Influence of Soil Fungal Communities on Soil Health in Relation to Yellowing Symptoms of Black Pepper (Piper nigrum L.) in Sarawak | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Influence of Soil Fungal Communities on Soil Health in Relation to Yellowing Symptoms of Black Pepper (Piper nigrum L.) in Sarawak Choy Yuen Khew, Suk Cheng Voon, Wei Yee Wee, Ee Tiing Lau This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6652797/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background and Aims Fungal communities are critically important for crop health and soil fertility. ITS amplicon sequencing has transformed soil fungal ecology by enabling high-resolution identification of fungal taxa, revealing extensive diversity and functional roles of soil fungal. However, our knowledge regarding how fungal community structure responds to healthy versus diseased black pepper crops is limited. This study aims to investigate the fungal community structure in soils from healthy and diseased black pepper crops, with a particular focus on the relationship between fungal abundance, diversity, and the symptoms exhibited by the plants. Methods We used high-throughput amplicon sequencing technology to comparatively analyze the fungal abundance, diversity, and community composition in soils from healthy black pepper crops versus those displaying yellowing symptoms. Results The findings revealed that black pepper plants with yellowing symptoms exhibited altered soil fungal abundance and significant variations in fungal diversity. Specifically, crops with yellowing symptoms showed an increased relative abundance of Fusarium , Purpureocillium , and Chaetomium , along with greater overall fungal diversity. Conversely, healthy crops had a higher abundance of beneficial fungi, such as Trichoderma and Humicola . Conclusions The analysis highlighted distinct shifts in trophic modes linked to disease progression and site location, emphasizing the dynamic interactions between plants and soil microbes. This study suggests the potential for targeted interventions, such as the use of biocontrol agents or soil amendments, to promote beneficial fungi while suppressing pathogenic taxa, ultimately improving soil quality and plant health. Black Pepper Soil health ITS Amplicon Sequencing Fungal Yellowing symptoms Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Yellowing symptoms are among the most prominent early warning signs of issues in black pepper farming, sometimes caused by nutrient deficiencies (Babu et al., 2019 ) or infections (Cheong et al., 2021 ). Nutrient deficiencies frequently appear by widespread and uniform yellowing throughout the field or in places with poor soil health (Zidack, 2024 ). Such deficiencies can frequently be rectified by providing corrective fertiliser treatments that improve plant health. Disease-induced yellowing symptoms, on the other hand, are usually irregular and commonly accompanied by lesions, patches, or rotting (Kharayat, 2023 ). Black pepper plants that show these disease-related symptoms can die in less than a month, with the infection spreading quickly and posing a serious threat to the entire farm. As a result, early surveillance and detection are essential for reducing losses and restoring affected plants. Black pepper farms are frequently affected by three major root diseases: White Root Disease (caused by Rigidoporus lignosus ), Yellow Wilt Disease (caused by Fusarium solani ), and Foot Rot Disease (caused by Phytophthora capsici ) (Zakaria et al., 2020; Cheong et al., 2021 ; Thao et al., 2024). These diseases infiltrate the root system, impairing the plant's capacity to absorb water and nutrients. The early signs of disease are discolouration and yellowing of the leaves, which begin in the lowest portion of the plant and develop upwards. As the disease spreads, branches may die, and the plant might die as a whole. These diseases can lead to massive crop losses and financial hardship for farmers. The indiscriminate and excessive use of chemical fungicides for controlling these diseases has unfortunately led to fungicide resistance in some pathogen populations (Islam et al., 2024 ). Accurate and prompt detection of the specific causing pathogen, as well as knowledge of how to deal with the impacted diseases, are critical when developing disease-specific management strategies. Traditional diagnostic approaches, such as culturing and soil-baiting, were once considered viable ways for detecting soil-borne infections. However, these methods are frequently hampered by their time-consuming and labour-intensive nature, which can delay diagnosis and restrict efficient treatment of diseases (Ghosh et al., 2019 ). Recent advances in amplicon sequencing have provided an effective alternative for investigating the complex ecology of the soil fungal communities. By allowing for direct sequencing and analysis of DNA isolated from soil samples, sequencing techniques can discover a wide range of fungal species, including major diseases, without the need for cultivation (Jayalakshmi et al., 2023 ). This culture-independent approach provides a rapid and thorough understanding of the fungal community dynamics associated with various soil conditions, including those that cause plant yellowing symptoms. Amplicon sequencing offers a more complete picture of the soil fungal, allowing researchers to identify the leading culturable fungal and the vast majority of unculturable fungal that play crucial functions in soil health and plant disease (Xiao et al., 2024 ). This comprehensive investigation of the fungal community may lead to a better understanding of the intricate interactions between plants, pathogens, and beneficial microorganisms, allowing for the development of more targeted and effective disease control strategies (Fadiji et al., 2025 ). This study aims to utilize amplicon sequencing analysis for the surveillance of black pepper farms exhibiting yellowing symptoms. The findings will enable the prompt detection of fungal infections by analyzing the soil fungal communities, leading to a faster and more efficient approach to disease management in black pepper cultivation. By integrating amplicon sequencing techniques into surveillance strategies, we can enhance black pepper farm management by providing actionable insights for early intervention and promoting sustainable agricultural practices. Materials and Methods Sample Collection and Preparation A total of six soil samples were collected from the rhizosphere of infected black pepper vines exhibiting yellowing symptoms at two locations in Sarawak, Malaysia. Samples H1 (healthy soil) and S1 (diseased soil) were obtained from Serian in January 2024, while HS1 (healthy soil), DS1 (diseased soil), DS2, and DS3 were collected from Sri Aman in March 2024 (Fig. 1). Black pepper has been cultivated on both farms for more than three years. Following collection, the soil samples were transported to the laboratory, where genomic DNA was extracted using the DNeasy ® PowerSoil Ⓡ Kit (Qiagen, Cat nos. 47014). The extracted DNA was then subjected to Internal Transcribed Spacer (ITS) region sequencing. These sequencing techniques target specific regions of the fungal genome, allowing for the identification and characterization of fungal communities present in the soil samples. Amplicon Sequencing and Analysis The DNA samples proceeded to amplicon library preparation using a 2-step PCR protocol, based on Illumina’s ITS metagenomic library preparation guidelines. Fungal ITS1 regions of the fungal genes were amplified using locus-specific sequence primers with overhang adapters. The forward overhang sequence was 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus‐ specific sequence], and the reverse overhang sequence was 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus‐ specific sequence]. KOD -Multi & Epi-® (Toyobo) was used for all PCR reactions. Following amplification, dual indices were attached to the amplicon PCR products using the Illumina Nextera XT Index Kit v2. Following normalization and pooling, the libraries were sequenced using the MiSeq platform on 300 PE. The DADA2 workflow is employed to generate amplicon sequence variants (ASVs) (Callahan et al., 2016 ). The quality assessment of raw reads is performed via FastQC, followed by the removal of primers and adaptors with Cutadapt 3.5 (Martin, 2014 ). Paired-end readings are processed and merged using DADA2 V1.18. Fungal Community Analysis The SILVA nr database (version 138.1, last updated on March 10, 2021) was used for chimera screening and taxonomic assignment. Phylogenetic analysis for UniFrac involved sequence alignment using MUSCLE v3.8 (Edgar RC, 2004), followed by the construction of a phylogenetic tree using FastTree2 (Price MN, Dehal PS, Arkin AP, 2010). Paired-end reads were initially processed to remove sequencing adaptors and low-quality bases using BBDuk from the BBTools package ( https://sourceforge.net/projects/bbmap/ ). Forward and reverse reads were then merged using USEARCH v11.0.667 ( https://www.drive5.com/usearch/ ). Reads shorter than 150 bp or longer than 600 bp were excluded to ensure consistent sequence length for downstream analysis. The preprocessed reads were aligned to the ITS reference database (UNITE) to identify fungal sequences. Chimeric sequences were detected and removed using VSEARCH v2.6.2. Merged reads were clustered de novo into operational taxonomic units (OTUs) at 97% similarity using UPARSE v11.0.667. To maintain data quality, rare OTUs with fewer than two reads (doubletons) were excluded. A single representative sequence from each OTU was selected randomly. Representative sequences were aligned using PyNAST ( https://www.ncbi.nlm.nih.gov/pubmed/19914921 ) and a phylogenetic tree was constructed and this ensured the accurate placement of OTUs in the phylogenetic context. The fungal sequences were functionally annotated using FUNGuild v.1.1. Results Fungal Diversity and Community Structure A taxonomic heat tree visualization (Fig. 2 ) was generated utilizing the metacoder package in R, a well-established tool for the analysis and visualization of metagenomic data. This methodological approach provides a comprehensive representation of the taxonomic groups distributed across various soil samples, facilitating the identification of key fungal taxa that are associated with soil health and disease dynamics. Among the analyzed samples, Ascomycota was discerned as the predominant fungal phylum, succeeded by Sordariomycetes. Other noteworthy taxa included Hypocreales, Basidiomycota, and Agaricomycetes, indicating a complex and diverse fungal community structure in black pepper cultivation farms. Comparison of Healthy and Diseased Soil Samples The heat tree visualization elucidated distinct differences between healthy (H1, HS1) and diseased (S1, DS1, DS2, DS3) soil samples (Fig. 2 ). Healthy soil samples were characterized by a greater prevalence of blue regions, signifying lower fungal abundance and reflecting a more balanced microbial community. Conversely, diseased soil samples exhibited an increase in orange regions, indicative of heightened fungal abundance. This enrichment of orange colouration suggests an increase in pathogenic fungi, which may be contributing to the manifestation of soil disease. Moreover, a progressive intensification of orange colouration was observed from DS1 to DS3, indicating a microbial shift linked to disease progression and a consequential proliferation of fungal populations in the later stages. The spatial distribution of orange regions further illustrates a correlation between fungal proliferation and disease severity. Specifically, samples DS2 and DS3 displayed the most pronounced orange shading, suggesting that particular fungal taxa are proliferating aggressively in these environments. Sample S1 was categorized as diseased, it contained some blue regions, which may reflect variability in the fungal community composition. This observation implies that S1 may represent an early-stage diseased soil, whereas DS2 and DS3 reflect more established and robust fungal communities. Among all diseased soil samples, DS3 demonstrated the highest fungal abundance, with the most intense orange coloration, signaling advanced-stage fungal proliferation that aligns with the later stages of soil disease. These findings are consistent with the symptoms illustrated in Fig. 1, wherein yellowing symptoms were more pronounced in DS1, DS2, and DS3 vines. The established relationship between fungal community composition and disease severity underscores the critical role of fungal proliferation in the deterioration of plant health. A comprehensive understanding of these microbial shifts provides significant insights into the influence of fungal communities on soil health and the progression of disease. Alpha Diversity Analysis Alpha diversity metrics were employed to evaluate species richness and distribution across various soil samples (DS1, DS2, DS3, H1, HS1, R1, and S1). The results indicated that DS3 exhibited the highest observed richness (Fig. 3 ), followed closely by DS2 and DS1, suggesting that diseased soils harbor a more diverse fungal community. In contrast, healthy soils (H1 and HS1) displayed lower richness values, indicative of a stable community characterized by a reduced presence of opportunistic taxa. It is noteworthy that S1, while classified as diseased, displayed richness similar to that of healthy soils, which may imply the presence of early-stage disease. The Chao1 index (Fig. 3 ) highlighted the abundance of rare species in diseased soils, thereby contributing to their richness, while healthy soils exhibited lower Chao1 values. The highest Shannon index was recorded for DS3, confirming a greater degree of richness and evenness in diseased soils relative to their healthy counterparts. Contrastingly, healthy soils such as H1 and HS1 were found to demonstrate a more specialized community composition dominated by beneficial taxa. Supplementary analyses utilizing the Simpson indices supported the observation of evenness within diseased soils, while Fisher’s Alpha confirmed that these soils possess the highest levels of microbial diversity when compared to their healthy counterparts. These findings indicate that diseased soils exhibit greater richness and diversity, a phenomenon likely driven by the prevalence of pathogenic fungi. Taxonomic Distribution of Fungal Communities in Soil Samples To further delineate the fungal groups of significant enrichment in the samples, taxonomic distributions were visualized using pie charts (Supplementary Document 1). This analysis facilitated an exploration of the relative abundances of distinct fungal taxa within the intricate hierarchies of metagenomic classification, enabling a detailed comparison between healthy and diseased soil samples obtained from various locations. Healthy soil samples from Serian Farm (H1) were predominantly represented by Humicola (54%), followed by Staphylotrichum (12%), with minor contributions from Phlyctis (4%) and low levels of Fusarium (0.8%). Similarly, the healthy soil from Sri Aman Pepper Farm (HS1) was primarily dominated by Rhizoctonia (26%) and Phlyctis (13%), alongside beneficial taxa such as Trichoderma (5%), with minimal Fusarium levels (1%). Diseased soils showed a significant decline in beneficial fungi and an increase in pathogenic taxa. At Serian Farm (S1), Humicola decreased by 21%, while pathogenic species like Fusarium (9%), Purpureocillum (14%), and Chaetomium (6%) increased. A similar trend was observed at Sri Aman Pepper Farm, in which the beneficial microbes such as Trichoderma decreased from 5% in healthy soil to 0.8% in late-stage diseased soil. The diseased soils (DS1, DS2, DS3) exhibited higher levels of Fusarium , Purpureocillium , Setosynnema , and Chaetomium . The abundance of Fusarium peaked during the initial to intermediate stages of disease progression, exhibiting a significant decline in soils corresponding to later stages. Prediction of the fungal community function The fungal community in rhizosphere soil was classified and analyzed using FUNGuild to identify the functional groups of fungi present and their relative abundance across different samples (Fig. 4 ). In the Sri Aman farm, most soil samples were dominated by pathotroph-saprotroph-symbiotroph fungi. Pathotrophs were detected in all samples, with the highest abundance observed during the early to intermediate stages of disease progression (DS1 to DS2), followed by a marked decline at the later stage (DS3). In contrast, soils from the Serian farm were primarily dominated by pathotroph-saprotroph fungi, with a higher proportion of pathotrophs in the diseased sample (S1). Furthermore, a shift was observed from saprotroph-symbiotroph in DS2 to increased proportions of symbiotroph and saprotroph in DS3. This transition may indicate an ecological succession in the fungal community toward a more decomposer- and mutualist-driven system during the later stages of disease progression. Discussions Among all the samples analyzed, Ascomycota emerged as the dominant fungal phylum, followed closely by Sordariomycetes. Ascomycota fungi are prevalent in soils worldwide (Egidi et al., 2019 ) and play a crucial role in carbon and nitrogen cycling (Challacombe et al., 2019 ). These fungi enhance soil stability, decompose plant biomass, and engage in crucial endophytic interactions with plants through specialized enzymes that target cellulose, hemicellulose, and lignin (Manici et al., 2024 ). Additionally, Ascomycota can form symbiotic relationships with biocrust components or act as latent saprotrophs or pathogens on plant tissues (Challacombe et al., 2019 ). Within the Ascomycota division, Sordariomycetes represent a significant class found in various ecosystems, serving as endophytes, plant pathogens, and saprotrophs. They are essential contributors to decomposition and nutrient cycling (Taylor et al., 2015 ). The Hypocreales order, a prominent group within Sordariomycetes, is particularly noted for its role as a rapid decomposer of plant tissue in soil (Wang et al., 2020 ; Wang et al., 2020 b). However, certain fungi from this order, such as Fusarium , are recognized as potential pathogens of black pepper. In addition to Ascomycota and Sordariomycetes, Basidiomycota also contributes to soil diversity. Prior studies have reported Basidiomycota as dominant in secondary forests, in contrast to Ascomycota, which dominates in crop plantation soils (Wong, 2021 ). This trend aligns with the current findings. Basidiomycetes are particularly involved in ectomycorrhizal associations with forest trees, playing a significant role in nutrient exchange and ecosystem stability (Basidiomycota - an Overview | ScienceDirect Topics, n.d.). The major group within Basidiomycota is Agaricomycetes, which includes mushroom-forming fungi that serve as decomposers, pathogens, and mutualists in terrestrial ecosystems (Hibbett et al., 2014 ). A comparison of healthy soil samples (H1, HS1) and diseased ones (S1, DS1, DS2, DS3) reveals significant differences in fungal communities. The analysis showed that healthy soils had lower fungal abundance, while diseased soils exhibited higher levels of diversity and richness within their fungal communities. These findings align with earlier research on the microbial communities associated with root rot in black pepper (Obieze et al., 2023). Typically, an increased abundance of microbial communities is associated with enhanced resistance to pathogens, providing a protective role against disease (Yan et al., 2023 ). However, the higher richness and diversity of fungal communities in diseased soils may result from a shift in community structure that creates conditions favorable for the occurrence of pepper root rot diseases, as noted by Zhang et al. ( 2021 ). Certain taxa may become dominant in these environments due to stress from environmental factors or the effects of plant disease. Continuous pepper cropping has been identified as a significant factor contributing to the occurrence of root rot. Research indicates that this practice leads to a reduction in fungal populations (Tan et al., 2017a, b). Specifically, the decline in diversity among rhizosphere fungi—particularly beneficial groups that are essential for plant health—may hinder disease resistance and increase vulnerability to infections during successive cropping cycles (Ji et al., 2021). The current findings suggest a connection between low fungal taxonomic richness and diversity in healthy soil and the practice of continuous pepper cropping in the sample collection areas, which contributes to increased disease susceptibility. In healthy soils, the presence of beneficial fungi, such as Humicola and Trichoderma , indicates a strong microbial ecosystem that supports plant growth and disease resistance. For instance, Humicola was predominant in the healthy soil from Serian Farm (Supplementary Document 1), highlighting its potential role in nutrient cycling and enhancing plant health (Shang et al., 2023 ). Both Humicola and Trichoderma may serve as biological control agents against diseases in pepper plants (Ko et al., 2011). The increased relative abundance of these fungi contributes to the reduction of pathogenic fungi and enhances soil organic matter content (Li et al., 2024 ). In contrast, the healthy soil from Sri Aman Pepper Farm was characterized by the presence of Rhizoctonia, a soil- and seed-borne fungus in the basidiomycete class, which can thrive freely in the soil and act as a saprophyte. Meanwhile, the diseased soil samples exhibited a significant decline in beneficial fungal populations, indicating a shift towards a more pathogenic environment. The rise in Fusarium and other pathogenic taxa, such as Purpureocillium and Chaetomium , under disease conditions reflects a disruption in the microbial balance, potentially contributing to plant stress and increased vulnerability to disease. Notably, the decline of Trichoderma from 5% in healthy soils to 0.8% in diseased soils at Sri Aman Pepper Farm highlights the importance of this genus in suppressing pathogens and promoting soil health. Data indicate a dynamic pattern in the prevalence of Fusarium throughout different disease progression stages. Its initial increase may correlate with early disease symptoms, suggesting that Fusarium behaves opportunistically in response to weakened plant defenses. However, its subsequent decline in later stages could indicate a change in the soil environment, possibly due to resource depletion or competition with other microbes, which may limit Fusarium 's growth. The prevalence of Fusarium wilt was significantly positively correlated with the abundance and diversity of soil fungi. Furthermore, continuous monocropping that led to an increase in both the abundance and diversity of soil fungi might decreasing the ability of the soil microflora to resist the invasion of Fusarium species, ultimately facilitating the successful colonization and accumulation of Fusarium spp. in the soil (Yan et al., 2023 ). The functional profiling of rhizosphere fungal communities revealed distinct shifts in trophic modes associated with disease progression and site location, highlighting the dynamic nature of plant–microbe interactions in soil ecosystems. The dominance of pathotroph-saprotroph-symbiotroph fungi in diseased soils from the Sri Aman farm (DS1 and DS2) (Fig. 4 ) suggests a highly versatile fungal community capable of both nutrient recycling and pathogenic interactions with host plants. The elevated abundance of pathotrophs during the early (DS1) and intermediate (DS2) stages of disease progression is consistent with the proliferation of opportunistic and plant-pathogenic fungi, potentially contributing to or exacerbating disease severity in the rhizosphere. Interestingly, the decline in pathotroph abundance observed in DS3 may indicate a late-stage ecological transition, possibly due to resource depletion, plant mortality, or the establishment of more competitive or mutualistic fungi. This shift coincides with an increase in saprotrophs and symbiotrophs, which could reflect a transition from active infection toward decomposition and/or attempted recovery of the microbial community balance. These findings have important implications for agricultural practices. Understanding the microbial dynamics in both healthy and diseased soils can guide effective plant health management strategies, such as enhancing the populations of beneficial fungi through soil amendments or the use of microbial inoculants. Recognizing the roles of specific pathogens can also aid in developing targeted interventions to mitigate the impacts of soil-borne diseases. Additionally, fungal diversity may serve as a valuable biological indicator for assessing the health of black pepper cultivation. Conclusion and Recommendations The analyses of taxonomic heat trees and taxonomic distribution provide important insights into how fungal communities change in response to soil health and disease progression. Healthy soils maintain a stable fungal ecosystem characterized by beneficial taxa such as Humicola and Trichoderma , which serve as essential indicators of soil health. In contrast, diseased soils experience a decline in beneficial microbes, an increase in pathogenic fungi such as Fusarium , Purpureocillium , and Chaetomium , along with greater fungal diversity. These shifts in fungal communities correlate with observable plant disease symptoms, highlighting the impact of fungal proliferation on soil health decline. This study emphasizes the potential for targeted interventions, such as using biocontrol agents or soil amendments, to enhance beneficial fungi and suppress pathogenic taxa, thereby improving soil quality and plant health. Declarations Competing Interests The authors declare that they have no known financial or personal relationships that could have appeared to influence the work reported in this article. Funding This research was funded by grants from the Malaysian Pepper Board of the Ministry of Plantation Industries and Commodities (20-1130000-10025). Acknowledgement This research was funded by grants from the Malaysian Pepper Board of the Ministry of Plantation Industries and Commodities (20-1130000-10025). We would like to extend our gratitude to Mr. Reki Rangking for his assistance in collecting samples from the pepper farms. Data availability The datasets used and/or analysed during the current study available from the corresponding author on reasonable request. References Babu S, Sujatha VS, Reshmi VR, Suresh KP, Pathrose B, Ragesh G (2019) Influence of major nutrients and seasons in yellowing affected black pepper fields. J Pharmacognosy Phytochemistry 8(5):2368–2373 Basidiomycota - an overview | ScienceDirect Topics (n.d.). Www.sciencedirect.com . https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/basidiomycota Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP (2016) DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods 13(7):581–583 Challacombe JF, Hesse CN, Bramer LM, McCue LA, Lipton M, Purvine S, Nicora C, Gallegos-Graves LV, Porras-Alfaro A, Kuske CR (2019) Genomes and secretomes of Ascomycota fungi reveal diverse functions in plant biomass decomposition and pathogenesis. BMC Genomics 20(1). https://doi.org/10.1186/s12864-019-6358-x Cheong SH, Kundat FR, Wong MY, Kwan YM (2021) Characterisation and Pathogenicity of Fusarium Species Associated with Yellowing Disease in Black Pepper ( Piper nigrum L). Sains Malaysiana 51(11):3591–3605. https://doi.org/10.17576/jsm-2022-5111-07 Egidi E, Delgado-Baquerizo M, Plett JM et al (2019) A few Ascomycota taxa dominate soil fungal communities worldwide. Nat Commun 10:2369. https://doi.org/10.1038/s41467-019-10373-z Fadiji AE, Ayangbenro AS, Akanmu AO, Babalola OO (2025) Plant health in the era of metagenomics: Current state and future prospects. Metagenomics, pp 399–419 Ghosh R, Tarafdar A, Chobe DR, Chandran S, Rani US, S., Sharma M (2019) Diagnostic techniques of soil borne plant diseases: recent advances and next generation evolutionary trends. In Biological Forum–An International Journal (Vol. 11, No. 2, pp. 1–13). Research Trend Hibbett DS, Bauer R, Binder M, Giachini AJ, Hosaka K, Justo A, Larsson E, Larsson KH, Lawrey JD, Miettinen O, Nagy LG, Nilsson RH, Weiss M, Thorn RG (2014) 14 Agaricomycetes. Systematics and Evolution, 373–429. https://doi.org/10.1007/978-3-642-55318-9_14 Islam T, Danishuddin, Tamanna NT, Matin MN, Barai HR, Haque MA (2024) Resistance Mechanisms of Plant Pathogenic Fungi to Fungicide, Environmental Impacts of Fungicides, and Sustainable Solutions. Plants 13(19):2737. https://doi.org/10.3390/plants13192737 Jayalakshmi K et al (2023) Detection and Diagnosis of Important Soil-Borne Pathogens. In: Singh UB, Kumar R, Singh HB (eds) Detection, Diagnosis and Management of Soil-borne Phytopathogens. Springer, Singapore. https://doi.org/10.1007/978-981-19-8307-8_5 . Kharayat BS (2023) Diseases Of Field And Horticultural Crops And Their Management Volume–Ii. Phi Learning Pvt. Ltd. Ko WH, Yang CH, Lin MJ, Chen CY, Tsou YJ (2011) Humicola phialophoroides sp. nov. from soil with potential for biological control of plant diseases. Bot Stud 52:197–202 Li J, Chen Y, Zhao G, Chen Y, Zhang N, Yu D, Li X (2024) Herbal materials used as soil amendments alleviate root rot of Panax ginseng. Sci Rep 14(1). https://doi.org/10.1038/s41598-024-74304-9 Liu C, Li H, Dong J, He X, Zhang L, Qiu B (2024) Structure and function of rhizosphere soil microbial communities associated with root rot of Knoxia roxburghii. Front Microbiol 15. https://doi.org/10.3389/fmicb.2024.1424633 Manici LM, Caputo F, Fornasier F, Paletto A, Ceotto E, De Meo I (2024) Ascomycota and Basidiomycota fungal phyla as indicators of land use efficiency for soil organic carbon accrual with woody plantations. Ecol Ind 160:111796 Martin M (2014) Algorithms and tools for the analysis of high throughput DNA sequencing data Obieze CC, George PBL, Boyle B, Khasa DP (2023) Black pepper rhizomicrobiome: Spectrum of plant health indicators, critical environmental factors and community compartmentation in Vietnam. Appl Soil Ecol 187:104857. https://doi.org/10.1016/j.apsoil.2023.104857 Shang G, Zou Q, Zhang J, Wang J, Zhang Y, Liu M, Wang S, Zhang D, Wang W, Wang Y (2023) Effects of Tillage Depth on Nutrients and Microbial Communities in Tobacco-Planting Soil. Agricultural Sci 14(12):1702–1715. https://doi.org/10.4236/as.2023.1412110 Taylor TN, Krings M, Taylor EL (2015) Fossil fungi. Academic, London Thao, L. D., Khanh, T. N., Van Liem, N., Hien, L. T., Thanh, H. M., Binh, V. T. P.,… Brau, L. (2024). Current species of oomycetes associated with foot rot disease of black pepper in Vietnam. Tropical Plant Pathology, 49(5), 633–648. Wang S, Cheng J, Li T, Liao Y (2020) Response of soil fungal communities to continuous cropping of flue-cured tobacco. Sci Rep 10(1). https://doi.org/10.1038/s41598-020-77044-8 Wang S, Cheng J, Li T, Liao Y (2020b) Response of soil fungal communities to continuous cropping of flue-cured tobacco. Sci Rep 10(1). https://doi.org/10.1038/s41598-020-77044-8 Wong S (2021) Soil Fungal Composition And Diversity In Oil Palm Plantation At Sungai Asap, Sarawak, Malaysia. Journal of Oil Palm Research. https://doi.org/10.21894/jopr.2021.0014 Xiao Y, Zhang S, Li H, Teng K, Wu S, Liu Y, Yu F, He Z, Li L, Li L, Meng D, Yin H, Wang Y (2024) Metagenomic insights into the response of soil microbial communities to pathogenic Ralstonia solanacearum . Front Plant Sci 15. https://doi.org/10.3389/fpls.2024.1325141 Yan X, Guo S, Gao K, Sun S, Yin C, Tian Y (2023) The Impact of the Soil Survival of the Pathogen of Fusarium Wilt on Soil Nutrient Cycling Mediated by Microorganisms. Microorganisms 11(9):2207–2207. https://doi.org/10.3390/microorganisms11092207 Zakaria SNS, Noor NM (2020) A review on major fungus associated with black pepper (Piper nigrum L.) diseases in Malaysia. Int J Sci Eng Res 11(10):6 Zhang X, Wang H, Que Y, Yu D, Wang H (2021) The influence of rhizosphere soil fungal diversity and complex community structure on wheat root rot disease. PeerJ, 9, e12601 Zidack H (2024), January 31 Watch out for these nutrient deficiency symptoms. Home and Garden Education Center. https://homegarden.cahnr.uconn.edu/2024/01/31/nutrientdeficiencyht/ Supplementary Files SupplementaryDocument1.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6652797","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":469107823,"identity":"2b51a8d2-c2ef-4515-bf14-adbc3d139c76","order_by":0,"name":"Choy Yuen Khew","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxUlEQVRIiWNgGAWjYFACNjYgYcPAIEGiljTStRwmQQv/jLS0Bx/bzkebSzcwv/jYxhBtcICAFokbaccNZ7bdzt055wCb5cw2htwNhLQYSKS3SfNuu5274UYCmzHPGWK1/N12jiQtacekGbcdAGlhfsxTQYQWiTPP0iR7/yUD/XKwjXFGhUTuTEJa+NvTzCR+nLHL3S7dfPjDBwOb3D5CWhgEEqAuZGBskwDFjgJBLfwHYFoYmD+AGPINhLSMglEwCkbBSAMAbRdIAKtuR1AAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-5300-3377","institution":"Malaysian Pepper Board","correspondingAuthor":true,"prefix":"","firstName":"Choy","middleName":"Yuen","lastName":"Khew","suffix":""},{"id":469107824,"identity":"5f4ff164-4490-4fcf-ae8d-8ce1d2082a5e","order_by":1,"name":"Suk Cheng Voon","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Suk","middleName":"Cheng","lastName":"Voon","suffix":""},{"id":469107825,"identity":"1f15ed12-7d40-4199-95aa-9d462444d4e1","order_by":2,"name":"Wei Yee Wee","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"Yee","lastName":"Wee","suffix":""},{"id":469107826,"identity":"1d8df6c9-4b13-4290-8b99-f8b2b2185a95","order_by":3,"name":"Ee Tiing Lau","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Ee","middleName":"Tiing","lastName":"Lau","suffix":""}],"badges":[],"createdAt":"2025-05-13 07:51:02","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6652797/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6652797/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":84501387,"identity":"4693dcc6-8e11-4043-9251-502f20c8efbf","added_by":"auto","created_at":"2025-06-12 17:00:17","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":223001,"visible":true,"origin":"","legend":"\u003cp\u003eSoil samples were collected from the rhizosphere of healthy-looking vines and yellowing symptom vines in Serian and Sri Aman, Sarawak, Malaysia.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6652797/v1/34721d434bcb68cc59f1115f.jpg"},{"id":84500883,"identity":"49be2f9b-1df9-4bbd-9e64-1ac65f762a22","added_by":"auto","created_at":"2025-06-12 16:52:17","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":49581,"visible":true,"origin":"","legend":"\u003cp\u003eTaxonomic heat tree visualization of key fungal taxa associated with soil health and disease dynamics.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6652797/v1/8266f7c595024aa44c1b8cd7.jpg"},{"id":84500884,"identity":"2bc26916-6caf-4b36-8999-4eccd1a85988","added_by":"auto","created_at":"2025-06-12 16:52:17","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":27056,"visible":true,"origin":"","legend":"\u003cp\u003eAlpha diversity metrics comparing different samples (DS1, DS2, DS3, H1, HS1, R1, S1) to measure the richness and diversity of the fungal taxa.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6652797/v1/72568f1fd871af4699f5da51.jpg"},{"id":84500885,"identity":"2f43761b-e9ef-4ed4-b987-553cb5b63c58","added_by":"auto","created_at":"2025-06-12 16:52:17","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":167899,"visible":true,"origin":"","legend":"\u003cp\u003ePrediction of soil fungi function from different samples.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6652797/v1/de0ace0fc7d31b8a1b67c2f7.jpg"},{"id":87925670,"identity":"2165f1ac-d314-46d6-9ae4-d54812d965b6","added_by":"auto","created_at":"2025-07-30 12:32:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1033071,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6652797/v1/6420d1c0-6f08-4461-b10b-ab2f41d66985.pdf"},{"id":84500899,"identity":"042b6445-fad0-4e02-9f75-c7b1241e7428","added_by":"auto","created_at":"2025-06-12 16:52:17","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":2161681,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryDocument1.docx","url":"https://assets-eu.researchsquare.com/files/rs-6652797/v1/95586874f511ee3067c1837b.docx"}],"financialInterests":"","formattedTitle":"Influence of Soil Fungal Communities on Soil Health in Relation to Yellowing Symptoms of Black Pepper (Piper nigrum L.) in Sarawak","fulltext":[{"header":"Introduction","content":"\u003cp\u003eYellowing symptoms are among the most prominent early warning signs of issues in black pepper farming, sometimes caused by nutrient deficiencies (Babu et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) or infections (Cheong et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Nutrient deficiencies frequently appear by widespread and uniform yellowing throughout the field or in places with poor soil health (Zidack, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Such deficiencies can frequently be rectified by providing corrective fertiliser treatments that improve plant health. Disease-induced yellowing symptoms, on the other hand, are usually irregular and commonly accompanied by lesions, patches, or rotting (Kharayat, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Black pepper plants that show these disease-related symptoms can die in less than a month, with the infection spreading quickly and posing a serious threat to the entire farm. As a result, early surveillance and detection are essential for reducing losses and restoring affected plants.\u003c/p\u003e \u003cp\u003eBlack pepper farms are frequently affected by three major root diseases: White Root Disease (caused by \u003cem\u003eRigidoporus lignosus\u003c/em\u003e), Yellow Wilt Disease (caused by \u003cem\u003eFusarium solani\u003c/em\u003e), and Foot Rot Disease (caused by \u003cem\u003ePhytophthora capsici\u003c/em\u003e) (Zakaria et al., 2020; Cheong et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Thao et al., 2024). These diseases infiltrate the root system, impairing the plant's capacity to absorb water and nutrients. The early signs of disease are discolouration and yellowing of the leaves, which begin in the lowest portion of the plant and develop upwards. As the disease spreads, branches may die, and the plant might die as a whole. These diseases can lead to massive crop losses and financial hardship for farmers. The indiscriminate and excessive use of chemical fungicides for controlling these diseases has unfortunately led to fungicide resistance in some pathogen populations (Islam et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Accurate and prompt detection of the specific causing pathogen, as well as knowledge of how to deal with the impacted diseases, are critical when developing disease-specific management strategies.\u003c/p\u003e \u003cp\u003eTraditional diagnostic approaches, such as culturing and soil-baiting, were once considered viable ways for detecting soil-borne infections. However, these methods are frequently hampered by their time-consuming and labour-intensive nature, which can delay diagnosis and restrict efficient treatment of diseases (Ghosh et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Recent advances in amplicon sequencing have provided an effective alternative for investigating the complex ecology of the soil fungal communities. By allowing for direct sequencing and analysis of DNA isolated from soil samples, sequencing techniques can discover a wide range of fungal species, including major diseases, without the need for cultivation (Jayalakshmi et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). This culture-independent approach provides a rapid and thorough understanding of the fungal community dynamics associated with various soil conditions, including those that cause plant yellowing symptoms.\u003c/p\u003e \u003cp\u003eAmplicon sequencing offers a more complete picture of the soil fungal, allowing researchers to identify the leading culturable fungal and the vast majority of unculturable fungal that play crucial functions in soil health and plant disease (Xiao et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). This comprehensive investigation of the fungal community may lead to a better understanding of the intricate interactions between plants, pathogens, and beneficial microorganisms, allowing for the development of more targeted and effective disease control strategies (Fadiji et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). This study aims to utilize amplicon sequencing analysis for the surveillance of black pepper farms exhibiting yellowing symptoms. The findings will enable the prompt detection of fungal infections by analyzing the soil fungal communities, leading to a faster and more efficient approach to disease management in black pepper cultivation. By integrating amplicon sequencing techniques into surveillance strategies, we can enhance black pepper farm management by providing actionable insights for early intervention and promoting sustainable agricultural practices.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eSample Collection and Preparation\u003c/h2\u003e \u003cp\u003eA total of six soil samples were collected from the rhizosphere of infected black pepper vines exhibiting yellowing symptoms at two locations in Sarawak, Malaysia. Samples H1 (healthy soil) and S1 (diseased soil) were obtained from Serian in January 2024, while HS1 (healthy soil), DS1 (diseased soil), DS2, and DS3 were collected from Sri Aman in March 2024 (Fig.\u0026nbsp;1). Black pepper has been cultivated on both farms for more than three years. Following collection, the soil samples were transported to the laboratory, where genomic DNA was extracted using the DNeasy\u003csup\u003e\u0026reg;\u003c/sup\u003e PowerSoil\u003csup\u003eⓇ\u003c/sup\u003e Kit (Qiagen, Cat nos. 47014). The extracted DNA was then subjected to Internal Transcribed Spacer (ITS) region sequencing. These sequencing techniques target specific regions of the fungal genome, allowing for the identification and characterization of fungal communities present in the soil samples.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAmplicon Sequencing and Analysis\u003c/h3\u003e\n\u003cp\u003eThe DNA samples proceeded to amplicon library preparation using a 2-step PCR protocol, based on Illumina\u0026rsquo;s ITS metagenomic library preparation guidelines. Fungal ITS1 regions of the fungal genes were amplified using locus-specific sequence primers with overhang adapters. The forward overhang sequence was 5\u0026rsquo; TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus‐ specific sequence], and the reverse overhang sequence was 5\u0026rsquo; GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus‐ specific sequence]. KOD -Multi \u0026amp; Epi-\u0026reg; (Toyobo) was used for all PCR reactions. Following amplification, dual indices were attached to the amplicon PCR products using the Illumina Nextera XT Index Kit v2. Following normalization and pooling, the libraries were sequenced using the MiSeq platform on 300 PE. The DADA2 workflow is employed to generate amplicon sequence variants (ASVs) (Callahan et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The quality assessment of raw reads is performed via FastQC, followed by the removal of primers and adaptors with Cutadapt 3.5 (Martin, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Paired-end readings are processed and merged using DADA2 V1.18.\u003c/p\u003e\n\u003ch3\u003eFungal Community Analysis\u003c/h3\u003e\n\u003cp\u003eThe SILVA nr database (version 138.1, last updated on March 10, 2021) was used for chimera screening and taxonomic assignment. Phylogenetic analysis for UniFrac involved sequence alignment using MUSCLE v3.8 (Edgar RC, 2004), followed by the construction of a phylogenetic tree using FastTree2 (Price MN, Dehal PS, Arkin AP, 2010). Paired-end reads were initially processed to remove sequencing adaptors and low-quality bases using BBDuk from the BBTools package (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://sourceforge.net/projects/bbmap/\u003c/span\u003e\u003cspan address=\"https://sourceforge.net/projects/bbmap/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Forward and reverse reads were then merged using USEARCH v11.0.667 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.drive5.com/usearch/\u003c/span\u003e\u003cspan address=\"https://www.drive5.com/usearch/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Reads shorter than 150 bp or longer than 600 bp were excluded to ensure consistent sequence length for downstream analysis. The preprocessed reads were aligned to the ITS reference database (UNITE) to identify fungal sequences. Chimeric sequences were detected and removed using VSEARCH v2.6.2. Merged reads were clustered de novo into operational taxonomic units (OTUs) at 97% similarity using UPARSE v11.0.667. To maintain data quality, rare OTUs with fewer than two reads (doubletons) were excluded. A single representative sequence from each OTU was selected randomly. Representative sequences were aligned using PyNAST (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/pubmed/19914921\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/pubmed/19914921\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and a phylogenetic tree was constructed and this ensured the accurate placement of OTUs in the phylogenetic context. The fungal sequences were functionally annotated using FUNGuild v.1.1.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eFungal Diversity and Community Structure\u003c/h2\u003e \u003cp\u003eA taxonomic heat tree visualization (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003e) was generated utilizing the metacoder package in R, a well-established tool for the analysis and visualization of metagenomic data. This methodological approach provides a comprehensive representation of the taxonomic groups distributed across various soil samples, facilitating the identification of key fungal taxa that are associated with soil health and disease dynamics. Among the analyzed samples, Ascomycota was discerned as the predominant fungal phylum, succeeded by Sordariomycetes. Other noteworthy taxa included Hypocreales, Basidiomycota, and Agaricomycetes, indicating a complex and diverse fungal community structure in black pepper cultivation farms.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eComparison of Healthy and Diseased Soil Samples\u003c/h3\u003e\n\u003cp\u003eThe heat tree visualization elucidated distinct differences between healthy (H1, HS1) and diseased (S1, DS1, DS2, DS3) soil samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Healthy soil samples were characterized by a greater prevalence of blue regions, signifying lower fungal abundance and reflecting a more balanced microbial community. Conversely, diseased soil samples exhibited an increase in orange regions, indicative of heightened fungal abundance. This enrichment of orange colouration suggests an increase in pathogenic fungi, which may be contributing to the manifestation of soil disease. Moreover, a progressive intensification of orange colouration was observed from DS1 to DS3, indicating a microbial shift linked to disease progression and a consequential proliferation of fungal populations in the later stages.\u003c/p\u003e \u003cp\u003eThe spatial distribution of orange regions further illustrates a correlation between fungal proliferation and disease severity. Specifically, samples DS2 and DS3 displayed the most pronounced orange shading, suggesting that particular fungal taxa are proliferating aggressively in these environments. Sample S1 was categorized as diseased, it contained some blue regions, which may reflect variability in the fungal community composition. This observation implies that S1 may represent an early-stage diseased soil, whereas DS2 and DS3 reflect more established and robust fungal communities. Among all diseased soil samples, DS3 demonstrated the highest fungal abundance, with the most intense orange coloration, signaling advanced-stage fungal proliferation that aligns with the later stages of soil disease.\u003c/p\u003e \u003cp\u003eThese findings are consistent with the symptoms illustrated in Fig.\u0026nbsp;1, wherein yellowing symptoms were more pronounced in DS1, DS2, and DS3 vines. The established relationship between fungal community composition and disease severity underscores the critical role of fungal proliferation in the deterioration of plant health. A comprehensive understanding of these microbial shifts provides significant insights into the influence of fungal communities on soil health and the progression of disease.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eAlpha Diversity Analysis\u003c/h2\u003e \u003cp\u003eAlpha diversity metrics were employed to evaluate species richness and distribution across various soil samples (DS1, DS2, DS3, H1, HS1, R1, and S1). The results indicated that DS3 exhibited the highest observed richness (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e), followed closely by DS2 and DS1, suggesting that diseased soils harbor a more diverse fungal community. In contrast, healthy soils (H1 and HS1) displayed lower richness values, indicative of a stable community characterized by a reduced presence of opportunistic taxa. It is noteworthy that S1, while classified as diseased, displayed richness similar to that of healthy soils, which may imply the presence of early-stage disease.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe Chao1 index (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e) highlighted the abundance of rare species in diseased soils, thereby contributing to their richness, while healthy soils exhibited lower Chao1 values. The highest Shannon index was recorded for DS3, confirming a greater degree of richness and evenness in diseased soils relative to their healthy counterparts. Contrastingly, healthy soils such as H1 and HS1 were found to demonstrate a more specialized community composition dominated by beneficial taxa.\u003c/p\u003e \u003cp\u003eSupplementary analyses utilizing the Simpson indices supported the observation of evenness within diseased soils, while Fisher\u0026rsquo;s Alpha confirmed that these soils possess the highest levels of microbial diversity when compared to their healthy counterparts. These findings indicate that diseased soils exhibit greater richness and diversity, a phenomenon likely driven by the prevalence of pathogenic fungi.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eTaxonomic Distribution of Fungal Communities in Soil Samples\u003c/h2\u003e \u003cp\u003eTo further delineate the fungal groups of significant enrichment in the samples, taxonomic distributions were visualized using pie charts (Supplementary Document 1). This analysis facilitated an exploration of the relative abundances of distinct fungal taxa within the intricate hierarchies of metagenomic classification, enabling a detailed comparison between healthy and diseased soil samples obtained from various locations.\u003c/p\u003e \u003cp\u003eHealthy soil samples from Serian Farm (H1) were predominantly represented by \u003cem\u003eHumicola\u003c/em\u003e (54%), followed by Staphylotrichum (12%), with minor contributions from Phlyctis (4%) and low levels of \u003cem\u003eFusarium\u003c/em\u003e (0.8%). Similarly, the healthy soil from Sri Aman Pepper Farm (HS1) was primarily dominated by Rhizoctonia (26%) and Phlyctis (13%), alongside beneficial taxa such as \u003cem\u003eTrichoderma\u003c/em\u003e (5%), with minimal \u003cem\u003eFusarium\u003c/em\u003e levels (1%). Diseased soils showed a significant decline in beneficial fungi and an increase in pathogenic taxa. At Serian Farm (S1), \u003cem\u003eHumicola\u003c/em\u003e decreased by 21%, while pathogenic species like \u003cem\u003eFusarium\u003c/em\u003e (9%), \u003cem\u003ePurpureocillum\u003c/em\u003e (14%), and \u003cem\u003eChaetomium\u003c/em\u003e (6%) increased. A similar trend was observed at Sri Aman Pepper Farm, in which the beneficial microbes such as \u003cem\u003eTrichoderma\u003c/em\u003e decreased from 5% in healthy soil to 0.8% in late-stage diseased soil. The diseased soils (DS1, DS2, DS3) exhibited higher levels of \u003cem\u003eFusarium\u003c/em\u003e, \u003cem\u003ePurpureocillium\u003c/em\u003e, \u003cem\u003eSetosynnema\u003c/em\u003e, and \u003cem\u003eChaetomium\u003c/em\u003e. The abundance of \u003cem\u003eFusarium\u003c/em\u003e peaked during the initial to intermediate stages of disease progression, exhibiting a significant decline in soils corresponding to later stages.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePrediction of the fungal community function\u003c/h2\u003e \u003cp\u003eThe fungal community in rhizosphere soil was classified and analyzed using FUNGuild to identify the functional groups of fungi present and their relative abundance across different samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In the Sri Aman farm, most soil samples were dominated by pathotroph-saprotroph-symbiotroph fungi. Pathotrophs were detected in all samples, with the highest abundance observed during the early to intermediate stages of disease progression (DS1 to DS2), followed by a marked decline at the later stage (DS3). In contrast, soils from the Serian farm were primarily dominated by pathotroph-saprotroph fungi, with a higher proportion of pathotrophs in the diseased sample (S1). Furthermore, a shift was observed from saprotroph-symbiotroph in DS2 to increased proportions of symbiotroph and saprotroph in DS3. This transition may indicate an ecological succession in the fungal community toward a more decomposer- and mutualist-driven system during the later stages of disease progression.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussions","content":"\u003cp\u003eAmong all the samples analyzed, Ascomycota emerged as the dominant fungal phylum, followed closely by Sordariomycetes. Ascomycota fungi are prevalent in soils worldwide (Egidi et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and play a crucial role in carbon and nitrogen cycling (Challacombe et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These fungi enhance soil stability, decompose plant biomass, and engage in crucial endophytic interactions with plants through specialized enzymes that target cellulose, hemicellulose, and lignin (Manici et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Additionally, Ascomycota can form symbiotic relationships with biocrust components or act as latent saprotrophs or pathogens on plant tissues (Challacombe et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWithin the Ascomycota division, Sordariomycetes represent a significant class found in various ecosystems, serving as endophytes, plant pathogens, and saprotrophs. They are essential contributors to decomposition and nutrient cycling (Taylor et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The Hypocreales order, a prominent group within Sordariomycetes, is particularly noted for its role as a rapid decomposer of plant tissue in soil (Wang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2020\u003c/span\u003eb). However, certain fungi from this order, such as \u003cem\u003eFusarium\u003c/em\u003e, are recognized as potential pathogens of black pepper.\u003c/p\u003e \u003cp\u003eIn addition to Ascomycota and Sordariomycetes, Basidiomycota also contributes to soil diversity. Prior studies have reported Basidiomycota as dominant in secondary forests, in contrast to Ascomycota, which dominates in crop plantation soils (Wong, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This trend aligns with the current findings. Basidiomycetes are particularly involved in ectomycorrhizal associations with forest trees, playing a significant role in nutrient exchange and ecosystem stability (Basidiomycota - an Overview | ScienceDirect Topics, n.d.). The major group within Basidiomycota is Agaricomycetes, which includes mushroom-forming fungi that serve as decomposers, pathogens, and mutualists in terrestrial ecosystems (Hibbett et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eA comparison of healthy soil samples (H1, HS1) and diseased ones (S1, DS1, DS2, DS3) reveals significant differences in fungal communities. The analysis showed that healthy soils had lower fungal abundance, while diseased soils exhibited higher levels of diversity and richness within their fungal communities. These findings align with earlier research on the microbial communities associated with root rot in black pepper (Obieze et al., 2023). Typically, an increased abundance of microbial communities is associated with enhanced resistance to pathogens, providing a protective role against disease (Yan et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). However, the higher richness and diversity of fungal communities in diseased soils may result from a shift in community structure that creates conditions favorable for the occurrence of pepper root rot diseases, as noted by Zhang et al. (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Certain taxa may become dominant in these environments due to stress from environmental factors or the effects of plant disease.\u003c/p\u003e \u003cp\u003eContinuous pepper cropping has been identified as a significant factor contributing to the occurrence of root rot. Research indicates that this practice leads to a reduction in fungal populations (Tan et al., 2017a, b). Specifically, the decline in diversity among rhizosphere fungi\u0026mdash;particularly beneficial groups that are essential for plant health\u0026mdash;may hinder disease resistance and increase vulnerability to infections during successive cropping cycles (Ji et al., 2021). The current findings suggest a connection between low fungal taxonomic richness and diversity in healthy soil and the practice of continuous pepper cropping in the sample collection areas, which contributes to increased disease susceptibility.\u003c/p\u003e \u003cp\u003eIn healthy soils, the presence of beneficial fungi, such as \u003cem\u003eHumicola\u003c/em\u003e and \u003cem\u003eTrichoderma\u003c/em\u003e, indicates a strong microbial ecosystem that supports plant growth and disease resistance. For instance, \u003cem\u003eHumicola\u003c/em\u003e was predominant in the healthy soil from Serian Farm (Supplementary Document 1), highlighting its potential role in nutrient cycling and enhancing plant health (Shang et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Both \u003cem\u003eHumicola\u003c/em\u003e and \u003cem\u003eTrichoderma\u003c/em\u003e may serve as biological control agents against diseases in pepper plants (Ko et al., 2011). The increased relative abundance of these fungi contributes to the reduction of pathogenic fungi and enhances soil organic matter content (Li et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn contrast, the healthy soil from Sri Aman Pepper Farm was characterized by the presence of Rhizoctonia, a soil- and seed-borne fungus in the basidiomycete class, which can thrive freely in the soil and act as a saprophyte. Meanwhile, the diseased soil samples exhibited a significant decline in beneficial fungal populations, indicating a shift towards a more pathogenic environment. The rise in \u003cem\u003eFusarium\u003c/em\u003e and other pathogenic taxa, such as \u003cem\u003ePurpureocillium\u003c/em\u003e and \u003cem\u003eChaetomium\u003c/em\u003e, under disease conditions reflects a disruption in the microbial balance, potentially contributing to plant stress and increased vulnerability to disease. Notably, the decline of \u003cem\u003eTrichoderma\u003c/em\u003e from 5% in healthy soils to 0.8% in diseased soils at Sri Aman Pepper Farm highlights the importance of this genus in suppressing pathogens and promoting soil health.\u003c/p\u003e \u003cp\u003eData indicate a dynamic pattern in the prevalence of \u003cem\u003eFusarium\u003c/em\u003e throughout different disease progression stages. Its initial increase may correlate with early disease symptoms, suggesting that \u003cem\u003eFusarium\u003c/em\u003e behaves opportunistically in response to weakened plant defenses. However, its subsequent decline in later stages could indicate a change in the soil environment, possibly due to resource depletion or competition with other microbes, which may limit \u003cem\u003eFusarium\u003c/em\u003e's growth. The prevalence of \u003cem\u003eFusarium\u003c/em\u003e wilt was significantly positively correlated with the abundance and diversity of soil fungi. Furthermore, continuous monocropping that led to an increase in both the abundance and diversity of soil fungi might decreasing the ability of the soil microflora to resist the invasion of \u003cem\u003eFusarium\u003c/em\u003e species, ultimately facilitating the successful colonization and accumulation of \u003cem\u003eFusarium\u003c/em\u003e spp. in the soil (Yan et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe functional profiling of rhizosphere fungal communities revealed distinct shifts in trophic modes associated with disease progression and site location, highlighting the dynamic nature of plant\u0026ndash;microbe interactions in soil ecosystems. The dominance of pathotroph-saprotroph-symbiotroph fungi in diseased soils from the Sri Aman farm (DS1 and DS2) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e) suggests a highly versatile fungal community capable of both nutrient recycling and pathogenic interactions with host plants. The elevated abundance of pathotrophs during the early (DS1) and intermediate (DS2) stages of disease progression is consistent with the proliferation of opportunistic and plant-pathogenic fungi, potentially contributing to or exacerbating disease severity in the rhizosphere.\u003c/p\u003e \u003cp\u003eInterestingly, the decline in pathotroph abundance observed in DS3 may indicate a late-stage ecological transition, possibly due to resource depletion, plant mortality, or the establishment of more competitive or mutualistic fungi. This shift coincides with an increase in saprotrophs and symbiotrophs, which could reflect a transition from active infection toward decomposition and/or attempted recovery of the microbial community balance.\u003c/p\u003e \u003cp\u003eThese findings have important implications for agricultural practices. Understanding the microbial dynamics in both healthy and diseased soils can guide effective plant health management strategies, such as enhancing the populations of beneficial fungi through soil amendments or the use of microbial inoculants. Recognizing the roles of specific pathogens can also aid in developing targeted interventions to mitigate the impacts of soil-borne diseases. Additionally, fungal diversity may serve as a valuable biological indicator for assessing the health of black pepper cultivation.\u003c/p\u003e"},{"header":"Conclusion and Recommendations","content":" \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003cp\u003eThe analyses of taxonomic heat trees and taxonomic distribution provide important insights into how fungal communities change in response to soil health and disease progression. Healthy soils maintain a stable fungal ecosystem characterized by beneficial taxa such as \u003cem\u003eHumicola\u003c/em\u003e and \u003cem\u003eTrichoderma\u003c/em\u003e, which serve as essential indicators of soil health. In contrast, diseased soils experience a decline in beneficial microbes, an increase in pathogenic fungi such as \u003cem\u003eFusarium\u003c/em\u003e, \u003cem\u003ePurpureocillium\u003c/em\u003e, and \u003cem\u003eChaetomium\u003c/em\u003e, along with greater fungal diversity. These shifts in fungal communities correlate with observable plant disease symptoms, highlighting the impact of fungal proliferation on soil health decline. This study emphasizes the potential for targeted interventions, such as using biocontrol agents or soil amendments, to enhance beneficial fungi and suppress pathogenic taxa, thereby improving soil quality and plant health.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting Interests\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no known financial or personal relationships that could have appeared to influence the work reported in this article.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis research was funded by grants from the Malaysian Pepper Board of the Ministry of Plantation Industries and Commodities (20-1130000-10025).\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e \u003cp\u003eThis research was funded by grants from the Malaysian Pepper Board of the Ministry of Plantation Industries and Commodities (20-1130000-10025). We would like to extend our gratitude to Mr. Reki Rangking for his assistance in collecting samples from the pepper farms.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBabu S, Sujatha VS, Reshmi VR, Suresh KP, Pathrose B, Ragesh G (2019) Influence of major nutrients and seasons in yellowing affected black pepper fields. J Pharmacognosy Phytochemistry 8(5):2368\u0026ndash;2373\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBasidiomycota - an overview | ScienceDirect Topics (n.d.). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003eWww.sciencedirect.com\u003c/span\u003e\u003cspan address=\"http://Www.sciencedirect.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/basidiomycota\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCallahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP (2016) DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods 13(7):581\u0026ndash;583\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChallacombe JF, Hesse CN, Bramer LM, McCue LA, Lipton M, Purvine S, Nicora C, Gallegos-Graves LV, Porras-Alfaro A, Kuske CR (2019) Genomes and secretomes of Ascomycota fungi reveal diverse functions in plant biomass decomposition and pathogenesis. BMC Genomics 20(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12864-019-6358-x\u003c/span\u003e\u003cspan address=\"10.1186/s12864-019-6358-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheong SH, Kundat FR, Wong MY, Kwan YM (2021) Characterisation and Pathogenicity of \u003cem\u003eFusarium\u003c/em\u003e Species Associated with Yellowing Disease in Black Pepper (\u003cem\u003ePiper nigrum\u003c/em\u003e L). Sains Malaysiana 51(11):3591\u0026ndash;3605. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.17576/jsm-2022-5111-07\u003c/span\u003e\u003cspan address=\"10.17576/jsm-2022-5111-07\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEgidi E, Delgado-Baquerizo M, Plett JM et al (2019) A few Ascomycota taxa dominate soil fungal communities worldwide. Nat Commun 10:2369. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-019-10373-z\u003c/span\u003e\u003cspan address=\"10.1038/s41467-019-10373-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFadiji AE, Ayangbenro AS, Akanmu AO, Babalola OO (2025) Plant health in the era of metagenomics: Current state and future prospects. Metagenomics, pp 399\u0026ndash;419\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhosh R, Tarafdar A, Chobe DR, Chandran S, Rani US, S., Sharma M (2019) Diagnostic techniques of soil borne plant diseases: recent advances and next generation evolutionary trends. In Biological Forum\u0026ndash;An International Journal (Vol. 11, No. 2, pp. 1\u0026ndash;13). Research Trend\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHibbett DS, Bauer R, Binder M, Giachini AJ, Hosaka K, Justo A, Larsson E, Larsson KH, Lawrey JD, Miettinen O, Nagy LG, Nilsson RH, Weiss M, Thorn RG (2014) 14 Agaricomycetes. Systematics and Evolution, 373\u0026ndash;429. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-642-55318-9_14\u003c/span\u003e\u003cspan address=\"10.1007/978-3-642-55318-9_14\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIslam T, Danishuddin, Tamanna NT, Matin MN, Barai HR, Haque MA (2024) Resistance Mechanisms of Plant Pathogenic Fungi to Fungicide, Environmental Impacts of Fungicides, and Sustainable Solutions. Plants 13(19):2737. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/plants13192737\u003c/span\u003e\u003cspan address=\"10.3390/plants13192737\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJayalakshmi K et al (2023) Detection and Diagnosis of Important Soil-Borne Pathogens. In: Singh UB, Kumar R, Singh HB (eds) Detection, Diagnosis and Management of Soil-borne Phytopathogens. Springer, Singapore. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-981-19-8307-8_5\u003c/span\u003e\u003cspan address=\"10.1007/978-981-19-8307-8_5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKharayat BS (2023) Diseases Of Field And Horticultural Crops And Their Management Volume\u0026ndash;Ii. Phi Learning Pvt. Ltd.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026zwnj;Ko WH, Yang CH, Lin MJ, Chen CY, Tsou YJ (2011) \u003cem\u003eHumicola\u003c/em\u003e phialophoroides sp. nov. from soil with potential for biological control of plant diseases. Bot Stud 52:197\u0026ndash;202\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Chen Y, Zhao G, Chen Y, Zhang N, Yu D, Li X (2024) Herbal materials used as soil amendments alleviate root rot of Panax ginseng. Sci Rep 14(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-024-74304-9\u003c/span\u003e\u003cspan address=\"10.1038/s41598-024-74304-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu C, Li H, Dong J, He X, Zhang L, Qiu B (2024) Structure and function of rhizosphere soil microbial communities associated with root rot of Knoxia roxburghii. Front Microbiol 15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2024.1424633\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2024.1424633\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManici LM, Caputo F, Fornasier F, Paletto A, Ceotto E, De Meo I (2024) Ascomycota and Basidiomycota fungal phyla as indicators of land use efficiency for soil organic carbon accrual with woody plantations. Ecol Ind 160:111796\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin M (2014) Algorithms and tools for the analysis of high throughput DNA sequencing data\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026zwnj; Obieze CC, George PBL, Boyle B, Khasa DP (2023) Black pepper rhizomicrobiome: Spectrum of plant health indicators, critical environmental factors and community compartmentation in Vietnam. Appl Soil Ecol 187:104857. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.apsoil.2023.104857\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2023.104857\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShang G, Zou Q, Zhang J, Wang J, Zhang Y, Liu M, Wang S, Zhang D, Wang W, Wang Y (2023) Effects of Tillage Depth on Nutrients and Microbial Communities in Tobacco-Planting Soil. Agricultural Sci 14(12):1702\u0026ndash;1715. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4236/as.2023.1412110\u003c/span\u003e\u003cspan address=\"10.4236/as.2023.1412110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaylor TN, Krings M, Taylor EL (2015) Fossil fungi. Academic, London\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThao, L. D., Khanh, T. N., Van Liem, N., Hien, L. T., Thanh, H. M., Binh, V. T. P.,\u0026hellip; Brau, L. (2024). Current species of oomycetes associated with foot rot disease of black pepper in Vietnam. Tropical Plant Pathology, 49(5), 633\u0026ndash;648.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang S, Cheng J, Li T, Liao Y (2020) Response of soil fungal communities to continuous cropping of flue-cured tobacco. Sci Rep 10(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-020-77044-8\u003c/span\u003e\u003cspan address=\"10.1038/s41598-020-77044-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang S, Cheng J, Li T, Liao Y (2020b) Response of soil fungal communities to continuous cropping of flue-cured tobacco. Sci Rep 10(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-020-77044-8\u003c/span\u003e\u003cspan address=\"10.1038/s41598-020-77044-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWong S (2021) Soil Fungal Composition And Diversity In Oil Palm Plantation At Sungai Asap, Sarawak, Malaysia. Journal of Oil Palm Research. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.21894/jopr.2021.0014\u003c/span\u003e\u003cspan address=\"10.21894/jopr.2021.0014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao Y, Zhang S, Li H, Teng K, Wu S, Liu Y, Yu F, He Z, Li L, Li L, Meng D, Yin H, Wang Y (2024) Metagenomic insights into the response of soil microbial communities to pathogenic \u003cem\u003eRalstonia solanacearum\u003c/em\u003e. Front Plant Sci 15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2024.1325141\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2024.1325141\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan X, Guo S, Gao K, Sun S, Yin C, Tian Y (2023) The Impact of the Soil Survival of the Pathogen of \u003cem\u003eFusarium\u003c/em\u003e Wilt on Soil Nutrient Cycling Mediated by Microorganisms. Microorganisms 11(9):2207\u0026ndash;2207. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms11092207\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms11092207\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZakaria SNS, Noor NM (2020) A review on major fungus associated with black pepper (Piper nigrum L.) diseases in Malaysia. Int J Sci Eng Res 11(10):6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, Wang H, Que Y, Yu D, Wang H (2021) The influence of rhizosphere soil fungal diversity and complex community structure on wheat root rot disease. PeerJ, 9, e12601\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZidack H (2024), January 31 Watch out for these nutrient deficiency symptoms. Home and Garden Education Center. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://homegarden.cahnr.uconn.edu/2024/01/31/nutrientdeficiencyht/\u003c/span\u003e\u003cspan address=\"https://homegarden.cahnr.uconn.edu/2024/01/31/nutrientdeficiencyht/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Black Pepper, Soil health, ITS Amplicon Sequencing, Fungal, Yellowing symptoms","lastPublishedDoi":"10.21203/rs.3.rs-6652797/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6652797/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground and Aims\u003c/h2\u003e \u003cp\u003eFungal communities are critically important for crop health and soil fertility. ITS amplicon sequencing has transformed soil fungal ecology by enabling high-resolution identification of fungal taxa, revealing extensive diversity and functional roles of soil fungal. However, our knowledge regarding how fungal community structure responds to healthy versus diseased black pepper crops is limited. This study aims to investigate the fungal community structure in soils from healthy and diseased black pepper crops, with a particular focus on the relationship between fungal abundance, diversity, and the symptoms exhibited by the plants.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eWe used high-throughput amplicon sequencing technology to comparatively analyze the fungal abundance, diversity, and community composition in soils from healthy black pepper crops versus those displaying yellowing symptoms.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe findings revealed that black pepper plants with yellowing symptoms exhibited altered soil fungal abundance and significant variations in fungal diversity. Specifically, crops with yellowing symptoms showed an increased relative abundance of \u003cem\u003eFusarium\u003c/em\u003e, \u003cem\u003ePurpureocillium\u003c/em\u003e, and \u003cem\u003eChaetomium\u003c/em\u003e, along with greater overall fungal diversity. Conversely, healthy crops had a higher abundance of beneficial fungi, such as \u003cem\u003eTrichoderma\u003c/em\u003e and \u003cem\u003eHumicola\u003c/em\u003e.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThe analysis highlighted distinct shifts in trophic modes linked to disease progression and site location, emphasizing the dynamic interactions between plants and soil microbes. This study suggests the potential for targeted interventions, such as the use of biocontrol agents or soil amendments, to promote beneficial fungi while suppressing pathogenic taxa, ultimately improving soil quality and plant health.\u003c/p\u003e","manuscriptTitle":"Influence of Soil Fungal Communities on Soil Health in Relation to Yellowing Symptoms of Black Pepper (Piper nigrum L.) in Sarawak","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-12 16:52:12","doi":"10.21203/rs.3.rs-6652797/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ec7e3051-4c49-470e-a3e4-456e93a42ccd","owner":[],"postedDate":"June 12th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-07-30T12:24:45+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-12 16:52:12","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6652797","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6652797","identity":"rs-6652797","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.