kdm2a/b Lysine Demethylases Regulate Canonical Wnt Signaling by Modulating the Stability of Nuclear β-Catenin. Dev. Cell 33 , 660–674 (2015). Fujita, Y. et al. Hakai, a c-Cbl-like protein, ubiquitinates and induces endocytosis of the E-cadherin complex. Nat. Cell Biol. 4 , 222–231 (2002). Nastasi, T. et al. Ozz-E3, a muscle-specific ubiquitin ligase, regulates β-catenin degradation during myogenesis. Dev. Cell 6 , 269–282 (2004). Additional Declarations There is NO Competing Interest. Supplementary Files Supplementaryinformation.pdf Supplementary information Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7182831","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":495040957,"identity":"49e0e8e2-e02b-4c3d-a436-7bc93b57b58a","order_by":0,"name":"Hiroshi Shibuya","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBElEQVRIiWNgGAWjYDACCcY2KIuH8QGQC2IZgAhmYrQwG4C08BDWwsAG08IGtgKmBSeQn93c9pi3zY5Bt/3ssaqbeywY7MUOb2D4UcPAbo5Di8Gdg+3GvG3JDGZn8tJu5zwDOkw6rYCx5xgDs2UDDi0SiW3SvG3MDGY3eMxu5xwAackxYOBtYGA2OIDDYTPAWurBWophWhj/4tHCcAOs5TBYCzNMCzM+WwxuJLYbzjl3nAfol2RpoBYenttpBYdljkng9Iv8jPRnD96UVcuZHT978HPOgTo59tnJGx++qbFJxhViYMDIBooNCAAzgE6SSMYfO3+wiNnh1zIKRsEoGAUjCAAAnidQGUb78wYAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-6422-8176","institution":"Institute of Science Tokyo","correspondingAuthor":true,"prefix":"","firstName":"Hiroshi","middleName":"","lastName":"Shibuya","suffix":""},{"id":495040958,"identity":"c2f41053-a224-4b11-b929-8a3dc801f859","order_by":1,"name":"Masahiro Shimizu","email":"","orcid":"https://orcid.org/0000-0001-9074-561X","institution":"Tokyo Medical and Dental University","correspondingAuthor":false,"prefix":"","firstName":"Masahiro","middleName":"","lastName":"Shimizu","suffix":""}],"badges":[],"createdAt":"2025-07-22 05:30:43","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7182831/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7182831/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88335037,"identity":"2c2e3c40-2781-47b4-a90a-d21e75826dfc","added_by":"auto","created_at":"2025-08-05 11:50:19","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":247593,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSuppression of GSK3β expression reduces β-Catenin expression.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e, Expression of endogenous β-Catenin following transfection of GSK3β siRNA for 48h and treatment with 20mM of MG132 for 8h in HEK293T cells. \u003cstrong\u003eB\u003c/strong\u003e, Western blot analysis of ubiquitinated β-Catenin in HEK293T cells under \u003cem\u003eGSK3β\u003c/em\u003e knockdown after treatment of MG132 (50mM) for 4h. \u003cstrong\u003eC\u003c/strong\u003e, Gene expression was examined by RT-PCR and quantitative PCR in HEK293T cells following the treatment of GSK3β siRNA and Wnt3a-CM for indicated times\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7182831/v1/bd8050c7196882377fec923d.jpg"},{"id":88335857,"identity":"fb1856d3-fbcb-40e5-8ad2-92d80d37da87","added_by":"auto","created_at":"2025-08-05 11:58:19","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":648629,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGID complex, but not βTrCP, induces β-Catenin ubiquitination and degradation by GSK3β knockdown.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e, Immunoblotting of β-Catenin expression in HEK293T cells after transfection of GSK3β siRNA, MAEA and RMND5A siRNA (\u003cem\u003esiGID\u003c/em\u003e), or βTrCP and FBXW11 siRNA (\u003cem\u003esiβTrCP\u003c/em\u003e) for 48h. Suppression of each gene was confirmed by RT-PCR. \u003cstrong\u003eB\u003c/strong\u003e, Ubiquitination levels of endogenous β-Catenin following the knockdown of \u003cem\u003eGSK3β\u003c/em\u003e, \u003cem\u003eMAEA\u003c/em\u003e and \u003cem\u003eRMND5A\u003c/em\u003e, or \u003cem\u003eβTrCP\u003c/em\u003e and \u003cem\u003eFBXW11\u003c/em\u003e. \u003cstrong\u003eC\u003c/strong\u003e, Expression of β-Catenin in \u003cem\u003eMAEA\u003c/em\u003e- and \u003cem\u003eRMND5A\u003c/em\u003e-knockout (\u003cem\u003eGID\u003c/em\u003e-KO) or \u003cem\u003eβTrCP\u003c/em\u003e-knockout (\u003cem\u003eβTrCP\u003c/em\u003e-KO) HEK293T cells after treatment of GSK3β siRNA for 48h. \u003cstrong\u003eD\u003c/strong\u003e, Western blot analysis of ubiquitinated β-Catenin in \u003cem\u003eGID\u003c/em\u003e-KO or\u003cem\u003e βTrCP\u003c/em\u003e-KO cells under \u003cem\u003eGSK3β\u003c/em\u003e knockdown after treatment of MG132 (50mM) for 4h. \u003cstrong\u003eE\u003c/strong\u003e, RT-PCR and quantitative PCR analysis of Wnt target genes in \u003cem\u003eGID\u003c/em\u003e-KO or\u003cem\u003e βTrCP\u003c/em\u003e-KO cells following the treatment of GSK3β siRNA and Wnt3a-CM for indicated times. \u003cstrong\u003eF\u003c/strong\u003e and \u003cstrong\u003eG\u003c/strong\u003e, Interaction of β-Catenin with MAEA (F) or βTrCP (G) under \u003cem\u003eGSK3β\u003c/em\u003e knockdown. HEK293T cells were transiently co-transfected with indicated vectors and GSK3β siRNA for 48h and treated with MG132 (50mM) for 4h.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7182831/v1/a3974d0f92fae11fb8973394.jpg"},{"id":88335039,"identity":"680798f4-e21c-4c63-92b0-1a729cd436c1","added_by":"auto","created_at":"2025-08-05 11:50:19","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":460804,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe GID complex targets both cytoplasmic and nuclear β-Catenin.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e, Western blot analysis of β-Catenin expression in cytoplasmic and nuclear fractions of HEK293T cells after transfection of GSK3β siRNA, MAEA and RMND5A siRNA, or βTrCP and FBXW11 siRNA for 48h. Cytoplasmic fraction was diluted 10 times with TNE buffer. \u003cstrong\u003eB\u003c/strong\u003e, Expression of β-Catenin in cytoplasm and nucleus of \u003cem\u003eGID\u003c/em\u003e-KO or \u003cem\u003eβTrCP\u003c/em\u003e-KO HEK293T cells after treatment of GSK3β siRNA for 48h. \u003cstrong\u003eC\u003c/strong\u003e, Ubiquitination levels of endogenous β-Catenin in cytoplasm and nucleus following the knockdown of GSK3β in GID-KO or βTrCP-KO cells. \u003cstrong\u003eD\u003c/strong\u003e, Binding analysis of MAEA and β-Catenin after co-transfection of indicated vectors and GSK3β siRNA for 48h and treatment of MG132 (50mM) for 4h. Cytoplasmic and nuclear fractions were extracted, and individual fractions were immunoprecipitated with anti-Flag antibody. For immunoprecipitation, only cytoplasmic fraction was diluted 10 times with TNE buffer.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7182831/v1/89ad0439a00ac4b881d6db2b.jpg"},{"id":88335858,"identity":"98b4f29b-c775-4837-9cc1-3a9050a6dc10","added_by":"auto","created_at":"2025-08-05 11:58:19","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":553704,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWnt stimulation enhances the interaction of GSK3β and GID E3 ligases and results in inhibition of the binding of β-Catenin to GID complex.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eand\u003cstrong\u003e B\u003c/strong\u003e,\u003cstrong\u003e \u003c/strong\u003eBinding assay of GSK3β to MAEA (A) and RMND5A (B) in HEK293T cells after transfection of indicated vectors for 48h. \u003cstrong\u003eC\u003c/strong\u003e and \u003cstrong\u003eD\u003c/strong\u003e, Interaction between GSK3β and MAEA (C) or RMND5A (D) with Wnt3a-CM treatment for 2h. \u003cstrong\u003eE\u003c/strong\u003e, Binding analysis of MAEA and β-Catenin after treatment of Wnt3a-CM and MG132 (50mM) for 4h. \u003cstrong\u003eF\u003c/strong\u003e, Expression of β-Catenin in HEK293T cells under transfection of GSK3β siRNA for 48h and treatment of Wnt3a-CM for 2h. \u003cstrong\u003eG\u003c/strong\u003e, Ubiquitination levels of endogenous β-Catenin after GSK3β knockdown and Wnt3a-CM and MG132 (50mM) stimulation for 4h. \u003cstrong\u003eH\u003c/strong\u003e, Interaction between MAEA and β-Catenin with GSK3β knockdown and Wnta-CM for 4h.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7182831/v1/889a4e6d15ca2a6f289bf79d.jpg"},{"id":88335046,"identity":"cfbde52b-da21-4d4a-be1e-3019c668c157","added_by":"auto","created_at":"2025-08-05 11:50:19","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":620156,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWnt stimulation enhances the interaction of GSK3β and GID E3 ligases and results in inhibition of the binding of β-Catenin to GID complex.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e, Expression of β-Catenin in cytoplasm and nucleus of HEK293T cells under transfection of GSK3β siRNA for 48h and treatment of Wnt3a-CM for 2h. \u003cstrong\u003eB \u003c/strong\u003eand\u003cstrong\u003e C\u003c/strong\u003e, Interaction between GSK3β and MAEA (B) or RMND5A (C) in cytoplasm and nucleus after treatment of Wnt3a-CM for 2h. \u003cstrong\u003eD\u003c/strong\u003e, Interaction between MAEA and β-Catenin in cytoplasmic and nuclear fractions after treatment of Wnt3a-CM and MG132 (50mM) for 4h. \u003cstrong\u003eE\u003c/strong\u003e, Binding analysis of MAEA and β-Catenin in cytoplasm and nucleus under transfection of GSK3β siRNA for 48h and treatment of Wnt3a-CM and MG132 (50mM) for 4h. \u003cstrong\u003eF\u003c/strong\u003e, Ubiquitination levels of endogenous β-Catenin in cytoplasm and nucleus following the knockdown of \u003cem\u003eGSK3β\u003c/em\u003e and treatment of Wnt3a-CM and MG132 (50mM) for 4h.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7182831/v1/1ffca6f2a09d00245a937298.jpg"},{"id":91142186,"identity":"c4200565-cb44-4c17-b7b9-a87f3c0ea99b","added_by":"auto","created_at":"2025-09-12 04:58:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3634539,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7182831/v1/d60c90ed-7231-4133-afb3-72ea9e9d0959.pdf"},{"id":88336196,"identity":"1a665558-d159-40f0-8441-4bf11871504e","added_by":"auto","created_at":"2025-08-05 12:06:19","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":655635,"visible":true,"origin":"","legend":"Supplementary information","description":"","filename":"Supplementaryinformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7182831/v1/3a42cf808afd341b93ac4340.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"GSK3β regulates a novel β-Catenin degradation pathway via the GID complex in Wnt signaling.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe Wnt signaling pathway is a crucial regulatory mechanism in multicellular organisms, known to be involved in cell proliferation, differentiation, and the maintenance of homeostasis\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. In the canonical Wnt pathway, β-Catenin acts as a central mediator, and the precise regulation of its protein levels is a key process in signaling pathway. Under Wnt-off conditions, β-Catenin is phosphorylated by the destruction complex composed of AXIN1, Adenomatous Polyposis Coli (APC), Casein Kinase 1 (CK1) and Glycogen Synthase Kinase 3β (GSK3β), and is subsequently ubiquitinated by the E3 ubiquitin ligase βTrCP. The ubiquitinated β-Catenin is degraded by the proteasome, maintaining basal β-Catenin levels\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Wnt signaling is activated upon binding of Wnt ligand to a receptor complex\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e, which inhibits the destruction complex, leading to β-Catenin accumulation in the cytoplasm. The accumulated β-Catenin translocates into the nucleus, where it activates transcription of Wnt target genes\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Although βTrCP-mediated degradation is a well-established mechanism, recent studies have identified several alternative E3 ligases involved in β-Catenin turnover\u003csup\u003e\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. These findings suggest that β-Catenin stability is regulated through multiple distinct ubiquitination pathways, likely contributing to the pathway\u0026rsquo;s context-specific modulation. However, the functional coordination between these alternative pathways and canonical regulators such as GSK3β remains largely unexplored.\u003c/p\u003e\u003cp\u003eThe glucose-induced degradation deficient (GID) complex is a conserved multi-subunit E3 ubiquitin ligase initially identified in \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e, where it mediates nutrient-responsive degradation of metabolic enzymes\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Recent studies have elucidated subunit proteins, structural organization and distinct mechanisms of target substrate of GID complex\u003csup\u003e\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Within the GID complex, MAEA and RMND5A function as E3 ubiquitin ligases containing RING domains, and several ubiquitinated substrates have been reported\u003csup\u003e\u003cspan additionalcitationids=\"CR14 CR15\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. We previously identified β-Catenin as a substrate of GID complex and demonstrated that WNK kinases modulate β-Catenin stability by interfering with its interaction with MAEA\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Notably, GSK3β, a core component of the β-Catenin destruction complex, has also been reported to interact with WNK kinases and positively regulate WNK signaling\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. These data raise the intriguing possibility that GSK3β may not only regulate the βTrCP-mediated β-Catenin degradation, but also influence alternative degradation routes involving the GID complex. However, the mechanistic relationship between GSK3β and the GID complex remains poorly understood.\u003c/p\u003e\u003cp\u003eAlthough GSK3β has classically been regarded as a kinase that promotes β-Catenin degradation, our findings challenge this paradigm by showing that suppression of GSK3β can also enhance β-Catenin degradation via the GID complex. This paradox highlights a layer of complexity in Wnt signaling regulation. Furthermore, understanding GID-mediated β-Catenin degradation could illuminate context-dependent regulatory switches in Wnt signaling, with implications for developmental biology, stem cell maintenance, and disease pathogenesis such as cancer.\u003c/p\u003e\u003cp\u003eIn this study, we demonstrated that suppression of GSK3β expression promoted β-Catenin degradation in both the cytoplasm and nucleus through the GID complex, independently of βTrCP. We further show that the activation of Wnt signaling enhances the interaction between GSK3β and GID E3 ligases MAEA and RMND5A, which in turn disrupts the association between MAEA and β-Catenin, stabilizing β-Catenin. These findings reveal a GSK3β-dependent regulatory mechanism of β-Catenin and uncover an important role of the GID complex in Wnt signaling pathway.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eSuppression of GSK3β expression reduces β-Catenin expression.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo investigate the effect of GSK3β on GID complex-mediated β-Catenin degradation, we first treated HEK293T cells with GSK3β siRNA. GSK3β is known to phosphorylate β-Catenin within the destruction complex, thereby promoting β-Catenin ubiquitination and degradation. Thus, the inhibition of GSK3β typically results in β-Catenin stabilization and activation of Wnt signaling\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Contrary to this expectation, knockdown of \u003cem\u003eGSK3β\u003c/em\u003e by siRNA reduced β-Catenin protein level, and this reduction was rescued by treatment with the proteasome inhibitor MG132 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Consistent with this result, \u003cem\u003eGSK3β\u003c/em\u003e knockdown led to an increase in β-Catenin ubiquitination (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFurthermore, RT-PCR analysis revealed that \u003cem\u003eGSK3β\u003c/em\u003e knockdown significantly impaired the induction of Wnt target genes AXIN2 and c-Jun (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Notably, β-Catenin mRNA levels remained unchanged under GSK3β siRNA treatment, indicating that the observed reduction in β-Catenin expression induced by \u003cem\u003eGSK3β\u003c/em\u003e knockdown occurs at the post-translational level (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003cb\u003eGID complex, but not βTrCP, induces β-Catenin ubiquitination and degradation upon GSK3β knockdown.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo examine whether the proteasomal degradation of β-Catenin induced by GSK3β suppression is mediated by the GID complex or βTrCP E3 ligases, we assessed the effects of siRNA-mediated knockdown of these E3 ligases on β-Catenin expression. Suppression of either \u003cem\u003eGID\u003c/em\u003e genes (\u003cem\u003eMAEA\u003c/em\u003e and \u003cem\u003eRMND5A\u003c/em\u003e) or \u003cem\u003eβTrCP\u003c/em\u003e genes (\u003cem\u003eβTrCP\u003c/em\u003e and \u003cem\u003eFBXW11\u003c/em\u003e (also known as \u003cem\u003eβTrCP2\u003c/em\u003e)) slightly increased β-Catenin protein levels in HEK293T cells (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA, B). In addition, Wnt stimulation led to a modest increase in β-Catenin levels compared to treatment with control medium (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA, B). Analysis of Wnt target gene expression revealed that knockdown of \u003cem\u003eGID\u003c/em\u003e genes enhanced \u003cem\u003eAXIN2\u003c/em\u003e expression and accelerated the induction of \u003cem\u003ec-Jun\u003c/em\u003e (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC). In contrast, knockdown of \u003cem\u003eβTrCP\u003c/em\u003e genes also increased \u003cem\u003eAXIN2\u003c/em\u003e expression but had little effect on \u003cem\u003ec-Jun\u003c/em\u003e expression (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eD). We next examined the ability of GID or βTrCP knockdown to rescue the reduction in β-Catenin expression induced by \u003cem\u003eGSK3β\u003c/em\u003e knockdown. The reduction in β-Catenin expression caused by \u003cem\u003eGSK3β\u003c/em\u003e knockdown was rescued by the knockdown of \u003cem\u003eGID\u003c/em\u003e genes, but not by the knockdown of \u003cem\u003eβTrCP\u003c/em\u003e genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Consistently, the increase in β-Catenin ubiquitination observed under \u003cem\u003eGSK3β\u003c/em\u003e knockdown was reversed by the suppression of \u003cem\u003eGID\u003c/em\u003e genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). In contrast, the knockdown of the \u003cem\u003eβTrCP\u003c/em\u003e genes did not restore the ubiquitination levels of β-Catenin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo further validate these findings, we analyzed the effects of GID or βTrCP genes knockout on β-Catenin expression and ubiquitination under \u003cem\u003eGSK3β\u003c/em\u003e knockdown conditions. In HEK293T cells, \u003cem\u003eMAEA\u003c/em\u003e and \u003cem\u003eRMND5A\u003c/em\u003e (\u003cem\u003eGID\u003c/em\u003e-KO) or \u003cem\u003eβTrCP\u003c/em\u003e (\u003cem\u003eβTrCP\u003c/em\u003e-KO) were knocked out by transient expression of respective target gRNAs along with Cas9-D10A mutant. Single-cell clones were isolated, and successful disruption of \u003cem\u003eMAEA\u003c/em\u003e, \u003cem\u003eRMND5A\u003c/em\u003e, and \u003cem\u003eβTrCP\u003c/em\u003e was confirmed by RT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Using these knockout clones, we analyzed β-Catenin expression and found that the reduction in β-Catenin expression caused by \u003cem\u003eGSK3β\u003c/em\u003e knockdown was rescued in \u003cem\u003eGID-\u003c/em\u003eKO cells, but not in \u003cem\u003eβTrCP\u003c/em\u003e-KO cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Moreover, β-Catenin ubiquitination levels were also restored by the knockout of GID genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003eNext, we examined the expression of Wnt target genes using these knockout clones yielded results consistent with those from siRNA experiments (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eE). Notably, \u003cem\u003ec-Jun\u003c/em\u003e induction was more enhanced in \u003cem\u003eGID\u003c/em\u003e-KO cells (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eE). As shown earlier, Wnt stimulation induced the expression of \u003cem\u003eAXIN2\u003c/em\u003e and \u003cem\u003ec-Jun\u003c/em\u003e, but this induction was suppressed by GSK3β siRNA treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Consistent with β-Catenin expression and ubiquitination data, Wnt target gene induction was not restore \u003cem\u003eβTrCP\u003c/em\u003e-KO cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). In contrast, in \u003cem\u003eGID\u003c/em\u003e-KO cells, Wnt target gene expression was markedly enhanced upon Wnt stimulation even in the presence of \u003cem\u003eGSK3β\u003c/em\u003e knockdown conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). These results indicate that the GID complex, but not βTrCP, is involved in the ubiquitination and degradation of β-Catenin upon \u003cem\u003eGSK3β\u003c/em\u003e suppression. Supporting this conclusion, \u003cem\u003eGSK3β\u003c/em\u003e knockdown increased the interaction between MAEA and β-Catenin, while the interaction between βTrCP and β-Catenin remained unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF, G).\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe GID complex targets both cytoplasmic and nuclear β-Catenin.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIt has been previously reported that the GID E3 ligase component MAEA is predominantly localized in the nucleus and targets nuclear transcription factors\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. To determine whether the GID complex targets cytoplasmic or nuclear β-Catenin upon \u003cem\u003eGSK3β\u003c/em\u003e knockdown, we performed subcellular fractionation. To confirm the validity of the subcellular fractionation, GAPDH was used as a cytoplasmic marker and PARP as a nuclear marker. We first examined the expression of β-Catenin in cytoplasmic and nuclear fractions following the knockdown of \u003cem\u003eGID\u003c/em\u003e genes. β-Catenin levels increased in both compartments, and this accumulation was further enhanced by Wnt stimulation compared to treatment with control medium (Fig. S2A). Similar result was obtained in \u003cem\u003eGID\u003c/em\u003e-KO cells (Fig. S2B). In contrast, suppression of \u003cem\u003eβTrCP\u003c/em\u003e genes led to β-Catenin accumulation only in the cytoplasm, with no apparent change in nuclear β-Catenin, at least during short-term Wnt stimulation (Fig. S2C).\u003c/p\u003e\u003cp\u003eTo further investigate the subcellular distribution of β-Catenin following \u003cem\u003eGSK3β\u003c/em\u003e knockdown, we examined β-Catenin expression in both cytoplasmic and nuclear fractions. Notably, GSK3β was predominantly localized in the cytoplasm, and the effect of GSK3β siRNA was observed only in the cytoplasmic fraction; non-specific bands were detected in the nuclear fraction (Fig. S2D). Despite this, β-Catenin levels were reduced in both the cytoplasmic and nuclear compartments upon \u003cem\u003eGSK3β\u003c/em\u003e knockdown, and this reduction was reversed by the treatment with the proteasome inhibitor MG132 (Fig. S2D). Consistently, \u003cem\u003eGSK3β\u003c/em\u003e knockdown led to an increase in β-Catenin ubiquitination in both fractions (Fig. S2E). These results suggest that even a modest reduction in nuclear GSK3β expression is sufficient to induce the degradation of nuclear β-Catenin. Knockdown of \u003cem\u003eGID\u003c/em\u003e genes restored β-Catenin levels in both compartments, whereas knockdown of \u003cem\u003eβTrCP\u003c/em\u003e genes had no effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Similar findings were obtained in \u003cem\u003eGID\u003c/em\u003e-KO and \u003cem\u003eβTrCP\u003c/em\u003e-KO cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe next examined the ubiquitination status of β-Catenin in these compartments. In \u003cem\u003eGID\u003c/em\u003e-KO cells, β-Catenin ubiquitination was reduced in both the cytoplasmic and nuclear fractions. In contrast, in \u003cem\u003eβTrCP\u003c/em\u003e-KO cells, a reduction in β-Catenin ubiquitination was observed only in the cytoplasmic fraction (Fig. S2F). Furthermore, the knockdown of \u003cem\u003eGSK3β\u003c/em\u003e led to increased β-Catenin ubiquitination in cytoplasm and nucleus, and this increase was substantially suppressed in \u003cem\u003eGID\u003c/em\u003e-KO cells, but not in \u003cem\u003eβTrCP\u003c/em\u003e-KO cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Additionally, we analyzed the interaction between MAEA and β-Catenin and found that \u003cem\u003eGSK3β\u003c/em\u003e knockdown enhanced their binding in both the cytoplasm and nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). These findings indicate that the GID complex mediates β-Catenin ubiquitination and degradation in both cytoplasmic and nuclear compartments upon \u003cem\u003eGSK3β\u003c/em\u003e knockdown.\u003c/p\u003e\u003cp\u003e\u003cb\u003eWnt stimulation enhances the interaction of GSK3β with GID E3 ligases and inhibits the binding of β-Catenin to the GID complex.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe next examined the interaction between GSK3β and the GID E3 ligase components MAEA and RMND5A. Co-immunoprecipitation assays revealed that both MAEA and RMND5A associated with GSK3β (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B). To investigate whether Wnt stimulation affects the interaction between GSK3β and the GID E3 ligases, we analyzed their binding under Wnt-treated conditions. The results showed that Wnt stimulation enhanced the interaction of GSK3β with both MAEA and RMND5A (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, D). Furthermore, Wnt stimulation reduced the interaction between MAEA and β-Catenin (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). These findings suggest that Wnt signaling promotes the association between GSK3β and the GID complex, thereby interfering with the binding between the GID complex and β-Catenin.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo determine whether Wnt stimulation can rescue β-Catenin degradation mediated by the GID complex under \u003cem\u003eGSK3β\u003c/em\u003e knockdown, we analyzed β-Catenin expression following Wnt treatment. Wnt stimulation increased β-Catenin levels and attenuated its degradation induced by GSK3β siRNA treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Additionally, Wnt stimulation suppressed β-Catenin ubiquitination, and this suppression was observed even under \u003cem\u003eGSK3β\u003c/em\u003e knockdown conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, the knockdown of \u003cem\u003eGSK3β\u003c/em\u003e enhances the interaction between MAEA and β-Catenin. In contrast, Wnt stimulation decreased the binding of MAEA to β-Catenin (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). These findings suggest that Wnt signaling antagonizes the MAEA\u0026ndash;β-Catenin interaction induced by \u003cem\u003eGSK3β\u003c/em\u003e knockdown, thereby contributing to β-Catenin stabilization. Indeed, our analysis revealed that Wnt treatment not only reduced the basal binding of β-Catenin to MAEA, and also suppressed the enhancement of this interaction caused by \u003cem\u003eGSK3β\u003c/em\u003e knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003e\u003cb\u003eWnt stimulation rescues GID-mediated β-Catenin degradation in both cytoplasmic and nuclear compartments following GSK3β knockdown.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe finally investigated whether Wnt stimulation could suppress the GID-mediated degradation of β-Catenin in the cytoplasm and nucleus that is induced by \u003cem\u003eGSK3β\u003c/em\u003e knockdown. As described earlier, knockdown of \u003cem\u003eGSK3β\u003c/em\u003e reduced β-Catenin levels in both cytoplasm and nucleus, and Wnt treatment restored β-Catenin expression in both compartments (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). We then examined the interaction of GSK3β with the E3 ligases MAEA and RMND5A in the cytoplasmic and nuclear fractions and found that both E3 ligases were associated with GSK3β in both compartments (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, C). Furthermore, Wnt stimulation enhanced the interaction between GSK3β and MAEA in both cytoplasm and nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB), whereas its effect on the GSK3β-RMND5A interaction was observed only in the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Analysis of the interaction between MAEA and β-Catenin revealed that Wnt treatment reduced their interaction in both cytoplasmic and nuclear fractions (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). These results suggest that Wnt signaling promotes the association of GSK3β with MAEA in both cytoplasmic and nuclear compartments, thereby interfering with the ability of MAEA E3 ligase to bind β-Catenin.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo examine whether Wnt stimulation could reversed the enhanced interaction between MAEA and β-Catenin caused by \u003cem\u003eGSK3β\u003c/em\u003e knockdown, we performed binding assays in both the cytoplasm and nucleus. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE, Wnt treatment suppressed the \u003cem\u003eGSK3β\u003c/em\u003e knockdown-induced increase in MAEA\u0026ndash;β-Catenin binding in both compartments. We also investigated β-Catenin ubiquitination and found that the increased ubiquitination observed in both compartments upon \u003cem\u003eGSK3β\u003c/em\u003e knockdown was attenuated by Wnt treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). Collectively, these results demonstrate that Wnt stimulation counteracts \u003cem\u003eGSK3β\u003c/em\u003e knockdown-induced GID-mediated degradation of β-Catenin in both the cytoplasm and nucleus.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn Wnt signaling, GSK3β phosphorylates β-Catenin within the destruction complex, promoting its ubiquitination by βTrCP and subsequent proteasomal degradation. Accordingly, inhibition of GSK3β is generally associated with β-Catenin stabilization and activation of Wnt signaling\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. However, in this study, we found that suppression of GSK3β expression led to a reduction in β-Catenin protein levels and inhibition of Wnt signaling. This reduction in β-Catenin levels caused by \u003cem\u003eGSK3β\u003c/em\u003e knockdown was rescued by treatment with a proteasome inhibitor (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), and RT-PCR analysis confirmed that β-Catenin mRNA levels remained unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), indicating that the reduction in β-Catenin expression by \u003cem\u003eGSK3β\u003c/em\u003e knockdown occurs at the post-translational level. Notably, suppression or knockout of \u003cem\u003eβTrCP\u003c/em\u003e did not restore β-Catenin levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-D), whereas suppression or knockout of \u003cem\u003eMAEA\u003c/em\u003e and \u003cem\u003eRMND5A\u003c/em\u003e, components of the GID complex, effectively rescued β-Catenin expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-D). Furthermore, we found that GSK3β interacts with these GID E3 ligases, and this interaction is enhanced by Wnt stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-D). Enhanced GSK3β\u0026ndash;GID association corresponded with reduced binding between MAEA and β-Catenin and a suppression of β-Catenin ubiquitination (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE and G). These findings suggest that GSK3β can inhibit β-Catenin degradation by binding to the GID complex and interfering with its interaction with β-Catenin.\u003c/p\u003e\u003cp\u003eIn our previous study, we proposed that WNK kinases similarly attenuate the ubiquitination of β-Catenin by interfering with its interaction with the GID complex in the Wnt signaling pathway\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Moreover, we also reported that GSK3β is bound to WNK kinases\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Based on these observations, we speculate that WNK kinases and GSK3β cooperatively regulate β-Catenin stability via the GID complex. Interestingly, Wnt stimulation enhanced the association between WNK kinases and MAEA, similar to the effects observed with GSK3β (Fig. S3A, B). Although Wnt stimulation did not affect the interaction between WNK1 and GSK3β, it did increase the binding between WNK4 and GSK3β (Fig. S3C, D). These results suggest that WNK4 may play a key role in the GID complex-mediated degradation of β-catenin in response to GSK3β suppression. However, further studies are needed to clarify the precise mechanisms involved.\u003c/p\u003e\u003cp\u003eAccumulating evidence has identified several E3 ligases that contribute to β-Catenin turnover through distinct regulatory mechanisms. Among them, Wnt-responsive E3 ligases such as Jade-1, c-Cbl and Mule have been reported to regulate β-Catenin degradation in a context-dependent manner\u003csup\u003e\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Notably, Jade-1 promotes β-Catenin degradation during the Wnt-off phase, whereas c-Cbl and Mule are involved in targeting β-Catenin under condition of active Wnt signaling. In the present study, we demonstrated that Wnt signaling inhibits β-Catenin ubiquitination and degradation mediated by the GID complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF and G). Therefore, similar to Jade-1 and βTrCP, the GID complex likely targets β-Catenin predominantly under Wnt-off conditions. However, the mechanism appears to differ from those of other E3 ligases. While E3 ligases such as βTrCP require active GSK3β for β-Catenin degradation, GID-mediated degradation instead depends on the reduction of GSK3β expression under Wnt-off conditions. These findings suggest that the contribution of each E3 ligase to β-Catenin turnover is modulated by the status of GSK3β\u0026mdash;its activity, localization, and expression level. Intriguingly, unlike other E3 ligases, overexpression of the EDD E3 ligase has been reported to stabilize β-catenin, promote its nuclear accumulation, and activate Wnt signaling in a manner dependent on GSK3β activity\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Furthermore, nuclear GSK3β itself has also been shown to activate Wnt signaling independently of β-Catenin degradation\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Collectively, these observations underscore the complex and multifaceted role of GSK3β in the regulation of Wnt signaling.\u003c/p\u003e\u003cp\u003eThe inhibition of GSK3β has been widely explored as a potential therapeutic strategy in various cancers\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Notably, recent studies have also reported that GSK3β inhibition is effective against tumors driven by mutant KRas\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. In such KRas-dependent tumors, apoptosis is induced via upregulation of β-Catenin expression. In contrast, tumors lacking KRas mutations do not exhibit increased β-Catenin levels or apoptosis upon GSK3β inhibition. In our study, however, suppression of GSK3β in non-cancerous HEK293T cells resulted in enhanced degradation of β-Catenin, rather than its stabilization. This discrepancy suggests that the presence or absence of KRas mutations may critically influence the cellular response to GSK3β inhibition. Further studies are needed to elucidate the molecular mechanisms underlying this context-dependent effect.\u003c/p\u003e\u003cp\u003eIn this study, suppression of GSK3β expression promoted the degradation of β-Catenin in both the cytoplasm and the nucleus. Recent studies have identified the lysine demethylases KDM2a and KDM2b as regulators of β-Catenin methylation\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. These enzymes demethylate nuclear β-Catenin, thereby facilitating its ubiquitination and subsequent degradation. In addition to nuclear regulation, membrane-associated β-Catenin subject to distinct control mechanisms. The E3 ubiquitin ligase Hakai regulates β-Catenin at the membrane in coordination with E-cadherin\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e, while the muscle-specific E3 ligase Ozz has also been implicated in β-Catenin degradation at the membrane compartment\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Together, these findings suggest that β-Catenin turnover is governed by multiple spatially distinct mechanisms. Elucidating the substrate specificity, subcellular localization, and regulatory mechanisms of the E3 ubiquitin ligases involved in β-Catenin degradation is crucial for understanding the fine-tuned control of Wnt signaling. Such insights may ultimately contribute to the development of targeted therapies for Wnt-related diseases.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cb\u003eCell culture and treatment\u003c/b\u003e\u003c/p\u003e\u003cp\u003eHEK293T cell was cultured in DMEM (Gibco, Waltham, MA, USA) containing 10% foetal bovine serum (FBS). The control and Wnt3a-conditioned medium (CM) were prepared from control or \u003cem\u003eWnt3a\u003c/em\u003e-expressing L cell, respectively. HEK293T cells were treated these medium for indicated time after transfection of plasmid or siRNA.\u003c/p\u003e\u003cp\u003e\u003cb\u003eAntibodies\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAnti-DDDDK, anti-Myc and anti-HA polyclonal antibodies were obtained from Medical \u0026amp; Biological Laboratories (Japan). Anti-GAPDH (5A12) monoclonal antibody was purchased from FUJIFILM Wako (Japan). Anti-GSK3βand Anti-β-Catenin monoclonal antibodies were obtained from BD Transduction Laboratories (Franklin Lakes, NJ, USA). Anti-Ub (P4G7) monoclonal antibody was obtained from COVANCE. Anti-PARP1 polyclonal antibody was purchased from Proteintech (Rosemont, IL, USA). For immunoprecipitation, Anti-β-Catenin (D10A8) monoclonal antibody (Cell Signaling Technology, Danvers, MA, USA), Anti-Myc monoclonal antibody (9B11, Cell Signaling Technology) and Anti-Flag (M2) monoclonal antibody (Sigma-Aldrich, St. Louis, MO, USA) were used at 1/500.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTransfection of expression vectors and siRNA\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFlag-GSK3β, Myc-β-Catenin, Flag-MAEA, Myc-MAEA, Flag-RMND5A, Myc-RMND5A, Flag-βTrCP, Myc-WNK1, HA-WNK1 and Myc-WNK4 in pRK5 were transfected with polyethyleneimine (Polysciences, Warrington, PA, USA) in cultured cells. We also performed transfection of siRNA using TransIT-X2 Dynamic Delivery System (Mirus Bio, Madison, WI, USA). siRNA target sequences were: MAEA 5\u0026prime;-ACGACUUUAUCAUCUUGAC-3\u0026prime; (NM_001017405.3 1135\u0026ndash;2753 bp), RMND5A 5\u0026prime;-UAUUUAACUCCACAAAUGG-3\u0026prime; (NM_022780.4 834\u0026ndash;852 bp), βTrCP 5\u0026prime;-AGAUUCUAUUGUCUCAAUG-3\u0026prime; (NM_001256856.2 772\u0026ndash;790 bp), FBXW11 5\u0026prime;-UCUUAAUAGAAUUAUCUCG-3\u0026prime; (NM_001378974.1 971\u0026ndash;989 bp) and GSK3β 5\u0026prime;-UUAAUACAGCAGUAUCAGG-3\u0026prime; (NM_001146156.2 1584\u0026ndash;1602 bp).\u003c/p\u003e\u003cp\u003e\u003cb\u003eReverse-transcription polymerase chain reaction (RT-PCR) analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTotal RNA was isolated using TRI Reagent (Molecular Research Center, Cincinnati, OH, USA). Double-strand cDNA was prepared from total RNA using oligonucleotide (dT), random primers and Moloney murine leukaemia virus reverse transcriptase (Invitrogen, Carlsbad, CA, USA). GAPDH was used to normalize the cDNA samples. The intensity of each band was quantified using ImageJ software. For quantification, the intensity of the GAPDH band was used to normalize each DNA signal. The sequences of the primer pairs for PCR were as follows: GAPDH 5\u0026rsquo;- GCCATCACTGCCACCCAGAAGACTG \u0026minus;\u0026thinsp;3\u0026prime; and 5\u0026rsquo;- CATGAGGTCCACCACCCTGTTGCTG \u0026minus;\u0026thinsp;3\u0026prime;, β-Catenin 5\u0026prime;- AAGACATCACTGAGCCTGCCATCTG-3\u0026prime; and 5\u0026prime;- TGGCTCCCTCAGCTTCAATAGCTTC-3\u0026prime;, βTrCP 5\u0026prime;- AGCGAATTCTCACAGGCCATACAGG-3\u0026prime; and 5\u0026prime;- GTCCCTGTACTGCAAACAGGCAATG-3\u0026prime;, FBXW11 5\u0026prime;- GCAGCGAGTGATCTCAGAAGGAATG-3\u0026prime; and 5\u0026prime;- GAACAGGTCACCATCAGTCCATTGC-3\u0026prime;, MAEA 5\u0026prime;- TCGAGCACCTCAAAGAGCATAGCAG-3\u0026prime; and 5\u0026prime;- GTTGTCGTACCGGAACTGCTGGATC-3\u0026prime;, RMND5A 5\u0026prime;- AGACATCCACAGCAGTGTTTCTCGG-3\u0026prime; and 5\u0026prime;- CACAGATATCAGCCCACTGGTTTGC-3\u0026prime;, GSK3β 5\u0026prime;- GCAGCAAGGTAACCACAGTAGTGGC-3\u0026prime; and 5\u0026prime;-TGGTGCCCTGTAGTACCGAGAACAG-3\u0026prime;, AXIN2 5\u0026prime;- ACAACAGCATTGTCTCCAAGCAGC-3\u0026prime; and 5\u0026prime;- GTCATGGACATGGAATCATCCGTC-3\u0026prime;, c-Jun 5\u0026prime;- AACCTCAGCAACTTCAACCC \u0026minus;\u0026thinsp;3\u0026prime; and 5\u0026prime;- ACCTGTTCCCTGAGCATGTT-3\u0026prime;,\u003c/p\u003e\u003cp\u003e\u003cb\u003eQuantitative real-time PCR\u003c/b\u003e\u003c/p\u003e\u003cp\u003eQuantitative PCR was performed using a 7300 Real-Time PCR Cycler (Applied Biosystems) and THUNDERBIRD SYBR qPCR Mix (TOYOBO, Japan). The primer sequences were as follows: GAPDH 5\u0026rsquo;-ATGACATCAAGAAGGTGGTG-3\u0026prime; and 5\u0026rsquo;-CATACCAGGAAATGAGCTTG-3\u0026prime;, AXIN2 5\u0026rsquo;-ATCAAGACGGTGCTTACCTGTTCCG-3\u0026prime; and 5\u0026rsquo;-CCTTCAGGTTCATCTGCCTGAATCC-3\u0026prime;, c-Jun 5\u0026rsquo;-GAAACGACCTTCTATGACGATGCCC-3\u0026prime; and 5\u0026rsquo;-GGTTCAGGGTCATGCTCTGTTTCAG-3\u0026rsquo;. GAPDH was used to normalize the cDNA samples.\u003c/p\u003e\u003cp\u003e\u003cb\u003eImmunoprecipitation and immunoblot analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCells were lysed with TNE buffer [10 mM Tris-HCl (pH 7.4), 0.1% NP-40, 150 mM NaCl, 1 mM EDTA, 1 mM DTT and protease inhibitor cocktail cOmplete (Roche, Switzerland)]. Lysates were pre-cleared with Protein A/G PLUS-agarose (Santa Cruz Biotechnology, Dallas, TX, USA) and immunoprecipitated with the indicated antibodies. For immunoblot analysis, cell lysates or immunoprecipitates were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene difluoride membranes (Merck Millipore, Germany). The membranes were probed with primary antibodies, followed by incubation with horseradish peroxidase-conjugated mouse or rabbit immunoglobulin G (GE Healthcare) and visualized using Immobilon Western (Merck Millipore). The protein bands were digitalized using the image analyzer LAS-4000 Mini (Fujifilm, Japan), and the intensity of each band was quantified using ImageJ software. For quantification, the intensity of the GAPDH or PARP band was used to normalize each protein signal.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGene knockout by CRISPR-Cas9\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFor gene knockout, pSpCas9n(BB)-2A-Puro (PX462) V2.0 vector was obtained from Addgene (Addgene plasmid # 62987, Cambridge, Massachusetts) and target sequences were cloned into PX462 vector following Zhang lab protocols. gRNA target sequences were: MAEA gRNA1: CCGGTCAATGTTCTTCTGAG and MAEA gRNA2: GACCAGCCACGTCACCATGG, RMND5A gRNA1: TCACCTCATTGAGAAGCCTT and RMND5A gRNA2: GTGGAGCACTTCTTTCGACA, βTrCP gRNA1: CACATAGTGATTTGGCATCC and βTrCP gRNA2: CTGAACTTGTGTGCAAGGAA. These gRNA1 and gRNA2 constructs were equally transfected into HEK293T cells using Lipofectamine 2000 reagent (Thermo Fisher Scientific, Waltham, Massachusetts) for 3 days. After transfection, cells were treated with puromycin (Nacalai Tesque, Japan) for selection, and the puromycin-resistance cells were plated in 96 well plate at the density of one cell per well. Single clones were collected and knockout of each gene was confirmed by RT-PCR using primer sets as described above.\u003c/p\u003e\u003cp\u003e\u003cb\u003eExtraction of cytoplasmic and nuclear fraction\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCytoplasmic and nuclear fractions of cultured cells were extracted using LysoPure(TM) Nuclear and Cytoplasmic Extractor Kit (FUJIFILM Wako). Only cytoplasmic fraction was diluted 10 times with TNE buffer for immunoblotting and immunoprecipitation. GAPDH was used as a cytoplasmic marker and PARP was used as a nuclear marker.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eConflict of interest\u003c/h2\u003e\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e\u003cp\u003eM.S. and H.S. designed the study, analyzed the data, and wrote the manuscript. M.S. performed the all experiments. M.S. and H.S. discussed the data.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e\u003cp\u003eThis work was supported by Grants-in-Aid for scientific research (C) from the Ministry of Education, Science, Sports and Culture of Japan (MEXT/JSPS KAKEN Grant Number 24K10280) and Nanken-Kyoten, Science Tokyo.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e\u003cp\u003eThe data are available from the corresponding author upon request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSteinhart, Z. \u0026amp; Angers, S. Wnt signaling in development and tissue homeostasis. \u003cem\u003eDevelopment\u003c/em\u003e \u003cstrong\u003e145\u003c/strong\u003e, 1\u0026ndash;8 (2018).\u003c/li\u003e\n\u003cli\u003eMajidinia, M., Aghazadeh, J., Jahanban-Esfahlani, R. \u0026amp; Yousefi, B. The roles of Wnt/\u0026beta;-catenin pathway in tissue development and regenerative medicine. \u003cem\u003eJ. Cell. Physiol.\u003c/em\u003e \u003cstrong\u003e233\u003c/strong\u003e, 5598\u0026ndash;5612 (2018).\u003c/li\u003e\n\u003cli\u003eMacDonald, B. T., Tamai, K. \u0026amp; He, X. Wnt/\u0026beta;-Catenin Signaling: Components, Mechanisms, and Diseases. \u003cem\u003eDev. Cell\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 9\u0026ndash;26 (2009).\u003c/li\u003e\n\u003cli\u003eClevers, H. \u0026amp; Nusse, R. Wnt/\u0026beta;-catenin signaling and disease. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e149\u003c/strong\u003e, 1192\u0026ndash;1205 (2012).\u003c/li\u003e\n\u003cli\u003eWinston, J. T. \u003cem\u003eet al.\u003c/em\u003e Erratum: The SCF(\u0026beta;-TRCP)-ubiquitin ligase complex associates specifically with phosphorylated destruction motifs in I\u0026kappa;b\u0026alpha; and \u0026beta;-catenin and stimulates I\u0026kappa;b\u0026alpha; ubiquitination in vitro (Genes and Development (1999) 17 (270-283)). \u003cem\u003eGenes Dev.\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1050 (1999).\u003c/li\u003e\n\u003cli\u003eDimitrova, Y. N. \u003cem\u003eet al.\u003c/em\u003e Direct ubiquitination of \u0026beta;-catenin by Siah-1 and regulation by the exchange factor TBL1. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cstrong\u003e285\u003c/strong\u003e, 13507\u0026ndash;13516 (2010).\u003c/li\u003e\n\u003cli\u003eQu, Y. \u003cem\u003eet al.\u003c/em\u003e Axitinib blocks Wnt/\u0026beta;-catenin signaling and directs asymmetric cell division in cancer. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e113\u003c/strong\u003e, 9339\u0026ndash;9344 (2016).\u003c/li\u003e\n\u003cli\u003eSophie Mokas, J. R. M. \u003cem\u003eet al.\u003c/em\u003e The Yeast GID Complex, a Novel Ubiquitin Ligase (E3) Involved in the Regulation of Carbohydrate Metabolism. \u003cem\u003eMol. Biol. Cell\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 2673\u0026ndash;2683 (2009).\u003c/li\u003e\n\u003cli\u003eFrancis, O., Han, F. \u0026amp; Adams, J. C. Molecular Phylogeny of a RING E3 Ubiquitin Ligase, Conserved in Eukaryotic Cells and Dominated by Homologous Components, the Muskelin/RanBPM/CTLH Complex. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, (2013).\u003c/li\u003e\n\u003cli\u003eSherpa, D., Chrustowicz, J. \u0026amp; Schulman, B. A. How the ends signal the end: Regulation by E3 ubiquitin ligases recognizing protein termini. \u003cem\u003eMol. Cell\u003c/em\u003e \u003cstrong\u003e82\u003c/strong\u003e, 1424\u0026ndash;1438 (2022).\u003c/li\u003e\n\u003cli\u003eMaitland, M. E. R., Lajoie, G. A., Shaw, G. S. \u0026amp; Schild-Poulter, C. Structural and Functional Insights into GID/CTLH E3 Ligase Complexes. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, (2022).\u003c/li\u003e\n\u003cli\u003eMohamed, W. I. \u003cem\u003eet al.\u003c/em\u003e The human GID complex engages two independent modules for substrate recruitment. \u003cem\u003eEMBO Rep.\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 1\u0026ndash;15 (2021).\u003c/li\u003e\n\u003cli\u003eLampert, F. \u003cem\u003eet al.\u003c/em\u003e The multi-subunit GID/CTLH e3 ubiquitin ligase promotes cell proliferation and targets the transcription factor Hbp1 for degradation. \u003cem\u003eElife\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1\u0026ndash;23 (2018).\u003c/li\u003e\n\u003cli\u003eMaitland, M. E. R. \u003cem\u003eet al.\u003c/em\u003e The mammalian CTLH complex is an E3 ubiquitin ligase that targets its subunit muskelin for degradation. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 1\u0026ndash;14 (2019).\u003c/li\u003e\n\u003cli\u003eZhen, R. \u003cem\u003eet al.\u003c/em\u003e Wdr26 regulates nuclear condensation in developing erythroblasts. \u003cem\u003eBlood\u003c/em\u003e \u003cstrong\u003e135\u003c/strong\u003e, 208\u0026ndash;219 (2020).\u003c/li\u003e\n\u003cli\u003eMaitland, M. E. R., Kuljanin, M., Wang, X., Lajoie, G. A. \u0026amp; Schild-Poulter, C. Proteomic analysis of ubiquitination substrates reveals a CTLH E3 ligase complex-dependent regulation of glycolysis. \u003cem\u003eFASEB J.\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 1\u0026ndash;16 (2021).\u003c/li\u003e\n\u003cli\u003eSato, A. \u003cem\u003eet al.\u003c/em\u003e WNK regulates Wnt signalling and \u0026beta;-Catenin levels by interfering with the interaction between \u0026beta;-Catenin and GID. \u003cem\u003eCommun. Biol.\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 1\u0026ndash;10 (2020).\u003c/li\u003e\n\u003cli\u003eSato, A. \u0026amp; Shibuya, H. Glycogen synthase kinase 3\u0026szlig; functions as a positive effector in the WNK signaling pathway. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1\u0026ndash;11 (2018).\u003c/li\u003e\n\u003cli\u003eLaw, S. M. \u0026amp; Zheng, J. J. Premise and peril of Wnt signaling activation through GSK-3\u0026beta; inhibition. \u003cem\u003eiScience\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 104159 (2022).\u003c/li\u003e\n\u003cli\u003eLiu, J. \u003cem\u003eet al.\u003c/em\u003e Wnt/\u0026beta;-catenin signalling: function, biological mechanisms, and therapeutic opportunities. \u003cem\u003eSignal Transduct. Target. Ther.\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, (2022).\u003c/li\u003e\n\u003cli\u003eKobayashi, N. \u003cem\u003eet al.\u003c/em\u003e RanBPM, Muskelin, p48EMLP, p44CTLH, and the armadillo-repeat proteins ARMC8\u0026alpha; and ARMC8\u0026beta; are components of the CTLH complex. \u003cem\u003eGene\u003c/em\u003e \u003cstrong\u003e396\u003c/strong\u003e, 236\u0026ndash;247 (2007).\u003c/li\u003e\n\u003cli\u003eChitalia, V. C. \u003cem\u003eet al.\u003c/em\u003e Jade-1 inhibits Wnt signalling by ubiquitylating \u0026beta;-catenin and mediates Wnt pathway inhibition by pVHL. \u003cem\u003eNat. Cell Biol.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 1208\u0026ndash;1216 (2008).\u003c/li\u003e\n\u003cli\u003eChitalia, V. \u003cem\u003eet al.\u003c/em\u003e C-Cbl, a ubiquitin E3 ligase that targets active \u0026beta;-Catenin: A novel layer of Wnt signaling regulation. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cstrong\u003e288\u003c/strong\u003e, 23505\u0026ndash;23517 (2013).\u003c/li\u003e\n\u003cli\u003eDominguez-Brauer, C. \u003cem\u003eet al.\u003c/em\u003e E3 ubiquitin ligase Mule targets \u0026beta;-catenin under conditions of hyperactive Wnt signaling. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e114\u003c/strong\u003e, E1148\u0026ndash;E1157 (2017).\u003c/li\u003e\n\u003cli\u003eHay-Koren, A., Caspi, M., Zilberberg, A. \u0026amp; Rosin-Arbesfeld, R. The EDD E3 ubiquitin ligase ubiquitinates and up-regulates \u0026beta;-catenin. \u003cem\u003eMol. Biol. Cell\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 399\u0026ndash;411 (2011).\u003c/li\u003e\n\u003cli\u003eCaspi, M., Zilberberg, A., Eldar-Finkelman, H. \u0026amp; Rosin-Arbesfeld, R. Nuclear GSK-3\u0026beta; inhibits the canonical Wnt signalling pathway in a \u0026beta;-catenin phosphorylation-independent manner. \u003cem\u003eOncogene\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 3546\u0026ndash;3555 (2008).\u003c/li\u003e\n\u003cli\u003eThapa, R. \u003cem\u003eet al.\u003c/em\u003e A review of Glycogen Synthase Kinase-3 (GSK3) inhibitors for cancers therapies. \u003cem\u003eInt. J. Biol. Macromol.\u003c/em\u003e \u003cstrong\u003e253\u003c/strong\u003e, 127375 (2023).\u003c/li\u003e\n\u003cli\u003eKazi, A. \u003cem\u003eet al.\u003c/em\u003e GSK3 suppression upregulates \u0026beta;-catenin and c-Myc to abrogate KRas-dependent tumors. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 1\u0026ndash;9 (2018).\u003c/li\u003e\n\u003cli\u003eLu, L. \u003cem\u003eet al.\u003c/em\u003e Kdm2a/b Lysine Demethylases Regulate Canonical Wnt Signaling by Modulating the Stability of Nuclear \u0026beta;-Catenin. \u003cem\u003eDev. Cell\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 660\u0026ndash;674 (2015).\u003c/li\u003e\n\u003cli\u003eFujita, Y. \u003cem\u003eet al.\u003c/em\u003e Hakai, a c-Cbl-like protein, ubiquitinates and induces endocytosis of the E-cadherin complex. \u003cem\u003eNat. Cell Biol.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 222\u0026ndash;231 (2002).\u003c/li\u003e\n\u003cli\u003eNastasi, T. \u003cem\u003eet al.\u003c/em\u003e Ozz-E3, a muscle-specific ubiquitin ligase, regulates \u0026beta;-catenin degradation during myogenesis. \u003cem\u003eDev. Cell\u003c/em\u003e\u003cstrong\u003e6\u003c/strong\u003e, 269\u0026ndash;282 (2004).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7182831/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7182831/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe canonical Wnt signaling pathway plays a pivotal role in regulating cell proliferation, differentiation, and tissue homeostasis. These functions are largely regulated through the degradation of β-Catenin. Under Wnt-off conditions, β-Catenin is phosphorylated by the destruction complex, including GSK3β, and subsequently ubiquitinated by the E3 ligase βTrCP, leading to proteasomal degradation. In this study, we identified a regulatory mechanism in which suppression of GSK3β promotes β-Catenin degradation via the GID complex, a conserved multi-subunit E3 ubiquitin ligase. GSK3β knockdown increased β-Catenin ubiquitination and decreased its protein levels in both the cytoplasm and nucleus, independent of βTrCP. This degradation was rescued by knockdown of GID components MAEA and RMND5A, but not by suppression of βTrCP. Furthermore, Wnt stimulation promoted the interaction between GSK3β and the GID E3 ligases, disrupting the association between MAEA and β-Catenin and thereby stabilizing β-Catenin. Together, these findings reveal a GSK3β-dependent mechanism of β-Catenin regulation mediated by the GID complex.\u003c/p\u003e","manuscriptTitle":"GSK3β regulates a novel β-Catenin degradation pathway via the GID complex in Wnt signaling.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-05 11:50:14","doi":"10.21203/rs.3.rs-7182831/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7b852bf2-26fa-4fc8-943d-2a1f069257e8","owner":[],"postedDate":"August 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":52568172,"name":"Biological sciences/Cell biology/Cell signalling/Growth factor signalling"},{"id":52568173,"name":"Biological sciences/Cell biology/Proteolysis/Ubiquitin ligases"}],"tags":[],"updatedAt":"2025-09-12T04:50:26+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-05 11:50:14","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7182831","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7182831","identity":"rs-7182831","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.