The autophagy-regulator gene BECN1,  T follicular regulatory and T follicular helper cell harmony in Acute Myeloid Leukemia

preprint OA: closed
Full text JSON View at publisher
Full text 111,072 characters · extracted from preprint-html · click to expand
The autophagy-regulator gene BECN1, T follicular regulatory and T follicular helper cell harmony in Acute Myeloid Leukemia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The autophagy-regulator gene BECN1, T follicular regulatory and T follicular helper cell harmony in Acute Myeloid Leukemia Salma Morsy, Asmaa Zahran, Mahmoud El-Rouby, Rania Hafez, Hanan Eltyb, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7358411/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Background Autophagy is a catabolic pathway with a controversial role regarding tumor suppression and promotion and is accused of suppressing the effect of several chemotherapeutic agents. Autophagy is also involved in regulating T cell function and immune response. This study aimed to characterize the interrelation of the autophagy-regulator gene BECN1 expression level with T follicular regulatory (Tfr) and T follicular helper (Tfh) cell ratio in acute myeloid leukemia (AML) and analyze their prognostic significance in achieving remission. Methods This study included 58 patients with denovo AML, and 26 controls. Levels of circulating Tfh and Tfr cells and analysis of fold change in BECN1 gene expression were evaluated in all participants. Patients were assessed whether they had achieved complete hematological remission after receiving induction chemotherapy or not. Results AML patients had significantly higher percentages of Tfh and Tfr cells and lower BECN1 gene expression level than the control group at the time of diagnosis. In addition, patients in the non-remission group showed a higher percentage of Tfr cells, Tfr/Tfh ratio, and BECN1 gene expression level than patients who achieved complete remission. Positive correlations were found between BECN1 expression level and both Tfr and Tfr/Tfh ratio. Conclusion the interplay between Tfh and Tfr cell imbalance and autophagy probably plays a pivotal role in AML pathogenesis and might be a good predictor of remission, eventually leading to improved outcomes and optimal treatment. Acute Myeloid Leukemia Autophagy Tfh Tfr BECN1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Acute myeloid leukemia (AML) is a malignant tumor of bone marrow myeloid lineage, clinically and genetically exhibited as diverse malignancies associated with an aberrant accumulation of immature hematopoietic progenitors in the bone marrow and peripheral blood ( 1 ). Several studies have demonstrated that self-renewing leukemic stem cells (LSCs) and leukemic blasts can use autophagy to react to distinct energetic needs during accelerated cell proliferation and mitigate the stress caused by chemotherapeutic treatment to ensure their survival ( 2 ). Autophagy is a highly conserved catabolic mechanism that directs cytosolic proteins, damaged organelles, and microbes to lysosomes for degradation ( 3 ), allowing cellular survival during stressful circumstances as starvation and infection ( 4 ). Autophagy is a multi-step process regulated by a group of protein complexes, ATG proteins, encoded by autophagy-related genes ( 5 ). Studies have shown that normal metabolic activity of hematopoietic stem cells (HSCs) is disrupted when the fundamental autophagy gene, such as TG7 or ATG5, is deleted. This causes superoxide to build up, DNA damage and promotes a preleukemic state ( 6 , 7 ). BECN1 , is a core regulatory gene related to the class III phosphatidylinositol 3-kinase (PtdIns3K) complex of the autophagy machinery. BECN1 operates by controlling the post-translation modification of several proteins ( 8 ). Interestingly, BECN1 phosphorylation has previously been shown to play a direct role in tumor progression, including tumor growth, metastasis, and chemoresistance ( 9 ). Furthermore, earlier studies on BECN1 gene in human cancer suggested that it is a haplo-insufficient tumor suppressor gene ( 10 ). T follicular helper (Tfh) cells are a subgroup of CD4 + T cells expressing CXCR5, PD-1, and ICOS ( 11 ). They are essential for regulating germinal center (GC) B cells, clonal selection, antibody production, class switching, and somatic hyper-mutations ( 12 ). It is understood that GC-Tfh cells and circulating Tfh (cTfh) cells have similar morphological and functional characteristics and that examination of cTfh subsets may reveal GC-Tfh responses ( 13 ). T follicular regulatory (Tfr) cells, a subset of regulatory T cells (Tregs), are distinguishable from other CD4 + T cell subsets mainly by the expression of Foxp3 and CXCR5 ( 14 ). Tfr cells have a crucial regulatory role in GCs. They interact with Tfh and/or B cells to limit the production of high-affinity antibodies ( 15 ). Several studies demonstrated the association of Tfh cells with disease progressiveness and treatment response in different hematologic malignancies, such as chronic lymphocytic leukemia (CLL) and acute lymphoblastic leukemia (ALL) ( 16 , 17 ). However, scarce data are available about the involvement of Tfh and Tfr in AML pathogenesis. Autophagy is known to have a cardinal role in immune response, including T-cell activation, differentiation, memory T-cell maintenance, and responses to extracellular cytokine stimuli ( 18 ). Thus, this study aimed to characterize the interrelation of the autophagy-regulator gene BECN1 expression level with Tfr and Tfh cell ratio in AML and analyze their prognostic significance in achieving remission. Patients and Methods Study subjects and design: This study is a case-control study, including 58 patients with denovo AML recruited from the Medical Oncology and Hemato-Oncology Department at South Egypt Cancer Institute and Hematology Department at Assiut University Hospital in collaboration with Clinical Pathology and Cancer Biology Departments at South Egypt Cancer Institute. Diagnosis of AML was carried out through morphologic, cytochemical, immunophenotypic, and cytogenetic studies. All patients were ≥ 18 years old. Patients with relapsed AML and those who previously received any chemotherapy were excluded from the study. Intensive Induction chemotherapy was given to patients who were < 60 years and to patients ≥ 60 years with good performance and unfavorable cytogenetics or molecular markers in the form of adriamycin 25 mg/m2, daily on days 1–3 and Cytarabine 100 mg/m 2 , continuous intravenous on days 1–7. In addition, lower intensity therapy was given for patients ≥ 60 who were not candidates for intensive therapy in the form of Cytarabine was given at 20 mg/m 2 subcutaneously twice daily on days 1–10. After induction chemotherapy, patients were assessed whether they had achieved complete hematological remission according to the 2017 Europen LeukemiaNet (ELN) response criteria ( 19 ). Twenty-six age and sex-matched apparently healthy subjects were included in the study as a control group. Samples collection and processing: Four ml of peripheral venous blood was withdrawn from AML patients before the initiation of chemotherapy and healthy donors. Each sample was divided into two ethylenediaminetetraacetic acid (EDTA) vacutainer blood collection tubes. One tube was dedicated for peripheral blood mononuclear cell (PBMC) separation, and the other was used for monoclonal antibody staining. Flow cytometry One hundred µL of whole blood was aliquoted into a sterilized test tube and stained for 15 minutes at 4°C in dark with 10 µL of Peridinin-chlorophyll-protein (PerCP) conjugated anti-CD4 (clone 11830) (Cat. No. FAB3791C, R&D system, USA), Fluorescein 6-isothiocyanate (FITC) conjugated anti-CXCR5 (clone 51505) (Cat. No. FAB190F, R&D system, USA) and Phycoerythrin (PE) conjugated anti-ICOS (clone 669222) (Cat. No. FAB6975P, R&D system, USA) monoclonal antibodies. Then, we added RBC lysis solution followed by centrifugation, washing twice with phosphate-buffered saline (PBS), and the pellet was incubated with the fixation buffer at 2–8°C for 30 minutes in the dark. After that, cells were washed with PBS and incubated with the permeabilizing solution, and 5 µl of Allophycocyanin (APC) conjugated anti-Foxp3(Clone 1054C) (Cat. No. FPK8214A, R&D system, USA) for 30 mins at 2–8°C. Finally, cells were washed and resuspended in PBS for flow cytometric analysis. Anti-human IgG was used as an isotype-matched negative control for every sample. Cell acquisition was made at a total of 50,000 events by BD FACSCanto, and analysis was performed using FACS DIVA 7.0 software (Becton Dickinson Biosciences, USA). The gating strategy is illustrated in figure (1). The percentage of CD4 + T cells expressing CXCR5 (total Tfh cells) was assessed. CD4 + CXCR5 + ICOS + Foxp3 − activated Tfh and CD4 + CXCR5 + ICOS + Foxp3 + Tfr cells were expressed as a percentage of total CD4 + CXCR5 + cells, and Tfr/Tfh ratio was calculated as the ratio between Tfr and activated Tfh cells ( 20 ). Lymphocyte Separation lymphocyte isolation from whole blood was performed using a Lymphocyte Separation Medium (LSM) according to the manufacturer’s protocol (Corning Cat. No. 25-072-Cl, life Science Group L, UK). Then, lymphocytes were resuspended in 1 ml of Trizol (Bluezol, Kat.-Nr/Cat. No. 39808) (Serva Electrophores, Germany) and stored at -80 o C. RNA extraction and cDNA synthesis: Total RNA was extracted from lymphocytes in Trizol by adding chloroform and precipitated through mixing with cold isopropyl alcohol. RNA concentration and purity were measured/ assessed for each sample using a Nanodrop spectrophotometer (Epoch, Bio Tek Instruments, Agilent Technologies Inc., USA). cDNA was synthesized from total RNA using RevertAid First Strand cDNA Synthesis Kit (Cat. No. K1622) and random hexamer primer according to the manufacturer’s specifications at the following condition: five mins at 25°C, 60 mins at 42°C and the reaction was terminated by heating for five mins at 70°C. cDNAs were stored at -20°C. Quantitative real-time polymerase chain reaction (qPCR) qPCR was performed using Maxima SYBR Green qPCR Master Mix Kit (2X) (Cat. No. K0251) (Thermo Scientific, USA) in the 7500 System Sequence Detection software (Applied Biosystems, USA). Forward and reverse pair of primers specific for BECN1 , F-5’ GGATGGTGTCTCTCGCAGAT3’, R-5’CAGTCTTCGGCTGAGGTTCT3’ and GAPDH gene, F-5’ CAGGAGGCATTGCTGATGAT3’, R-5’ GAAGGCTGGGGCTCATTT3’ were used. All Samples were amplified in triplicates, and the relative gene expression was normalized to the housekeeping gene GAPDH transcript level and quantified by the 2 −ΔΔCT method. Statistical analysis of data: JMP Pro 16 software (JMP, SAS Institute, North Carolina, USA) was used for statistical analysis. Descriptive statistics were calculated for the variables, including averages and standard errors of the mean. Student t-test was employed for parametric data, and the Mann-Whitney U test for non-parametric data. Pearson and Spearman correlation and a multilogistic regression analysis were used to test the relationship between the variables. Figures were generated by GraphPad Prism (GraphPad Software, San Diego, California, USA). Results Basic demographic and laboratory characteristics of the studied groups The present study was carried out on 58 patients with denovo AML, 29 males and 29 females, and 26 controls. Cases and controls were age and sex-matched. Demographic and laboratory data of patients and controls were demonstrated in (Table 1 ). Table 1 Demographic and laboratory data of patients with AML Variable AML patients (n = 58) Controls (n = 26) p -value Age (years) Mean ± SE Range 47.8 ± 2 19–86 42.5 ± 2 20–60 0.1 Sex number (%) Male Female 29 (50%) 29 (50%) 15 (58%) 11 (42%) 0.5 FAB Classification Number (%) M0 M1 M2 M3 M4 M5 M6 6 (10%) 2 (3%) 15 (26%) 12 (21%) 11 (19%) 11 (19%) 1 (2%) N/A N/A Bone marrow blast (%) 56.5% ±3 N/A N/A Peripheral blood blast (%) 35.9% ±3 N/A N/A Total leukocyte count (10 9 /L) 48.3 ± 8 5 ± 0.2 0.0006 Neutrophils (10 9 /L) 10.7 ± 3 4.6 ± 0.3 0.1 Monocyte (10 9 /L) 13.2 ± 4 0.6 ± 0.05 0.04 Lymphocytes (10 9 /L) 4.8 ± 0.8 2.6 ± 0.2 0.059 RBCs (10 12 /L) 2.6 ± 0.1 4.8 ± 0.1 < 0.0001 Hemoglobin (gm/dL) 7.7 ± 0.3 13.3 ± 0.3 < 0.0001 Platelets (10 9 /L) 44.7 ± 8 251.1 ± 12 < 0.0001 AML Acute Myeloid leukemia, RBCs red blood cells. Data are presented as mean ± SE or number (percent) A p -value is significant if < 0.05 Tfh and Tfr cell percentages in AML patients and controls The mean percentage of CD4 + cells was significantly lower in AML patients than in healthy controls (9 ± 1 vs. 12.9 ± 1, p = 0.02). On the contrary, the mean percentage of the total Tfh cells was significantly higher in AML patients than in the control group (5 ± 0.3 vs. 1.3 ± 0.1, p < 0.0001) (Fig. 2 a, b). The percentages of activated Tfh and Tfr cells were significantly higher in AML patients than in controls (68.6 ± 2 vs. 16.5 ± 2, p < 0.0001) and (15.3 ± 1 vs. 5.8 ± 0.7, p < 0.0001), respectively (Fig. 2 c, d). In addition, the Tfr/Tfh ratio was significantly lower in the AML patients’ group (0.2 ± 0.03 vs. 0.4 ± 0.04, p < 0.001) (Fig. 2 e). The expression level of the autophagy-regulator gene BECN1 in AML patients and controls Analysis of fold change in BECN1 gene expression showed that the gene was significantly downregulated in AML patients compared with the control group (0.5 ± 0.07 vs. 1 ± 0.3, p = 0.02), (Fig. 2 f). Relation between Tfh, Tfr cells, and BECN1 gene expression level and the treatment outcome in AML patients After receiving induction chemotherapy, AML patients were investigated to detect if they got into remission according to the 2017 ELN response criteria. Thirty-four AML patients (58.6%) achieved complete remission (CR), while twenty-four patients (41.4%) did not achieve complete remission (NCR). As shown in (Fig. 3 ), comparing the percentages of different cells and BECN1 gene expression levels between CR and NCR groups revealed a significantly higher percentage of CD4 + cells in the CR group than the NCR group (11. ±2 vs. 6.4 ± 1, p = 0.009). While the mean percentages of Tfr cells and Tfr/Tfh ratio were significantly lower in patients who achieved CR compared with those in the NCR group (11.7 ± 0.8 vs. 20.4 ± 1.5, p < 0.0001) and (0.17 ± 0.01 vs. 0.3 ± 0.02, p < 0.0001), respectively). No significant differences were observed in the frequency of either total or activated Tfh cells ( p = 0.5 and p = 0.3, respectively). Also, the CR group had a significantly lower BECN1 gene expression level than the NCR group ( p = 0.01). The prognostic value of Tfh, Tfr cells, and BECN1 gene expression level in AML patients Multivariate logistic regression analysis was employed to evaluate the prognostic significance of Tfh, Tfr cells, and BECN1 gene expression level in remission of AML. Analysis showed a statistically significant effect of Tfr cells, Tfr/Tfh ratio, and BECN1 gene expression on remission. The odds ratios of the NCR/CR groups as regards Tfr cells and Tfr/Tfh ratio were (184.2) and (315.9), with p -value of (0.0001) and (0.0003), respectively. In comparison, the odds ratio of the NCR/CR groups regarding BECN1 gene expression was (7.4) with a p -value of (0.03). Data are presented in (Table 2 ) and (Fig. 4 ). Table 2 The prognostic value of Tfh, Tfr cells, and BECN1 gene expression level in AML patients Variable Odds Ratio p- value Total Tfh cells 0.45 0.6 Activated Tfh cells 0.7 0.8 Tfr cells 184.2 0.0001 Tfr/Tfh 315.9 0.0003 BECN1 gene expression 7.4 0.03 A p -value is significant if < 0.05 Correlations between Tfh, Tfr cells , BECN1 gene expression level, and the other laboratory parameters The analysis of correlations of total Tfh, activated Tfh, and Tfr with BECN1 expression level revealed positive correlations between BECN1 expression level and each of Tfr and Tfr/Tfh ratio (r = 0.4, p = 0.02 and r = 0.4, p = 0.006, respectively). Moreover, total Tfh, activated Tfh, Tfr, and BECN1 expression level didn’t significantly correlate with the other laboratory parameters, including the percentages of blast cells in the peripheral blood and bone marrow, (Fig. 5 ). Discussion In the present study, we aimed to characterize the interrelation of the autophagy-regulator gene BECN1 expression level with Tfr and Tfh cell ratio in AML and analyze their prognostic significance in achieving remission. Our results demonstrated that AML patients had significantly lower percentage of CD4 + cells and higher percentages of total and activated Tfh as well as Tfr cells than the control group at the time of diagnosis. Moreover, patients in the non-remission group showed lower percentage of CD4 + cells and a higher percentage of Tfr cells and Tfr/Tfh ratio than patients who achieved CR. Different studies showed that leukemic changes are associated with disruptions of T cell immunity ( 21 ). In addition, it was proven that leukemic cells express inhibitory molecules, for instance, leukocyte immunoglobulin-like receptor B4 (LILRB4) ( 22 ) and CD200 ( 23 ), that interact with T cells, reducing T helper cells number, functions and augmenting Treg cells activity causing myeloid disease progression. Investigating Tfh cells regarding its role in tumorigenesis showed that these cells secret interleukin-21 (IL-21) and provide co-stimulatory factors, such as ICOS, which promote B cells proliferation, differentiation, and maturation into plasma cells generating antibodies against tumor-specific antigens and hence, enhancing long-term anti-tumor immune response ( 24 ). However, its value in predicting prognostic outcomes in cancer is still arguable. For instance, In solid tumors, Tfh cells were associated with forming tertiary lymphoid structures (TLS)/GC and better clinical responses in breast cancer ( 25 ). In addition, a research group reported that disruption of Tfh cell functions might be related to progression of hepatocellular carcinoma (HCC) and higher recurrence rate ( 26 ). On the contrary, in hematological malignancies, Zhou et al . ( 17 ) revealed a higher percentage of Tfh cells in multiple myeloma patients than in healthy controls. ( 17 ). In addition, Tfh infiltration of follicular lymphoma may have a negative effect on prognosis by enhancing lymphoid tumor survival ( 27 ). Also, in CLL, it was recognized that higher levels of co-stimulatory molecules and cytokines secreted by Tfh cells might enhance CLL-B cell survival and proliferation ( 16 ). On the other hand, it is yet unclear how cTfr cells contribute to cancer, and its prognostic importance is also debatable. For example, in diffuse large B cell lymphomas (DLBCL) and breast cancer patients, Tfr cells were significantly higher in the early stages of the disease and may contribute to intertumoral immunity ( 28 , 29 ). In the context of AML, Guo, and coauthors discovered that AML patients had a much more significant proportion of cTfr cells than did controls and that patients who had lower cTfr cell percentages at diagnosis had better outcomes for achieving CR after inductive chemotherapy ( 30 ), which is consistent with our findings in the current study. However, unlike the present results, they didn’t find differences in the cTfh frequency between AML patients and the control group. This might support the idea that immune system disruption brought on by increased cTfr cells, which results in an immune-suppressive reaction, encourages AML cell development and proliferation through GC mechanisms. Nonetheless, the discrepancy in Tfr and Tfh prognostic effect and its role in different types of cancer might be related to different pathogenesis and disease stages. So, this could justify the substantial role of cTfh and cTfr in AML development and reveal that cTfr cells and Tfr/Tfh ratio at diagnosis might be valuable prognostic biomarkers for estimating clinical outcomes in AML patients. Autophagy is a regulating mechanism for HSC maintenance and cellular destiny in normal hematopoiesis ( 31 ). Even so, In cancer, autophagy may have an impartial, tumor-suppressive, or tumor-promoting role in different conditions and stages of cancer development ( 32 ). Taking into account the crucial function of BECN1 in autophagy, A rising number of studies have examined its expression status and reported variable expression and prognostic significance in various human malignancies. High Beclin-1 levels have been linked to favorable overall survival rates in patients with non-Hodgkin lymphomas ( 33 ). Similarly, patients with breast ( 34 ) and gastric ( 35 ) malignancies have lower overall survival rates consistent with decreasing Beclin-1 levels. In contrast, patients with endometrial adenocarcinomas had poor prognoses associated with high BECN1 expression ( 36 ). Noteworthily, it was found that patients with colorectal cancer who had excessive increase or decrease in Beclin-1 levels had significantly lower overall survival rates ( 37 ). This indicates that a balance in autophagy-mediated mechanisms may be needed to achieve better prognostic outcomes in cancer patients. Regarding AML, it was reported that low expression of BECN1 was detected in intermediate and unfavorable patients compared to the normal controls. ( 38 ). Likewise, in the present study, the BECN1 gene expression level was significantly downregulated in AML patients, but a significantly lower expression was found in the patient group who achieved complete remission. These findings affirm the role of autophagy and its prognostic value in AML disease. Autophagy is a known crucial factor in leukemogenesis and chemoresistance ( 39 ). In agreement with the current findings, earlier studies have shown that most chemotherapeutic drugs may have a reduced effect on various cancers due to autophagy as a cellular defense process ( 40 ). Intriguingly, a study by Park et al. ( 41 ) revealed that elevated Beclin-1 level was connected to poor overall survival in colon cancer patients after adjuvant therapy with 5-fluorouracil. Moreover, increasing autophagic flux provides a pro-survival adaptive mechanism helping leukemic cells to overcome the chemotherapeutic effect ( 42 ). This generated the concept of using autophagy as a therapeutic target in conjunction with chemotherapy to create a more effective therapeutic mechanism to combat drug resistance, enhance clinical outcomes, and reduce drug toxicity in AML patients ( 43 ). Besides autophagy's effect on HSC functions, autophagy was also implicated in the maintenance of T-lymphoid lineage activities and response to extracellular cytokine stimuli ( 44 ). As far as we know, this is the first study characterizing the interrelation of the BECN1 expression level with Tfh and Tfr imbalance in AML and analyzing their prognostic significance in achieving remission. In the present work, levels of BECN1 expression, Tfr cells, and Tfr/Tfh ratio at diagnosis were lower in patients who passed to remission and might be good predictors of remission. Noteworthy, a positive correlation was found between the BECN1 expression level and each of Tfr and Tfr/Tfh ratio. Thus, the autophagy-related variations in circulating Tfr level in the present study might reveal the immunological state of AML patients and point to the potential immunotherapeutic implications. Considering the aforementioned results, the lower Tfr/Tfh ratio in the AML patients compared with the controls in the present study may seem illogical given the regulatory function associated with Tfr cells in AML. However, the higher increase in the frequency of activated Tfh cells than Tfr cells in AML patients might explain this unexpected finding. Conclusions The interplay between Tfh and Tfr cell imbalance and autophagy probably plays a pivotal role in AML pathogenesis and might be a good predictor of remission, eventually leading to improved outcomes and optimal treatment. Abbreviations LSC Leukemic Stem Cells TFR T Follicular Regulatory Cells TFH T Follicular Helper Cells CR Complete Remission NCR Non- Complete Remission AML Acute Myeloid Leukemia HSC Hematopoietic Stem Cells DLBCL Diffuse Large B Cell Lymphomas CLL Chronic Lymphocytic Leukemia TLS Tertiary Lymphoid Structures LILRB4 Leukocyte Immunoglobulin-Like Receptor B4 QPCR Quantitative Polymerase Chain Reaction FACS Fluorescence-Activated Cell Sorting EDTA Ethylenediaminetetraacetic Acid PBMC Peripheral Blood Mononuclear Cell Declarations Funding This work was supported by South Egypt Cancer Institute, Assiut university, Assiut, Egypt. Competing Interests The authors have no relevant financial interests to disclose. Author Contributions The study conception and design were provided by Asmaa M. Zahran and Omnia El-Badawy. Sample collection was performed by Salma G. Morsy, Hanan Eltyb, and Rania M. Hafez. All authors substantially contributed to the acquisition, analysis or interpretation of data. The first draft of the manuscript was written by Salma G. Morsy and all authors revised and critically reviewed the manuscript for important intellectual content. All authors approved the final version of this manuscript to be published. Data statement All data generated or analyzed during this study are included in this published article. Ethics approval The current study was approved by the Ethical Committee of South Egypt Cancer Institute, Assiut University (IRB No: 490), in line with the principles of the Declaration of Helsinki. Patient Consent Statement Written informed consent for the study and sample collection was obtained from every patient and control enrolled in the study after complete explanation of the purposes of the research and the procedures involved. Acknowledgment We thank the Flow Cytometry Lab., South Egypt Cancer Institute, and Medical Research Center, Faculty of Medicine, Assiut University staff for their effort to support this work. We also thank the post graduate unit at South Egypt Cancer Institute for providing a grant to assist in achieving this research. References Wachter F, Pikman Y. Pathophysiology of Acute Myeloid Leukemia. Acta Haematol. 2024;147(2):229–46. Baquero P, Dawson A, Mukhopadhyay A, Kuntz EM, Mitchell R, Olivares O, et al. Targeting quiescent leukemic stem cells using second generation autophagy inhibitors. Leukemia. 2019;33(4):981–94. Debnath J, Gammoh N, Ryan KM. Autophagy and autophagy-related pathways in cancer. Nat Rev Mol Cell Biol. 2023;24(8):560–75. Du W, Xu A, Huang Y, Cao J, Zhu H, Yang B, et al. The role of autophagy in targeted therapy for acute myeloid leukemia. Autophagy. 2021;17(10):2665–79. Levine B, Kroemer G. Biological Functions of Autophagy Genes: A Disease Perspective. Cell. 2019;176(1–2):11–42. Mortensen M, Soilleux EJ, Djordjevic G, Tripp R, Lutteropp M, Sadighi-Akha E, et al. The autophagy protein Atg7 is essential for hematopoietic stem cell maintenance. J Exp Med. 2011;208(3):455–67. Watson AS, Riffelmacher T, Stranks A, Williams O, De Boer J, Cain K, et al. Autophagy limits proliferation and glycolytic metabolism in acute myeloid leukemia. Cell death discovery. 2015;1(1):1–10. Hu F, Song D, Yan Y, Huang C, Shen C, Lan J, et al. IL-6 regulates autophagy and chemotherapy resistance by promoting BECN1 phosphorylation. Nat Commun. 2021;12(1):3651. Wei Y, Zou Z, Becker N, Anderson M, Sumpter R, Xiao G, et al. EGFR-mediated Beclin 1 phosphorylation in autophagy suppression, tumor progression, and tumor chemoresistance. Cell. 2013;154(6):1269–84. Huang W, Choi W, Hu W, Mi N, Guo Q, Ma M, et al. Crystal structure and biochemical analyses reveal Beclin 1 as a novel membrane binding protein. Cell Res. 2012;22(3):473–89. Crotty S. T follicular helper cell biology: a decade of discovery and diseases. Immunity. 2019;50(5):1132–48. Vinuesa CG, Linterman MA, Yu D, MacLennan IC. Follicular helper T cells. Annu Rev Immunol. 2016;34:335–68. He J, Tsai LM, Leong YA, Hu X, Ma CS, Chevalier N, et al. Circulating precursor CCR7loPD-1hi CXCR5 + CD4 + T cells indicate Tfh cell activity and promote antibody responses upon antigen reexposure. Immunity. 2013;39(4):770–81. Dixon ML, Leavenworth JD, Leavenworth JW. Lineage Reprogramming of Effector Regulatory T Cells in Cancer. Front Immunol. 2021;12:717421. Sage PT, Sharpe AH. T follicular regulatory cells. Immunol Rev. 2016;271(1):246–59. Wu X, Fajardo-Despaigne JE, Zhang C, Neppalli V, Banerji V, Johnston JB, et al. Altered T follicular helper cell subsets and function in chronic lymphocytic leukemia. Front Oncol. 2021;11:674492. Zhou D-M, Xu Y-X, Zhang L-Y, Sun Y, Wang Z-Y, Yuan Y-Q, et al. The role of follicular T helper cells in patients with malignant lymphoid disease. Hematology. 2017;22(7):412–8. Bronietzki AW, Schuster M, Schmitz I. Autophagy in T-cell development, activation and differentiation. Immunol Cell Biol. 2015;93(1):25–34. Döhner H, Estey EH, Amadori S, Appelbaum FR, Büchner T, Burnett AK, et al. Diagnosis and management of acute myeloid leukemia in adults: recommendations from an international expert panel, on behalf of the European LeukemiaNet. Blood J Am Soc Hematol. 2010;115(3):453–74. Zahran AM, Abdel-Rahim MH, Nasif KA, Hussein S, Hafez R, Ahmad AB, et al. Association of follicular helper T and follicular regulatory T cells with severity and hyperglycemia in hospitalized COVID-19 patients. Virulence. 2022;13(1):569–77. Hao F, Sholy C, Wang C, Cao M, Kang X. The Role of T Cell Immunotherapy in Acute Myeloid Leukemia. Cells. 2021;10(12):3376. Deng M, Gui X, Kim J, Xie L, Chen W, Li Z, et al. LILRB4 signalling in leukaemia cells mediates T cell suppression and tumour infiltration. Nature. 2018;562(7728):605–9. Coles S, Hills RK, Wang ECY, Burnett AK, Man S, Darley RL, et al. Increased CD200 expression in acute myeloid leukemia is linked with an increased frequency of FoxP3 + regulatory T cells. Leukemia. 2012;26(9):2146–8. Zhou Z-Q, Tong D-N, Guan J, Tan H-W, Zhao L-D, Zhu Y, et al. Follicular helper T cell exhaustion induced by PD-L1 expression in hepatocellular carcinoma results in impaired cytokine expression and B cell help, and is associated with advanced tumor stages. Am J Translational Res. 2016;8(7):2926. Gu-Trantien C, Loi S, Garaud S, Equeter C, Libin M, De Wind A, et al. CD4 + follicular helper T cell infiltration predicts breast cancer survival. J Clin Investig. 2013;123(7):2873–92. Jia Y, Zeng Z, Li Y, Li Z, Jin L, Zhang Z, et al. Impaired function of CD4 + T follicular helper (Tfh) cells associated with hepatocellular carcinoma progression. PLoS ONE. 2015;10(2):e0117458. Amé-Thomas P, Le Priol J, Yssel H, Caron G, Pangault C, Jean R, et al. Characterization of intratumoral follicular helper T cells in follicular lymphoma: role in the survival of malignant B cells. Leukemia. 2012;26(5):1053–63. Cha Z, Gu H, Zang Y, Wang Z, Li J, Huang W, et al. The prevalence and function of CD4 + CXCR5 + Foxp3 + follicular regulatory T cells in diffuse large B cell lymphoma. Int Immunopharmacol. 2018;61:132–9. Miao X, Guo Q, Pan Z, Xu X, Shao X, Wang X. The characteristics and novel clinical implications of CD4 + CXCR5 + Foxp3 + follicular regulatory T cells in breast cancer. Annals Translational Med. 2021;9(16). Guo Z, Chen Z, Xu Y, Zhang Y, Hu L, Yu F, et al. The Association of Circulating T Follicular Helper Cells and Regulatory Cells with Acute Myeloid Leukemia Patients. Acta Haematol. 2020;143(1):19–25. Pan H, Cai N, Li M, Liu GH, Izpisua Belmonte JC. Autophagic control of cell ‘stemness’. EMBO Mol Med. 2013;5(3):327–31. Levy JMM, Towers CG, Thorburn A. Targeting autophagy in cancer. Nat Rev Cancer. 2017;17(9):528–42. Nicotra G, Mercalli F, Peracchio C, Castino R, Follo C, Valente G, et al. Autophagy-active beclin-1 correlates with favourable clinical outcome in non-Hodgkin lymphomas. Mod Pathol. 2010;23(7):937–50. Dong M, Wan X-b, Yuan ZY, Wei L, Fan XJ, Wang T-t, et al. Low expression of Beclin 1 and elevated expression of HIF-1α refine distant metastasis risk and predict poor prognosis of ER-positive, HER2-negative breast cancer. Med Oncol. 2013;30(1):1–10. Zhou W-H, Tang F, Xu J, Wu X, Yang S-B, Feng Z-Y, et al. Low expression of Beclin 1, associated with high Bcl-xL, predicts a malignant phenotype and poor prognosis of gastric cancer. Autophagy. 2012;8(3):389–400. Giatromanolaki A, Koukourakis MI, Koutsopoulos A, Chloropoulou P, Liberis V, Sivridis E. High Beclin 1 expression defines a poor prognosis in endometrial adenocarcinomas. Gynecol Oncol. 2011;123(1):147–51. Koukourakis M, Giatromanolaki A, Sivridis E, Pitiakoudis M, Gatter K, Harris A. Beclin 1 over-and underexpression in colorectal cancer: distinct patterns relate to prognosis and tumour hypoxia. Br J Cancer. 2010;103(8):1209–14. Zare-Abdollahi D, Safari S, Movafagh A, Ghadiani M, Tabarraee M, Riazi‐Isfahani S, et al. Expression analysis of BECN 1 in acute myeloid leukemia: association with distinct cytogenetic and molecular abnormalities. Int J Lab Hematol. 2016;38(2):125–32. Auberger P, Puissant A. Autophagy, a key mechanism of oncogenesis and resistance in leukemia. Blood J Am Soc Hematol. 2017;129(5):547–52. Barnard RA, Regan DP, Hansen RJ, Maycotte P, Thorburn A, Gustafson DL. Autophagy inhibition delays early but not late-stage metastatic disease. J Pharmacol Exp Ther. 2016;358(2):282–93. Myung Park J, Huang S, Wu T-T, Foster NR, Sinicrope FA. Prognostic impact of Beclin 1, p62/sequestosome 1 and LC3 protein expression in colon carcinomas from patients receiving 5-fluorouracil as adjuvant chemotherapy. Cancer Biol Ther. 2013;14(2):100–7. Jang JE, Eom JI, Jeung HK, Chung H, Kim YR, Kim JS, et al. PERK/NRF2 and autophagy form a resistance mechanism against G9a inhibition in leukemia stem cells. J Exp Clin Cancer Res. 2020;39(1):66. Putyrski M, Vakhrusheva O, Bonn F, Guntur S, Vorobyov A, Brandts C, et al. Disrupting the LC3 Interaction Region (LIR) Binding of Selective Autophagy Receptors Sensitizes AML Cell Lines to Cytarabine. Front Cell Dev Biol. 2020;8:208. Le Texier L, Lineburg KE, Cao B, McDonald-Hyman C, Leveque-El Mouttie L, Nicholls J et al. Autophagy-dependent regulatory T cells are critical for the control of graft-versus-host disease. JCI insight. 2016;1(15). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 04 Sep, 2025 Reviewers agreed at journal 04 Sep, 2025 Reviewers invited by journal 04 Sep, 2025 Editor invited by journal 14 Aug, 2025 Editor assigned by journal 12 Aug, 2025 Submission checks completed at journal 12 Aug, 2025 First submitted to journal 12 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7358411","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":511101213,"identity":"483209e5-f2ae-42a7-89c6-932d6a2bf021","order_by":0,"name":"Salma Morsy","email":"","orcid":"","institution":"Assiut University","correspondingAuthor":false,"prefix":"","firstName":"Salma","middleName":"","lastName":"Morsy","suffix":""},{"id":511101216,"identity":"7b8db7c8-3536-4196-8efa-daa164f2fe03","order_by":1,"name":"Asmaa Zahran","email":"","orcid":"","institution":"Assiut University","correspondingAuthor":false,"prefix":"","firstName":"Asmaa","middleName":"","lastName":"Zahran","suffix":""},{"id":511101220,"identity":"0851ec2e-c30d-484b-8caf-a645b6c65676","order_by":2,"name":"Mahmoud El-Rouby","email":"","orcid":"","institution":"Cairo University","correspondingAuthor":false,"prefix":"","firstName":"Mahmoud","middleName":"","lastName":"El-Rouby","suffix":""},{"id":511101222,"identity":"3310bace-bc91-4e22-98d0-7fff42c791df","order_by":3,"name":"Rania Hafez","email":"","orcid":"","institution":"Assiut University","correspondingAuthor":false,"prefix":"","firstName":"Rania","middleName":"","lastName":"Hafez","suffix":""},{"id":511101226,"identity":"e63ca4da-86a2-489b-8cc0-b7423b29bea8","order_by":4,"name":"Hanan Eltyb","email":"","orcid":"","institution":"Assiut University","correspondingAuthor":false,"prefix":"","firstName":"Hanan","middleName":"","lastName":"Eltyb","suffix":""},{"id":511101227,"identity":"d356060c-6642-47ab-9084-f34aa20a39e9","order_by":5,"name":"Nivin Hassan","email":"","orcid":"","institution":"Assiut University","correspondingAuthor":false,"prefix":"","firstName":"Nivin","middleName":"","lastName":"Hassan","suffix":""},{"id":511101228,"identity":"9965b0c2-8742-4b1a-ae6d-9e3561abfb0d","order_by":6,"name":"omnia El-Badawy","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABEklEQVRIiWNgGAWjYJCCAwwMFgkMDEDEUAERkSBCiwRUyxkitTDAtTC2EaGFX+zswQM/aiTy+NuTn0nzzrNL3M7AfPA2D4ONXQMOLZKz8xIO9hyTKJY488xMmndbcuLOBrZkax6GtGRcWgxu5xgc4GGTSGy4kWB2m3cbc+KGAzxm0jwMh5NxOQyk5eCffxKJ82+kf7vNO6ceqIX/G1DLf7xaDvO2SSRuuJEDtKXhMMgWNqCWA3a4tEjOBmqR7ZMoNjzzpvznnGPHjTccZjO2nGOQnIBLC790jvHHN99s8uSOp282eFNTLbvhePPDG28q7OxxaUEBTDwgkhnsYIbEBmK0MP5A4hBnyygYBaNgFIwEAADCuVvX0ljSQwAAAABJRU5ErkJggg==","orcid":"","institution":"Assiut University","correspondingAuthor":true,"prefix":"","firstName":"omnia","middleName":"","lastName":"El-Badawy","suffix":""}],"badges":[],"createdAt":"2025-08-12 18:08:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7358411/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7358411/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":91074447,"identity":"0e6ea845-fe66-461c-ae95-0ab1ef171223","added_by":"auto","created_at":"2025-09-11 11:03:04","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":72946,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFlow cytometric detection of follicular helper and follicular regulatory T cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;(A)\u003c/strong\u003e A forward and side scatter histogram defined the lymphocyte population.\u003cstrong\u003e (B) \u003c/strong\u003eThe expression of CD4 was detected among the lymphocyte population; then CD4\u003csup\u003e+\u003c/sup\u003e cells were gated for further analysis. \u003cstrong\u003e(C) \u003c/strong\u003eThe percentage of CD4\u003csup\u003e+\u003c/sup\u003e T cells expressing CXCR5 (total Tfh cells) was assessed. \u003cstrong\u003e(D)\u003c/strong\u003e CD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003eICOS\u003csup\u003e+\u003c/sup\u003eFoxp3\u003csup\u003e- \u003c/sup\u003eTfh cells were identified as activated Tfh cells (Q1), and Tfr cells were identified as CD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003eICOS\u003csup\u003e+\u003c/sup\u003eFoxp3\u003csup\u003e+\u003c/sup\u003e cells (Q2).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7358411/v1/13aaec256f75e870e431d14d.png"},{"id":91076561,"identity":"486d279a-3158-4eb6-b186-1f7dfac70a63","added_by":"auto","created_at":"2025-09-11 11:11:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":36421,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eComparison of Tfh, Tfr cells and expression levels of autophagy-regulator gene BECN1 between AML patients and controls\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A\u003c/strong\u003e) The mean percentage of CD4+ cells was significantly lower in AML patients than in healthy controls. \u003cstrong\u003e(B)\u003c/strong\u003e The mean percentage of total Tfh cells was significantly higher in AML patients than the control group \u003cstrong\u003e(C)\u003c/strong\u003e The mean percentages of activated Tfh cells and \u003cstrong\u003e(D)\u003c/strong\u003e Tfr cells were significantly higher in AML patients than in controls \u003cstrong\u003e(E)\u003c/strong\u003e Tfr/Tfh ratio was significantly lower in AML patients. \u003cstrong\u003e(F)\u003c/strong\u003e BECN1 gene expression is significantly downregulated in AML patients compared with the control group. Data were represented as mean ± SE, p-value is significant if \u0026lt;0.05 (*p\u0026lt;0.05, ** p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7358411/v1/6904e7c7394cef57aedb08b0.png"},{"id":91074448,"identity":"724b60f7-d847-4fc9-b0ea-6dd5af7d7b36","added_by":"auto","created_at":"2025-09-11 11:03:04","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":28920,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRelations between Tfh, Tfr cells, and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBECN1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e gene expression level and the treatment outcome in AML patients\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Mean percentage of CD4 cells is significantly lower in the NCR group than in the CR group.\u003cstrong\u003e (B\u003c/strong\u003e) there is no significant difference in the mean of total Tfh between CR and NCR groups. \u003cstrong\u003e(C) \u003c/strong\u003ethere is no significant difference in the mean of activated Tfh between CR and NCR groups. \u003cstrong\u003e(D) \u003c/strong\u003eThe Mean percentage of Tfr cells is significantly lower in the CR group than in the NCR group. \u003cstrong\u003e(E)\u003c/strong\u003e Mean percentage of the Tfr/Tfr ratio is significantly lower in the CR group than in the NCR group\u003cstrong\u003e. (F) \u003c/strong\u003eBECN1 gene expression level is significantly lower in the CR group than in NCR. Data are presented as mean ± SEM, p-value is significant if \u0026lt;0.05 (*p\u0026lt;0.05, ** p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001)\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7358411/v1/c2ecf5d7c94d4a9c3a55d565.png"},{"id":91078228,"identity":"76cbcf94-7404-4036-b193-0bb8b1597b07","added_by":"auto","created_at":"2025-09-11 11:19:04","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":38261,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe prognostic value of (a) follicular regulatory T cells and (b) \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBECN1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e gene expression level in AML patients.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7358411/v1/0ee291d3a720a31384439039.png"},{"id":91074449,"identity":"50ede154-2ff5-4c24-a9c9-7120f5f1a2b4","added_by":"auto","created_at":"2025-09-11 11:03:04","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":42322,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCorrelations of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBECN1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e gene expression level with (A) the frequency of Tfr and (B) Tfr/Tfh ratio.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7358411/v1/9b537bee6a8aedbff904e084.png"},{"id":91080317,"identity":"2ea1859e-1c95-411f-b37a-56c26709f5cc","added_by":"auto","created_at":"2025-09-11 11:35:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1472765,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7358411/v1/f99a37a3-b793-4e01-af6d-dea974b45441.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The autophagy-regulator gene BECN1, T follicular regulatory and T follicular helper cell harmony in Acute Myeloid Leukemia","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAcute myeloid leukemia (AML) is a malignant tumor of bone marrow myeloid lineage, clinically and genetically exhibited as diverse malignancies associated with an aberrant accumulation of immature hematopoietic progenitors in the bone marrow and peripheral blood (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Several studies have demonstrated that self-renewing leukemic stem cells (LSCs) and leukemic blasts can use autophagy to react to distinct energetic needs during accelerated cell proliferation and mitigate the stress caused by chemotherapeutic treatment to ensure their survival (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAutophagy is a highly conserved catabolic mechanism that directs cytosolic proteins, damaged organelles, and microbes to lysosomes for degradation (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e), allowing cellular survival during stressful circumstances as starvation and infection (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Autophagy is a multi-step process regulated by a group of protein complexes, ATG proteins, encoded by autophagy-related genes (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Studies have shown that normal metabolic activity of hematopoietic stem cells (HSCs) is disrupted when the fundamental autophagy gene, such as TG7 or ATG5, is deleted. This causes superoxide to build up, DNA damage and promotes a preleukemic state (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cem\u003eBECN1\u003c/em\u003e, is a core regulatory gene related to the class III phosphatidylinositol 3-kinase (PtdIns3K) complex of the autophagy machinery. \u003cem\u003eBECN1\u003c/em\u003e operates by controlling the post-translation modification of several proteins (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Interestingly, \u003cem\u003eBECN1\u003c/em\u003e phosphorylation has previously been shown to play a direct role in tumor progression, including tumor growth, metastasis, and chemoresistance (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Furthermore, earlier studies on \u003cem\u003eBECN1\u003c/em\u003e gene in human cancer suggested that it is a haplo-insufficient tumor suppressor gene (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eT follicular helper (Tfh) cells are a subgroup of CD4\u003csup\u003e+\u003c/sup\u003e T cells expressing CXCR5, PD-1, and ICOS (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). They are essential for regulating germinal center (GC) B cells, clonal selection, antibody production, class switching, and somatic hyper-mutations (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). It is understood that GC-Tfh cells and circulating Tfh (cTfh) cells have similar morphological and functional characteristics and that examination of cTfh subsets may reveal GC-Tfh responses (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). T follicular regulatory (Tfr) cells, a subset of regulatory T cells (Tregs), are distinguishable from other CD4\u003csup\u003e+\u003c/sup\u003e T cell subsets mainly by the expression of Foxp3 and CXCR5 (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Tfr cells have a crucial regulatory role in GCs. They interact with Tfh and/or B cells to limit the production of high-affinity antibodies (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSeveral studies demonstrated the association of Tfh cells with disease progressiveness and treatment response in different hematologic malignancies, such as chronic lymphocytic leukemia (CLL) and acute lymphoblastic leukemia (ALL) (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). However, scarce data are available about the involvement of Tfh and Tfr in AML pathogenesis. Autophagy is known to have a cardinal role in immune response, including T-cell activation, differentiation, memory T-cell maintenance, and responses to extracellular cytokine stimuli (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Thus, this study aimed to characterize the interrelation of the autophagy-regulator gene \u003cem\u003eBECN1\u003c/em\u003e expression level with Tfr and Tfh cell ratio in AML and analyze their prognostic significance in achieving remission.\u003c/p\u003e"},{"header":"Patients and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStudy subjects and design:\u003c/h2\u003e\u003cp\u003eThis study is a case-control study, including 58 patients with denovo AML recruited from the Medical Oncology and Hemato-Oncology Department at South Egypt Cancer Institute and Hematology Department at Assiut University Hospital in collaboration with Clinical Pathology and Cancer Biology Departments at South Egypt Cancer Institute. Diagnosis of AML was carried out through morphologic, cytochemical, immunophenotypic, and cytogenetic studies. All patients were \u0026ge;\u0026thinsp;18 years old. Patients with relapsed AML and those who previously received any chemotherapy were excluded from the study.\u003c/p\u003e\u003cp\u003eIntensive Induction chemotherapy was given to patients who were \u0026lt;\u0026thinsp;60 years and to patients\u0026thinsp;\u0026ge;\u0026thinsp;60 years with good performance and unfavorable cytogenetics or molecular markers in the form of adriamycin 25 mg/m2, daily on days 1\u0026ndash;3 and Cytarabine 100 mg/m\u003csup\u003e2\u003c/sup\u003e, continuous intravenous on days 1\u0026ndash;7. In addition, lower intensity therapy was given for patients\u0026thinsp;\u0026ge;\u0026thinsp;60 who were not candidates for intensive therapy in the form of Cytarabine was given at 20 mg/m\u003csup\u003e2\u003c/sup\u003e subcutaneously twice daily on days 1\u0026ndash;10. After induction chemotherapy, patients were assessed whether they had achieved complete hematological remission according to the 2017 Europen LeukemiaNet (ELN) response criteria (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Twenty-six age and sex-matched apparently healthy subjects were included in the study as a control group.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eSamples collection and processing:\u003c/h3\u003e\n\u003cp\u003eFour ml of peripheral venous blood was withdrawn from AML patients before the initiation of chemotherapy and healthy donors. Each sample was divided into two ethylenediaminetetraacetic acid (EDTA) vacutainer blood collection tubes. One tube was dedicated for peripheral blood mononuclear cell (PBMC) separation, and the other was used for monoclonal antibody staining.\u003c/p\u003e\n\u003ch3\u003eFlow cytometry\u003c/h3\u003e\n\u003cp\u003eOne hundred \u0026micro;L of whole blood was aliquoted into a sterilized test tube and stained for 15 minutes at 4\u0026deg;C in dark with 10 \u0026micro;L of Peridinin-chlorophyll-protein (PerCP) conjugated anti-CD4 (clone 11830) (Cat. No. FAB3791C, R\u0026amp;D system, USA), Fluorescein 6-isothiocyanate (FITC) conjugated anti-CXCR5 (clone 51505) (Cat. No. FAB190F, R\u0026amp;D system, USA) and Phycoerythrin (PE) conjugated anti-ICOS (clone 669222) (Cat. No. FAB6975P, R\u0026amp;D system, USA) monoclonal antibodies.\u003c/p\u003e\u003cp\u003e Then, we added RBC lysis solution followed by centrifugation, washing twice with phosphate-buffered saline (PBS), and the pellet was incubated with the fixation buffer at 2\u0026ndash;8\u0026deg;C for 30 minutes in the dark. After that, cells were washed with PBS and incubated with the permeabilizing solution, and 5 \u0026micro;l of Allophycocyanin (APC) conjugated anti-Foxp3(Clone 1054C) (Cat. No. FPK8214A, R\u0026amp;D system, USA) for 30 mins at 2\u0026ndash;8\u0026deg;C. Finally, cells were washed and resuspended in PBS for flow cytometric analysis. Anti-human IgG was used as an isotype-matched negative control for every sample.\u003c/p\u003e\u003cp\u003eCell acquisition was made at a total of 50,000 events by BD FACSCanto, and analysis was performed using FACS DIVA 7.0 software (Becton Dickinson Biosciences, USA). The gating strategy is illustrated in figure (1). The percentage of CD4\u003csup\u003e+\u003c/sup\u003e T cells expressing CXCR5 (total Tfh cells) was assessed. CD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003eICOS\u003csup\u003e+\u003c/sup\u003eFoxp3\u003csup\u003e\u0026minus;\u003c/sup\u003e activated Tfh and CD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003eICOS\u003csup\u003e+\u003c/sup\u003eFoxp3\u003csup\u003e+\u003c/sup\u003e Tfr cells were expressed as a percentage of total CD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003e cells, and Tfr/Tfh ratio was calculated as the ratio between Tfr and activated Tfh cells (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eLymphocyte Separation\u003c/h3\u003e\n\u003cp\u003elymphocyte isolation from whole blood was performed using a Lymphocyte Separation Medium (LSM) according to the manufacturer\u0026rsquo;s protocol (Corning Cat. No. 25-072-Cl, life Science Group L, UK). Then, lymphocytes were resuspended in 1 ml of Trizol (Bluezol, Kat.-Nr/Cat. No. 39808) (Serva Electrophores, Germany) and stored at -80 \u003csup\u003eo\u003c/sup\u003eC.\u003c/p\u003e\n\u003ch3\u003eRNA extraction and cDNA synthesis:\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from lymphocytes in Trizol by adding chloroform and precipitated through mixing with cold isopropyl alcohol. RNA concentration and purity were measured/ assessed for each sample using a Nanodrop spectrophotometer (Epoch, Bio Tek Instruments, Agilent Technologies Inc., USA). cDNA was synthesized from total RNA using RevertAid First Strand cDNA Synthesis Kit (Cat. No. K1622) and random hexamer primer according to the manufacturer\u0026rsquo;s specifications at the following condition: five mins at 25\u0026deg;C, 60 mins at 42\u0026deg;C and the reaction was terminated by heating for five mins at 70\u0026deg;C. cDNAs were stored at -20\u0026deg;C.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eQuantitative real-time polymerase chain reaction (qPCR)\u003c/h2\u003e\u003cp\u003eqPCR was performed using Maxima SYBR Green qPCR Master Mix Kit (2X) (Cat. No. K0251) (Thermo Scientific, USA) in the 7500 System Sequence Detection software (Applied Biosystems, USA). Forward and reverse pair of primers specific for \u003cem\u003eBECN1\u003c/em\u003e, F-5\u0026rsquo; GGATGGTGTCTCTCGCAGAT3\u0026rsquo;, R-5\u0026rsquo;CAGTCTTCGGCTGAGGTTCT3\u0026rsquo; and \u003cem\u003eGAPDH\u003c/em\u003e gene, F-5\u0026rsquo; CAGGAGGCATTGCTGATGAT3\u0026rsquo;, R-5\u0026rsquo; GAAGGCTGGGGCTCATTT3\u0026rsquo; were used. All Samples were amplified in triplicates, and the relative gene expression was normalized to the housekeeping gene GAPDH transcript level and quantified by the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eStatistical analysis of data:\u003c/h3\u003e\n\u003cp\u003eJMP Pro 16 software (JMP, SAS Institute, North Carolina, USA) was used for statistical analysis. Descriptive statistics were calculated for the variables, including averages and standard errors of the mean. Student t-test was employed for parametric data, and the Mann-Whitney U test for non-parametric data. Pearson and Spearman correlation and a multilogistic regression analysis were used to test the relationship between the variables. Figures were generated by GraphPad Prism (GraphPad Software, San Diego, California, USA).\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eBasic demographic and laboratory characteristics of the studied groups\u003c/h2\u003e\u003cp\u003eThe present study was carried out on 58 patients with denovo AML, 29 males and 29 females, and 26 controls. Cases and controls were age and sex-matched. Demographic and laboratory data of patients and controls were demonstrated in (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab1\" border=\"1\" class=\"fr-table-selection-hover\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eDemographic and laboratory data of patients with AML\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eVariable\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAML patients\u003c/p\u003e\n \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;58)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eControls\u003c/p\u003e\n \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;26)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ep\u003c/em\u003e-value\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAge (years)\u003c/p\u003e\n \u003cp\u003eMean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE\u003c/p\u003e\n \u003cp\u003eRange\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e47.8\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u003c/p\u003e\n \u003cp\u003e19\u0026ndash;86\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e42.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u003c/p\u003e\n \u003cp\u003e20\u0026ndash;60\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSex number (%)\u003c/p\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e29 (50%)\u003c/p\u003e\n \u003cp\u003e29 (50%)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e15 (58%)\u003c/p\u003e\n \u003cp\u003e11 (42%)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e0.5\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eFAB Classification\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eNumber (%)\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eM0\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eM1\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eM2\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eM3\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eM4\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eM5\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eM6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e6 (10%)\u003c/p\u003e\n \u003cp\u003e2 (3%)\u003c/p\u003e\n \u003cp\u003e15 (26%)\u003c/p\u003e\n \u003cp\u003e12 (21%)\u003c/p\u003e\n \u003cp\u003e11 (19%)\u003c/p\u003e\n \u003cp\u003e11 (19%)\u003c/p\u003e\n \u003cp\u003e1 (2%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eBone marrow blast (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e56.5% \u0026plusmn;3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ePeripheral blood blast (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e35.9% \u0026plusmn;3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal leukocyte count (10\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e9\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e/L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e48.3\u0026thinsp;\u0026plusmn;\u0026thinsp;8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.0006\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNeutrophils (10\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e9\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e/L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e10.7\u0026thinsp;\u0026plusmn;\u0026thinsp;3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eMonocyte (10\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e9\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e/L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e13.2\u0026thinsp;\u0026plusmn;\u0026thinsp;4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.04\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eLymphocytes (10\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e9\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e/L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.059\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eRBCs (10\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e12\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e/L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;\u0026thinsp;0.0001\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eHemoglobin (gm/dL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;\u0026thinsp;0.0001\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ePlatelets (10\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e9\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e/L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e44.7\u0026thinsp;\u0026plusmn;\u0026thinsp;8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e251.1\u0026thinsp;\u0026plusmn;\u0026thinsp;12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;\u0026thinsp;0.0001\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\"\u003eAML Acute Myeloid leukemia, RBCs red blood cells. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE or number (percent)\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\"\u003eA \u003cem\u003ep\u003c/em\u003e-value is significant if\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eTfh and Tfr cell percentages in AML patients and controls\u003c/h2\u003e\u003cp\u003eThe mean percentage of CD4\u003csup\u003e+\u003c/sup\u003e cells was significantly lower in AML patients than in healthy controls (9\u0026thinsp;\u0026plusmn;\u0026thinsp;1 vs. 12.9\u0026thinsp;\u0026plusmn;\u0026thinsp;1, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.02). On the contrary, the mean percentage of the total Tfh cells was significantly higher in AML patients than in the control group (5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 vs. 1.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, b). The percentages of activated Tfh and Tfr cells were significantly higher in AML patients than in controls (68.6\u0026thinsp;\u0026plusmn;\u0026thinsp;2 vs. 16.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and (15.3\u0026thinsp;\u0026plusmn;\u0026thinsp;1 vs. 5.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, d). In addition, the Tfr/Tfh ratio was significantly lower in the AML patients\u0026rsquo; group (0.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03 vs. 0.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003ee).\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe expression level of the autophagy-regulator gene\u003c/b\u003e \u003cb\u003eBECN1\u003c/b\u003e \u003cb\u003ein AML patients and controls\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAnalysis of fold change in \u003cem\u003eBECN1\u003c/em\u003e gene expression showed that the gene was significantly downregulated in AML patients compared with the control group (0.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07 vs. 1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.02), (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003ef).\u003c/p\u003e\u003cp\u003e\u003cb\u003eRelation between Tfh, Tfr cells, and\u003c/b\u003e \u003cb\u003eBECN1\u003c/b\u003e \u003cb\u003egene expression level and the treatment outcome in AML patients\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAfter receiving induction chemotherapy, AML patients were investigated to detect if they got into remission according to the 2017 ELN response criteria. Thirty-four AML patients (58.6%) achieved complete remission (CR), while twenty-four patients (41.4%) did not achieve complete remission (NCR). As shown in (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e), comparing the percentages of different cells and \u003cem\u003eBECN1\u003c/em\u003e gene expression levels between CR and NCR groups revealed a significantly higher percentage of CD4\u003csup\u003e+\u003c/sup\u003e cells in the CR group than the NCR group (11. \u0026plusmn;2 vs. 6.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1, \u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.009). While the mean percentages of Tfr cells and Tfr/Tfh ratio were significantly lower in patients who achieved CR compared with those in the NCR group (11.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.8 vs. 20.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and (0.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01 vs. 0.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), respectively). No significant differences were observed in the frequency of either total or activated Tfh cells (\u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.5 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.3, respectively). Also, the CR group had a significantly lower BECN1 gene expression level than the NCR group (\u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.01).\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe prognostic value of Tfh, Tfr cells, and\u003c/b\u003e \u003cb\u003eBECN1\u003c/b\u003e \u003cb\u003egene expression level in AML patients\u003c/b\u003e\u003c/p\u003e\u003cp\u003eMultivariate logistic regression analysis was employed to evaluate the prognostic significance of Tfh, Tfr cells, and \u003cem\u003eBECN1\u003c/em\u003e gene expression level in remission of AML. Analysis showed a statistically significant effect of Tfr cells, Tfr/Tfh ratio, and \u003cem\u003eBECN1\u003c/em\u003e gene expression on remission. The odds ratios of the NCR/CR groups as regards Tfr cells and Tfr/Tfh ratio were (184.2) and (315.9), with \u003cem\u003ep\u003c/em\u003e-value of (0.0001) and (0.0003), respectively. In comparison, the odds ratio of the NCR/CR groups regarding \u003cem\u003eBECN1\u003c/em\u003e gene expression was (7.4) with a \u003cem\u003ep\u003c/em\u003e-value of (0.03). Data are presented in (Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) and (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe prognostic value of Tfh, Tfr cells, and \u003cem\u003eBECN1\u003c/em\u003e gene expression level in AML patients\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVariable\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eOdds Ratio\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003ep-\u003c/em\u003evalue\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eTotal Tfh cells\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e0.45\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.6\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eActivated Tfh cells\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e0.7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.8\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eTfr cells\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e184.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e0.0001\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eTfr/Tfh\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e315.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e0.0003\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eBECN1\u003c/b\u003e \u003cb\u003egene expression\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e7.4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e0.03\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eA \u003cem\u003ep\u003c/em\u003e-value is significant if\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/h2\u003e\u003cp\u003e\u003cb\u003eCorrelations between Tfh, Tfr cells\u003c/b\u003e, \u003cb\u003eBECN1\u003c/b\u003e \u003cb\u003egene expression level, and the other laboratory parameters\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe analysis of correlations of total Tfh, activated Tfh, and Tfr with \u003cem\u003eBECN1\u003c/em\u003e expression level revealed positive correlations between \u003cem\u003eBECN1\u003c/em\u003e expression level and each of Tfr and Tfr/Tfh ratio (r\u0026thinsp;=\u0026thinsp;0.4, \u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.02 and r\u0026thinsp;=\u0026thinsp;0.4, \u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.006, respectively). Moreover, total Tfh, activated Tfh, Tfr, and \u003cem\u003eBECN1\u003c/em\u003e expression level didn\u0026rsquo;t significantly correlate with the other laboratory parameters, including the percentages of blast cells in the peripheral blood and bone marrow, (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the present study, we aimed to characterize the interrelation of the autophagy-regulator gene \u003cem\u003eBECN1\u003c/em\u003e expression level with Tfr and Tfh cell ratio in AML and analyze their prognostic significance in achieving remission. Our results demonstrated that AML patients had significantly lower percentage of CD4\u003csup\u003e+\u003c/sup\u003e cells and higher percentages of total and activated Tfh as well as Tfr cells than the control group at the time of diagnosis. Moreover, patients in the non-remission group showed lower percentage of CD4\u003csup\u003e+\u003c/sup\u003e cells and a higher percentage of Tfr cells and Tfr/Tfh ratio than patients who achieved CR.\u003c/p\u003e\u003cp\u003eDifferent studies showed that leukemic changes are associated with disruptions of T cell immunity (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). In addition, it was proven that leukemic cells express inhibitory molecules, for instance, leukocyte immunoglobulin-like receptor B4 (LILRB4) (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e) and CD200 (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), that interact with T cells, reducing T helper cells number, functions and augmenting Treg cells activity causing myeloid disease progression.\u003c/p\u003e\u003cp\u003eInvestigating Tfh cells regarding its role in tumorigenesis showed that these cells secret interleukin-21 (IL-21) and provide co-stimulatory factors, such as ICOS, which promote B cells proliferation, differentiation, and maturation into plasma cells generating antibodies against tumor-specific antigens and hence, enhancing long-term anti-tumor immune response (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). However, its value in predicting prognostic outcomes in cancer is still arguable. For instance, In solid tumors, Tfh cells were associated with forming tertiary lymphoid structures (TLS)/GC and better clinical responses in breast cancer (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). In addition, a research group reported that disruption of Tfh cell functions might be related to progression of hepatocellular carcinoma (HCC) and higher recurrence rate (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eOn the contrary, in hematological malignancies, Zhou \u003cem\u003eet al\u003c/em\u003e. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e) revealed a higher percentage of Tfh cells in multiple myeloma patients than in healthy controls. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). In addition, Tfh infiltration of follicular lymphoma may have a negative effect on prognosis by enhancing lymphoid tumor survival (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). Also, in CLL, it was recognized that higher levels of co-stimulatory molecules and cytokines secreted by Tfh cells might enhance CLL-B cell survival and proliferation (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). On the other hand, it is yet unclear how cTfr cells contribute to cancer, and its prognostic importance is also debatable. For example, in diffuse large B cell lymphomas (DLBCL) and breast cancer patients, Tfr cells were significantly higher in the early stages of the disease and may contribute to intertumoral immunity (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn the context of AML, Guo, and coauthors discovered that AML patients had a much more significant proportion of cTfr cells than did controls and that patients who had lower cTfr cell percentages at diagnosis had better outcomes for achieving CR after inductive chemotherapy (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e), which is consistent with our findings in the current study. However, unlike the present results, they didn\u0026rsquo;t find differences in the cTfh frequency between AML patients and the control group. This might support the idea that immune system disruption brought on by increased cTfr cells, which results in an immune-suppressive reaction, encourages AML cell development and proliferation through GC mechanisms. Nonetheless, the discrepancy in Tfr and Tfh prognostic effect and its role in different types of cancer might be related to different pathogenesis and disease stages. So, this could justify the substantial role of cTfh and cTfr in AML development and reveal that cTfr cells and Tfr/Tfh ratio at diagnosis might be valuable prognostic biomarkers for estimating clinical outcomes in AML patients.\u003c/p\u003e\u003cp\u003eAutophagy is a regulating mechanism for HSC maintenance and cellular destiny in normal hematopoiesis (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). Even so, In cancer, autophagy may have an impartial, tumor-suppressive, or tumor-promoting role in different conditions and stages of cancer development (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Taking into account the crucial function of \u003cem\u003eBECN1\u003c/em\u003e in autophagy, A rising number of studies have examined its expression status and reported variable expression and prognostic significance in various human malignancies. High Beclin-1 levels have been linked to favorable overall survival rates in patients with non-Hodgkin lymphomas (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). Similarly, patients with breast (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e) and gastric (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e) malignancies have lower overall survival rates consistent with decreasing Beclin-1 levels.\u003c/p\u003e\u003cp\u003eIn contrast, patients with endometrial adenocarcinomas had poor prognoses associated with high \u003cem\u003eBECN1\u003c/em\u003e expression (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). Noteworthily, it was found that patients with colorectal cancer who had excessive increase or decrease in Beclin-1 levels had significantly lower overall survival rates (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). This indicates that a balance in autophagy-mediated mechanisms may be needed to achieve better prognostic outcomes in cancer patients.\u003c/p\u003e\u003cp\u003eRegarding AML, it was reported that low expression of \u003cem\u003eBECN1\u003c/em\u003e was detected in intermediate and unfavorable patients compared to the normal controls. (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). Likewise, in the present study, the \u003cem\u003eBECN1\u003c/em\u003e gene expression level was significantly downregulated in AML patients, but a significantly lower expression was found in the patient group who achieved complete remission. These findings affirm the role of autophagy and its prognostic value in AML disease.\u003c/p\u003e\u003cp\u003eAutophagy is a known crucial factor in leukemogenesis and chemoresistance (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). In agreement with the current findings, earlier studies have shown that most chemotherapeutic drugs may have a reduced effect on various cancers due to autophagy as a cellular defense process (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Intriguingly, a study by Park \u003cem\u003eet al.\u003c/em\u003e (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e) revealed that elevated Beclin-1 level was connected to poor overall survival in colon cancer patients after adjuvant therapy with 5-fluorouracil. Moreover, increasing autophagic flux provides a pro-survival adaptive mechanism helping leukemic cells to overcome the chemotherapeutic effect (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). This generated the concept of using autophagy as a therapeutic target in conjunction with chemotherapy to create a more effective therapeutic mechanism to combat drug resistance, enhance clinical outcomes, and reduce drug toxicity in AML patients (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eBesides autophagy's effect on HSC functions, autophagy was also implicated in the maintenance of T-lymphoid lineage activities and response to extracellular cytokine stimuli (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). As far as we know, this is the first study characterizing the interrelation of the \u003cem\u003eBECN1\u003c/em\u003e expression level with Tfh and Tfr imbalance in AML and analyzing their prognostic significance in achieving remission. In the present work, levels of \u003cem\u003eBECN1\u003c/em\u003e expression, Tfr cells, and Tfr/Tfh ratio at diagnosis were lower in patients who passed to remission and might be good predictors of remission. Noteworthy, a positive correlation was found between the \u003cem\u003eBECN1\u003c/em\u003e expression level and each of Tfr and Tfr/Tfh ratio. Thus, the autophagy-related variations in circulating Tfr level in the present study might reveal the immunological state of AML patients and point to the potential immunotherapeutic implications.\u003c/p\u003e\u003cp\u003eConsidering the aforementioned results, the lower Tfr/Tfh ratio in the AML patients compared with the controls in the present study may seem illogical given the regulatory function associated with Tfr cells in AML. However, the higher increase in the frequency of activated Tfh cells than Tfr cells in AML patients might explain this unexpected finding.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe interplay between Tfh and Tfr cell imbalance and autophagy probably plays a pivotal role in AML pathogenesis and might be a good predictor of remission, eventually leading to improved outcomes and optimal treatment.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eLSC\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eLeukemic Stem Cells\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eTFR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eT Follicular Regulatory Cells\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eTFH\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eT Follicular Helper Cells\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eCR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eComplete Remission\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eNCR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eNon- Complete Remission\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eAML\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eAcute Myeloid Leukemia\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eHSC\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eHematopoietic Stem Cells\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eDLBCL\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eDiffuse Large B Cell Lymphomas\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eCLL\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eChronic Lymphocytic Leukemia\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eTLS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eTertiary Lymphoid Structures\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eLILRB4\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eLeukocyte Immunoglobulin-Like Receptor B4\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eQPCR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eQuantitative Polymerase Chain Reaction\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eFACS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eFluorescence-Activated Cell Sorting\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eEDTA\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eEthylenediaminetetraacetic Acid\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePBMC\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePeripheral Blood Mononuclear Cell\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis work was supported by South Egypt Cancer Institute, Assiut university, Assiut, Egypt.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCompeting Interests\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial interests to disclose.\u003c/p\u003e\n\u003cp\u003eAuthor Contributions\u003c/p\u003e\n\u003cp\u003eThe study conception and design were provided by Asmaa M. Zahran and Omnia El-Badawy. Sample collection was performed by Salma G. Morsy, Hanan Eltyb, and Rania M. Hafez. All authors substantially contributed to the acquisition, analysis or interpretation of data. The first draft of the manuscript was written by Salma G. Morsy and all authors revised and critically reviewed the manuscript for important intellectual content. All authors approved the final version of this manuscript to be published.\u003c/p\u003e\n\u003cp\u003eData statement\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003eEthics approval\u003c/p\u003e\n\u003cp\u003eThe current study was approved by the Ethical Committee of South Egypt Cancer Institute, Assiut University (IRB No:\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003e490), in line with the principles of the Declaration of Helsinki.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePatient Consent Statement\u003c/p\u003e\n\u003cp\u003eWritten informed consent for the study and sample collection was obtained from every patient and control enrolled in the study after complete explanation of the purposes of the research and the procedures involved.\u003c/p\u003e\n\u003cp\u003eAcknowledgment\u003c/p\u003e\n\u003cp\u003eWe thank the Flow Cytometry Lab., South Egypt Cancer Institute, and Medical Research Center, Faculty of Medicine, Assiut University staff for their effort to support this work. We also thank the post graduate unit at South Egypt Cancer Institute for providing a grant to assist in achieving this research.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWachter F, Pikman Y. Pathophysiology of Acute Myeloid Leukemia. Acta Haematol. 2024;147(2):229\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaquero P, Dawson A, Mukhopadhyay A, Kuntz EM, Mitchell R, Olivares O, et al. Targeting quiescent leukemic stem cells using second generation autophagy inhibitors. Leukemia. 2019;33(4):981\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDebnath J, Gammoh N, Ryan KM. Autophagy and autophagy-related pathways in cancer. Nat Rev Mol Cell Biol. 2023;24(8):560\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDu W, Xu A, Huang Y, Cao J, Zhu H, Yang B, et al. The role of autophagy in targeted therapy for acute myeloid leukemia. Autophagy. 2021;17(10):2665\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLevine B, Kroemer G. Biological Functions of Autophagy Genes: A Disease Perspective. Cell. 2019;176(1\u0026ndash;2):11\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMortensen M, Soilleux EJ, Djordjevic G, Tripp R, Lutteropp M, Sadighi-Akha E, et al. The autophagy protein Atg7 is essential for hematopoietic stem cell maintenance. J Exp Med. 2011;208(3):455\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWatson AS, Riffelmacher T, Stranks A, Williams O, De Boer J, Cain K, et al. Autophagy limits proliferation and glycolytic metabolism in acute myeloid leukemia. Cell death discovery. 2015;1(1):1\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu F, Song D, Yan Y, Huang C, Shen C, Lan J, et al. IL-6 regulates autophagy and chemotherapy resistance by promoting BECN1 phosphorylation. Nat Commun. 2021;12(1):3651.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWei Y, Zou Z, Becker N, Anderson M, Sumpter R, Xiao G, et al. EGFR-mediated Beclin 1 phosphorylation in autophagy suppression, tumor progression, and tumor chemoresistance. Cell. 2013;154(6):1269\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang W, Choi W, Hu W, Mi N, Guo Q, Ma M, et al. Crystal structure and biochemical analyses reveal Beclin 1 as a novel membrane binding protein. Cell Res. 2012;22(3):473\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCrotty S. T follicular helper cell biology: a decade of discovery and diseases. Immunity. 2019;50(5):1132\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVinuesa CG, Linterman MA, Yu D, MacLennan IC. Follicular helper T cells. Annu Rev Immunol. 2016;34:335\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHe J, Tsai LM, Leong YA, Hu X, Ma CS, Chevalier N, et al. Circulating precursor CCR7loPD-1hi CXCR5\u0026thinsp;+\u0026thinsp;CD4\u0026thinsp;+\u0026thinsp;T cells indicate Tfh cell activity and promote antibody responses upon antigen reexposure. Immunity. 2013;39(4):770\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDixon ML, Leavenworth JD, Leavenworth JW. Lineage Reprogramming of Effector Regulatory T Cells in Cancer. Front Immunol. 2021;12:717421.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSage PT, Sharpe AH. T follicular regulatory cells. Immunol Rev. 2016;271(1):246\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu X, Fajardo-Despaigne JE, Zhang C, Neppalli V, Banerji V, Johnston JB, et al. Altered T follicular helper cell subsets and function in chronic lymphocytic leukemia. Front Oncol. 2021;11:674492.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou D-M, Xu Y-X, Zhang L-Y, Sun Y, Wang Z-Y, Yuan Y-Q, et al. The role of follicular T helper cells in patients with malignant lymphoid disease. Hematology. 2017;22(7):412\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBronietzki AW, Schuster M, Schmitz I. Autophagy in T-cell development, activation and differentiation. Immunol Cell Biol. 2015;93(1):25\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD\u0026ouml;hner H, Estey EH, Amadori S, Appelbaum FR, B\u0026uuml;chner T, Burnett AK, et al. Diagnosis and management of acute myeloid leukemia in adults: recommendations from an international expert panel, on behalf of the European LeukemiaNet. Blood J Am Soc Hematol. 2010;115(3):453\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZahran AM, Abdel-Rahim MH, Nasif KA, Hussein S, Hafez R, Ahmad AB, et al. Association of follicular helper T and follicular regulatory T cells with severity and hyperglycemia in hospitalized COVID-19 patients. Virulence. 2022;13(1):569\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHao F, Sholy C, Wang C, Cao M, Kang X. The Role of T Cell Immunotherapy in Acute Myeloid Leukemia. Cells. 2021;10(12):3376.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeng M, Gui X, Kim J, Xie L, Chen W, Li Z, et al. LILRB4 signalling in leukaemia cells mediates T cell suppression and tumour infiltration. Nature. 2018;562(7728):605\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eColes S, Hills RK, Wang ECY, Burnett AK, Man S, Darley RL, et al. Increased CD200 expression in acute myeloid leukemia is linked with an increased frequency of FoxP3\u0026thinsp;+\u0026thinsp;regulatory T cells. Leukemia. 2012;26(9):2146\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou Z-Q, Tong D-N, Guan J, Tan H-W, Zhao L-D, Zhu Y, et al. Follicular helper T cell exhaustion induced by PD-L1 expression in hepatocellular carcinoma results in impaired cytokine expression and B cell help, and is associated with advanced tumor stages. Am J Translational Res. 2016;8(7):2926.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGu-Trantien C, Loi S, Garaud S, Equeter C, Libin M, De Wind A, et al. CD4\u0026thinsp;+\u0026thinsp;follicular helper T cell infiltration predicts breast cancer survival. J Clin Investig. 2013;123(7):2873\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJia Y, Zeng Z, Li Y, Li Z, Jin L, Zhang Z, et al. Impaired function of CD4\u0026thinsp;+\u0026thinsp;T follicular helper (Tfh) cells associated with hepatocellular carcinoma progression. PLoS ONE. 2015;10(2):e0117458.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAm\u0026eacute;-Thomas P, Le Priol J, Yssel H, Caron G, Pangault C, Jean R, et al. Characterization of intratumoral follicular helper T cells in follicular lymphoma: role in the survival of malignant B cells. Leukemia. 2012;26(5):1053\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCha Z, Gu H, Zang Y, Wang Z, Li J, Huang W, et al. The prevalence and function of CD4\u0026thinsp;+\u0026thinsp;CXCR5\u0026thinsp;+\u0026thinsp;Foxp3\u0026thinsp;+\u0026thinsp;follicular regulatory T cells in diffuse large B cell lymphoma. Int Immunopharmacol. 2018;61:132\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMiao X, Guo Q, Pan Z, Xu X, Shao X, Wang X. The characteristics and novel clinical implications of CD4\u0026thinsp;+\u0026thinsp;CXCR5\u0026thinsp;+\u0026thinsp;Foxp3\u0026thinsp;+\u0026thinsp;follicular regulatory T cells in breast cancer. Annals Translational Med. 2021;9(16).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuo Z, Chen Z, Xu Y, Zhang Y, Hu L, Yu F, et al. The Association of Circulating T Follicular Helper Cells and Regulatory Cells with Acute Myeloid Leukemia Patients. Acta Haematol. 2020;143(1):19\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePan H, Cai N, Li M, Liu GH, Izpisua Belmonte JC. Autophagic control of cell \u0026lsquo;stemness\u0026rsquo;. EMBO Mol Med. 2013;5(3):327\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLevy JMM, Towers CG, Thorburn A. Targeting autophagy in cancer. Nat Rev Cancer. 2017;17(9):528\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNicotra G, Mercalli F, Peracchio C, Castino R, Follo C, Valente G, et al. Autophagy-active beclin-1 correlates with favourable clinical outcome in non-Hodgkin lymphomas. Mod Pathol. 2010;23(7):937\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDong M, Wan X-b, Yuan ZY, Wei L, Fan XJ, Wang T-t, et al. Low expression of Beclin 1 and elevated expression of HIF-1α refine distant metastasis risk and predict poor prognosis of ER-positive, HER2-negative breast cancer. Med Oncol. 2013;30(1):1\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou W-H, Tang F, Xu J, Wu X, Yang S-B, Feng Z-Y, et al. Low expression of Beclin 1, associated with high Bcl-xL, predicts a malignant phenotype and poor prognosis of gastric cancer. Autophagy. 2012;8(3):389\u0026ndash;400.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGiatromanolaki A, Koukourakis MI, Koutsopoulos A, Chloropoulou P, Liberis V, Sivridis E. High Beclin 1 expression defines a poor prognosis in endometrial adenocarcinomas. Gynecol Oncol. 2011;123(1):147\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKoukourakis M, Giatromanolaki A, Sivridis E, Pitiakoudis M, Gatter K, Harris A. Beclin 1 over-and underexpression in colorectal cancer: distinct patterns relate to prognosis and tumour hypoxia. Br J Cancer. 2010;103(8):1209\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZare-Abdollahi D, Safari S, Movafagh A, Ghadiani M, Tabarraee M, Riazi‐Isfahani S, et al. Expression analysis of BECN 1 in acute myeloid leukemia: association with distinct cytogenetic and molecular abnormalities. Int J Lab Hematol. 2016;38(2):125\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAuberger P, Puissant A. Autophagy, a key mechanism of oncogenesis and resistance in leukemia. Blood J Am Soc Hematol. 2017;129(5):547\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBarnard RA, Regan DP, Hansen RJ, Maycotte P, Thorburn A, Gustafson DL. Autophagy inhibition delays early but not late-stage metastatic disease. J Pharmacol Exp Ther. 2016;358(2):282\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMyung Park J, Huang S, Wu T-T, Foster NR, Sinicrope FA. Prognostic impact of Beclin 1, p62/sequestosome 1 and LC3 protein expression in colon carcinomas from patients receiving 5-fluorouracil as adjuvant chemotherapy. Cancer Biol Ther. 2013;14(2):100\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJang JE, Eom JI, Jeung HK, Chung H, Kim YR, Kim JS, et al. PERK/NRF2 and autophagy form a resistance mechanism against G9a inhibition in leukemia stem cells. J Exp Clin Cancer Res. 2020;39(1):66.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePutyrski M, Vakhrusheva O, Bonn F, Guntur S, Vorobyov A, Brandts C, et al. Disrupting the LC3 Interaction Region (LIR) Binding of Selective Autophagy Receptors Sensitizes AML Cell Lines to Cytarabine. Front Cell Dev Biol. 2020;8:208.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLe Texier L, Lineburg KE, Cao B, McDonald-Hyman C, Leveque-El Mouttie L, Nicholls J et al. Autophagy-dependent regulatory T cells are critical for the control of graft-versus-host disease. JCI insight. 2016;1(15).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Acute Myeloid Leukemia, Autophagy, Tfh, Tfr, BECN1","lastPublishedDoi":"10.21203/rs.3.rs-7358411/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7358411/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eAutophagy is a catabolic pathway with a controversial role regarding tumor suppression and promotion and is accused of suppressing the effect of several chemotherapeutic agents. Autophagy is also involved in regulating T cell function and immune response. This study aimed to characterize the interrelation of the autophagy-regulator gene \u003cem\u003eBECN1\u003c/em\u003e expression level with T follicular regulatory (Tfr) and T follicular helper (Tfh) cell ratio in acute myeloid leukemia (AML) and analyze their prognostic significance in achieving remission.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eThis study included 58 patients with denovo AML, and 26 controls. Levels of circulating Tfh and Tfr cells and analysis of fold change in \u003cem\u003eBECN1\u003c/em\u003e gene expression were evaluated in all participants. Patients were assessed whether they had achieved complete hematological remission after receiving induction chemotherapy or not.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eAML patients had significantly higher percentages of Tfh and Tfr cells and lower \u003cem\u003eBECN1\u003c/em\u003e gene expression level than the control group at the time of diagnosis. In addition, patients in the non-remission group showed a higher percentage of Tfr cells, Tfr/Tfh ratio, and \u003cem\u003eBECN1\u003c/em\u003e gene expression level than patients who achieved complete remission. Positive correlations were found between \u003cem\u003eBECN1\u003c/em\u003e expression level and both Tfr and Tfr/Tfh ratio.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003ethe interplay between Tfh and Tfr cell imbalance and autophagy probably plays a pivotal role in AML pathogenesis and might be a good predictor of remission, eventually leading to improved outcomes and optimal treatment.\u003c/p\u003e","manuscriptTitle":"The autophagy-regulator gene BECN1, T follicular regulatory and T follicular helper cell harmony in Acute Myeloid Leukemia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-11 11:02:59","doi":"10.21203/rs.3.rs-7358411/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2025-09-04T12:23:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"18314541758286328082862824141656332953","date":"2025-09-04T06:27:07+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-04T06:22:40+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-08-14T10:03:47+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-13T03:40:59+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-13T03:40:08+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Cancer","date":"2025-08-12T18:04:58+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4a567779-064d-41af-9ec4-4791bb577b1a","owner":[],"postedDate":"September 11th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-09-11T11:03:00+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-11 11:02:59","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7358411","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7358411","identity":"rs-7358411","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00