Analysis of the expression and mechanism of follistatin‑like protein 1 in cervical cancer.

OA: gold CC-BY-NC-ND-4.0
⚙ AI-generated summary by gemini-2.5-flash-lite, 2026-08-03 ⓘ

Follistatin-like protein 1 (FSTL1) expression is downregulated in cervical cancer, inhibiting proliferation, migration, invasion, and promoting apoptosis via the IGF-1R/PI3K/AKT/BCL-2 pathway.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

⚙ AI-generated deep summary by qwen3.7-flash, 2026-09-03 · read from full text ⓘ

This study investigated the expression and functional role of follistatin-like protein 1 (FSTL1) in cervical cancer using tissue samples from patients and in vitro experiments with HeLa and SiHa cell lines. The researchers found that FSTL1 is significantly downregulated in cervical cancer tissues compared to normal or adjacent tissues, and its restoration inhibited cell proliferation, migration, and invasion while promoting apoptosis. These effects were mediated through the regulation of the IGF-1R/PI3K/AKT/BCL-2 signaling pathway, identifying FSTL1 as a potential tumor suppressor in this malignancy. Relevance to endometriosis: Endometriosis was included only as a source for non-tumor control tissue specimens during the collection of adjacent cervical samples, not as a subject of investigation.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

The abnormal expression of follistatin‑like protein 1 (FSTL1) in various tumors is a crucial regulator of the biological process of tumorigenesis. Nonetheless, the regulatory role of FSTL1 in cervical cancer is yet to be elucidated. Hence, the present study aimed to explore the expression, function, and molecular mechanism of FSTL1 in cervical cancer. The expression of FSTL1 in normal and cervical cancer tissues was examined using quantitative reverse transcription‑polymerase chain reaction and immunohistochemistry assays. The effects of abnormal expression of FSTL1 on cervical cancer cells were assessed using colony formation, MTT, wound‑healing, Transwell, apoptosis, and nude mouse tumorigenicity assays. FSTL1‑related molecular mechanisms were screened using gene chip analysis. Western blotting analysis was used to verify the regulatory mechanisms of FSTL1 in cervical cancer. The results indicated that the expression of FSTL1 was downregulated in cervical cancer tissues and that its downregulation was associated with tumor differentiation, pathologic type, and infiltration depth. Moreover, FSTL1 inhibited the proliferation, migration, and invasion of cervical cancer cells as well as xenograft tumor growth and promoted cell apoptosis. In addition, the findings of gene chip analysis suggested that the differentially expressed genes of FSTL1 were predominantly enriched in multiple signaling pathways, of which the insulin‑like growth factor (IGF)‑1 signaling pathway was significantly activated. Western blotting suggested the involvement of FSTL1 in the regulation of the IGF‑1R/PI3K/AKT/BCL‑2 signaling pathway. These data establish the downregulation of FSTL1 in cervical cancer tissues. FSTL1 inhibited the proliferation, migration, and invasion of cervical cancer cells and promoted their apoptosis. Furthermore, xenograft tumor growth in nude mice was inhibited. FSTL1 may be involved in the regulation of the IGF‑1R/PI3K/AKT/BCL‑2 signaling pathway in cervical cancer. Therefore, FSTL1 may be employed as a novel biomarker to determine the extent of disease progression in patients with cervical cancer.
Full text 34,393 characters · extracted from pmc-nxml · 4 sections · click to expand

Intro

Cervical cancer is one of the most common malignancies of the female reproductive system and seriously threatens the life and health of women. Approximately 570,000 new cases of cervical cancer are diagnosed annually, and ~311,000 patients succumb to the disease worldwide ( 1 ). Several investigations have indicated that the incidence of cervical cancer is closely related to human papillomavirus (HPV) infection ( 2 , 3 ). Owing to the continuous improvements in cervical cancer detection and diagnosis technologies and standardized HPV screening, the incidence of this disease has decreased in countries that have HPV screening and vaccination programs. The major issue with cervical cancer is the lack of such programs in low-income countries. Women in these countries require new therapies, which again are likely to be too expensive, but hopefully, a target can be identified. Therefore, developing novel diagnostic and therapeutic biomarkers to enhance the overall survival of patients with cervical cancer is the need of the hour. Follistatin-like protein 1 (FSTL1), a type of secretory glycoprotein, is expressed in most mammalian cells, with the exception of peripheral lymphocytes. FSTL1 is localized on chromosome 3q13.33 and comprises 308 amino acids. The protein belongs to the secreted protein acidic and rich in cysteine (SPARC) family ( 4 ). However, the functions and biological characteristics of FSTL1 are different from those of other members of the SPARC family ( 5 ). In recent years, several studies have confirmed that FSTL1 functions as a crucial regulator in various biological processes and that it has a key effect on the occurrence and development of cancer. Epithelial ovarian cancer ( 6 ), non-small cell lung cancer ( 7 ), clear cell renal cell carcinoma ( 8 ), nasopharyngeal carcinoma ( 9 ), esophageal squamous cell carcinoma ( 10 ), gastric cancer ( 11 ), prostate cancer ( 12 ), and hepatocellular carcinoma are a few examples ( 13 ). FSTL1 plays a role in several cancer-related signaling pathways. For example, the protein can retard the progression of clear cell renal cell carcinoma by inhibiting the NF-kB and HIF-2α signaling pathways ( 8 ). In hepatocellular carcinoma ( 13 ), FSTL1 promotes tumor growth by activating AKT via regulation of TLR4/CD14. With respect to cervical cancer, only one study has reported that FSTL1 could significantly inhibit the proliferation and invasion of cervical cancer cells through negative regulation of the BMP4/Smad1/5/9 signaling pathway ( 14 ). A previous study by the authors confirmed that FSTL1 is a direct target of miR-9, which is involved in the migration of cervical cancer cells ( 15 ). Nonetheless, clarity on the clinical significance and mechanism of FSTL1 is lacking in cervical cancer. Hence, in the present study, the expression, function, and molecular mechanisms of FSTL1 in cervical cancer were investigated. The expression of FSTL1 in cervical tissues was examined. Subsequently, the effects of abnormal expression of FSTL1 on cervical cancer cells were assessed using in vivo animal experiments and functional in vitro experiments. Finally, the molecular mechanisms associated with FSTL1 were examined in HeLa and SiHa cells. The results indicated the downregulation of FSTL1 in cervical cancer tissues. FSTL1 inhibited the proliferation, migration, and invasion of cervical cancer cells and promoted their apoptosis. This protein is likely to be involved in the regulation of the IGF-1R/PI3K/AKT/BCL-2 signaling pathway in cervical cancer.

Results

FSTL1 expression at the mRNA and protein levels was detected in cervical cancer tissues using RT-qPCR and IHC, respectively. The findings indicated that the expression of FSTL1 at the mRNA and protein levels was downregulated in cervical cancer tissues compared with tumor-adjacent or normal cervical tissues (P<0.001, Fig. 1A and D ). According to the observations, the expression of FSTL1 mRNA was gradually increased in cervical cancer tissues, tumor-adjacent tissues, and normal cervical tissues (P<0.001, Fig. 1A ). In addition, the expression of FSTL1 mRNA in the matched cancer tissues was downregulated compared with the tumor-adjacent tissues (P<0.001, Fig. 1B ), and that in the non-matching cancer tissues was downregulated compared with the normal cervical tissues (P<0.001, Fig. 1C ). FSTL1 protein expression was lower in the cervical cancer tissues compared with that in the normal cervical tissues (P=0.006). Moreover, the expression was predominantly localized in the nucleus, but some expression was also detected in the cytoplasm ( Fig. 1D ). To determine the relationship between FSTL1 expression and clinical features in patients with cervical cancer, the cervical cancer tissues were categorized into high- and low-expression groups based on the median expression of FSTL1 mRNA. The low expression of FSTL1 mRNA was observed to be associated with the infiltration depth (P=0.037) and pathologic type (P=0.05) ( Table I ). Subsequently, the cervical cancer tissues were classified into high- and low-expression groups based on the median IRS of FSTL1 protein expression. The findings demonstrated that the low expression of FSTL1 at the protein level was linked to the infiltration depth (P=0.021) and degree of differentiation (P=0.002). On the contrary, the expression of FSTL1 at the mRNA and protein levels was not related to age, FIGO stage, or lymph node metastasis (P>0.05) ( Table I ). HeLa and SiHa cells were infected with lentivirus-FSTL1 or lentivirus-NC. Stable strains of cervical cancer cells with FSTL1 OE or KO were selected with puromycin for 2 weeks. The fluorescence efficiency of stable strains of cervical cancer cells was observed under a fluorescence microscope, which revealed that the lentiviral infection efficiency of cells with OE or KO of FSTL1 was >80% ( Fig. 2A and E ). RT-qPCR assay suggested that FSTL1 mRNA expression was upregulated in the OE group compared with the NC and mock (MOCK) groups ( Fig. 2B ). Western blotting signified that the expression of the FSTL1 protein was upregulated in the OE group compared with the NC and MOCK groups ( Fig. 2C and D ). Furthermore, RT-qPCR assay demonstrated that the expression of FSTL1 mRNA was downregulated in the KO group compared with the NC and MOCK groups ( Fig. 2F ). Western blotting assay signified that the expression of the FSTL1 protein was downregulated in the KO group compared with the NC and MOCK groups ( Fig. 2I and J ). Cruiser TM assay showed that the KO1 and KO3 targets were active, the KO2 target was inactive, and the KO3 target activity was comparatively improved ( Fig. 2G ). The sequencing of the plasmids containing the three sgRNAs is presented in Fig. 2H . These results indicated that cervical cancer cells with FSTL1 KO or OE were successfully created. To comprehend the biological characteristics of FSTL1 in vitro , HeLa and SiHa cells were infected with lentivirus-FSTL1 or lentivirus-NC. The results of the MTT assay indicated that the proliferation of both HeLa and SiHa cells was inhibited in the FSTL1 OE group compared with the NC and MOCK groups ( Fig. 3A ). Moreover, FSTL1 OE significantly inhibited the proliferation of HeLa and SiHa cells on the 3rd and 4th day respectively. Subsequently, the colony formation assay was performed to explore whether FSTL1 affected the single-cell proliferation of HeLa and SiHa cells. The colony formation rate of HeLa and SiHa cells in the OE group was lower than that in the other two control groups ( Fig. 3B ). Furthermore, the wound-healing assay demonstrated that FSTL1 OE retarded the migration of HeLa and SiHa cells when compared with that in the NC and MOCK groups ( Fig. 3C ). Furthermore, invasion and migration in Transwell assay confirmed that the number of invasive and migratory cells in the FSTL1 OE group was significantly less than that in the NC and MOCK groups ( Fig. 3D and E ). Collectively, these data established that FSTL1 inhibited the migration and invasion abilities of HeLa and SiHa cells and that it may be a metastasis-related gene in cervical cancer. Finally, the effect of FSTL1 on apoptosis was detected using flow cytometric analysis. Apoptosis assay demonstrated that the number of apoptotic cells in the FSTL1 OE group was significantly higher than that in the NC and MOCK groups ( Fig. 3F ), which proved that the OE of FSTL1 promoted apoptosis in cervical cancer cells. To decipher the effects of FSTL1 depletion on the biological function of cervical cancer cells, HeLa and SiHa cells were infected with lentivirus-Cas9-sgRNA-FSTL1 or lentivirus-Cas9-sgRNA-NC. MTT assay was subsequently performed, which indicated that the proliferation of both HeLa and SiHa cells was promoted in the FTL1 KO group compared with the NC and MOCK groups ( Fig. 4A ). KO of FSTL1 significantly promoted the proliferation of HeLa and SiHa cells from the 2nd day. The colony formation assay revealed that the KO of FSTL1 promoted the single-cell proliferation of HeLa and SiHa cells ( Fig. 4B ). Furthermore, the results of the wound-healing assay demonstrated that the KO of FSTL1 accelerated the migration of HeLa and SiHa cells compared with the two control groups ( Fig. 4C ). Moreover, invasion and migration in the Transwell assay confirmed that the number of invasive and migratory cells in the KO group was significantly higher than that in the two control groups ( Fig. 4D and E ). Succinctly, these results confirmed that the KO of FSTL1 augmented the migration and invasion abilities of HeLa and SiHa cells. Apoptosis assay further revealed that the number of apoptotic cells in the KO group was significantly less than that in the two control groups ( Fig. 4F ). Collectively, these results confirmed that the KO of FSTL1 inhibited the apoptosis of cervical cancer cells. To determine the biological function of FSTL1 in vivo , cervical cancer cells overexpressing FSTL1 were subcutaneously injected into the axillary region of nude mice. After 27 days, the average weight and final volume of the tumor in the FSTL1 OE group were significantly lower than those in the NC group ( Fig. 5A, C and D ). RT-qPCR and IHC assays showed that the expression of FSTL1 at the mRNA and protein levels was significantly higher compared with the NC group ( Fig. 5B and E ). Moreover, cervical cancer cells with FSTL1 KO were subcutaneously injected into the axillary region of nude mice ( Fig. 6A-E ). The findings signified that the biological functions of the FSTL1 KO group were opposite to those of the OE group in vivo . Collectively, FSTL1 could inhibit xenograft tumor growth in nude mice. To clarify the regulatory mechanism of FSTL1 in cervical cancer, gene chip analysis and bioinformatics methods were used to analyze the interaction and relationship between FSTL1 and its downstream signaling pathways. The results of gene chip analysis suggested that compared with the NC group, 881 differentially expressed genes were present in the OE group, of which 593 were upregulated and 288 were downregulated ( Fig. 7B and Table II ). Disease and functional enrichment analysis revealed that the differentially expressed genes were predominantly involved in regulating biological processes including cancer development, damage and development of the body, gastrointestinal diseases and gene expression ( Fig. 7A ). Furthermore, according to KEGG and IPA signaling pathway enrichment analysis, the differentially expressed genes of FSTL1 were chiefly enriched in cancer transcriptional misregulation, mitogen-activated protein kinase (MAPK), cancer, P53, and IGF-1 signaling pathways, of which the IGF-1 signaling pathway was significantly activated in this experiment ( Fig. 7C ; Table III ). The results of western blotting analysis suggested that FSTL1 OE downregulated IGF-1R, PI3K, P-AKT and BCL-2 but upregulated BAX ( Fig. 7D-F ). On the contrary, FSTL1 KO restored these changes ( Fig. 7D, G and H ). These findings indicated that in cervical cancer, FSTL1 may be involved in the regulation of the IGF-1R/PI3K/AKT signaling pathway, thereby leading to the activation of the BCL-2 family.

Discussion

In the present study, the expression of FSTL1 in cervical cancer tissues was detected using RT-qPCR and IHC analyses. These investigations revealed that the expression of FSTL1 mRNA and protein was significantly decreased in cervical cancer tissues compared with the corresponding tumor-adjacent and normal cervical tissues. These findings were consistent with the latest relevant studies, affirming that the FSTL1 expression is reduced in cervical cancer tissues ( 14 ). The results also established a gradual increase in the expression of FSTL1 mRNA in cervical cancer, tumor-adjacent and normal cervical tissues. Furthermore, the FSTL1 expression was associated with the clinicopathological features of patients with cervical cancer. Low FSTL1mRNA expression was observed in association with the extent of tumor differentiation and infiltration depth, whereas low FSTL1 protein expression was associated with the pathological type and infiltration depth. Thus, infiltration depth was associated with both mRNA and protein expression levels. Nonetheless, several discrepancies were observed between the IHC and mRNA expression levels of FSTL1. This difference may be attributed to multiple levels of gene expression regulation, the transcription level regulation being the only one link, and post-transcriptional, translational and post-translational regulations playing a role in the final protein expression. Moreover, factors including mRNA degradation, protein degradation, modification and folding may have contributed to the inconsistency between mRNA abundance and the protein expression ( 18 , 19 ). Next, stable strains of cervical cancer with FSTL1 OE and KO were constructed in HeLa and SiHa cells. Certain functional assays were performed both in vitro and in vivo . The findings demonstrated that FSTL1 OE inhibited the proliferation, migration and invasion of HeLa and SiHa cells and enhanced their apoptosis in vitro . In addition, FSTL1 OE suppressed xenograft tumor growth in nude mice in vivo , whereas inhibition of FSTL1 expression resulted in the opposite effect. These observations support that FSTL1 is a potential new diagnostic marker for cervical cancer. Therefore, it is feasible to detect the expression of FSTL1 in sample tissues to estimate progression in cervical cancer cases. However, there are several drawbacks to tissue protein detection method, including that it is time-consuming and expensive and the inaccessibility to dynamic contrast and follow-up after lesion resection. The detection of the gene expression in the blood is convenient, economical and highly accepted by patients. This technique can be dynamically compared after treatment and is convenient for follow-up observation. If the expression of FSTL1 mRNA in the blood is correlated with the clinical pathology of cervical cancer patients, the FSTL1 level in the blood of cervical cancer patients could serve as one of the severity indicators to assist in the judging of the progression of cervical cancer. However, FSTL1 expression in the blood was not examined in the present study. Previous studies have reported that FSTL1 participates in the occurrence of tumors by regulating multiple signaling pathways, such as the NF-kB ( 6 ) and BMP/Smad signaling pathways ( 14 ). In the present study, it was revealed that several novel signaling pathways regulated by FSTL1 are closely related to the occurrence and development of cervical cancer. The results of gene chip analysis indicated the presence of 881 differentially expressed genes after FSTL1 OE. These genes were chiefly enriched in cancer transcriptional misregulation, MAPK, cancer, P53 and IGF-1 signaling pathways. Of these, the IGF-1 signaling pathway was markedly altered. Previous studies have identified that IGF-1 and its receptor (IGF-1R) are aberrantly expressed in several tumors, stimulating the growth of different types of cells and blocking their apoptosis ( 20 – 23 ). IGF-1 promotes cancer development mainly via the PI3K/AKT ( 24 , 25 ) and Ras/MAPK pathways ( 26 ). Disorders related to the PI3K/AKT signaling pathway occur in various human diseases, including cancer ( 27 , 28 ), diabetes ( 29 ), cardiovascular ( 30 ) and neurological disease ( 31 ). In cancer, activated AKT regulates different cellular biological functions in the following ways: i) regulation of cell growth by activating mTOR and downstream molecules ( 25 ); ii) regulation of cell proliferation by phosphorylating p27 ( 32 ) iii) direct inhibition of cell apoptosis by inhibiting apoptotic proteins (such as BAX) ( 33 ) or transcription factors (such as FOXO) ( 34 ) iv) participation in cell migration and invasion by regulating E-cadherin and vimentin ( 35 ) and v) regulation of NF-κB signaling pathway via phosphorylation of IKK ( 36 ). Bcl-2 is one of the key effector molecules downstream of the PI3K/AKT signaling pathway and can inhibit cell apoptosis and lead to various diseases ( 37 ). When PI3K-dependent AKT is activated, Bcl-2 is phosphorylated, and free Bcl-2 exerts an antiapoptotic effect ( 37 ). Hers et al ( 38 ) reported that the PI3K/AKT signaling pathway regulates tumor cells by phosphorylating a range of downstream targets, including Bcl-2 family members and caspase. Yang et al ( 13 ) observed that FSTL1 inhibited cell apoptosis in hepatocellular carcinoma by silencing AKT/GSK-3β/Bcl2/BAX/Bim signaling. In the present study, for the first time to the best of our knowledge, it was demonstrated that the OE of FSTL1 downregulated IGF-1R, PI3K, P-AKT and BCL-2 but upregulated BAX. KO of FSTL1 restored these changes. These findings suggest the involvement of FSTL1 in the regulation of the IGF-1R/PI3K/AKT/BCL-2 signaling pathway in cervical cancer. Collectively, the present study revealed that FSTL1 was downregulated in cervical cancer tissues. FSTL1 inhibited the proliferation, migration and invasion of cervical cancer cells and promoted their apoptosis. Furthermore, FSTL1 inhibited xenograft tumor growth in nude mice. FSTL1 may be involved in the regulation of the IGF-1R/PI3K/AKT/BCL-2 signaling pathway in cervical cancer. Hence, it may be exploited as a novel biomarker to evaluate disease progression in patients with cervical cancer. Prognosis evaluation and treatment in such patients could therefore be improved.

Materials|Methods

A total of 117 cervical cancer tissues were collected from the People's Hospital of Guangxi Zhuang Autonomous Region (Nanning, China) between September 2012 and June 2017. The non-tumor tissues were composed of 29 tumor-adjacent tissues and 43 normal cervical tissues, including uterine prolapse (n=4), endometriosis (n=19), and hysteromyoma (n=20), which were collected during the same period. None of the patients received any treatment before the operation, as confirmed by pathologists after the operation. The clinical data of all patients with cervical cancer are shown in Table I . HeLa and SiHa cells were obtained from the Shanghai Cell Bank, Chinese Academy of Sciences. HeLa and SiHa cells were maintained in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal cow serum (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 1% penicillin and streptomycin at 37°C in a humidified atmosphere containing 5% CO 2 . The present study complied with the guidelines outlined in the Declaration of Helsinki and was approved (approval no. KY-LW-2017-5) by the Ethics Committee of the People's Hospital of Guangxi Zhuang Autonomous Region (Nanning, China). Written informed consent was obtained from all patients. Total RNA was extracted by using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and 500 ng of purified RNA was reverse transcribed into cDNA by using the Takara Reverse Transcription kit, following the manufacturer's instructions. RT-qPCR was performed by using the SYBR Green PCR Master Mix Kit on the ABI 7500 Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). Briefly, after an initial denaturation step at 95°C for 15 min, the amplifications were conducted with 40 cycles at a melting temperature of 95°C for 10 sec, followed by an annealing temperature of 60°C for 23 sec. GAPDH was selected as the housekeeping gene. The relative expression of FSTL1 was calculated by using the standard 2 −ΔΔCq method ( 16 ). The special primer sequences used were as follows: FSTL1 forward, 5′-GAGGGCAAGAGTACACCA-3′ and reverse, 5′-TACGGCATAGACGACAGC-3′; GAPDH forward, 5′-CATGAGAAGTATGACAACAGCCT-3′ and reverse, 5′-AGTCCTTCCACGATACCAAAG-3′. The FSTL1 mRNA expression was divided into high-expression and low-expression groups based on the median expression of FSTL1 mRNA. The cervical tissues were fixed in 4% polyoxymethylene for 24 h at room temperature, embedded in paraffin and made into 3.5-µm thick sections. All cervical tissue sections were dewaxed and hydrated by an automatic dewaxing machine (ST5020; Leica Microsystems GmbH). The slides were treated under high pressure for antigen retrieval and 3% hydrogen peroxide to remove endogenous peroxidase. Subsequently, the sections were incubated with specific primary antibodies against FSTL1 (1:250; cat. no. ab71548; Abcam) at 4°C overnight. Known positive tissues (prostate cancer) were assigned to the positive-control group and phosphate-buffered saline (PBS) was used instead of the primary antibody in the negative-control group. The slides were then incubated with goat-anti-mouse/rabbit secondary antibodies (cat. no. PV-9000; OriGene Technologies, Inc.) at 37°C for 20 min, followed by staining by using the DAB detection kit (cat. no. ZLI9018; OriGene Technologies, Inc.). The slides were sequentially stained with hematoxylin, followed by differentiation in 0.5% hydrochloric acid alcohol, 1% ammonia water anti-blue, gradient alcohol dehydration, and neutral gum sealing. Finally, the slides were examined using a light microscope (BX51; Olympus Corporation). The proportion of stained cells was scored as follows: 0–25% ( 1 ), 25–50% ( 2 ), 50–75% ( 3 ), and 75–100% ( 4 ). The intensity of the stained cells was scored as follows: negative (0), weak ( 1 ), moderate ( 2 ) and strong ( 3 ). The final immunoreactivity score (IRS) was counted by summing the proportion and intensity scores ( 17 ). The IRS was finally confirmed by two independent pathologists from the People's Hospital of Guangxi Zhuang Autonomous Region. The FSTL1 expression at the protein level was classified as high expression or low expression group based on the median of IRS. All cervical tissue slides were dewaxed and hydrated in an automatic dewaxing machine (ST5020; Leica Microsystems GmbH), followed by rinsing in distilled water for 5 min and staining with hematoxylin. Next, the slides were immersed for differentiation in 0.5% hydrochloric acid alcohol and 1% ammonia water anti-blue for a few seconds. Subsequently, the slides were washed with distilled water for 5 min and then stained with 0.5% eosin for 2 min at room temperature. Finally, the slides were subjected to dehydration in a gradient series of alcohol and then sealed with neutral gum, followed by observation using a light microscope (BX51; Olympus Corporation). Lentiviral vector harboring FSTL1 was constructed and packaged by Shanghai GeneChem Co., Ltd. Briefly, cervical cancer cells (3–6×10 4 cells/well) were seeded into six-well plates and cultured at 37°C for 24 h under a humidified atmosphere of 5% CO 2 . On the next day, the cells were infected with lentivirus-FSTL1-puro or lentivirus-negative control (NC)-puro [multiplicity of infection (MOI) was as follows: HeLa, 2×10 7 TU/ml; SiHa: 1×10 7 TU/ml] using polybrene or enhanced infection solution (Shanghai GeneChem Co., Ltd.). The culture medium was replaced after 12 h. Subsequently, puromycin (1.0 µg/ml) was added to the culture medium at 72 h after infection. The stable expression cell lines of FSTL1 were selected with puromycin for 2 weeks. The FSTL1 expression at the mRNA and protein levels in cervical cancer cells was detected by RT-qPCR and western blotting, respectively. A total of three small-guide RNAs (sgRNAs) targeting FSTL1 were designed and used to construct CRISPR/CRISPR-associated (Cas)9-FSTL1 lentiviral particles. The three sgRNA-FSTL1 sequences were as follows: sgRNA-1(KO1): AGTGTCCATCGTAATCAACC; sgRNA-2(KO2): ACTTACCTCAATGCAGAGAC; and sgRNA3(KO3): GTAAGTCCATCTGCCAGCCC. Screening of biologically active sgRNA was performed by the Cruiser ™ method. Cas9 and sgRNA lentiviral particles were constructed and packaged by Shanghai GeneChem Co., Ltd. Briefly, the cells (3–6×10 4 cells/well) were seeded into six-well plates and cultured at 37°C for 24 h in a humidified atmosphere of 5% CO 2 . On the next day, the cells were infected with lenti-cas9-puro lentiviral particles using polybrene or enhanced infection solution (Shanghai GeneChem Co., Ltd.). The culture medium was replaced after 12 h. Then, puromycin (1.2 µg/ml) was added to the culture medium at 72 h after infection. The stable expression cell lines of FSTL1 were selected with puromycin for 2 weeks. Subsequently, cervical cancer cells were infected with lenti-cas9-puro lentiviral particles, the latter being infected with lentivirus-sgRNA-FSTL1 or lentivirus-sgRNA-NC, respectively. The expression of FSTL1 at the protein level was detected by western blotting. Genomic DNA was extracted by using a nucleic acid extraction kit (cat. no. D3121; Magen Biotechnology Co., Ltd.). Active sgRNA was screened using the KO and mutation detection kit. The PCR reaction was conducted in accordance with the following system to obtain a hybrid DNA product. Briefly, after an initial denaturation step at 95°C for 2 min, amplifications were conducted with 35 cycles at a melting temperature of 95°C for 20 sec and 55°C for 20 sec, followed by an annealing temperature of 72°C for 5 min. Then, 3 µl of hybrid DNA product, 2 µl of detecase buffer, 1 µl of detecase and 4 µl of water were mixed and allowed to react for 20 min at 45°C, to which 2 µl of stop buffer was finally added. The final PCR product was detected by 2% agarose gel electrophoresis. The gel was stained with 0.5 µg/ml ethidium bromide solution for 20 min at room temperature and decolorized with deionized water for 10 min. The gel imaging analysis system (Tanon-2500; Shanghai Tianneng Technology Co., Ltd.) was used to observe and analyze the results. The special primer sequences used for this reaction were as follows: sgRNA-1(KO1) forward, 5′-TATCCATAACTGCACAAACATTCTC′ and reverse, 5′-GGCAAACCCAGCAGGCTCATAAG-3′; sgRNA-2(KO2) forward, 5′-GTATGTTTTAGGAAGAGCTAAGGAG-3′ and reverse, 5′-CCATGCTTTAAAAATCAGGAATCTG-3′; sgRNA-3(KO3) forward, 5′-ACATGTAGAGCAGCTGTAATCCTAG-3′ and reverse, 5′-TCTGACCCAACCAGCTGCTTCAATT-3′. For the cell colony formation assay, HeLa or SiHa cells (1×10 3 cells/well) were seeded into a six-well plate and cultured for 6–10 days. The cells were then washed twice with PBS and fixed with methanol for 30 min. Subsequently, the cells were stained with 1% crystal violet for 20 min at room temperature (Red Rock Reagent Factory). Finally, the fixed cells were washed twice with PBS for 10 min and enumerated manually under an inverted microscope (Olympus Corporation) when the colony contained ≥50 cells. For the MTT assay, HeLa or SiHa cells (3×10 3 cells/well) were seeded and cultured in a 96-well plate for 24, 48, 72, 96 and 120 h. Next, 20 µl of PBS containing 0.5% MTT (5 mg/ml, MilliporeSigma) was added to each well and incubated at 37°C for 4 h. Then, the culture medium was discarded and 150 µl of dimethyl sulfoxide was added to dissolve the formazan crystals. Next, 96-well plates containing cells were vibrated at 37°C for 10 min. Finally, the absorbance of each well was determined at 490 nm wavelength by using a microplate reader (Biotek Synergy H1; Agilent Technologies, Inc.). For the wound-healing assay, the experimental cells (3×10 5 cells/well) were seeded into a culture insert (cat. no. 80209; Ibidi GmbH) and cultured at 37°C for 24 h in a humidified atmosphere of 5% CO 2 . After 24 h, a wound was created by removing the culture insert. The cells were carefully washed twice in cold PBS and incubated with RPMI-1640 medium without fetal bovine serum at 37°C for 24 h. The Transwell assay was conducted in a 24-well Boyden chamber (cat. no. 3422; Corning, Inc.). Briefly, 3×10 4 cells were suspended in a serum-free medium and seeded into the upper chamber. Subsequently, 600 µl of 15% fetal bovine serum was added to the lower chamber. After the cells were cultured at 37°C for 12 h, the invasive cells were fixed with methanol for 30 min and then stained with 1% crystal violet for 20 min. Finally, the invasive cells were counted under a light microscope. For the invasion assay, Matrigel® Basement Membrane Matrix (BD Biosciences) and serum-free medium in the ratio of 1 to 3 were pre-coated to the membrane of upper chambers at 4°C and then placed at 37°C for 4–5 h to solidify. After the cells were cultured at 37°C for 24 h, the invasive cells were fixed with methanol for 30 min and stained with 1% crystal violet for 20 min. Other measurements were the same as for the migration assay. Briefly, 1×10 5 cells were collected and the apoptotic rate was detected by using the APC Annexin V/PI Apoptosis Detection kit (cat. no. KGA1022; Nanjing KeyGen Biotech Co., Ltd.) following the manufacturer's instructions. The cells were sequentially incubated with Annexin V-APC for 15 min and then with PI for 10 min in the dark. Subsequently, the cells were detected by FACS CantoII (BD Biosciences) and analyzed by Flowjo V10 (FlowJo LLC). A total of 72 female BALB/C nude mice (age 4–6 weeks old) were purchased from the Animal Experiment Center of Guangxi Medical University and housed in the specific-pathogen-free (SPF) animal facility under controlled temperature and humidity with alternating 12/12-h light and dark cycles. SPF food and sterile water were provided ad libitum . The body weight of the mice ranged from 13.52–18.64 g. The nude mice were randomly assigned to the experimental, negative-control group, and mock groups of 6 nude mice each. Briefly, 2×10 6 [1×10 7 /l (0.2 ml)] cells were subcutaneously injected into the corresponding axillary region of nude mice. The size of the tumor was measured using vernier calipers every 3 days and then calculated using the following formula: (volume=0.5× long diameter × short diameter 2 ). All nude mice were sacrificed by cervical dislocation at 27 days. The animal experiments were approved (approval no. 2201805166) by The Animal Care & Welfare Committee of Guangxi Medical University (Nanning, China). Gene chip analysis was performed in SiHa cell lines overexpressing FSTL1 when compared with negative controls. The assay and data analyses were performed at the Shanghai GeneChem Co., Ltd. in accordance with the protocols of the Affymetrix Gene Chip system. Total RNA was extracted from the cells using TRIzol reagent (Pufei Biotechnology Co., Ltd.). First, a mixture of poly-a RNA and total RNA was synthesized into first-strand cDNA. Second, first-strand cDNA was further synthesized to second-strand cDNA, as the procedure of gene chip as aforementioned by Shanghai GeneChem Co., Ltd. Then, the second-strand cDNA and IVT were applied to synthesize biotin-labeled aRNA. Finally, the data were obtained through purification, hybridization, dyeing and scanning. The results of the gene chip were analyzed and integrated with the Ingenuity Pathway Analysis (IPA) software 23.0 (Qiagen). The proteins were extracted using the RIPA buffer (cat. no. P0013C; Beyotime Institute of Biotechnology) containing protease inhibitors (P0100; Beijing Solarbio Science & Technology Co., Ltd.). The protein concentration was determined by using the BCA protein assay kit (cat. no. P001S; Beijing Solarbio Science & Technology Co., Ltd.). Equal amounts of proteins (25 µg) were subjected to 12% sodium dodecyl-sulfate polyacrylamide gel electrophoresis ( SDS - PAGE ) and then transferred onto PVDF membranes (Beijing Solarbio Science & Technology Co., Ltd.). The membranes were incubated with 5% non-fat milk at room temperature for 1 h. Subsequently, the membranes were incubated with specific primary antibodies against FSTL1 (1:500; cat. no. ab71548; Abcam), IGF-1R (1:500; cat. no. 3027; Cell Signaling Technology, Inc.), PI3K (1:250; cat. no. 4255; Cell Signaling Technology, Inc.), AKT (1:250; cat. no. 9272; Cell Signaling Technology, Inc.), phosphorylated (P-)AKT (1:250; cat. no. 4060; Cell Signaling Technology, Inc.), BCL-2 (1:500; cat. no. ab32503; Abcam), BAX (1:500; cat. no. ab32124; Abcam) and GAPDH (1:1,000; cat. no. 5174; Cell Signaling Technology, Inc.) at 4°C overnight, followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibody (1:15,000; cat. no. 7074; Cell Signaling Technology, Inc.) at 37°C for 2 h. The immunoreactive bands were visualized using the ECL kit (cat. no. P0018; Beijing Solarbio Science & Technology Co., Ltd.) and analyzed using ImageJ software (version 2.1.4.7; National Institutes of Health). The relative expression of the target proteins was normalized to GAPDH. All the data were analyzed using SPSS Statistics V22.0 software (IBM Corp.). The measurement data was tested for normal distribution using the Shapiro-Wilk method. If the data showed a normal distribution, it was expressed as the mean ± standard deviation (SD). The differences between the two groups and among the three groups were analyzed using two-independent sample Student's t-test and one-way analysis of variance (ANOVA), respectively. The least significant difference (LSD) method was applied by following ANOVA. If the data did not conform to a normal distribution, it was expressed as a median (interquartile range). The non-parametric test method was applied for the difference between the groups. Count data was described in relative numbers. The expression of FSTL1 at the mRNA and protein levels was analyzed using the Chi-square test. The mock group was equivalent to a blank control, and nothing was added to the blank group. P≤0.05 was considered to indicate a statistically significant difference (two-tailed).

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-09-27T09:11:36.575535+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-NC-ND-4.0