Identification of differential pathogenic mechanisms between chronic rhinosinusitis with nasal polyps and odontogenic sinusitis using the PrimeView™ Human Gene Expression Array

Identification of differential pathogenic mechanisms between chronic rhinosinusitis with nasal polyps and odontogenic sinusitis using the PrimeView™ Human Gene Expression Array | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification of differential pathogenic mechanisms between chronic rhinosinusitis with nasal polyps and odontogenic sinusitis using the PrimeView™ Human Gene Expression Array Lin Wei 林炜, Zhu Jianhua 朱建华, Yuan Wenwen 袁雯雯, Feng Junlin 冯俊林 This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7229477/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objectives: To explore mucosal tissue gene expression and pathway differences between chronic rhinosinusitis with nasal polyps (CRSwNP) and odontogenic sinusitis (OS) using the PrimeView™ Human Gene Expression Array to identify the different molecular genetic pathways associated with the development of these two diseases. Materials and methods: According to the “Guidelines for the Diagnosis and Treatment of Chronic Rhinosinusitis (Kunming, 2012)”and “European Rhinology Diagnostic Tools Position Paper 2019”, 12 patients with CRSwNP and OS (6 with CRSwNP and 6 with OS) were screened for surgery. The Prime View TM Human Gene Expression Array was hybridized with the RNA lysate. CRSwNP- and OS-specific differentially expressed genes (DEGs) with a more than 2-fold change in expression were considered significant and subjected to GO and pathway enrichment analyses. The top-ranked up- and downregulated DEGs were selected and used to explore the molecular mechanisms of disease development via a literature analysis. Results: A total of 1037 DEGs, including 168 upregulated genes and 869 downregulated genes, were detected in CRSwNP vs. OS. The top 10 hub genes, MAPK14, ACTB, GNAI, CXCR1, CXCR2, JAK, CXCL1, CXCL8, CCR1 and CCR2, were downregulated. Conclusions: Bioinformatics analysis of genome-wide expression revealed that CRSwNP is an eosinophil-associated TH2-type, immune-related and infection-related disease. OS is an infectious immune disease related to neutrophil enrichment. Clinical relevance: This study provides a theoretical foundation for the differential diagnosis of CRSwNP and OS by dentists and otolaryngologists. Chronic Rhinosinusitis with Nasal Polyps (CRSwNP) Odontogenic Sinusitis (OS) GeneChip PrimeView™ Human Gene Expression Array Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction The prevalence of chronic maxillary sinusitis among adults is 8% in China, 7–27% in Europe, and 14% in the United States [ 1 , 2 ]. The clinical symptoms include nasal congestion, nasal leakage (from both anterior and posterior nostrils), headache, altered taste, loss of taste, memory changes, olfactory loss and even anosmia, which severely affects daily life and work and increases health care costs [ 3 , 4 ]. Chronic rhinosinusitis can be divided into chronic rhinosinusitis with polyps (CRSwNP) and chronic rhinosinusitis without polyps (CRSsNP). CRSwNP is often refractory or recurrent and is frequently misdiagnosed in a significant percentage of patients with odontogenic maxillary sinusitis (OS) [ 5 ]. With the increased use of implant dentures, the incidence of odontogenic sinusitis is further increasing [ 6 ]. There are several regional consensuses regarding the differential diagnosis and treatment of CRSwNP and OS, but global guidelines have not yet been developed, which makes the diagnosis and treatment of CRSwNP and OS often confusing [ 7 , 8 ]. CRSwNP is a genetic predisposition that has been recognized by many experts. The pathogenesis of chronic rhinosinusitis has been reported in the literature as the up- or downregulation of related genes [ 9 , 10 ]. Odontogenic maxillary sinusitis is thought to be the result of odontogenic factors, which disrupts the integration of the Schneider membrane [ 11 ]. The specific molecular mechanisms underlying these two diseases have not been reported. In the present study, we analyzed the molecular mechanisms of chronic rhinosinusitis and odontogenic maxillary sinusitis by using the PrimeView™ Human Gene Expression Array, exploiting gene and pathway differences between CRSwNP and OS to identify differences in the molecular mechanisms involved. Methods Sample collection For CRSwNP patients, the uncinate process was excised. The maxillary ostium was enlarged, and the mucosal tissue of the diseased maxillary sinus was endoscopically resected. The samples were placed in a sterile frozen storage tube and transferred to -80°C in liquid nitrogen within 5 minutes. For OS patients, access to diseased tissue was obtained using the alveolar ridge-antral route, by exposing the floor of the maxillary sinus, or in combination with nasal endoscopy. Total RNA isolation Liquid nitrogen-preserved samples were thawed, TRIzol (from QIAGEN, Germany) was used for lysis, and isopropanol (from Shanghai Pharmaceutical Group) was used to remove protein contaminants according to the manufacturer’s instructions. QIAGEN RNase-free DNaseI (QIAGEN21704, 79254, GmBH, German) was used to digest the DNA, and the RNA solution was obtained by centrifugation. (15minutes at 12000 х g, 4℃), The RNA concentration was measured using an SMA3000 spectrophotometer (Meriton, Beijing), and the RNA was stored at -80°C. RNA quality control and cRNA synthesis A SMA3000 spectrophotometer (Beijing, Meriton, Wavelength 200-750nm, Measurement range: 2–3700 ng/ul (dsDNA)) was used to measure the concentration and saturation of the RNA solution. A Bio-Rad (USA) electrophoresis apparatus and a JS-380A gel imaging system (Shanghai Peking Technology Co., Ltd.) were used to evaluate the integrity of the 18S and 28S RNA. The quality control results revealed that 12 samples met the requirements for RNA liquid chip hybridization (Table 1 ). In accordance with the 3' IVT PLUS reagent instructions, cDNA first and second strands were synthesized in vitro, the cRNA mixture was synthesized and purified, and fragmentation was performed using 3' fragmentation buffer [ 12 , 13 ]. Table 1 OS CRSwNP RNA QC results Sample number Lab number Name Focusing (ng/µl) 260/280 Volume (µl) Total (µg) Result 1 HT2Q2110130 1 Black3 829.4 2.04 40 33.18 B 2 HT2Q2110130 2 Black4 494.3 2.04 40 19.77 B 3 HT2Q2110130 3 Black5 258.4 2.00 40 10.34 B 4 HT2Q2110130 4 Black7 186.3 1.99 40 7.45 B 5 HT2Q2110130 5 Black8 729.1 1.86 40 31.68 B 7 HT2Q2110130 7 Green3 200.6 2.01 20 4.01 B 8 HT2Q2110130 8 Green4 492.3 1.91 20 9.85 B 9 HT2Q2110130 9 Green8 385.0 1.86 20 7.70 D 1 HT2Q2110260 1 Black2 341 2.08 40 13.64 B 2 HT2Q2110260 2 Red1 388 2.05 140 54.32 B 4 HT2Q2110260 4 Green5 542.1 2.11 40 21.68 B 5 HT2Q2110260 5 Green7 401.8 2.08 140 56.25 B Notes: OS: odontogenic sinusitis, CRSwNP: chronic rhinosinusitis with nasal polyps, RNA QC: RNA quality control, Sample number: The serial number of the sample stored at -80℃. Lab number: The serial number assigned after the sample control is completed. Name: The serial number for sample collection during the surgery. Focusing (ng/ul): The concentration of RNA used for electrophoresis in agarose gel (ng/ul). 260/280: The purity of RNA detected by ultraviolet spectrophotometer. Volume (ug): The volume of RNA extracted from the sample. Total: The quality of RNA extracted from the sample. Result: The classification of RNA quality control assessment, B is good, D is qualified. Black represents the CRSwNP group, while green and red represent the OS group. This table was originally created by the corresponding author and was first cited in the author’s unpublished master’s thesis. The copyright belongs to the author. Data is available from the corresponding author. Microarray hybridization and data preprocessing Total RNA was extracted from liquid nitrogen-preserved samples using TRIzol reagent (Life Technologies, Carlsbad, CA, USA) and purified with a RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Biotinylated cDNA was prepared from 150 ng of total RNA using the Ambion® WT Expression Kit according to the standard Affymetrix protocol. Following labeling, the fragmented cDNA was hybridized for 16 hr. at 45°C on a PrimeView human chip (Affymetrix Clariom S Array reservation, CA, USA). GeneChips were washed and stained with the Affymetrix Fluidics Station 450. All arrays were scanned using the Affymetrix® GeneChip Command Console (AGCC), which was installed in the GeneChip® Scanner 3000 7G. The data were analyzed with the Robust Multichip Analysis (RMA) algorithm using Affymetrix default analysis settings and global scaling as a normalization method. The values presented are log 2 RMA signal intensities [ 14 – 16 ]. Quantitative real-time RT‒PCR For real-time PCR (qPCR), total RNA was isolated from cells using TRIzol reagent (Life Technologies, Carlsbad, CA, USA) and then transcribed to cDNA using a reverse transcription kit (Takara, Dalian, Liaoning, China). Quantitative PCR was performed in technical triplicates using SYBR Green reagent (Bio-Rad, Hercules, CA, USA). The expression levels were calculated using the 2 –∆∆Ct method, with the Ct values normalized to those of GAPDH, which was used as an internal control. The primers used are listed in Table 2 . The key node genes JAK1, CXCR1, MAPK, NOS2, and JUN were selected from the global signal transduction network diagram based on their in-degree and out-degree. Table 2 Primer DNA sequence design Gene Gene ID Primer sequence (5ʹ to 3ʹ) Size (bp) Annealing temperature (°C) JUN_F Hs696684 TCCAAGTGCCGAAAAAGGAAG 78 60 JUN_R Hs 696684 CGAGTTCTGAGCTTTCAAGGT 78 60 MAPK14_F Hs 485333 TCAGTCCATCATTCATGCGAAA 91 60 MAPK14_R Hs 485233 AACGTCCAACAGACCAATCAC 981 60 NOS2_F Hs 709191 AGGGACAAGCCTACCCCTC 168 60 NOS2_R Hs 709191 CTCATCATCCCGTCAGTTGGT 168 60 JAK1_F Hs 207538 CTTTGCCCTGTATGACGAGAAC 101 60 JAK1_R Hs 207538 ACCTCATCCGGTAGTGGAGC 101 60 CXCR1_F Hs 194778 CTGACCCAGAAGCGTCACTTG 139 60 CXCR1_R Hs 194778 CCAGGACCTCATAGCAAACTG 139 60 Notes: The reaction system was composed of the following: 2 × S6 Universal SYBR qPCR Mix, 5 µL; Primer-F (10 µM), 0.2 µL; Primer-R (10 µM), 0.2 µL; cDNA template, 1 µL; RNase-free ddH₂O to 10µL. The reaction system was placed in the quantitative PCR instrument (ABI 7900HT fluorescence), and the reaction was performed under specific conditions. Primer3.0 software was used for assistance in primer design. The gene sequences were retrieved from a database ( http://www.nici.nini.mih.gov/web/genebank ). This table was originally created by the corresponding author and was first cited in the author’s unpublished master’s thesis. The copyright belongs to the author. Data are available from the corresponding author. Statistical analysis The statistical analysis was conducted using R software (version 3.5.1). The R package Limma (version 3.36.5) was utilized for the differential expression analysis. The statistical methods employed for the differential chip analysis included trimmed mean of M-values (TMM). For gene chip standardization, the method employed was the Transcriptome Analysis Console (TAC4.0), and the robust multichip analysis algorithm used was log2(RMA signal). The differential expression analysis involved Student's test and one-way NOVA. It is imperative to note that all enrichment results were analyzed via Fisher's exact test. Nonparametric tests were employed for data that did not adhere to a normal distribution. Statistically significant differences were those with a p value less than 0.05. The Benjamini‒Hochberg method was used for correction (FDR). Results Differential gene expression analysis To verify the existence of differentially expressed genes, we first screened differentially expressed genes and performed functional enrichment analysis. A total of 49,372 genes were detected in comparisons of the six groups of CRSwNP and OS samples for differentially expressed mRNA screening. There were 1,037 differentially expressed genes (DEGs) with a fold change greater than 1.5, including 168 upregulated genes and 869 downregulated genes. Differences with a LogFC (fold change) greater than 1.5 and a P value less than 0.01 were considered statistically significant (Figs. 1 and 2 ). Functional enrichment analysis The differentially expressed genes were annotated for their gene functions based on the GO database, and all the functions related to the genes were obtained. The top 10 up- or downregulated functional genes obtained from the enrichment analysis are presented in the form of a bar chart. The upregulated genes were enriched mainly in salivary gland cell development and maturation and epithelial cell differentiation and maturation (P < 0.01, FDR < 0.05) (Fig. 3 ). The downregulated genes were enriched mainly in neutrophil degradation and the inflammatory response. This mainly reflects the reconstruction associated with the membrane epithelium, differentiation and mutation accompanying membrane vesicles (P < 0.01, FDR < 0.05) (Fig. 4 ). Pathway analysis of the screened genes To understand the interaction among the differentially expressed genes; the genes were annotated based on the KEGG database to reveal related signaling pathways (Pathway Annotation). The top ten upregulated pathways included glutamatergic synapse, leishmaniasis, salivary gland secretion, depression, long-term effects, cocaine addiction, vascular smooth muscle contraction, asthma, rheumatoid arthritis, and cytochrome P450 drug metabolism. These pathways are related primarily to intracellular signal transduction under environmental stress and high expression of intercellular signals in the nervous system (P < 0.01, FDR < 0.05) (Fig. 5 ). The top ten downregulated pathways included apoptosis, leishmaniasis, tuberculosis, Staphylococcus aureus infection, rheumatoid arthritis, lysosomes, chemokine signaling pathways, exogenous antigen processing and presentation, and FC-γ R-mediated apoptosis (P < 0.01, FDR < 0.05). These include mainly exogenous infections, the release of inflammatory factors, microbial clearance, and autoimmune processes (Fig. 6 ). Global signal transduction network To visualize the interactions between genes and facilitate the selection of hub genes for subsequent research, a gene‒gene interaction network (global signal transduction network) was constructed based on the data of the DEGs. The genes were categorized as in-degree, out-degree, or degree. A higher degree indicated that the gene exhibited a strong correlation with other genes, implying a more important role in the signal transduction network. (Fig. 7 ). The 136 nodes in network graphs were the dominating genes, and the 430 edges represent the relationship types (including the activation or phosphorylation) between signals. The degree is denoted by the number of links from one node to others. Genes with higher degrees mean they have a more crucial position in the network. Thus, signal transduction network analysis is a method for identifying the key hub genes that potently modulate other genes. RT‒qPCR To verify the differentially expressed genes obtained from the gene chip, RT-qPCR was performed. The selected key node genes JUN, NOS2, MAPK14, and JAK1 from the PPI network were subjected to RT‒qPCR experiments on the same RNA samples used for microarray analysis. The results confirmed the upregulation of the JUN and NOS2 genes, while MAPK14 presented similar expression levels, and JAK1 presented results opposite those of the gene detection results (Fig. 8 ). Discussion In the introduction, we summarized the current research status on the pathogenesis of OS and CRSwNP. We found that there is very little evidence in the existing literature regarding the pathogenesis of these two diseases. The reasons for this are complex. It might be because these two diseases are prevalent in clinical practice, and the occurrence of serious complications and sequelae is relatively rare. However, in fact, the misdiagnosis and mistreatment of these two diseases is very common, prolonging the healing process, causing patients to incur large amounts of time and financial costs. Thus, it is important to discuss the different molecular mechanisms at the genetic level and explore the reasons for the misdiagnosis of OS and CRSwNP. Reasons for misdiagnosis of OS and CRSwNP In clinical practice, the differential diagnosis of CRSwNP and OS is controversial in patients who have undergone reoperation after endoscopic sinus surgery [ 17 ]. This is due to the following reasons: ① Due to the anatomical proximity between the tooth apex and the floor of the maxillary sinus, OS may present early with subtle clinical symptoms due to the drainage of the maxillary sinus [ 18 ]. ② In the late stage of OS, the diseased tissue occupies the maxillary sinus, spreads to the adjacent globus pallidus, middle turbinate, sieve sinus, pterygoid sinus, frontal sinus and contralateral maxillary sinus; and blocks the natural drainage port of the maxillary sinus, resulting in almost the same clinical symptoms as those observed in CRSwNP [ 19 ]. ③ in some cases, the diagnosis of OS itself is difficult, and the symptoms and signs disappear naturally or take a chronic course. In some patients with OS, maxillary sinus lesions disappear after ESS, which can inadvertently mislead otolaryngologists in the diagnosis of OS [ 20 ]. ④ Multidisciplinary diagnostic and therapeutic approaches in dentistry, otolaryngology and departmental radiology have not yet been promoted and popularized [ 7 , 8 ]. ⑤ According to the results of Prof. Wilhelm Bauer's study, odontogenic microorganisms can enter the maxillary sinus through the bone marrow, blood vessels, and lymphatic system. The exclusion of OS in differential diagnosis cannot be dependent on the presence or absence of a bone barrier [ 11 ]. ⑥ In the guidelines for the diagnosis and management of chronic rhinosinusitis, CT descriptions are limited to changes in the sinonasal complex and inflammatory changes in the sinus mucosa and do not depict the floor of the maxillary sinus or the focal tooth, which may be the main reason for the misdiagnosis of odontogenic maxillary sinusitis [ 21 , 22 ]. The forthcoming updates to the CRSwNP diagnosis guidelines, are expected to include detailed descriptions of the maxillary sinus floor and dentition [ 7 ]. JUN and NOS2, which were verified by RT–qPCR, were among the top 10 downregulated hub genes; The pathways enriched in upregulated and downregulated genes were further assessed, and their potential roles in the pathogenesis of the diseases of interest were discussed in the context of the literature, Mechanism of action of JUN and NOS2 in CRSwNP pathogenesis In this study, the genes JUN and NOS2 were significantly upregulated in CRSwNP compared to OS, which was confirmed by RT‒Qpcr. The Jun gene, located on human chromosome 1 in the p32-p31 region, has been implicated in malignant gene translocations and deletions. c-JUN forms a dimeric complex with activator protein-1 A (AP1), c-JUN, and c-FOS [ 23 ]. In the nucleus, it regulates p53, p19, p21, p16, and the cell cycle. c-JUN is a growth factor peptide, cyclind1, which is phosphorylated at the N-terminal amino acid (JNK) [ 24 ]. JNK is affected by various factors, including the growth factor cyclind1, other growth factor peptides, proinflammatory factors, oxidation, environmental stress, and UV light [ 25 ]. The JNK pathway is one of three parallel mitogen-activated protein kinase (MAPK) pathways (ERK, JNK/SAPK, P38/MAPK), and TGFβ regulates JNK expression and function by interacting with the downstream MAPK pathway [ 26 ]. TGF-β promotes the differentiation of fibroblasts into myofibroblasts, which are a major source of extracellular matrix proteins. Although the precise mechanism underlying nasal polyp formation is not fully understood, myofibroblasts and the extracellular matrix are thought to play pivotal roles in maxillary sinus polyp formation [ 27 ]. Selective JNK blockers have recently received FDA approval for use in treating autoimmune diseases, rheumatoid diseases, renal tumors, enteritis, and intestinal polyp diseases [ 25 ]. In the present study, both JNK and TGF-β were highly expressed in both the experimental and control groups; however, the experimental group presented significantly higher expression levels than did the control group. Downregulated gene analysis Functions of the top ten downregulated genes in OSPPI. The top 10 downregulated hub genes were MAPK14, MYD88, TLR4, JAK, CXCL1, CXCL8, CXCR1, CXCR2, CCR1, and CCR2 (Fig. 4 ). MAPK14, a mitogen-activated protein kinase, has been shown to activate serine/threonine kinases, thereby regulating stress responses and cell cycle adjustments that are involved in cell survival and apoptosis, autophagy, cell proliferation, differentiation, mobility, maintenance of mRNA stability, and determining the type of cellular differentiation in inflammatory responses [ 28 ]. MyD88, a protein that functions as an intracellular signal transduction molecule, is a component of the host innate immune system. It has been identified as a molecular target for the treatment of chronic inflammation and for antiviral and tumor induction therapies [ 29 ]. Toll-like receptor 4 (TLR4) is a member of the TLR family, and it plays a central role in extracellular signaling in the cell by binding to IL1 and initiating the downstream MyD88 and TRIF pathways. A few drugs targeting TLR4 have been developed for their anti-infection, antitumor, and apoptosis induction properties [ 30 ]. The JAK and STAT pathways involve transmembrane proteins that integrate extracellular signals into the nucleus and are involved in cell division, proliferation, death, the immune response, and tumorigenesis [ 31 ]. Preclinical studies have shown that targeted blockade of JAK or STAT can reduce mortality after septic shock by modulating immune function and emergency myelopoiesis and reducing multiple organ failure (MOF) [ 32 ]. Furthermore, studies of the molecular mechanisms underlying these processes have revealed the secretion of chemokines such as CCL1, CCL8, CXCR1, and CXCR2 by various cell types, including macrophages, neutrophils, epithelial cells, and Th17 cells, are primarily involved in inflammation, leading to the production of other inflammatory factors [ 33 ]. The receptors for CXCL1 and CXCL8, CXCR1 and CXCR2 tend to induce neutrophil migration to the site of injury or inflammation and are the most critical cytokines in the inflammatory cascade [ 34 ]. Analysis of the top ten upregulated pathway and downregulated pathways The upregulation of relevant genes and pathways suggests a molecular mechanism for CRSwNP pathology, whereby intracellular signaling and interneuronal signaling is increased in response to environmental stress and stimulated by proinflammatory cytokines. Consequently, previous studies have shown that the upregulated pathways associated with CRSwNP are involved primarily in eosinophilic inflammation, immune system disorders, and microbial infection diseases. This conclusion aligns with the findings of the present study[ 35 – 38 ]. The top 10 downregulated genes and pathways indicate that the molecular mechanisms underlying OS pathology are predominantly infectious immune-related diseases. Findings in the literature support the conclusions of this study [ 39 ]. Limitations of this study The lack of a normal maxillary sinus mucosa control group is more convincing for in-depth studies of the molecular mechanisms of CRS and OS. On the one hand, it was difficult to recruit subjects with normal maxillary sinus mucosa tissue. On the other hand, the main purpose of this study was to differentiate the diagnoses of CRS and OS, and the use of each group as the control for the other group satisfied the criteria for this experiment. Endotypes such as eosinophilic (E-CRSwNP) and noneosinophilic (NE-CRSwNP) were not further subdivided in this study. CRS in Europe and the United States is predominantly eosinophilic with a predominant type II inflammatory pattern[ 40 , 41 ], and in East Asia, a predominant type III inflammatory pattern with mixed type II and type III subclasses has been reported, which may affect the representativeness and comprehensiveness of the results [ 42 ]. The experimental results can be subsequently validated through a multiregional collaborative program. The sample size of this experiment was small, and the results may be more convincing if the sample size is increased and a normal control group is added. Conclusions Bioinformatic analysis of whole-genome expression data suggests that the mechanism of chronic rhinosinusitis with nasal polyps (CRSwNP) is associated primarily with eosinophil-associated TH2-type inflammatory responses and immune- and infection-related diseases, whereas the role of infection in this mechanism remains unclear. The downregulation of the genes CXCL1, CXCL8, CXCR1 and CXCR2 suggests that OS is associated with neutrophil-associated infectious immune diseases, which lead to cytokine release and cascade reactions that promote the formation of nasal polyps, resulting in symptoms such as CRSwNP. However, it is still unclear whether OS and CRSwNP occur simultaneously. In clinical practice, OS treatment alone cannot fully cure chronic maxillary sinus infections. Some patients require a combination of drug treatment and functional endoscopic sinus surgery (FESS). The existing literature does not report the coexistence of the two diseases. A new research plan must be designed to continue the study. Declarations Ethics approval Approval was obtained from the Ethics Committee of the hospital before the experiment was conducted, with ethical approval number [2020] 012. Consent to participate Informed consent was obtained from all participants included in the study, and routine preoperative forms were used. Consent to publish Consent for the publication of identifying images or other personal or clinical details of participants is "Not Applicable". Author information Authors and affiliations Department of Dentistry, Zhejiang Provincial Tongde Hospital, Affiliated Hospital of Zhejiang University of Chinese Medicine, Zhejiang Academy of Chinese Medicine Research 234 Guchui Road, Xihu District, Hangzhou, Zhejiang 310012, China Department of Otolaryngology, Zhejiang Provincial Tongde Hospital, Affiliated Hospital of Zhejiang University of Traditional Chinese Medicine, Zhejiang Academy of Traditional Chinese Medicine Research, 234 Gu Cui Road, Xihu District, Hangzhou City, Zhejiang Province, 310012, China Beijing Zhongkangbo Biotechnology Co., Ltd., China. 6th Floor, Digital Workshop, Jinghai Fifth Road, Economic and Technological Development Zone, Beijing. 100176 Corresponding author Zhu Jianhua, Email: [email protected] . Tel: +8615700196953. Fax: 057189972175 Competing interests All the authors in the list and Beijing Zhongkangbo Biotechnology Co., Ltd. have no conflicts of interest regarding this paper, and all have agreed that this paper should be published in this journal. Funding Most of the funds for this project were self-raised, with a portion coming from the Natural Science Foundation (Project Number: LGC22H130001). Author Contribution All the authors contributed to the study conception and design. Zhu Jianhua was involved in conceptualization of the study and methodology, formal analysis and investigation, preparation of the original draft, review and editing, revision of the project and paper, collection of materials, surgeries and sampling of patients with odontogenic maxillary sinusitis. Lin Wei participated in conceptualization, methodology development, formal analysis and investigation, original draft preparation, review and editing, revision of the project and paper, collection of materials, surgeries and sampling of patients with chronic rhinosinusitis with nasal polyps, and funding acquisition. Yuan Wenwen was responsible for patient appointments, ensuring the signing of consent forms, follow-up, preservation of biological specimens, and quality control. Feng Julin was responsible for purchasing relevant experimental materials, installing related software, conducting experimental operations, computerizing data, conducting statistical processing, and creating images. Acknowledgments Members of the research team would like to express their gratitude to the teachers and employees of Zhong Kangbo Biotechnology Co., Ltd., for their additional assistance. Data Availability The datasets generated and/or analysed during the current study are available in the GEO repository. under accession number GSE305123(secure token: yhghmwoizzkvxoh). To access the data, please visit [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE305132](https:/www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE305132) and enter the secure token in the provided box References Shi JB, Fu QL, Zhang H, Cheng L, Wang YJ, Zhu DD, Lv W, Liu SX, Li PZ, Ou CQ, Xu G. Epidemiology of chronic rhinosinusitis: results from a cross-sectional survey in seven Chinese cities. Allergy. 2015;70:533–9. https://doi.org/10.1111/all.12577 . Wang X, Zhang N, Bo M, Holtappels G, Zheng M, Lou H, Wang H, Zhang L, Bachert C. Diversity of T(H) cytokine profiles in patients with chronic rhinosinusitis: a multicenter study in Europe, Asia, and Oceania. J Allergy Clin Immunol. 2016;138:1344–53. https://doi.org/10.1016/j.jaci.2016.05.041 . Liu Z, Chen J, Cheng L, et al. Chinese society of allergy and Chinese society of otorhinolaryngology-head and neck surgery guideline for chronic rhinosinusitis. Allergy Asthma Immunol Res. 2020;12:176–237. https://doi.org/10.4168/aair.2020.12.2.176 . Wautlet A, Bachert C, Desrosiers M, Hellings PW, Peters AT. The management of chronic rhinosinusitis with nasal polyps (CRSwNP) with biologics. J Allergy Clin Immunol Pract. 2023;11:2642–51. https://doi.org/10.1016/j.jaip.2023.04.054 . Fokkens WJ, Lund VJ, Hopkins C, Hellings PW, Kern R, Reitsma S, Toppila-Salmi S, Bernal-Sprekelsen M, Mullol J, Alobid I. European position paper on rhinosinusitis and nasal polyps 2020. Rhinology. 2020;58:1–464. Fokkens WJ, Lund V, Bachert C, et al. EUFOREA consensus on biologics for CRSwNP with or without asthma. Allergy. 2019;74:2312–9. https://doi.org/10.1111/all.13875 . Lin J, Wang C, Wang X, et al. Expert consensus on odontogenic maxillary sinusitis multi-disciplinary treatment. Int J Oral Sci. 2024;16:11. https://doi.org/10.1038/s41368-024-00278-z . Allevi F, Fadda GL, Rosso C, Martino F, Pipolo C, Cavallo G, Felisati G, Saibene AM. Diagnostic criteria for odontogenic sinusitis: a systematic review. Am J Rhinol Allergy. 2021;35:713–21. https://doi.org/10.1177/1945892420976766 . Hwang JW, Lee KJ, Choi IH, Han HM, Kim TH, Lee SH. Decreased expression of type I (IFN-beta) and type III (IFN-lambda) interferons and interferon-stimulated genes in patients with chronic rhinosinusitis with and without nasal polyps. J Allergy Clin Immunol. 2019;144:1551–e15652. https://doi.org/10.1016/j.jaci.2019.08.010 . Bassiouni A, Ou J, Schreiber A, Geoghegan J, Tsykin A, Psaltis AJ, Wormald PJ, Vreugde S. The global transcriptomic signature in sinonasal tissues reveals roles for tissue type and chronic rhinosinusitis disease phenotype. Rhinology. 2020;58:273–83. https://doi.org/10.4193/Rhin19.403 . Bauer WH. Maxillary sinusitis of dental origin. Am J Orthod Oral Surg. 1943;29:B133–51. Kit S. (2005) GeneChip® expression analysis technical manual. Pradervand S, Paillusson A, Thomas J, Weber J, Wirapati P, Hagenbüchle O, Harshman K. Affymetrix whole-transcript human gene 1.0 ST array is highly concordant with standard 3' expression arrays. Biotechniques. 2008;44:759–62. https://doi.org/10.2144/000112751 . Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U, Speed TP. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics. 2003;4:249–64. https://doi.org/10.1093/biostatistics/4.2.249 . Smyth GK. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol. 2004;3. https://doi.org/10.2202/1544-6115.1027 . :Article3. Smyth GK, Michaud J, Scott HS. Use of within-array replicate spots for assessing differential expression in microarray experiments. Bioinformatics. 2005;21:2067–75. https://doi.org/10.1093/bioinformatics/bti270 . Craig JR, Poetker DM, Aksoy U, et al. Diagnosing odontogenic sinusitis: an international multidisciplinary consensus statement. Int Forum Allergy Rhinol. 2021;11:1235–48. https://doi.org/10.1002/alr.22777 . Craig JR, Tataryn RW, Sibley HC, Mason WD, Deuel JA, Loyd GE, Nerenz DR, Goyal P. Expected costs of primary dental treatments and endoscopic sinus surgery for odontogenic sinusitis. Laryngoscope. 2022;132:1346–55. https://doi.org/10.1002/lary.29825 . Vitali FC, Santos PS, Massignan C, Maia LC, Cardoso M, Teixeira CDS. Global prevalence of maxillary sinusitis of odontogenic origin and associated factors: a systematic review and meta-analysis. J Endod. 2023;49:369–e38111. https://doi.org/10.1016/j.joen.2023.01.010 . Alaqla A, Alhasoun M, Asseery M, Altheyabi S, Farook FF, Albanyan H, Al-Kadi MT. ENT specialists' knowledge and their skills in detecting maxillary sinusitis of odontogenic origin, a cross-sectional study. Am J Otolaryngol. 2025;46:104587. https://doi.org/10.1016/j.amjoto.2024.104587 . Rosenfeld RM, Piccirillo JF, Chandrasekhar SS, Brook I, Kumar KA, Kramper M, Orlandi RR, Palmer JN, Patel ZM, Peters A, Walsh SA, Corrigan MD. Clinical practice guideline (update): adult sinusitis executive summary. Otolaryngol Head Neck Surg. 2015;152:598–609. https://doi.org/10.1177/0194599815574247 . Fokkens WJ, Lund V, Bachert C, et al. EUFOREA consensus on biologics for CRSwNP with or without asthma. Allergy. 2019;74:2312–9. https://doi.org/10.1111/all.13875 . Vogt PK. Fortuitous convergences: the beginnings of JUN. Nat Rev Cancer. 2002;2:465–9. https://doi.org/10.1038/nrc818 . Simi A, Ingelman-Sundberg M, Tindberg N. Neuroprotective agent chlomethiazole attenuates c-fos, c-jun, and AP-1 activation through inhibition of p38 MAP kinase. J Cereb Blood Flow Metab. 2000;20:1077–88. https://doi.org/10.1097/00004647-200007000-00007 . Clere-Jehl R, Mariotte A, Meziani F, Bahram S, Georgel P, Helms J. JAK-STAT targeting offers novel therapeutic opportunities in sepsis. Trends Mol Med. 2020;26:987–1002. https://doi.org/10.1016/j.molmed.2020.06.007 . Li G, Qi W, Li X, Zhao J, Luo M, Chen J. Recent advances in c-Jun N-terminal kinase (JNK) inhibitors. Curr Med Chem. 2021;28:607–27. https://doi.org/10.2174/0929867327666200210144114 . Serpero L, Petecchia L, Sabatini F, Giuliani M, Silvestri M, Di Blasi P, Rossi GA. The effect of transforming growth factor (TGF)-beta1 and (TGF)-beta2 on nasal polyp fibroblast activities involved upper airway remodeling: modulation by fluticasone propionate. Immunol Lett. 2006;105:61–7. https://doi.org/10.1016/j.imlet.2006.01.003 . Madkour MM, Anbar HS, El-Gamal MI. Current status and future prospects of p38α/MAPK14 kinase and its inhibitors. Eur J Med Chem. 2021;213:113216. Saikh KU. MyD88 and beyond: a perspective on MyD88-targeted therapeutic approach for modulation of host immunity. Immunol Res. 2021;69:117–28. https://doi.org/10.1007/s12026-021-09188-2 . Song L, Zhu S, Liu C, Zhang Q, Liang X. Baicalin triggers apoptosis, inhibits migration, and enhances anti-tumor immunity in colorectal cancer via TLR4/NF-κB signaling pathway. J Food Biochem. 2022;46:e13703. https://doi.org/10.1111/jfbc.13703 . Hu Q, Bian Q, Rong D, Wang L, Song J, Huang HS, Zeng J, Mei J, Wang PY. JAK/STAT pathway: extracellular signals, diseases, immunity, and therapeutic regimens. Front Bioeng Biotechnol. 2023;11:1110765. https://doi.org/10.3389/fbioe.2023.1110765 . Ivashkiv LB, Donlin LT. Regulation of type I interferon responses. Nat Rev Immunol. 2014;14:36–49. https://doi.org/10.1038/nri3581 . Rafeie F, Abdoli R, Hossein-Zadeh NG, Talebi R, Szmatoła T. Interaction networks and pathway analysis of genetic resistance to gastrointestinal nematodes in sheep. Trop Anim Health Prod. 2023;55:34. https://doi.org/10.1007/s11250-022-03448-5 . Silva RL, Lopes AH, Guimarães RM, Cunha TM. CXCL1/CXCR2 signaling in pathological pain: role in peripheral and central sensitization. Neurobiol Dis. 2017;105:109–16. https://doi.org/10.1016/j.nbd.2017.06.001 . Li X, Meng J, Qiao X, et al. Expression of TGF, matrix metalloproteinases, and tissue inhibitors in Chinese chronic rhinosinusitis. J Allergy Clin Immunol. 2010;125:1061–8. https://doi.org/10.1016/j.jaci.2010.02.023 . Wang X, Sima Y, Zhao Y, et al. Endotypes of chronic rhinosinusitis based on inflammatory and remodeling factors. J Allergy Clin Immunol. 2023;151:458–68. https://doi.org/10.1016/j.jaci.2022.10.010 . Ye X, Li Y, Fang B, et al. Type 17 mucosal-associated invariant T cells contribute to neutrophilic inflammation in patients with nasal polyps. J Allergy Clin Immunol. 2023;152:1153–e116612. https://doi.org/10.1016/j.jaci.2023.06.021 . Xiang D, Zou J, Zhu X, Chen X, Luo J, Kong L, Zhang H. Physalin D attenuates hepatic stellate cell activation and liver fibrosis by blocking TGF-β/Smad and YAP signaling. Phytomedicine. 2020;78:153294. https://doi.org/10.1016/j.phymed.2020.153294 . Pereira IG, Vaz P, Almeida RF, Braga AC, Felino A. IRAK4 gene polymorphism and odontogenic maxillary sinusitis. Clin Oral Investig. 2015;19:1815–24. https://doi.org/10.1007/s00784-015-1424-5 . Patadia M, Dixon J, Conley D, Chandra R, Peters A, Suh LA, Kato A, Carter R, Harris K, Grammer L, Kern R, Schleimer R. Evaluation of the presence of B-cell attractant chemokines in chronic rhinosinusitis. Am J Rhinol Allergy. 2010;24:11–6. https://doi.org/10.2500/ajra.2010.24.3386 . Cardoso JM, Ribeiro AC, Palos C, Proença L, Noronha S, Alves RC. Association between IL-1A and IL-1B gene polymorphisms with peri-implantitis in a Portuguese population-a pilot study. PeerJ. 2022;10:e13729. https://doi.org/10.7717/peerj.13729 . Zhang N, Liu S, Lin P, Li X, van Bruaene N, Zhang J, van Zele T, Bachert C. (2010) Remodeling and inflammation in Chinese versus white patients with chronic rhinosinusitis. J Allergy Clin Immunol 125:507; author reply 507–508. https://doi.org/10.1016/j.jaci.2009.10.015 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7229477","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":505279719,"identity":"45c49d15-4de2-4a8e-bc4c-f9a4931341e6","order_by":0,"name":"Lin Wei 林炜","email":"","orcid":"","institution":"Department of Dentistry, Zhejiang Provincial TonZhejiang University of Chinese Medicinegde Hospital,","correspondingAuthor":false,"prefix":"","firstName":"Lin","middleName":"Wei","lastName":"林炜","suffix":""},{"id":505279720,"identity":"e3473ab7-4b31-4fb7-b9d2-4b873f6aa677","order_by":1,"name":"Zhu Jianhua 朱建华","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+0lEQVRIie3RPWrDMBiA4U8Y7A7CkO0zKXGPoJApYMhVZALp4kKmkK0xAuUKyS18BBmDu5jO3mLToVMh4KVjFWfJJHcMRO+mnwdJCMBmu8e8NG34FqnrCQV4mVFDhBaCNVX07NOS/5Pgqxy1chVNMGHXmSHCVCyBVwV1MenOcwkTv+akWxtJLvVbNKE/GQskzIKaO+ODieTpnvWneG8Z1yTOau461EQKIjGWmkDSKE3eh0nZkxV1nxKy04SzIRJUROiLRfot5QzwE6fHqhVjE/FP3237u8VFuBdfHW6i0P9Y5p2JvKibgYP9Z5KdAQCEt8vkbNxrs9lsj9of4hhRtpFtPV0AAAAASUVORK5CYII=","orcid":"","institution":"Department of Dentistry, Zhejiang Provincial TonZhejiang University of Chinese Medicinegde Hospital,","correspondingAuthor":true,"prefix":"","firstName":"Zhu","middleName":"Jianhua","lastName":"朱建华","suffix":""},{"id":505279721,"identity":"43bca979-6ba9-4dfa-a898-e0d71f96207b","order_by":2,"name":"Yuan Wenwen 袁雯雯","email":"","orcid":"","institution":"Department of Dentistry, Zhejiang Provincial TonZhejiang University of Chinese Medicinegde Hospital,","correspondingAuthor":false,"prefix":"","firstName":"Yuan","middleName":"Wenwen","lastName":"袁雯雯","suffix":""},{"id":505279722,"identity":"46c718cf-5eeb-4580-b31f-7f612058bacb","order_by":3,"name":"Feng Junlin 冯俊林","email":"","orcid":"","institution":"Department of Dentistry, Zhejiang Provincial TonZhejiang University of Chinese Medicinegde Hospital,","correspondingAuthor":false,"prefix":"","firstName":"Feng","middleName":"Junlin","lastName":"冯俊林","suffix":""}],"badges":[],"createdAt":"2025-07-28 03:53:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7229477/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7229477/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90502925,"identity":"49b13465-172c-4a89-be7a-e8a8015191c1","added_by":"auto","created_at":"2025-09-03 12:05:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":19513,"visible":true,"origin":"","legend":"\u003cp\u003eDEGs between CRS and OS\u003c/p\u003e\n\u003cp\u003eCRS: chronic rhinosinusitis with nasal polyps, OS: odontogenic sinusitis. Red indicates upregulated genes, blue indicates downregulated genes, and the height of the column represents the number of genes. The figure was originally created by the corresponding author and was first cited in the author's unpublished master's thesis. The copyright belongs to the author. The figure is available from the corresponding author\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7229477/v1/3517aca53d177a6dc15548f7.png"},{"id":90503971,"identity":"73651e92-d86f-4219-b19e-7f4d459e9245","added_by":"auto","created_at":"2025-09-03 12:13:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":194510,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmap of differentially expressed genes between CRS and OS in the mRNA analysis\u003c/p\u003e\n\u003cp\u003eCRS: chronic rhinosinusitis with nasal polyps, OS: odontogenic sinusitis. Hierarchical cluster analysis with cutoff Z score 4 revealed CRSwNP group distinctly segregated from OS group. the fire red indicates the gene expresses upregulated levels, while the sea blue color indicates gene expresses downregulated levels. This graph was plotted using the visualization R package ggplot2 (version 3.1.0). The figure was originally created by the corresponding author and was first cited in the author's unpublished master's thesis. The copyright belongs to the author. The figure is available from the corresponding author.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7229477/v1/40c6bda3ec3a06238df0f636.png"},{"id":90502927,"identity":"74b9bfd0-d398-4543-abd7-d1abd3a7f62b","added_by":"auto","created_at":"2025-09-03 12:05:42","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":58594,"visible":true,"origin":"","legend":"\u003cp\u003eGene Ontology results for the top 10 upregulated genes\u003c/p\u003e\n\u003cp\u003eX-axis -Log10(Value): The larger the (-Log), the smaller the P_value, indicating a higher significance level of GO\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7229477/v1/024942d834d1d46f673ea48b.png"},{"id":90502929,"identity":"e17be827-e745-4cd8-9770-ca7fabeed401","added_by":"auto","created_at":"2025-09-03 12:05:42","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":52788,"visible":true,"origin":"","legend":"\u003cp\u003eGene Ontology of the top 10 genes with downregulated\u003c/p\u003e\n\u003cp\u003eX-axis -Log10(Value): The larger the (-Log), the smaller the P_value, indicating a higher significance level of GO term enrichment. Y-axis GO_Name: Name of the enriched term in the Gene Ontology database. Blue represents the degree of gene downregulation.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7229477/v1/9abcb66a3c189bb3d5db021f.png"},{"id":90504239,"identity":"1fc7502a-f176-4b0b-91c1-5d6081172250","added_by":"auto","created_at":"2025-09-03 12:21:42","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":48457,"visible":true,"origin":"","legend":"\u003cp\u003ePathway enrichment results for upregulated genes\u003c/p\u003e\n\u003cp\u003eX-axis -Log10(Value). The larger the (-Log) value, the smaller the P_value, indicating a higher significance level of the Pathway. Y-axis Pathway_Name: Name of the pathway in the KEGG database\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7229477/v1/3c935a2ae4bb7d51844ab5ce.png"},{"id":90502932,"identity":"fa375732-b54d-4df1-a50f-e072667488c7","added_by":"auto","created_at":"2025-09-03 12:05:42","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":45271,"visible":true,"origin":"","legend":"\u003cp\u003ePathway enrichment results for downregulated genes\u003c/p\u003e\n\u003cp\u003eX-axis -Log10(Value). The larger the (-Log) value, the smaller the P_value, indicating a higher significance level of the Pathway. Y-axis Pathway_Name: Name of the pathway in the KEGG database\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7229477/v1/486c1f871ceabeffab29e23e.png"},{"id":90504245,"identity":"50bc34e8-dbd9-4a09-94d6-3d345822aa1a","added_by":"auto","created_at":"2025-09-03 12:21:42","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":69957,"visible":true,"origin":"","legend":"\u003cp\u003eGlobal Signal Transduction Network (EPS)\u003c/p\u003e\n\u003cp\u003eThe 136 nodes in network graphs were the dominating genes, and the 430 edges represent the relationship types (including the activation or phosphorylation) between signals. The degree is denoted by the number of links from one node to others. Genes with higher degrees mean they have a more crucial position in the network. Thus, signal transduction network analysis is a method for identifying the key hub genes that potently modulate other genes.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7229477/v1/697cdf086f996171b102755d.png"},{"id":90504243,"identity":"dd490a53-2cae-4550-b511-0353b3dbab7b","added_by":"auto","created_at":"2025-09-03 12:21:42","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":33829,"visible":true,"origin":"","legend":"\u003cp\u003eBar chart of the RT-qPCR results for the key hub genes\u003c/p\u003e\n\u003cp\u003eCRS: chronic rhinosinusitis with nasal polyps, OS: odontogenic sinusitis. JUN: c-jun gene, MAPK14: mitogen-activated protein kinase, NOS2: nitric oxide synthase, JAK: janus kinase, CXCR1: chemokine receptor. Yellow represents the CRSwNP group, while blue represents the OS group. The Y-axis indicates the relative expression levels. Data was processed using RQ Manager 1.2.1 and Data Assist V3.0 software. The relative quantitative analysis results of each sample were analyzed. According to the formula F = 2 - [average CI value of CRS gene in the tested group - average CI value of CRS housekeeping gene in the tested group] - [average CI value of the target gene in the OS group - average CI value of the housekeeping gene in the OS group], the quantitative results of the target gene in the samples relative to the control samples were calculated to reflect the differences in the mRNA transcript levels of the target gene.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-7229477/v1/2095f214427981c260d6a9df.png"},{"id":98433973,"identity":"081493fc-d3ed-4007-81d9-d01d306b26bd","added_by":"auto","created_at":"2025-12-17 16:51:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1535965,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7229477/v1/3c2069e4-bcfc-4d7a-86ca-0002ad22005d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Identification of differential pathogenic mechanisms between chronic rhinosinusitis with nasal polyps and odontogenic sinusitis using the PrimeView™ Human Gene Expression Array","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe prevalence of chronic maxillary sinusitis among adults is 8% in China, 7\u0026ndash;27% in Europe, and 14% in the United States [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The clinical symptoms include nasal congestion, nasal leakage (from both anterior and posterior nostrils), headache, altered taste, loss of taste, memory changes, olfactory loss and even anosmia, which severely affects daily life and work and increases health care costs [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Chronic rhinosinusitis can be divided into chronic rhinosinusitis with polyps (CRSwNP) and chronic rhinosinusitis without polyps (CRSsNP). CRSwNP is often refractory or recurrent and is frequently misdiagnosed in a significant percentage of patients with odontogenic maxillary sinusitis (OS) [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. With the increased use of implant dentures, the incidence of odontogenic sinusitis is further increasing [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThere are several regional consensuses regarding the differential diagnosis and treatment of CRSwNP and OS, but global guidelines have not yet been developed, which makes the diagnosis and treatment of CRSwNP and OS often confusing [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. CRSwNP is a genetic predisposition that has been recognized by many experts. The pathogenesis of chronic rhinosinusitis has been reported in the literature as the up- or downregulation of related genes [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Odontogenic maxillary sinusitis is thought to be the result of odontogenic factors, which disrupts the integration of the Schneider membrane [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The specific molecular mechanisms underlying these two diseases have not been reported.\u003c/p\u003e\u003cp\u003eIn the present study, we analyzed the molecular mechanisms of chronic rhinosinusitis and odontogenic maxillary sinusitis by using the PrimeView\u0026trade; Human Gene Expression Array, exploiting gene and pathway differences between CRSwNP and OS to identify differences in the molecular mechanisms involved.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eSample collection\u003c/h2\u003e\u003cp\u003eFor CRSwNP patients, the uncinate process was excised. The maxillary ostium was enlarged, and the mucosal tissue of the diseased maxillary sinus was endoscopically resected. The samples were placed in a sterile frozen storage tube and transferred to -80\u0026deg;C in liquid nitrogen within 5 minutes.\u003c/p\u003e\u003cp\u003eFor OS patients, access to diseased tissue was obtained using the alveolar ridge-antral route, by exposing the floor of the maxillary sinus, or in combination with nasal endoscopy.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eTotal RNA isolation\u003c/h3\u003e\n\u003cp\u003eLiquid nitrogen-preserved samples were thawed, TRIzol (from QIAGEN, Germany) was used for lysis, and isopropanol (from Shanghai Pharmaceutical Group) was used to remove protein contaminants according to the manufacturer\u0026rsquo;s instructions. QIAGEN RNase-free DNaseI (QIAGEN21704, 79254, GmBH, German) was used to digest the DNA, and the RNA solution was obtained by centrifugation. (15minutes at 12000 х g, 4℃), The RNA concentration was measured using an SMA3000 spectrophotometer (Meriton, Beijing), and the RNA was stored at -80\u0026deg;C.\u003c/p\u003e\n\u003ch3\u003eRNA quality control and cRNA synthesis\u003c/h3\u003e\n\u003cp\u003eA SMA3000 spectrophotometer (Beijing, Meriton, Wavelength 200-750nm, Measurement range: 2\u0026ndash;3700 ng/ul (dsDNA)) was used to measure the concentration and saturation of the RNA solution. A Bio-Rad (USA) electrophoresis apparatus and a JS-380A gel imaging system (Shanghai Peking Technology Co., Ltd.) were used to evaluate the integrity of the 18S and 28S RNA. The quality control results revealed that 12 samples met the requirements for RNA liquid chip hybridization (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In accordance with the 3' IVT PLUS reagent instructions, cDNA first and second strands were synthesized in vitro, the cRNA mixture was synthesized and purified, and fragmentation was performed using 3' fragmentation buffer [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eOS CRSwNP RNA QC results\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSample number\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLab number\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eName\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFocusing (ng/\u0026micro;l)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e260/280\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eVolume (\u0026micro;l)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eTotal (\u0026micro;g)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eResult\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHT2Q2110130\u003c/p\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBlack3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e829.4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2.04\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e33.18\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHT2Q2110130\u003c/p\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBlack4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e494.3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2.04\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e19.77\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHT2Q2110130\u003c/p\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBlack5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e258.4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e10.34\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHT2Q2110130\u003c/p\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBlack7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e186.3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1.99\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e7.45\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHT2Q2110130\u003c/p\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBlack8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e729.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1.86\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e31.68\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHT2Q2110130\u003c/p\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGreen3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e200.6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e4.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHT2Q2110130\u003c/p\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGreen4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e492.3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1.91\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e9.85\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHT2Q2110130\u003c/p\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGreen8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e385.0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1.86\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e7.70\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eD\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHT2Q2110260\u003c/p\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBlack2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e341\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2.08\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e13.64\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHT2Q2110260\u003c/p\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRed1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e388\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2.05\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e140\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e54.32\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHT2Q2110260\u003c/p\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGreen5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e542.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2.11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e21.68\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHT2Q2110260\u003c/p\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGreen7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e401.8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2.08\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e140\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e56.25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003eB\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"8\"\u003eNotes:\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd colspan=\"8\"\u003eOS: odontogenic sinusitis, CRSwNP: chronic rhinosinusitis with nasal polyps, RNA QC: RNA quality control,\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd colspan=\"8\"\u003eSample number: The serial number of the sample stored at -80℃. Lab number: The serial number assigned after the sample control is completed. Name: The serial number for sample collection during the surgery. Focusing (ng/ul): The concentration of RNA used for electrophoresis in agarose gel (ng/ul). 260/280: The purity of RNA detected by ultraviolet spectrophotometer. Volume (ug): The volume of RNA extracted from the sample. Total: The quality of RNA extracted from the sample. Result: The classification of RNA quality control assessment, B is good, D is qualified. Black represents the CRSwNP group, while green and red represent the OS group. This table was originally created by the corresponding author and was first cited in the author\u0026rsquo;s unpublished master\u0026rsquo;s thesis. The copyright belongs to the author. Data is available from the corresponding author.\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eMicroarray hybridization and data preprocessing\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from liquid nitrogen-preserved samples using TRIzol reagent (Life Technologies, Carlsbad, CA, USA) and purified with a RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Biotinylated cDNA was prepared from 150 ng of total RNA using the Ambion\u0026reg; WT Expression Kit according to the standard Affymetrix protocol. Following labeling, the fragmented cDNA was hybridized for 16 hr. at 45\u0026deg;C on a PrimeView human chip (Affymetrix Clariom S Array reservation, CA, USA). GeneChips were washed and stained with the Affymetrix Fluidics Station 450. All arrays were scanned using the Affymetrix\u0026reg; GeneChip Command Console (AGCC), which was installed in the GeneChip\u0026reg; Scanner 3000 7G. The data were analyzed with the Robust Multichip Analysis (RMA) algorithm using Affymetrix default analysis settings and global scaling as a normalization method. The values presented are log 2 RMA signal intensities [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eQuantitative real-time RT‒PCR\u003c/h3\u003e\n\u003cp\u003eFor real-time PCR (qPCR), total RNA was isolated from cells using TRIzol reagent (Life Technologies, Carlsbad, CA, USA) and then transcribed to cDNA using a reverse transcription kit (Takara, Dalian, Liaoning, China).\u003c/p\u003e\u003cp\u003eQuantitative PCR was performed in technical triplicates using SYBR Green reagent (Bio-Rad, Hercules, CA, USA). The expression levels were calculated using the 2\u003csup\u003e\u0026ndash;∆∆Ct\u003c/sup\u003e method, with the Ct values normalized to those of GAPDH, which was used as an internal control. The primers used are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The key node genes JAK1, CXCR1, MAPK, NOS2, and JUN were selected from the global signal transduction network diagram based on their in-degree and out-degree.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer DNA sequence design\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGene ID\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePrimer sequence (5ʹ to 3ʹ)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSize (bp)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eAnnealing temperature (\u0026deg;C)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eJUN_F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHs696684\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCCAAGTGCCGAAAAAGGAAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e78\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eJUN_R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHs 696684\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGAGTTCTGAGCTTTCAAGGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e78\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMAPK14_F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHs 485333\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCAGTCCATCATTCATGCGAAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e91\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMAPK14_R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHs 485233\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAACGTCCAACAGACCAATCAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e981\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNOS2_F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHs 709191\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGGGACAAGCCTACCCCTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e168\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNOS2_R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHs 709191\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTCATCATCCCGTCAGTTGGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e168\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eJAK1_F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHs 207538\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTTTGCCCTGTATGACGAGAAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e101\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eJAK1_R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHs 207538\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACCTCATCCGGTAGTGGAGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e101\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCXCR1_F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHs 194778\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGACCCAGAAGCGTCACTTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e139\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCXCR1_R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHs 194778\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCAGGACCTCATAGCAAACTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e139\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eNotes:\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eThe reaction system was composed of the following: 2 \u0026times; S6 Universal SYBR qPCR Mix, 5 \u0026micro;L; Primer-F (10 \u0026micro;M), 0.2 \u0026micro;L; Primer-R (10 \u0026micro;M), 0.2 \u0026micro;L; cDNA template, 1 \u0026micro;L; RNase-free ddH₂O to 10\u0026micro;L.\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eThe reaction system was placed in the quantitative PCR instrument (ABI 7900HT fluorescence), and the reaction was performed under specific conditions. Primer3.0 software was used for assistance in primer design. The gene sequences were retrieved from a database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.nici.nini.mih.gov/web/genebank\u003c/span\u003e\u003cspan address=\"http://www.nici.nini.mih.gov/web/genebank\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eThis table was originally created by the corresponding author and was first cited in the author\u0026rsquo;s unpublished master\u0026rsquo;s thesis. The copyright belongs to the author. Data are available from the corresponding author.\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eThe statistical analysis was conducted using R software (version 3.5.1). The R package Limma (version 3.36.5) was utilized for the differential expression analysis. The statistical methods employed for the differential chip analysis included trimmed mean of M-values (TMM). For gene chip standardization, the method employed was the Transcriptome Analysis Console (TAC4.0), and the robust multichip analysis algorithm used was log2(RMA signal).\u003c/p\u003e\u003cp\u003eThe differential expression analysis involved Student's test and one-way NOVA. It is imperative to note that all enrichment results were analyzed via Fisher's exact test. Nonparametric tests were employed for data that did not adhere to a normal distribution. Statistically significant differences were those with a p value less than 0.05. The Benjamini‒Hochberg method was used for correction (FDR).\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n\u003ch2\u003eDifferential gene expression analysis\u003c/h2\u003e\n\u003cp\u003eTo verify the existence of differentially expressed genes, we first screened differentially expressed genes and performed functional enrichment analysis. A total of 49,372 genes were detected in comparisons of the six groups of CRSwNP and OS samples for differentially expressed mRNA screening. There were 1,037 differentially expressed genes (DEGs) with a fold change greater than 1.5, including 168 upregulated genes and 869 downregulated genes. Differences with a LogFC (fold change) greater than 1.5 and a P value less than 0.01 were considered statistically significant (Figs.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n\u003ch2\u003eFunctional enrichment analysis\u003c/h2\u003e\n\u003cp\u003eThe differentially expressed genes were annotated for their gene functions based on the GO database, and all the functions related to the genes were obtained. The top 10 up- or downregulated functional genes obtained from the enrichment analysis are presented in the form of a bar chart. The upregulated genes were enriched mainly in salivary gland cell development and maturation and epithelial cell differentiation and maturation (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). The downregulated genes were enriched mainly in neutrophil degradation and the inflammatory response. This mainly reflects the reconstruction associated with the membrane epithelium, differentiation and mutation accompanying membrane vesicles (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003ePathway analysis of the screened genes\u003c/h2\u003e\n\u003cp\u003eTo understand the interaction among the differentially expressed genes; the genes were annotated based on the KEGG database to reveal related signaling pathways (Pathway Annotation). The top ten upregulated pathways included glutamatergic synapse, leishmaniasis, salivary gland secretion, depression, long-term effects, cocaine addiction, vascular smooth muscle contraction, asthma, rheumatoid arthritis, and cytochrome P450 drug metabolism. These pathways are related primarily to intracellular signal transduction under environmental stress and high expression of intercellular signals in the nervous system (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). The top ten downregulated pathways included apoptosis, leishmaniasis, tuberculosis, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e infection, rheumatoid arthritis, lysosomes, chemokine signaling pathways, exogenous antigen processing and presentation, and FC-\u0026gamma; R-mediated apoptosis (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These include mainly exogenous infections, the release of inflammatory factors, microbial clearance, and autoimmune processes (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n\u003ch2\u003eGlobal signal transduction network\u003c/h2\u003e\n\u003cp\u003eTo visualize the interactions between genes and facilitate the selection of hub genes for subsequent research, a gene‒gene interaction network (global signal transduction network) was constructed based on the data of the DEGs. The genes were categorized as in-degree, out-degree, or degree. A higher degree indicated that the gene exhibited a strong correlation with other genes, implying a more important role in the signal transduction network. (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThe 136 nodes in network graphs were the dominating genes, and the 430 edges represent the relationship types (including the activation or phosphorylation) between signals. The degree is denoted by the number of links from one node to others. Genes with higher degrees mean they have a more crucial position in the network. Thus, signal transduction network analysis is a method for identifying the key hub genes that potently modulate other genes.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n\u003ch2\u003eRT‒qPCR\u003c/h2\u003e\n\u003cp\u003eTo verify the differentially expressed genes obtained from the gene chip, RT-qPCR was performed. The selected key node genes JUN, NOS2, MAPK14, and JAK1 from the PPI network were subjected to RT‒qPCR experiments on the same RNA samples used for microarray analysis. The results confirmed the upregulation of the JUN and NOS2 genes, while MAPK14 presented similar expression levels, and JAK1 presented results opposite those of the gene detection results (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the introduction, we summarized the current research status on the pathogenesis of OS and CRSwNP.\u003c/p\u003e\u003cp\u003eWe found that there is very little evidence in the existing literature regarding the pathogenesis of these two diseases. The reasons for this are complex. It might be because these two diseases are prevalent in clinical practice, and the occurrence of serious complications and sequelae is relatively rare. However, in fact, the misdiagnosis and mistreatment of these two diseases is very common, prolonging the healing process, causing patients to incur large amounts of time and financial costs. Thus, it is important to discuss the different molecular mechanisms at the genetic level and explore the reasons for the misdiagnosis of OS and CRSwNP.\u003c/p\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eReasons for misdiagnosis of OS and CRSwNP\u003c/h2\u003e\u003cp\u003eIn clinical practice, the differential diagnosis of CRSwNP and OS is controversial in patients who have undergone reoperation after endoscopic sinus surgery [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. This is due to the following reasons: ① Due to the anatomical proximity between the tooth apex and the floor of the maxillary sinus, OS may present early with subtle clinical symptoms due to the drainage of the maxillary sinus [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. ② In the late stage of OS, the diseased tissue occupies the maxillary sinus, spreads to the adjacent globus pallidus, middle turbinate, sieve sinus, pterygoid sinus, frontal sinus and contralateral maxillary sinus; and blocks the natural drainage port of the maxillary sinus, resulting in almost the same clinical symptoms as those observed in CRSwNP [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. ③ in some cases, the diagnosis of OS itself is difficult, and the symptoms and signs disappear naturally or take a chronic course. In some patients with OS, maxillary sinus lesions disappear after ESS, which can inadvertently mislead otolaryngologists in the diagnosis of OS [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. ④ Multidisciplinary diagnostic and therapeutic approaches in dentistry, otolaryngology and departmental radiology have not yet been promoted and popularized [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. ⑤ According to the results of Prof. Wilhelm Bauer's study, odontogenic microorganisms can enter the maxillary sinus through the bone marrow, blood vessels, and lymphatic system. The exclusion of OS in differential diagnosis cannot be dependent on the presence or absence of a bone barrier [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. ⑥ In the guidelines for the diagnosis and management of chronic rhinosinusitis, CT descriptions are limited to changes in the sinonasal complex and inflammatory changes in the sinus mucosa and do not depict the floor of the maxillary sinus or the focal tooth, which may be the main reason for the misdiagnosis of odontogenic maxillary sinusitis [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The forthcoming updates to the CRSwNP diagnosis guidelines, are expected to include detailed descriptions of the maxillary sinus floor and dentition [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eJUN and NOS2, which were verified by RT\u0026ndash;qPCR, were among the top 10 downregulated hub genes; The pathways enriched in upregulated and downregulated genes were further assessed, and their potential roles in the pathogenesis of the diseases of interest were discussed in the context of the literature,\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eMechanism of action of JUN and NOS2 in CRSwNP pathogenesis\u003c/h2\u003e\u003cp\u003eIn this study, the genes JUN and NOS2 were significantly upregulated in CRSwNP compared to OS, which was confirmed by RT‒Qpcr. The Jun gene, located on human chromosome 1 in the p32-p31 region, has been implicated in malignant gene translocations and deletions. c-JUN forms a dimeric complex with activator protein-1 A (AP1), c-JUN, and c-FOS [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In the nucleus, it regulates p53, p19, p21, p16, and the cell cycle. c-JUN is a growth factor peptide, cyclind1, which is phosphorylated at the N-terminal amino acid (JNK) [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. JNK is affected by various factors, including the growth factor cyclind1, other growth factor peptides, proinflammatory factors, oxidation, environmental stress, and UV light [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The JNK pathway is one of three parallel mitogen-activated protein kinase (MAPK) pathways (ERK, JNK/SAPK, P38/MAPK), and TGFβ regulates JNK expression and function by interacting with the downstream MAPK pathway [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. TGF-β promotes the differentiation of fibroblasts into myofibroblasts, which are a major source of extracellular matrix proteins. Although the precise mechanism underlying nasal polyp formation is not fully understood, myofibroblasts and the extracellular matrix are thought to play pivotal roles in maxillary sinus polyp formation [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Selective JNK blockers have recently received FDA approval for use in treating autoimmune diseases, rheumatoid diseases, renal tumors, enteritis, and intestinal polyp diseases [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In the present study, both JNK and TGF-β were highly expressed in both the experimental and control groups; however, the experimental group presented significantly higher expression levels than did the control group.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eDownregulated gene analysis\u003c/h2\u003e\u003cp\u003eFunctions of the top ten downregulated genes in OSPPI.\u003c/p\u003e\u003cp\u003eThe top 10 downregulated hub genes were MAPK14, MYD88, TLR4, JAK, CXCL1, CXCL8, CXCR1, CXCR2, CCR1, and CCR2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). MAPK14, a mitogen-activated protein kinase, has been shown to activate serine/threonine kinases, thereby regulating stress responses and cell cycle adjustments that are involved in cell survival and apoptosis, autophagy, cell proliferation, differentiation, mobility, maintenance of mRNA stability, and determining the type of cellular differentiation in inflammatory responses [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. MyD88, a protein that functions as an intracellular signal transduction molecule, is a component of the host innate immune system. It has been identified as a molecular target for the treatment of chronic inflammation and for antiviral and tumor induction therapies [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Toll-like receptor 4 (TLR4) is a member of the TLR family, and it plays a central role in extracellular signaling in the cell by binding to IL1 and initiating the downstream MyD88 and TRIF pathways. A few drugs targeting TLR4 have been developed for their anti-infection, antitumor, and apoptosis induction properties [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The JAK and STAT pathways involve transmembrane proteins that integrate extracellular signals into the nucleus and are involved in cell division, proliferation, death, the immune response, and tumorigenesis [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Preclinical studies have shown that targeted blockade of JAK or STAT can reduce mortality after septic shock by modulating immune function and emergency myelopoiesis and reducing multiple organ failure (MOF) [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Furthermore, studies of the molecular mechanisms underlying these processes have revealed the secretion of chemokines such as CCL1, CCL8, CXCR1, and CXCR2 by various cell types, including macrophages, neutrophils, epithelial cells, and Th17 cells, are primarily involved in inflammation, leading to the production of other inflammatory factors [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The receptors for CXCL1 and CXCL8, CXCR1 and CXCR2 tend to induce neutrophil migration to the site of injury or inflammation and are the most critical cytokines in the inflammatory cascade [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eAnalysis of the top ten upregulated pathway and downregulated pathways\u003c/h2\u003e\u003cp\u003eThe upregulation of relevant genes and pathways suggests a molecular mechanism for CRSwNP pathology, whereby intracellular signaling and interneuronal signaling is increased in response to environmental stress and stimulated by proinflammatory cytokines. Consequently, previous studies have shown that the upregulated pathways associated with CRSwNP are involved primarily in eosinophilic inflammation, immune system disorders, and microbial infection diseases. This conclusion aligns with the findings of the present study[\u003cspan additionalcitationids=\"CR36 CR37\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. The top 10 downregulated genes and pathways indicate that the molecular mechanisms underlying OS pathology are predominantly infectious immune-related diseases. Findings in the literature support the conclusions of this study [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eLimitations of this study\u003c/h2\u003e\u003cp\u003eThe lack of a normal maxillary sinus mucosa control group is more convincing for in-depth studies of the molecular mechanisms of CRS and OS. On the one hand, it was difficult to recruit subjects with normal maxillary sinus mucosa tissue. On the other hand, the main purpose of this study was to differentiate the diagnoses of CRS and OS, and the use of each group as the control for the other group satisfied the criteria for this experiment. Endotypes such as eosinophilic (E-CRSwNP) and noneosinophilic (NE-CRSwNP) were not further subdivided in this study. CRS in Europe and the United States is predominantly eosinophilic with a predominant type II inflammatory pattern[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], and in East Asia, a predominant type III inflammatory pattern with mixed type II and type III subclasses has been reported, which may affect the representativeness and comprehensiveness of the results [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. The experimental results can be subsequently validated through a multiregional collaborative program. The sample size of this experiment was small, and the results may be more convincing if the sample size is increased and a normal control group is added.\u003c/p\u003e\u003c/div\u003e"},{"header":"Conclusions","content":"\u003cp\u003eBioinformatic analysis of whole-genome expression data suggests that the mechanism of chronic rhinosinusitis with nasal polyps (CRSwNP) is associated primarily with eosinophil-associated TH2-type inflammatory responses and immune- and infection-related diseases, whereas the role of infection in this mechanism remains unclear. The downregulation of the genes CXCL1, CXCL8, CXCR1 and CXCR2 suggests that OS is associated with neutrophil-associated infectious immune diseases, which lead to cytokine release and cascade reactions that promote the formation of nasal polyps, resulting in symptoms such as CRSwNP.\u003c/p\u003e\u003cp\u003eHowever, it is still unclear whether OS and CRSwNP occur simultaneously. In clinical practice, OS treatment alone cannot fully cure chronic maxillary sinus infections. Some patients require a combination of drug treatment and functional endoscopic sinus surgery (FESS). The existing literature does not report the coexistence of the two diseases. A new research plan must be designed to continue the study.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003cp\u003eApproval was obtained from the Ethics Committee of the hospital before the experiment was conducted, with ethical approval number [2020] 012.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003cp\u003eInformed consent was obtained from all participants included in the study, and routine preoperative forms were used.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e\u003cp\u003eConsent for the publication of identifying images or other personal or clinical details of participants is \"Not Applicable\".\u003c/p\u003e\u003c/p\u003e\u003ch2\u003e\u003cb\u003eAuthor information\u003c/b\u003e\u003c/h2\u003e\u003cp\u003e\u003cstrong\u003eAuthors and affiliations\u003c/strong\u003e\u003cp\u003eDepartment of Dentistry, Zhejiang Provincial Tongde Hospital, Affiliated Hospital of Zhejiang University of Chinese Medicine, Zhejiang Academy of Chinese Medicine Research 234 Guchui Road, Xihu District, Hangzhou, Zhejiang 310012, China\u003c/p\u003e\u003cp\u003eDepartment of Otolaryngology, Zhejiang Provincial Tongde Hospital, Affiliated Hospital of Zhejiang University of Traditional Chinese Medicine, Zhejiang Academy of Traditional Chinese Medicine Research, 234 Gu Cui Road, Xihu District, Hangzhou City, Zhejiang Province, 310012, China\u003c/p\u003e\u003cp\u003eBeijing Zhongkangbo Biotechnology Co., Ltd., China. 6th Floor, Digital Workshop, Jinghai Fifth Road, Economic and Technological Development Zone, Beijing. 100176\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eCorresponding author\u003c/h2\u003e\u003cp\u003eZhu Jianhua, Email: [email protected]. Tel: +8615700196953. Fax: 057189972175\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eCompeting interests\u003c/h2\u003e\u003cp\u003eAll the authors in the list and Beijing Zhongkangbo Biotechnology Co., Ltd. have no conflicts of interest regarding this paper, and all have agreed that this paper should be published in this journal.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eMost of the funds for this project were self-raised, with a portion coming from the Natural Science Foundation (Project Number: LGC22H130001).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAll the authors contributed to the study conception and design. Zhu Jianhua was involved in conceptualization of the study and methodology, formal analysis and investigation, preparation of the original draft, review and editing, revision of the project and paper, collection of materials, surgeries and sampling of patients with odontogenic maxillary sinusitis. Lin Wei participated in conceptualization, methodology development, formal analysis and investigation, original draft preparation, review and editing, revision of the project and paper, collection of materials, surgeries and sampling of patients with chronic rhinosinusitis with nasal polyps, and funding acquisition. Yuan Wenwen was responsible for patient appointments, ensuring the signing of consent forms, follow-up, preservation of biological specimens, and quality control. Feng Julin was responsible for purchasing relevant experimental materials, installing related software, conducting experimental operations, computerizing data, conducting statistical processing, and creating images.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e\u003cp\u003eMembers of the research team would like to express their gratitude to the teachers and employees of Zhong Kangbo Biotechnology Co., Ltd., for their additional assistance.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets generated and/or analysed during the current study are available in the GEO repository. under accession number GSE305123(secure token: yhghmwoizzkvxoh). To access the data, please visit [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE305132](https:/www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE305132) and enter the secure token in the provided box\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eShi JB, Fu QL, Zhang H, Cheng L, Wang YJ, Zhu DD, Lv W, Liu SX, Li PZ, Ou CQ, Xu G. Epidemiology of chronic rhinosinusitis: results from a cross-sectional survey in seven Chinese cities. Allergy. 2015;70:533\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/all.12577\u003c/span\u003e\u003cspan address=\"10.1111/all.12577\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang X, Zhang N, Bo M, Holtappels G, Zheng M, Lou H, Wang H, Zhang L, Bachert C. Diversity of T(H) cytokine profiles in patients with chronic rhinosinusitis: a multicenter study in Europe, Asia, and Oceania. J Allergy Clin Immunol. 2016;138:1344\u0026ndash;53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jaci.2016.05.041\u003c/span\u003e\u003cspan address=\"10.1016/j.jaci.2016.05.041\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Z, Chen J, Cheng L, et al. Chinese society of allergy and Chinese society of otorhinolaryngology-head and neck surgery guideline for chronic rhinosinusitis. Allergy Asthma Immunol Res. 2020;12:176\u0026ndash;237. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4168/aair.2020.12.2.176\u003c/span\u003e\u003cspan address=\"10.4168/aair.2020.12.2.176\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWautlet A, Bachert C, Desrosiers M, Hellings PW, Peters AT. The management of chronic rhinosinusitis with nasal polyps (CRSwNP) with biologics. J Allergy Clin Immunol Pract. 2023;11:2642\u0026ndash;51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jaip.2023.04.054\u003c/span\u003e\u003cspan address=\"10.1016/j.jaip.2023.04.054\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFokkens WJ, Lund VJ, Hopkins C, Hellings PW, Kern R, Reitsma S, Toppila-Salmi S, Bernal-Sprekelsen M, Mullol J, Alobid I. European position paper on rhinosinusitis and nasal polyps 2020. Rhinology. 2020;58:1\u0026ndash;464.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFokkens WJ, Lund V, Bachert C, et al. EUFOREA consensus on biologics for CRSwNP with or without asthma. Allergy. 2019;74:2312\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/all.13875\u003c/span\u003e\u003cspan address=\"10.1111/all.13875\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin J, Wang C, Wang X, et al. Expert consensus on odontogenic maxillary sinusitis multi-disciplinary treatment. Int J Oral Sci. 2024;16:11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41368-024-00278-z\u003c/span\u003e\u003cspan address=\"10.1038/s41368-024-00278-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAllevi F, Fadda GL, Rosso C, Martino F, Pipolo C, Cavallo G, Felisati G, Saibene AM. Diagnostic criteria for odontogenic sinusitis: a systematic review. Am J Rhinol Allergy. 2021;35:713\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/1945892420976766\u003c/span\u003e\u003cspan address=\"10.1177/1945892420976766\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHwang JW, Lee KJ, Choi IH, Han HM, Kim TH, Lee SH. Decreased expression of type I (IFN-beta) and type III (IFN-lambda) interferons and interferon-stimulated genes in patients with chronic rhinosinusitis with and without nasal polyps. J Allergy Clin Immunol. 2019;144:1551\u0026ndash;e15652. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jaci.2019.08.010\u003c/span\u003e\u003cspan address=\"10.1016/j.jaci.2019.08.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBassiouni A, Ou J, Schreiber A, Geoghegan J, Tsykin A, Psaltis AJ, Wormald PJ, Vreugde S. The global transcriptomic signature in sinonasal tissues reveals roles for tissue type and chronic rhinosinusitis disease phenotype. Rhinology. 2020;58:273\u0026ndash;83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4193/Rhin19.403\u003c/span\u003e\u003cspan address=\"10.4193/Rhin19.403\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBauer WH. Maxillary sinusitis of dental origin. Am J Orthod Oral Surg. 1943;29:B133\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKit S. (2005) GeneChip\u0026reg; expression analysis technical manual.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePradervand S, Paillusson A, Thomas J, Weber J, Wirapati P, Hagenb\u0026uuml;chle O, Harshman K. Affymetrix whole-transcript human gene 1.0 ST array is highly concordant with standard 3' expression arrays. Biotechniques. 2008;44:759\u0026ndash;62. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2144/000112751\u003c/span\u003e\u003cspan address=\"10.2144/000112751\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIrizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U, Speed TP. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics. 2003;4:249\u0026ndash;64. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/biostatistics/4.2.249\u003c/span\u003e\u003cspan address=\"10.1093/biostatistics/4.2.249\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSmyth GK. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol. 2004;3. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2202/1544-6115.1027\u003c/span\u003e\u003cspan address=\"10.2202/1544-6115.1027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. :Article3.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSmyth GK, Michaud J, Scott HS. Use of within-array replicate spots for assessing differential expression in microarray experiments. Bioinformatics. 2005;21:2067\u0026ndash;75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/bti270\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/bti270\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCraig JR, Poetker DM, Aksoy U, et al. Diagnosing odontogenic sinusitis: an international multidisciplinary consensus statement. Int Forum Allergy Rhinol. 2021;11:1235\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/alr.22777\u003c/span\u003e\u003cspan address=\"10.1002/alr.22777\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCraig JR, Tataryn RW, Sibley HC, Mason WD, Deuel JA, Loyd GE, Nerenz DR, Goyal P. Expected costs of primary dental treatments and endoscopic sinus surgery for odontogenic sinusitis. Laryngoscope. 2022;132:1346\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/lary.29825\u003c/span\u003e\u003cspan address=\"10.1002/lary.29825\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVitali FC, Santos PS, Massignan C, Maia LC, Cardoso M, Teixeira CDS. Global prevalence of maxillary sinusitis of odontogenic origin and associated factors: a systematic review and meta-analysis. J Endod. 2023;49:369\u0026ndash;e38111. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.joen.2023.01.010\u003c/span\u003e\u003cspan address=\"10.1016/j.joen.2023.01.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlaqla A, Alhasoun M, Asseery M, Altheyabi S, Farook FF, Albanyan H, Al-Kadi MT. ENT specialists' knowledge and their skills in detecting maxillary sinusitis of odontogenic origin, a cross-sectional study. Am J Otolaryngol. 2025;46:104587. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.amjoto.2024.104587\u003c/span\u003e\u003cspan address=\"10.1016/j.amjoto.2024.104587\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRosenfeld RM, Piccirillo JF, Chandrasekhar SS, Brook I, Kumar KA, Kramper M, Orlandi RR, Palmer JN, Patel ZM, Peters A, Walsh SA, Corrigan MD. Clinical practice guideline (update): adult sinusitis executive summary. Otolaryngol Head Neck Surg. 2015;152:598\u0026ndash;609. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/0194599815574247\u003c/span\u003e\u003cspan address=\"10.1177/0194599815574247\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFokkens WJ, Lund V, Bachert C, et al. EUFOREA consensus on biologics for CRSwNP with or without asthma. Allergy. 2019;74:2312\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/all.13875\u003c/span\u003e\u003cspan address=\"10.1111/all.13875\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVogt PK. Fortuitous convergences: the beginnings of JUN. Nat Rev Cancer. 2002;2:465\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrc818\u003c/span\u003e\u003cspan address=\"10.1038/nrc818\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSimi A, Ingelman-Sundberg M, Tindberg N. Neuroprotective agent chlomethiazole attenuates c-fos, c-jun, and AP-1 activation through inhibition of p38 MAP kinase. J Cereb Blood Flow Metab. 2000;20:1077\u0026ndash;88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/00004647-200007000-00007\u003c/span\u003e\u003cspan address=\"10.1097/00004647-200007000-00007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eClere-Jehl R, Mariotte A, Meziani F, Bahram S, Georgel P, Helms J. JAK-STAT targeting offers novel therapeutic opportunities in sepsis. Trends Mol Med. 2020;26:987\u0026ndash;1002. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.molmed.2020.06.007\u003c/span\u003e\u003cspan address=\"10.1016/j.molmed.2020.06.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi G, Qi W, Li X, Zhao J, Luo M, Chen J. Recent advances in c-Jun N-terminal kinase (JNK) inhibitors. Curr Med Chem. 2021;28:607\u0026ndash;27. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2174/0929867327666200210144114\u003c/span\u003e\u003cspan address=\"10.2174/0929867327666200210144114\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSerpero L, Petecchia L, Sabatini F, Giuliani M, Silvestri M, Di Blasi P, Rossi GA. The effect of transforming growth factor (TGF)-beta1 and (TGF)-beta2 on nasal polyp fibroblast activities involved upper airway remodeling: modulation by fluticasone propionate. Immunol Lett. 2006;105:61\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.imlet.2006.01.003\u003c/span\u003e\u003cspan address=\"10.1016/j.imlet.2006.01.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMadkour MM, Anbar HS, El-Gamal MI. Current status and future prospects of p38α/MAPK14 kinase and its inhibitors. Eur J Med Chem. 2021;213:113216.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaikh KU. MyD88 and beyond: a perspective on MyD88-targeted therapeutic approach for modulation of host immunity. Immunol Res. 2021;69:117\u0026ndash;28. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12026-021-09188-2\u003c/span\u003e\u003cspan address=\"10.1007/s12026-021-09188-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSong L, Zhu S, Liu C, Zhang Q, Liang X. Baicalin triggers apoptosis, inhibits migration, and enhances anti-tumor immunity in colorectal cancer via TLR4/NF-κB signaling pathway. J Food Biochem. 2022;46:e13703. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jfbc.13703\u003c/span\u003e\u003cspan address=\"10.1111/jfbc.13703\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu Q, Bian Q, Rong D, Wang L, Song J, Huang HS, Zeng J, Mei J, Wang PY. JAK/STAT pathway: extracellular signals, diseases, immunity, and therapeutic regimens. Front Bioeng Biotechnol. 2023;11:1110765. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fbioe.2023.1110765\u003c/span\u003e\u003cspan address=\"10.3389/fbioe.2023.1110765\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIvashkiv LB, Donlin LT. Regulation of type I interferon responses. Nat Rev Immunol. 2014;14:36\u0026ndash;49. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nri3581\u003c/span\u003e\u003cspan address=\"10.1038/nri3581\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRafeie F, Abdoli R, Hossein-Zadeh NG, Talebi R, Szmatoła T. Interaction networks and pathway analysis of genetic resistance to gastrointestinal nematodes in sheep. Trop Anim Health Prod. 2023;55:34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11250-022-03448-5\u003c/span\u003e\u003cspan address=\"10.1007/s11250-022-03448-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSilva RL, Lopes AH, Guimar\u0026atilde;es RM, Cunha TM. CXCL1/CXCR2 signaling in pathological pain: role in peripheral and central sensitization. Neurobiol Dis. 2017;105:109\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.nbd.2017.06.001\u003c/span\u003e\u003cspan address=\"10.1016/j.nbd.2017.06.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi X, Meng J, Qiao X, et al. Expression of TGF, matrix metalloproteinases, and tissue inhibitors in Chinese chronic rhinosinusitis. J Allergy Clin Immunol. 2010;125:1061\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jaci.2010.02.023\u003c/span\u003e\u003cspan address=\"10.1016/j.jaci.2010.02.023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang X, Sima Y, Zhao Y, et al. Endotypes of chronic rhinosinusitis based on inflammatory and remodeling factors. J Allergy Clin Immunol. 2023;151:458\u0026ndash;68. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jaci.2022.10.010\u003c/span\u003e\u003cspan address=\"10.1016/j.jaci.2022.10.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYe X, Li Y, Fang B, et al. Type 17 mucosal-associated invariant T cells contribute to neutrophilic inflammation in patients with nasal polyps. J Allergy Clin Immunol. 2023;152:1153\u0026ndash;e116612. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jaci.2023.06.021\u003c/span\u003e\u003cspan address=\"10.1016/j.jaci.2023.06.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiang D, Zou J, Zhu X, Chen X, Luo J, Kong L, Zhang H. Physalin D attenuates hepatic stellate cell activation and liver fibrosis by blocking TGF-β/Smad and YAP signaling. Phytomedicine. 2020;78:153294. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.phymed.2020.153294\u003c/span\u003e\u003cspan address=\"10.1016/j.phymed.2020.153294\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePereira IG, Vaz P, Almeida RF, Braga AC, Felino A. IRAK4 gene polymorphism and odontogenic maxillary sinusitis. Clin Oral Investig. 2015;19:1815\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00784-015-1424-5\u003c/span\u003e\u003cspan address=\"10.1007/s00784-015-1424-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePatadia M, Dixon J, Conley D, Chandra R, Peters A, Suh LA, Kato A, Carter R, Harris K, Grammer L, Kern R, Schleimer R. Evaluation of the presence of B-cell attractant chemokines in chronic rhinosinusitis. Am J Rhinol Allergy. 2010;24:11\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2500/ajra.2010.24.3386\u003c/span\u003e\u003cspan address=\"10.2500/ajra.2010.24.3386\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCardoso JM, Ribeiro AC, Palos C, Proen\u0026ccedil;a L, Noronha S, Alves RC. Association between IL-1A and IL-1B gene polymorphisms with peri-implantitis in a Portuguese population-a pilot study. PeerJ. 2022;10:e13729. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7717/peerj.13729\u003c/span\u003e\u003cspan address=\"10.7717/peerj.13729\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang N, Liu S, Lin P, Li X, van Bruaene N, Zhang J, van Zele T, Bachert C. (2010) Remodeling and inflammation in Chinese versus white patients with chronic rhinosinusitis. J Allergy Clin Immunol 125:507; author reply 507\u0026ndash;508. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jaci.2009.10.015\u003c/span\u003e\u003cspan address=\"10.1016/j.jaci.2009.10.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Chronic Rhinosinusitis with Nasal Polyps (CRSwNP), Odontogenic Sinusitis (OS), GeneChip, PrimeView™ Human Gene Expression Array","lastPublishedDoi":"10.21203/rs.3.rs-7229477/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7229477/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eObjectives: \u003c/strong\u003eTo explore mucosal tissue gene expression and pathway differences between chronic rhinosinusitis with nasal polyps (CRSwNP) and odontogenic sinusitis (OS) using the PrimeView™ Human Gene Expression Array to identify the different molecular genetic pathways associated with the development of these two diseases.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterials and methods: \u003c/strong\u003eAccording to the “Guidelines for the Diagnosis and Treatment of Chronic Rhinosinusitis (Kunming, 2012)”and “European Rhinology Diagnostic Tools Position Paper 2019”, 12 patients with CRSwNP and OS (6 with CRSwNP and 6 with OS) were screened for surgery. The Prime View\u003csup\u003eTM\u003c/sup\u003e Human Gene Expression Array was hybridized with the RNA lysate. CRSwNP- and OS-specific differentially expressed genes (DEGs) with a more than 2-fold change in expression were considered significant and subjected to GO and pathway enrichment analyses. The top-ranked up- and downregulated DEGs were selected and used to explore the molecular mechanisms of disease development via a literature analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e A total of 1037 DEGs, including 168 upregulated genes and 869 downregulated genes, were detected in CRSwNP vs. OS. The top 10 hub genes, MAPK14, ACTB, GNAI, CXCR1, CXCR2, JAK, CXCL1, CXCL8, CCR1 and CCR2, were downregulated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eBioinformatics analysis of genome-wide expression revealed that CRSwNP is an eosinophil-associated TH2-type, immune-related and infection-related disease. OS is an infectious immune disease related to neutrophil enrichment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical relevance: \u003c/strong\u003eThis study provides a theoretical foundation for the differential diagnosis of CRSwNP and OS by dentists and otolaryngologists.\u003c/p\u003e","manuscriptTitle":"Identification of differential pathogenic mechanisms between chronic rhinosinusitis with nasal polyps and odontogenic sinusitis using the PrimeView™ Human Gene Expression Array","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-03 12:05:37","doi":"10.21203/rs.3.rs-7229477/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2df015f5-8966-4786-93d6-3d5042e73a81","owner":[],"postedDate":"September 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-12-15T11:39:01+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-03 12:05:37","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7229477","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7229477","identity":"rs-7229477","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}