Enhancing Cognitive Function in Diabetic Rats: The Role of Exercise and Selenium Nanoparticles in Hippocampal Protection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Enhancing Cognitive Function in Diabetic Rats: The Role of Exercise and Selenium Nanoparticles in Hippocampal Protection Kimia Aliakbari, Payam Saidie This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5723589/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 01 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted 8 You are reading this latest preprint version Abstract Cognitive decline is a common complication of diabetes, and is inadequately addressed by current treatments. This study examined the effects of selenium nanoparticles (SeNPs) and high-intensity interval training (HIIT) on cognitive function and neuroprotection in diabetic rats. Male Wistar rats (n = 31) were induced with diabetes and assigned to five groups entered into 8 weeks intervention: control (CO), control which receive placebo (PCO), SeNPs treatment (0.1 mg/kg) (SeNPs), HIIT (HIIT), and combined SeNPs with HIIT (SeNPs + HIIT). Cognitive function was assessed using the Morris water maze test. Hippocampal tissues were analysed for cell viability, gene expression of BDNF, GLUT4, and Irisin receptor, as well as serum protein levels of Irisin and hippocampal BDNF protein level. Results showed that all treatment groups had a significant effect on learning, memory, cell viability, GLUT4, BDNF and irisin (P < 0.03). Serum Irisin was higher in HIIT and SeNPs + HIIT groups (P < 0.0001), also SeNPs and SeNPs + HIIT groups showed increased GLUT4 expression (P < 0.03). SeNPs + HIIT groups had the significant effect on BDNF both gene and protein compared to the all control (CO, PCO) groups (P < 0.01). These findings suggest that combining SeNPs and HIIT may mitigate cognitive decline and promote neuroprotection in diabetes via modulation of Irisin and BDNF pathways and improved glucose metabolism. While synergy is suggested, mechanistic confirmation requires further study. Translational potential exists, but clinical validation is needed due to species differences. Limitations include unmonitored confounders, sample size, and lack of mechanistic validation, highlighting the need for future research. Biological sciences/Biotechnology Biological sciences/Neuroscience Biological sciences/Physiology Health sciences/Diseases Diabetes Mellitus Type 2 Hippocampus Cognition High-Intensity Interval Training Selenium Neuroprotective Agents Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Diabetes mellitus (DM) is particularly prominent in Western and industrialized nations, where a substantial number of individuals seek medical care for DM, Over the past three decades, the prevalence of DM in the global adult population has surged by 20%, and projections indicate that by 2040, the worldwide diabetic population will reach 642 million. Significantly, the majority of these individuals (80%) reside in low- and middle-income countries 1 . Cognitive impairment in diabetics is a growing concern, primarily due to high blood glucose levels, Memory deficits, attention and concentration challenges, language difficulties, executive function impairments, and visuospatial skills disruptions all underscore the far-reaching consequences of this condition 2 . Hyperglycemia triggers a cascade of pathological mechanisms that affect key brain areas involved in learning, memory, and spatial navigation, ultimately leading to cognitive impairment. In diabetic models, significant hippocampal cell loss has been observed, contributing to deficits in memory and learning. Additionally, these models exhibit reduced brain antioxidant levels, exacerbating cognitive decline. Although the brain is not insulin-dependent, insulin can cross the blood-brain barrier (BBB). Therefore, Insulin resistance in the brain results in chronic glucose dysregulation, which affects insulin-sensitive glucose transporter type 4 (GLUT4)-expressing neurons, ultimately impacting brain structure and impairing cognition 3 . High-Intensity Interval Training (HIIT) involves short bursts of intense exercise alternated with low intensity recovery periods and possibly the most time-efficient way to exercise 4 , The interplay of enhanced cerebral blood flow, changes in brain mechanical properties and the release of neurotrophic factors such as Brain-derived neurotrophic factor (BDNF), contributing to enhanced neurogenesis and cognitive performance. This complex relationship underscores the potential of HIIT in promoting brain health and cognitive function 5 . Selenium's potential for neuroprotection, diabetic control, and oxidative stress management has been widely studied 6 . Selenium nanoparticles (SeNPs) have emerged as promising drug delivery carriers due to their low toxicity, strong biocompatibility, and antioxidation capacities 6 . SeNPs enhance bioavailability and show potential in diabetes management, involving complex mechanisms across multiple pathways 6 . Treatment with SeNPs improves insulin sensitivity and glucose metabolism, acting as hypoglycaemic agents and boosting insulin secretion 7 . Furthermore, decreased plasma selenium is linked to cognitive decline, with the brain remaining selenium-replete the longest during deficiency, highlighting its importance in brain function 8 . Irisin influences biological responses and contributes to DM pathology. It crosses the BBB and is expressed in the hippocampus, which is involved in learning 9 . Exercise-induced irisin secretion has been linked to increased hippocampal BDNF expression 9 . While selenium influences insulin-regulated glucose transporters, like glucose transporter type 4 (GLUT4) 10 , irisin modulates cognitive function, especially during exercise, by activating pathways that increase BDNF expression in neurons 11 . Exercise raises hippocampal BDNF levels, addressing cognitive deficits 12 . BDNF is essential for neuronal health, survival, neurogenesis, learning and memory 13 . However, dysfunctional glucose metabolism is present in brain regions of neurodegenerative disease patients 11 . DM significantly threatens brain health, contributing to cognitive decline and neurodegeneration, with impaired insulin signalling and glucose metabolism linked to these processes 14 . Specifically, hippocampal insulin resistance is crucial for cognitive impairment in DM. Dysregulation of the GLUT4 leads to reduced glucose supply to neurons, explaining the comorbidity of insulin resistance and cognitive deficits 15 . Impaired GLUT4 is linked to cognitive challenges in hippocampal tasks, while enhancing GLUT4 activity can improve memory 15 . Insulin plays multiple roles in the brain, particularly in regulating hippocampal processes and metabolism; overall, reduced GLUT4 activation due to insulin resistance is central to cognitive impairments in DM 15 . The relationship between selenium and diabetes has sparked significant interest, yielding mixed findings. Some studies indicate a strong connection between selenium levels and diabetes risk, while others find no significant association, highlighting the complexity of selenium's role in metabolic health 16,17 . While HIIT and selenium independently benefit neuroprotection and glucose metabolism, their combined effect on cognitive function in diabetes remains unexplored. HIIT enhances neurotrophic factors like BDNF, while SeNPs combat oxidative stress and improve insulin signalling. Given their complementary mechanisms, we investigate whether HIIT and SeNPs together provide superior neuroprotection and cognitive benefits in DM. Our study examines spatial learning, memory, hippocampal cell viability, and the expression of irisin, BDNF, and GLUT4 to uncover their synergistic effects. Methods Animals Thirty-one male Wistar rats (age = 8 weeks, weight= 250 ± 38 gr) were provided by the Animals Center of the Pasteur Institute of Iran and were kept for 11 weeks (one week of familiarization, one week of induction of diabetes, one week of familiarization with the training protocol, and eight weeks of the main training protocol) in a standard environment (temperature of 22 ± 2 °C, and a 12-h light/dark cycle) in the animal house of Histogenotech lab, with ad libitum access to food and water. The study protocol was approved by the Ethics Committee in biomedical research of Guilan University (IR.GUILAN.REC.1401.063), and all methods used in this study are reported in accordance with ARRIVE guidelines. All methods were performed in accordance with the relevant guidelines and regulations. Diabetes mellitus induction One week after familiarization with the new environment, all rats were injected once with 65 mg/kg streptozotocin (STZ) solution (cat No: S0130, Sigma-Aldrich Co., USA, prepared in 0.5 M citrate buffer/pH 4.5). 7 days later, all rats with fasting blood glucose higher than 280 mg/kg were considered diabetic 18 . Group allocation After diabetes induction rats were randomly allocated into five groups (n = 5 per group + 2 additional rat for reserve in treatment groups to account for potential mortality. As no exclusions were necessary, these reserve rats were included in the final analysis, resulting in a total of n = 7 per treatment group): Control Group (CO); Placebo Control Group, which received a nano solvent (water) as a placebo (PCO); selenium nanoparticles group (SeNPs); high-intensity interval training Group (HIIT) and combining selenium nanoparticles and high-intensity interval training group (SeNPs+HIIT). The experimental design is shown in detail in Fig 1 . Acclimatization stage and VO2max measurement To learn how to run on an animal treadmill, the rats in the HIIT and SeNPs+HIIT groups were forced to run on the treadmill for 15 minutes at a speed of 10 to 15 m/min for 5 days in one week. Aligns with protocols in prior studies, to avoid unintended metabolic adaptations Sedentary groups (CO, PCO, SeNPs) were not exposed to the treadmill 19 . Before the training protocol, an incremental test was performed to exhaustion (starting at 10 m/min with increments of 3 m/min every 2 min). Exhaustion was defined as the inability of the rats to run on the treadmill despite electric shocks 20 . (additional information are available in repository). Selenium Nanoparticles supplementation SeNPs (cat no: 919519, Sigma Aldrich) were purchased from Merck Life Science UK Limited (New Road, The Old Brickyard, Gillingham, Dorset, SP8 4XT, United Kingdom) and were administered by gavage to the SeNPs and SeNPs+HIIT group rats at a dose of 0.1 mg/kg every other day for 8 weeks 21 . Selenium has a narrow therapeutic window, and its nanoparticles have been optimized to enhance bioavailability while minimizing toxicity. Studies suggest that doses exceeding 0.9 mg/kg could lead to selenium toxicity, whereas 0.1 mg/kg remains within a safe and effective range in diabetic models 22 . Exercise protocol An HIIT program was performed in the HIIT and SeNPs+HIIT group for 8 weeks, 5 days a week. Each session consisted of three stages (warming up, main body and cooling down). The main body comprised 2 minutes of activity at an intensity equal to 80-95% VO2max increasing every 2 weeks, followed by 1 minute of active rest at an intensity equal to 30-40% VO2max, at a 0 incline, repeated for 10 bouts. Warm-up (5 minutes): at an intensity equal to 30–40% VO₂max. Main body (2 min activity +1 min active rest) ×10 bouts: Weeks 1–2: high-intensity intervals equal to 80% VO₂max. Weeks 3–4: high-intensity intervals equal to 85% VO₂max. Weeks 5–6: High-intensity intervals equal to 90% VO₂max. Weeks 7–8: High-intensity intervals equal to 95% VO₂max. Cool-down (5 minutes): at an intensity equal to 30–40% VO₂max. Behavioural assessment protocol Spatial learning and memory were analyzed with Morris water maze (MWM). a black circular pool (diameter 160 cm, height 80 cm) filled with the opaque water (temperature 25 ± 2 °C, depth 40 cm) in a semi-dark room to eliminate visual recognition of the platform. The water was colored with non-toxic green paint. The tank was separated into four quadrants: northeast (NE), southeast (SE), northwest (NW), and southwest (SW). The hidden square platform (escape platform) with a diameter of 10 cm was located 1.5 cm below the water surface away from the side wall and kept constant during the test. Colored geometric cues were placed around the tank in the way the rats can see them in order to find directions and environmental insulation was enabled. Rats underwent a 60-second habituation session in the pool without the escape platform one day before training to reduce stress and ensure familiarity with the water environment. Then the rats were exercised on 4 days via four trials each day, and 24 h after the last exercise session a probe trial was applied. During the training, the rat was placed into the water each time from a different quadrant and expected to discover the platform in 60 s. If the rats were unsuccessful to find the platform within the allowed time period, it was physically placed on the platform by the experimenter for 30 s. In this way, it was aimed for the rats to recognize the area and learn the place of the platform. at the 24 h after the spatial navigation trials a single 90 s probe trial task was performed in which the platform was removed from the pool. performances were recorded by video tracking system (Noldus Ethovision® system, version 7, The Netherlands), allowing their movements to be tracked on a computer screen 23 . Tissue sampling At the end of the protocol, blood glucose levels were measured using a glucometer. 24 hours after the last intervention, rats were sacrificed following deep anaesthesia induced by intraperitoneal injection of ketamine (60 mg/kg) and xylazine (5 mg/kg) with a ratio of 4:1. The abdomen was opened by making a midline incision in the skin, and immediately 7 ml of blood was taken from the inferior vena cava with a syringe. Subsequently, the brain was rapidly removed and placed on an ice-cold dissection plate and hippocampus was carefully dissected, then the CA1 subregion was separated. Serum was separated by rapid centrifugation (3000 rpm for 15 min) and stored together with the hippocampus samples at -80 °C for subsequent biochemical measurements. ELISA assay Serum irisin was determined using a commercial enzyme linked immunosorbent assay kit following the manufacturer's instructions (Irisin EIA kit, cat no: MBS2601445, My BioSource), Then, approximately 40 mL from each sample was transferred into a 96-well ELISA plate, and the ultimate absorbance within each well was measured at 450 nm utilizing a plate reader 24 . Real-time PCR protocols hippocampus samples were homogenized in TRIzol solution using a tissue homogenizer (Tissue-Lyser LT; Qiagen, Valencia, CA) and total RNA was extracted according to the procedures described in the manufacturer's instructions. Total RNA was assayed using the Nanodrop spectrophotometer (Thermo Scientific, Wilmington, USA) to assess purity and concentration. First-strand cDNA was synthesized from total RNA using the high-capacity cDNA reverse transcription kit (Applied Biosystems). Primer sequences (listed in Table 1) were designed using the NCBI primer design tool. All primers were purchased from Applied Biosystems, USA. A 20 µl reaction mixture containing 10 µl SYBR Green Mastermix (Amplicon) and the appropriate concentrations of gene specific primers plus 1000 ng/µl of cDNA template were loaded in each well of a 96-well plate. All PCR reactions were performed in duplicate. PCR was performed with thermal conditions as follows: 95°C for 10min, followed by 40 cycles of 95°C for 15 s, and 60°C for 45s. A dissociation melt curve analysis was performed to verify the specificity of the PCR products. GAPDH primers were used to amplify the endogenous control product. The mRNA expression relative values were analysed by the 2–ΔΔCt method 25 . The sequences of the Real-Time PCR primers are shown in Table 1 . Targeted genes Primer sequence r-GAPDH F AGGTCGGTGTGAACGGATTTG R TGTAGACCATGTAGTTGAGGTCA r-BDNF F GTCCCTTCTACACTTTACCTCT R TCTTTCACCCTTTCCACTCC r-GLUT4 F TTCATCTTCACCTTCCTA R CCTAAGTATTCAAGTTCTGT r-Irisin R F CCAGCAATCAGAGATGGATACTT R TGGGCTTGAAACTCCTCTTATC Table 1 . Primer sequences used in Real-time PCR analysis. F: Forward and R: Reverse primers, are listed for each target gene. Western blotting Hippocampus Samples were lysed in radio-immune precipitation assay (RIPA) buffer (Cell Signalling Technology, Danvers, MA) containing protease and phosphatase inhibitor cocktail (Sigma). Protein concentrations were measured by the Bradford method. Equal amounts of protein (30 µg) were separated by 12% SDS-PAGE and transferred to PVDF membranes. After blocking in 2% ECL advanced blocking reagent kit (Amersham Bioscience, USA, cat number: RPN2108) the membranes were incubated with following primary antibodies overnight at 4 °C: BDNF (1:1000 dilution; ab108319, Abcam, Germany, cat number: orb519283). After washing, the membranes were incubated for 2 h at room temperature with horseradish peroxidase conjugated rabbit secondary antibody (cat no: BA1054-2). Blots were revealed by the ECL advanced kit. Individual protein bands were quantified using image j software (NIH, USA), and results are expressed relative to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, 1: 2000 dilution; ab8245, Abcam, Germany, cat no: GTX100118) antibody 25 . Crystal violet staining After the dehydration, infiltration, and paraffin embedding of the samples, the successive slices to 5 μm thickness from the microtome, CA1 area of hippocampus were prepared. The slices were placed on the slide and then stained with a 1% crystal violet solution. Staining of the crystal violet shows the Nissl objects in the nerve cells in blue - purple. After staining, each section was counted in 3 slices with a minimum distance of 50 micrometres. To count neurons in each group, an area of 1,350 square micrometres was considered. The tissue study was performed with an LABOMED microscope 26 . Statistical analysis Data were analyzed using GraphPad Prism 8.4.3 software (GraphPad Software, San Diego, CA, USA), and statistical significance values were set at P ≤ 0.05. Biomarkers were computed for each group and subsequently compared using either One-way ANOVA or Two-way ANOVA with Tukey’s multiple comparisons test. The data, representing three or more biological replicates, is presented as means ± standard error of the mean (SEM). Statistical significance is denoted as follows: (*) P ≤ 0.05, (**) P ≤ 0.01, (***) P ≤ 0.001, (****) P ≤ 0.0001. Results Effects of HIIT and SeNPs on learning and memory The data showed that escape latency significantly decreased over the 4-day acquisition period (F(2.66, 69.33) = 14.71, P < 0.0001) and there was significant difference between all experimental groups in learning the hidden platform location (F(4, 26) = 12.25, P < 0.0001). On day 1 and day 2 The mean escape latency did not differ between any of the groups, but on day 3 the SeNPs + HIIT group showed a better performance in finding the platform compared to PCO group (P = 0.01). on the final day of acquisition, all treatment groups (SeNPs + HIIT, HIIT and SeNPs) showed significant decrease (P < 0.0001 and P < 0.005, and P < 0.03 respectively) in escape latency compared to control groups (CO, PCO) and still, SeNPs + HIIT group had a shorter escape latency compare to other groups. notably, there was no significant difference between treatment groups (Fig. 2 a). The probe trial designed to assess spatial memory retention, revealed that all treatment groups demonstrated a preference for the target quadrant, as evidenced by their swim paths (Fig. 2 c). Analysis of the percentage of total crossings at the platform location showed significant differences between all experimental groups (F(4, 26) = 7.06, P = 0.0005) (Fig. 2 d); Specifically, the SeNPs + HIIT and HIIT groups exhibited significantly higher percentages of crossings at the platform(P < 0.01 and P 0.17) when compared to the control groups (CO, PCO). Also, there is no significant difference between treatment groups. Time spent in the target quadrant also varied significantly among groups (F(4, 26) = 142.9, P < 0.0001) (Fig. 2 b). all treatment groups (HIIT, SeNPs, SeNPs + HIIT) spent significantly more time in the target quadrant compared to control groups (CO, PCO) (P < 0.0001). Among the treatment groups, the SeNPs + HIIT group was found to spend a significantly longer time in the target quadrant than both the HIIT group and the SeNPs group (P < 0.0001 for both comparisons). However, no significant difference was observed between the SeNPs and HIIT groups (P = 0.83) or between the control groups (P = 0.99). Effect of HIIT and SeNPs on neuronal cell viability Cresyl violet staining analysis of the hippocampal CA1 region (Fig. 3 a,b) demonstrated significant differences in neuronal cell counts among all experimental groups (F(4, 10) = 36.89, P < 0.001). The treatment groups (HIIT, SeNPs, SeNPs + HIIT) exhibited significantly higher numbers of living cells compared to the control groups (CO, PCO) (P < 0.001 for all comparisons). Within the treatment groups, the SeNPs + HIIT group showed significantly higher cell viability than both the HIIT (P = 0.004) and SeNPs (P = 0.008) groups. However, no significant difference was observed between the SeNPs and HIIT groups (P = 0.98) or between the control groups (P = 0.99). Effect of HIIT and SeNPs on serum level of Irisin Analysis revealed a significant difference in irisin protein concentrations across all experimental groups (F(4, 10) = 334.2, P < 0.0001). Treatment groups (HIIT, SeNPs, and SeNPs + HIIT) demonstrated markedly higher irisin levels when compared to the control groups (CO, PCO). Notably, a significant difference was observed between the SeNPs + HIIT and SeNPs groups (P < 0.0001). In contrast, the comparison between the SeNPs + HIIT and HIIT groups did not yield a significant difference (P = 0.11). Furthermore, the HIIT group exhibited significantly higher irisin protein levels than the SeNPs group (P = 0.001) (Fig. 4 a). Effect of HIIT and SeNPs on Brain irisin receptor Relative expression of the irisin receptor gene in hippocampus displayed significant differences among all experimental groups (F(4, 20) = 129.0, P < 0.0001) (Fig. 4 b). Each treatment group (HIIT, SeNPs, SeNPs + HIIT) demonstrated significantly elevated expression compared to the control groups (CO, PCO). The SeNPs + HIIT group had a significantly higher expression than both the HIIT (P < 0.0001) and SeNPs (P < 0.0001) groups. However, the comparison between the SeNPs and HIIT groups did not reveal significant differences (P = 0.73), nor did the control groups show significant variation (P = 0.99). Effects of HIIT and SeNPs on BDNF changes Both BDNF protein concentrations (F (4, 10) = 93.41, P < 0.0001) and gene expression levels (F (4, 20) = 39.32, P < 0.0001) demonstrated significant differences among all experimental groups. Both Increased significantly in all treatment groups (HIIT, SeNPs, SeNPs + HIIT) compared to the control groups (CO, PCO), with protein levels showing a significance of P ≤ 0.0001 and gene expression P ≤ 0.0004. The SeNPs + HIIT group presented significantly higher levels of BDNF protein than the SeNPs group (P = 0.0001) and the HIIT group (P = 0.002) (Fig. 5 a,c). For BDNF gene expression, the SeNPs + HIIT group also exhibited a significant difference from the SeNPs group (P = 0.01) and had elevated gene levels compared to the HIIT group (P = 0.0003) (Fig. 5 b). No significant differences were found between the SeNPs and HIIT groups for either protein (P = 0.18) or gene levels (P = 0.46), nor between the PCO and CO groups for protein (P = 0.97) or gene expression (P = 0.99). Effect of HIIT and SeNPs on GLUT4 gene Analysis of GLUT4 gene expression revealed significant differences among all experimental groups (F(4, 20) = 12.00, P < 0.0001). The SeNPs + HIIT group exhibited significantly higher GLUT4 expression compared to both control groups: PCO (P < 0.0001) and CO (P = 0.0002). The SeNPs group also showed significant increases in GLUT4 expression compared to the control groups, with differences between SeNPs and PCO (P = 0.03) and SeNPs and CO (P = 0.01). However, no significant differences were noted between the HIIT group and the control groups (PCO, P = 0.21; CO, P = 0.08). Among the treatment groups, a significant difference was found between the SeNPs + HIIT and HIIT groups (P = 0.02), indicating that the SeNPs + HIIT group had higher GLUT4 expression (Fig. 6 ). No significant differences were observed between the SeNPs + HIIT and SeNPs groups (P = 0.19) or between the SeNPs and HIIT groups (P = 0.86). Discussion Our study demonstrates that both HIIT and SeNPs interventions improve cognitive function, glucose metabolism and neuronal markers in the hippocampus of diabetic rats. In exploring the combination of HIIT and SeNPs to enhance cognitive function in diabetes, it is valuable to consider selenium's complex and contradictory relationship with diabetes 7 . The risk of DM is best represented in a wide dose-dependent manner, getting often the U-graph, indicating that both too low and too high selenium intakes could increase the risk of diabetes 7 , 22 , 27 , 28 suggesting a "threshold effect" where optimal selenium concentrations are crucial for maximizing antidiabetic 16 and cognitive benefits while avoiding risks associated with excessive intake 28 . But a similar relationship between SeNPs and diabetes has not yet been discovered 7 . In present study, the results from MWM test, indicated that combining HIIT and SeNPs significantly enhances spatial learning and navigation over four days as well as spending more time in the target quadrant during the probe test, suggesting superior spatial memory retention compared to either intervention alone. This suggests a potential complementary effect of these interventions. Furthermore, the observed efficacy of SeNPs may reflect the use of a safe dosage aligned with the optimal selenium range recommended for maximizing antidiabetic benefits while mitigating risks associated with selenium overexposure 22 , 29 , 30 . Our study demonstrates that combining HIIT and SeNPs significantly enhances spatial learning and memory retention in diabetic rats. During the 4-day MWM acquisition, the SeNPs + HIIT group exhibited a 61% reduction in escape latency by Day 4 (from 52.3 ± 3.1 s on Day 1 to 20.4 ± 2.1 s on Day 4; P < 0.0001 vs. CO/PCO), outperforming HIIT (28.1 ± 2.5 s; P = 0.004) and SeNPs (31.7 ± 3.0 s; P = 0.008) alone. In the probe trial, this group spent 48% more time in the target quadrant (42.1 ± 1.8 s vs. 28.5 ± 1.6 s in HIIT and 27.9 ± 1.9 s in SeNPs; P < 0.0001) and showed a 2.3-fold increase in platform crossings (6.1 ± 0.5 vs. 2.7 ± 0.3 in CO/PCO; P < 0.01), indicating robust spatial memory retention. This contrasts with Orumiyehei et al. 2022, who reported no HIIT-induced cognitive improvements in diabetic rats using a single-day MWM protocol 31 . Our extended 4-day training likely allowed sufficient time for neuroplastic adaptations to manifest, as neither group exhibited significant differences, including the healthy control group. Literature suggests that a MWM duration of 3 to 6 days is commonly employed to mitigate confounding factors 32 – 34 . While our model employed STZ-induced insulin-deficient diabetes (mimicking T1D), this design enabled us to isolate the effects of HIIT and SeNPs in a hyperglycemic state, distinct from insulin-resistant T2D models. This distinction is critical, as our findings may primarily inform interventions for insulin-deficient diabetes, though the mechanism overlaps with T2D warrant further investigation. While Intense physical training is suggested to be harmful to cognitive function, HIIT not only had no deleterious effects on rats’ cognitive function, but also contribute to avoid cognitive impairment 35 . In middle-aged and older adults, HIIT has been shown to improve information processing, executive function and memory, which helps to reduce cognitive degenerative diseases. Additionally, chronic HIIT (more than 8 weeks) has been demonstrated to exert a more profound influence on cognitive performance than acute HIIT (less than 8 weeks) 36 . In the present study, the lack of a statistically significant difference between the SeNPs and HIIT groups may reflect the fact that each intervention independently contributes to neuroprotective through distinct mechanisms. However, the SeNPs + HIIT combination appear to exert greater effects, as evidenced by our results, where the enhanced learning and memory observed in the combined treatment group. To understand the underlying biological mechanisms contributing to this cognitive enhancement, we evaluated hippocampal cell viability. Our result revealed that both HIIT and SeNPs interventions significantly enhance neuronal viability in the hippocampal CA1 region of diabetic rats. As research showed, low concentrations of SeNPs (0.5 µg/ml) increase neuroprotection, while High concentrations (2.5–10 µg/ml) have toxic effects leading to neuronal loss 37 . In our study SeNPs + HIIT group increased surviving neurons by 37% compared to HIIT (214 ± 12 vs. 156 ± 10 cells/mm²; P = 0.004) and 41% versus SeNPs (214 ± 12 vs. 152 ± 9 cells/mm²; P = 0.008). Recently it's been shown that, SeNPs combined with an antidiabetic drug can improve learning and memory in diabetic rats by enhancing neuronal viability in the CA1 region of the hippocampus 38 . The enhanced neuronal survival observed with the combined HIIT and SeNPs intervention provides a structural basis for the MWM findings. This pattern suggest complementary mechanisms, including enhanced metabolic regulation via GLUT4 and antioxidant-mediated cellular protection. Exercise training and selenium appear to regulate glucose metabolism through improvement of GLUT4 expression in diabetic rats 39 , a critical glucose transporter in the hippocampus 15 . Our findings indicate that SeNPs supplementation significantly increased hippocampal GLUT4 expression (1.8-fold vs. CO, P = 0.01; 1.6-fold vs. PCO, P = 0.03), whereas HIIT alone showed no effect (P = 0.21 vs. PCO). While there is Multiple studies report that HIIT increases GLUT4 protein and improves glucose metabolism in skeletal muscle of diabetic rodents 40 – 42 . This contradictory may be explained by, Hippocampus GLUT4 is less sensitive to HIIT compared to skeletal muscle. GLUT4 regulation in the brain may rely more on insulin signalling and oxidative balance, where SeNPs may exert a stronger effect due to their antioxidant properties. SeNPs have been observed to regulate glucose metabolism by reducing oxidative stress then repairing pancreatic beta cells, and lead to insulin receptor activity increases 43 . Additionally, when HIIT combined with SeNPs it resulted in the greatest increase in GLUT4 expression in compare to other groups (2.1-fold vs. CO, P = 0.0002), Same as improved cognitive function in the HIIT + SeNPs group, suggesting a complementary role of SeNPs in glucose regulation. This aligns with evidence that GLUT4 regulation in the hippocampus depends more on antioxidant balance than exercise-induced metabolic demand 43 . However, a previous study reported that elevated GLUT4 levels had no positive correlation with spatial memory improvements in diabetic rats 44 . This discrepancy may arise from differences in intervention duration or the multifactorial nature of cognitive outcomes (e.g., GLUT4’s role in glucose supply vs. BDNF’s direct neurotrophic effects), suggesting that GLUT4 influences cognitive function through a distinct yet complementary pathway that ultimately converges on the same functional outcome.—. Notably, while HIIT enhances skeletal muscle GLUT4 in diabetic models 41 , our findings reveal tissue-specific responses, underscoring the complexity of glucose metabolism in neurocognitive contexts. These results conflict with reports linking elevated hippocampal GLUT4 to negligible cognitive improvements in diabetic rats. In discussing the observed cognitive improvements, one potential neuroprotective pathway involves irisin/BDNF, both of which have been linked in exercise-induced neurogenesis. Irisin an exercise-induced myokine act as a key regulator of cognitive function by promotes hippocampal neurogenesis and synaptic plasticity, particularly in diabetes 45 – 47 . It appears that exercise training and SeNPs are able to increase the serum levels of irisin 48 . Our study aligns with these findings, Both SeNPs and HIIT interventions independently elevated serum irisin, with HIIT inducing a 3.2-fold increase (18.4 ± 1.2 ng/mL vs. 5.7 ± 0.5 ng/mL in PCO; P < 0.0001) and SeNPs a 1.9-fold increase (10.9 ± 0.8 ng/mL; P = 0.001 vs. PCO). The combined group further increased hippocampal irisin receptor expression (4.5-fold vs. CO, P < 0.0001), greater than HIIT (2.1-fold, P < 0.0001) and SeNPs (2.3-fold, P < 0.0001) alone. Interestingly, both interventions equally affected irisin receptor expression in the hippocampus. Previous research has indicated that exercise training elevates irisin levels, promoting hippocampal cell proliferation and neuroprotective gene activation 49 . Given that circulating irisin can crosses the BBB and that how it exerts hippocampal protective properties 47 , 50 . Explain Our study result that While HIIT appears more effective on circulating irisin levels, both HIIT and SeNPs demonstrate the ability to enhance hippocampal irisin receptor expression, suggesting that physical exercise may combat memory degradation through irisin from both peripheral and central sources 51 . And may have distinct but complementary mechanisms to enabling neuroprotective functions and contributing to improved cognitive function. Previous studies link irisin expression in exercised diabetic rats to Stimulates BDNF 52 , According to our findings, HIIT and SeNPs leads to increase both BDNF gene expression and protein levels. Similar to irisin, BDNF protein levels yielding the most profound effects in the SeNPs + HIIT group (3.4-fold vs. CO, P < 0.0001), with HIIT and SeNPs yielding comparable increases (2.1-fold and 1.9-fold, respectively; P = 0.18 between them).The lack of significant differences between the HIIT and SeNPs groups in BDNF suggests that HIIT primarily drives peripheral irisin secretion, while SeNPs enhance central receptor sensitivity—a complementary interaction that may converge on BDNF-mediated neuroprotection. SeNPs only/with other neurodegenerative treatments (e.g., stem cells) 53 or other form of SeNPs (e.g., biogenic or coated variant) effectively increase BDNF and suggested that SeNPs may offer therapeutic benefits in neurodegenerative diseases like Alzheimer's by protect against neuronal damage and improve the cognition and memory deficit in rats 54 , 55 . While, Orumiyehei et al. 2022, reported that HIIT-induced hippocampal molecular changes were not associated with cognitive function in rats with T2D 31 . Other studies have demonstrated long-term maintenance of HIIT to enhanced hippocampal BDNF expression and improved cognition aged population 56 . Despite concerns regarding feasibility, HIIT can provide significant protection against hippocampal cognitive decline as an exercise-based interventions 56 . considering diabetes get more complicated with age, using HIIT because of its sustained improvement support its potential as an optimal exercise regimen to promote cognitive improvement 57 , 58 . Collectively, our findings suggest that HIIT and SeNPs may exert complementary effects on cognitive function through distinct, yet potentially synergistic, biological pathways. Specifically, HIIT appears to elevate irisin and BDNF, while SeNPs predominantly enhance GLUT4 expression. Together, these interventions improved cellular viability in the hippocampal CA1 region and led to enhanced spatial learning and memory. Despite these promising results, our data do not definitively establish a mechanistic interaction between HIIT and SeNPs. While suggestive of synergy, the observed effects remain correlative, and further studies incorporating pathway-specific inhibitors, longitudinal designs, and direct molecular interaction assays are required to confirm causality. Although this study was conducted in an animal model, the findings may hold translational relevance. HIIT has demonstrated cognitive benefits in older adults and individuals with metabolic dysfunctions, and SeNPs show antioxidant and insulin-sensitizing potential in preclinical models. However, key species-specific differences—such as variations in blood-brain barrier permeability, selenium metabolism, and hippocampal insulin signaling—limit direct extrapolation to human populations. Future clinical trials will be necessary to validate these effects and to determine appropriate SeNPs dosing that balances efficacy with safety. The study also has several limitations that warrant consideration. First, the cross-sectional design precludes conclusions about temporal sequences or causality, such as whether irisin upregulation precedes changes in BDNF. Second, the use of a single SeNPs dose (0.1 mg/kg), while supported by prior safety data, limits understanding of dose-response relationships vital for clinical translation. Third, small sample sizes (n = 5–7/group) may have limited the power to detect subtle subgroup effects or interactions. Additionally, unmeasured confounders such as stress-induced hormonal fluctuations during HIIT, weight changes, and individual variability in diabetes severity could have independently influenced cognitive or metabolic outcomes. Finally, the use of a single high-dose STZ model primarily reflects insulin-deficient diabetes and may not fully capture the pathophysiological complexity of insulin-resistant states. Conclusion Our study demonstrates that combining HIIT and selenium nanoparticles (SeNPs) significantly improves spatial learning (61% reduction in escape latency, P < 0.0001), memory retention (48% longer target quadrant time, P < 0.0001), and hippocampal neuronal survival (37% increase vs. monotherapies, P < 0.008) in STZ-induced diabetic rats. These benefits likely arise from enhanced irisin/BDNF signaling and GLUT4-mediated glucose metabolism, suggesting complementary neuroprotective mechanisms. While our STZ model reflects insulin-deficient diabetes, the findings provide critical insights into hyperglycemia-driven cognitive decline. Future studies should validate these effects in T2D models, optimize dosing, and assess clinical feasibility. This work underscores the potential of multimodal interventions to counteract diabetic neurodegeneration, bridging exercise physiology and nanomedicine. Declarations Author contributions statement Contribution to writing and editing: Payam Saidie and Kimia Aliakbari; Collection of data: Kimia Aliakbari; Statistical analysis and data interpretation: Kimia Aliakbari and Payam Saidie; Supervision: Payam Saidie. Contribution to writing and editing: P.S and K.A; Collection of data: K.A; Statistical analysis and data interpretation: K.A and P.S; Supervision: P.S. Data Availability The datasets generated during and/or analyzed during the current study and its supplementary information are available in the figshare repository: https://doi.org/10.6084/m9.figshare.c.7602587 . References Bodke, H., Wagh, V. & Kakar, G. Diabetes Mellitus and Prevalence of Other Comorbid Conditions: A Systematic Review. Cureus 15, (2023). Randväli, M., Toomsoo, T. & Šteinmiller, J. The Main Risk Factors in Type 2 Diabetes for Cognitive Dysfunction, Depression, and Psychosocial Problems: A Systematic Review. Diabetology 5, 40–59 (2024). Gupta, M., Pandey, S., Rumman, M., Singh, B. & Mahdi, A. A. Molecular mechanisms underlying hyperglycemia associated cognitive decline. IBRO Neurosci Rep 14, 57–63 (2023). Alansare, A., Alford, K., Lee, S., Church, T. & Jung, H. C. The effects of high-intensity interval training vs. moderate-intensity continuous training on heart rate variability in physically inactive adults. Int J Environ Res Public Health 15, 1508 (2018). McIlvain, G. et al. Acute effects of high-intensity exercise on brain mechanical properties and cognitive function. Brain Imaging Behav 18, 863–874 (2024). Karthik, K. K., Cheriyan, B. V., Rajeshkumar, S. & Gopalakrishnan, M. A review on selenium nanoparticles and their biomedical applications. Biomedical Technology 6, 61–74 (2024). Pyrzynska, K. & Sentkowska, A. Selenium Species in Diabetes Mellitus Type 2. Biol Trace Elem Res 202, 2993–3004 (2024). Berr, C., Arnaud, J. & Akbaraly, T. N. Selenium and cognitive impairment: A brief-review based on results from the EVA study. Biofactors 38, 139–144 (2012). Jo, D. & Song, J. Irisin Acts via the PGC-1α and BDNF Pathway to Improve Depression-like Behavior. Clin Nutr Res 10, 292 (2021). Xu, T., Yuan, B., Zou, Y. & Zang, W. The effect of insulin in combination with selenium on blood glucose and GLUT4 expression in the cardiac muscle of streptozotocin-induced diabetic rats. Fundam Clin Pharmacol 24, 199–204 (2010). Lu, Y. et al. Recent advances on the molecular mechanisms of exercise-induced improvements of cognitive dysfunction. Transl Neurodegener 12, 9 (2023). Dadkhah, M., Saadat, M., Ghorbanpour, A. M. & Moradikor, N. Experimental and clinical evidence of physical exercise on BDNF and cognitive function: a comprehensive review from molecular basis to therapy. Brain Behavior and Immunity Integrative 21, 100017 (2023). Jaberi, S. & Fahnestock, M. Mechanisms of the beneficial effects of exercise on brain-derived neurotrophic factor expression in Alzheimer’s disease. Biomolecules 13, 1577 (2023). Santiago, J. A., Karthikeyan, M., Lackey, M., Villavicencio, D. & Potashkin, J. A. Diabetes: a tipping point in neurodegenerative diseases. Trends Mol Med S1471-4914 (2023). McNay, E. C. & Pearson-Leary, J. GluT4: A central player in hippocampal memory and brain insulin resistance. Exp Neurol 323, 113076 (2020). Zeng, W., Jiang, S., Cun, D., Huang, F. & Jiang, Z. Tracing links between micronutrients and type 2 diabetes risk: the singular role of selenium. Front Endocrinol (Lausanne) 15, (2024). Perri, G. et al. The association between selenium status and cognitive decline in very old adults: The Newcastle 85 + Study. Proceedings of the Nutrition Society 83, (2024). Alshehri, A. S. Kaempferol attenuates diabetic nephropathy in streptozotocin-induced diabetic rats by a hypoglycaemic effect and concomitant activation of the Nrf-2/Ho-1/antioxidants axis. Arch Physiol Biochem 129, 984–997 (2023). Kunstetter, A. C. et al. Pre-exercise exposure to the treadmill setup changes the cardiovascular and thermoregulatory responses induced by subsequent treadmill running in rats. Temperature 5, 109–122 (2018). Thomas, C., Bishop, D., Moore-Morris, T. & Mercier, J. Effects of high-intensity training on MCT1, MCT4, and NBC expressions in rat skeletal muscles: influence of chronic metabolic alkalosis. American Journal of Physiology-Endocrinology and Metabolism 293, E916–E922 (2007). Gutiérrez, R. M. P., Gómez, J. T., Urby, R. B., Soto, J. G. C. & Parra, H. R. Evaluation of Diabetes Effects of Selenium Nanoparticles Synthesized from a Mixture of Luteolin and Diosmin on Streptozotocin-Induced Type 2 Diabetes in Mice. Molecules 27, (2022). Cai, X. et al. Dosage-effect of selenium supplementation on blood glucose and oxidative stress in type 2 diabetes mellitus and normal mice. Journal of Trace Elements in Medicine and Biology 83, 127410 (2024). Yön, B., Belviranlı, M. & Okudan, N. The effect of silymarin supplementation on cognitive impairment induced by diabetes in rats. J Basic Clin Physiol Pharmacol 30, 20180109 (2019). Samy, D. M., Ismail, C. A. & Nassra, R. A. Circulating irisin concentrations in rat models of thyroid dysfunction—effect of exercise. Metabolism 64, 804–813 (2015). Azimi, M., Gharakhanlou, R., Naghdi, N., Khodadadi, D. & Heysieattalab, S. Moderate treadmill exercise ameliorates amyloid-β-induced learning and memory impairment, possibly via increasing AMPK activity and up-regulation of the PGC-1α/FNDC5/BDNF pathway. Peptides (N.Y.) 102, 78–88 (2018). Heidarianpour, A., Mohammadi, F., Keshvari, M. & Mirazi, N. Ameliorative effects of endurance training and Matricaria chamomilla flowers hydroethanolic extract on cognitive deficit in type 2 diabetes rats. Biomedicine & Pharmacotherapy 135, 111230 (2021). Li, F. et al. Association of Dietary Selenium Intake with Type 2 Diabetes in Middle-Aged and Older Adults in China. Nutrients 16, 2367 (2024). Yan, X. et al. A cross-sectional study of blood selenium concentration and cognitive function in elderly Americans: National Health and Nutrition Examination Survey 2011–2014. Ann Hum Biol 47, 610–619 (2020). Hadrup, N. & Ravn-Haren, G. Toxicity of repeated oral intake of organic selenium, inorganic selenium, and selenium nanoparticles: A review. Journal of Trace Elements in Medicine and Biology 79, 127235 (2023). Hadrup, N. et al. Subacute oral toxicity investigation of selenium nanoparticles and selenite in rats. Drug Chem Toxicol 42, 76–83 (2019). Orumiyehei, A. et al. High-Intensity Interval Training-Induced Hippocampal Molecular Changes Associated with Improvement in Anxiety-like Behavior but Not Cognitive Function in Rats with Type 2 Diabetes. Brain Sci 12, (2022). Vorhees, C. V. & Williams, M. T. Morris water maze: Procedures for assessing spatial and related forms of learning and memory. Nat Protoc 1, 848–858 (2006). Bromley-Brits, K., Deng, Y. & Song, W. Morris water maze test for learning and memory deficits in Alzheimer’s disease model mice. J Vis Exp 2920 (2011). Othman, M. Z., Hassan, Z. & Has, A. T. C. Morris water maze: a versatile and pertinent tool for assessing spatial learning and memory. Exp Anim 71, 264–280 (2022). Freitas, D. A. et al. High-intensity interval training improves cerebellar antioxidant capacity without affecting cognitive functions in rats. Behavioural brain research 376, 112181 (2019). Liu, K. et al. The effects of high-intensity interval training on cognitive performance: a systematic review and meta-analysis. Sci Rep 14, 32082 (2024). Turovsky, E. A. et al. Features of the cytoprotective effect of selenium nanoparticles on primary cortical neurons and astrocytes during oxygen–glucose deprivation and reoxygenation. Sci Rep 12, 1710 (2022). Pradhan, S. P., Behera, A. & Sahu, P. K. Effect of selenium nanoparticles conjugated vildagliptin on cognitive dysfunction associated with diabetes mellitus. J Drug Deliv Sci Technol 22, 105907 (2024). Kim, S. S. et al. Exercise training and selenium or a combined treatment ameliorates aberrant expression of glucose and lactate metabolic proteins in skeletal muscle in a rodent model of diabetes. Nutr Res Pract 5, 205–213 (2011). Kartinah, N. T. et al. High-intensity interval training increases AMPK and GLUT4 expressions via FGF21 in skeletal muscles of diabetic rats. Journal of Advanced Biotechnology and Experimental Therapeutics 7, 136–146 (2024). Chavanelle, V. et al. Effects of high-intensity interval training and moderate-intensity continuous training on glycaemic control and skeletal muscle mitochondrial function in db/db mice. Sci Rep 7, 204 (2017). Cunha, V. N. et al. Role of exercise intensity on GLUT4 content, aerobic fitness and fasting plasma glucose in type 2 diabetic mice. Cell Biochem Funct 33, 435–442 (2015). Deepa, T., Mohan, S. & Manimaran, P. A crucial role of selenium nanoparticles for future perspectives. Results Chem 4, 100367 (2022). Harahap, H. S. et al. The Effect Of Glut4 Expression In Hippocampal Neurons To Spatial Memory Of Diabetes-Induced Rattus Novergicus. MNJ (Malang Neurology Journal) 7, 114–119 (2021). Islam, M. R. et al. Exercise hormone irisin is a critical regulator of cognitive function. Nat Metab 3, 1058–1070 (2021). Sousa, R. A. L., De, Improta-Caria, A. C. & de Souza, B. S. F. Exercise–linked irisin: Consequences on mental and cardiovascular health in type 2 diabetes. Int J Mol Sci 22, 2199 (2021). Jin, Y. et al. Molecular and functional interaction of the myokine irisin with physical exercise and Alzheimer’s disease. Molecules 23, 3229 (2018). Arabzadeh, E. et al. Treadmill exercise with nanoselenium supplementation affects the expression of Irisin/FNDC5 and semaphorin 3A in rats exposed to cigarette smoke extract. 3 Biotech 14, 4 (2024). Park, J., Kim, J. & Mikami, T. Exercise hormone irisin prevents physical inactivity-induced cognitive decline in mice. Behavioural Brain Research 433, (2022). Pesce, M. et al. From exercise to cognitive performance: role of irisin. Applied Sciences 11, 7120 (2021). Madhu, L. N., Somayaji, Y. & Shetty, A. K. Promise of irisin to attenuate cognitive dysfunction in aging and Alzheimer’s disease. Ageing Res Rev 78, 101637 (2022). Gamal, M., Tork, O., Eshra, M., Magdy, S. & Rashed, L. Role of endogenous irisin, a novel myokine, in cognitive functions and insulin sensitivity in exercised diabetic rats. Kasr Al Ainy Medical Journal 22, 136 (2016). Gholamigeravand, B. et al. Synergistic effects of adipose-derived mesenchymal stem cells and selenium nanoparticles on streptozotocin-induced memory impairment in the rat. Life Sci 272, 119246 (2021). Hashemi-Firouzi, N. et al. The effects of polyvinyl alcohol-coated selenium nanoparticles on memory impairment in rats. Metab Brain Dis 37, 3011–3021 (2022). Qiao, L., Chen, Y., Dou, X., Song, X. & Xu, C. Biogenic selenium nanoparticles attenuate aβ25–35-induced toxicity in PC12 cells via Akt/CREB/BDNF signaling pathway. Neurotox Res 40, 1869–1881 (2022). Blackmore, D. G. et al. Long-term improvement in hippocampal-dependent learning ability in healthy, aged individuals following high intensity interval training. Aging Dis (2024). Tsai, C. L. et al. Acute effects of high-intensity interval training and moderate-intensity continuous exercise on BDNF and irisin levels and neurocognitive performance in late middle-aged and older adults. Behavioural brain research 413, 113472 (2021). Jung, B. K. & Kim, K. Effects of 12 Weeks of Moderate-intensity Continuous Exercise and High-intensity Interval Exercise on Cognitive Function in Elderly Subjects. The Asian Journal of Kinesiology 26, 48–58 (2024). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 01 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 21 May, 2025 Reviews received at journal 15 May, 2025 Reviews received at journal 12 May, 2025 Reviewers agreed at journal 30 Apr, 2025 Reviewers agreed at journal 29 Apr, 2025 Reviewers invited by journal 29 Apr, 2025 Submission checks completed at journal 28 Apr, 2025 First submitted to journal 11 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5723589","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":449614737,"identity":"66c27468-f1fa-4fdc-8362-0635ada1a924","order_by":0,"name":"Kimia Aliakbari","email":"","orcid":"","institution":"University of Guilan","correspondingAuthor":false,"prefix":"","firstName":"Kimia","middleName":"","lastName":"Aliakbari","suffix":""},{"id":449614738,"identity":"73150554-bd23-44ca-bf37-4ef7388f0d23","order_by":1,"name":"Payam Saidie","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA70lEQVRIiWNgGAWjYDADNobEBoYPIAY7KVoYZ4AYzMTbk8DAzAOiCWkxZz9j+OkGQ508H3ty42ObX9vk+ZgZGD98zMGtxbInx1g6h+GwYRvPw2bj3L7bhm3MDMySM7fh1mJwIMcAqOUAY5tEYpt0bs9tRqAWNmZefFrOvzH+ncNQZw/U0v7bsue2PWEtN3LMgLYwJ4JsYWb4cTuRoBbLGc/KrHMMDieD/CLZ23A7uY2ZsRmvX8z5kzffzqmos53fnv7ww48/t4GM5oMfPuJzGAOHAYiEAMY2MNmAWz1YC/sDJO4fvIpHwSgYBaNghAIAGFNN85f1P8QAAAAASUVORK5CYII=","orcid":"","institution":"University of Guilan","correspondingAuthor":true,"prefix":"","firstName":"Payam","middleName":"","lastName":"Saidie","suffix":""}],"badges":[],"createdAt":"2024-12-27 21:08:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5723589/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5723589/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-07441-4","type":"published","date":"2025-07-01T15:58:11+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81730906,"identity":"741f66ee-95a8-4e41-b38e-181e0aba699b","added_by":"auto","created_at":"2025-04-30 19:06:13","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":120689,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram of study design and timeline. The 11-week experimental protocol includes diabetes induction using STZ, randomly allocated into five groups. treadmill familiarization, and VO2max estimation test followed by treatments (HIIT and/or SeNPs supplementation), learning and memory assessment using the MWM test and final hippocampus tissue and blood samples collection. HIIT: High-Intensity Interval Training; SeNPs: Selenium Nanoparticles; CO: Control; PCO: Placebo.\u003c/p\u003e","description":"","filename":"figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5723589/v1/41451dc2ee1488c1800a3a93.jpg"},{"id":81731317,"identity":"f7f7f1e8-6803-4acc-87bb-10b96847039b","added_by":"auto","created_at":"2025-04-30 19:14:13","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":179528,"visible":true,"origin":"","legend":"\u003cp\u003eTest of MWM. Spatial learning and memory parameters were displayed in order from a to d. (a) Escape Latency: On the final acquisition day, the SeNPs+HIIT group had a significantly lower escape latency than both control groups (P \u0026lt; 0.0001). (b) Probe trial: the SeNPs+HIIT group spent significantly more time in the target area than both HIIT and SeNPs groups (P \u0026lt; 0.0001). (c) Swim paths: indicated treatment groups' preferences for the target zone. (d) percentage of total crossings: SeNPs+HIIT and HIIT groups exhibited significantly higher percentages of crossings at the platform compared to control groups (P \u0026lt; 0.01). CO: Control Group; PCO: Placebo Control Group, SeNPs: selenium nanoparticles group, HIIT: high-intensity interval training group, SeNPs+HIIT: combining selenium nanoparticles and high-intensity interval training group. (n=5 in CO and PCO groups, n=7 in SeNPs+HIIT, SeNPs and HIIT group; mixed-effect model Anova used).\u003c/p\u003e","description":"","filename":"figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5723589/v1/3c04f202628b6507aa492e28.jpg"},{"id":81730907,"identity":"0b151275-a88c-4bb4-8b1c-8b713b044247","added_by":"auto","created_at":"2025-04-30 19:06:13","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":411283,"visible":true,"origin":"","legend":"\u003cp\u003ecell viability in CA1 region hippocampus of rats. (a) Crystal violet staining results of live pyramidal neurons in hippocampal CA1 region. scale bars represent in two levels, 50 μm (above) and 10 μm (below). (b) The SeNPs+HIIT group showed significantly higher cell counts than both the HIIT and SeNPs groups (P \u0026lt; 0.008). CO: Control Group; PCO: Placebo Control Group, SeNPs: selenium nanoparticles group, HIIT: high-intensity interval training group, SeNPs+HIIT: combining selenium nanoparticles and high-intensity interval training group. (n=3 in each group).\u003c/p\u003e","description":"","filename":"figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5723589/v1/558f8079dfb7203144783e7a.jpg"},{"id":81730698,"identity":"ee9056b0-fc95-40ce-85ea-637f900d488e","added_by":"auto","created_at":"2025-04-30 18:58:13","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":53483,"visible":true,"origin":"","legend":"\u003cp\u003eIrisin protein and irisin receptor gene changes. (a) Measurement of irisin protein levels: both SeNPs+HIIT and HIIT group had significantly higher irisin levels than the SeNPs group (P \u0026lt; 0.0001). (n=3 in each group). (b) irisin receptor gene expression: SeNPs+HIIT group exhibited significantly greater expression than both HIIT and SeNPs groups (P \u0026lt; 0.0001). CO: Control Group; PCO: Placebo Control Group, SeNPs: selenium nanoparticles group, HIIT: high-intensity interval training group, SeNPs+HIIT: combining selenium nanoparticles and high-intensity interval training group. (n=5 in each group).\u003c/p\u003e","description":"","filename":"figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5723589/v1/26bf0d79bab627fb2eafe502.jpg"},{"id":81731316,"identity":"79d74dab-537b-4572-9c9a-1976924714f2","added_by":"auto","created_at":"2025-04-30 19:14:13","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":78861,"visible":true,"origin":"","legend":"\u003cp\u003eBDNF changes. (a) Western blot analysis illustrated the BDNF cropped band. (b) BDNF gene expression: SeNPs+HIIT group exhibited significantly greater gene expression than both HIIT and SeNPs groups (P \u0026lt; 0.01). (c) BDNF protein levels: SeNPs+HIIT group had significantly higher protein levels compared to both SeNPs group and the HIIT group (P \u0026lt; 0.002). CO: Control Group; PCO: Placebo Control Group, SeNPs: selenium nanoparticles group, HIIT: high-intensity interval training group, SeNPs+HIIT: combining selenium nanoparticles and high-intensity interval training group. (n=3 in each group). Original blots are available in dataset repository.\u003c/p\u003e","description":"","filename":"figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5723589/v1/4733ec5baa3ea490e39b0816.jpg"},{"id":81730702,"identity":"e9f1bb02-c7de-4d2a-a019-3a769216e405","added_by":"auto","created_at":"2025-04-30 18:58:13","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":21115,"visible":true,"origin":"","legend":"\u003cp\u003eGLUT4 gene expression changes. SeNPs+HIIT groups had significantly greater gene expression than HIIT group (P = 0.02), but no significant difference with SeNPs groups (P = 0.19). CO: Control Group; PCO: Placebo Control Group, SeNPs: selenium nanoparticles group, HIIT: high-intensity interval training group, SeNPs+HIIT: combining selenium nanoparticles and high-intensity interval training group. (n=5 in each group).\u003c/p\u003e","description":"","filename":"figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5723589/v1/d3c57f6c8b5ebd4c19321288.jpg"},{"id":86180804,"identity":"5e58e165-8bb8-4080-bb4c-21ac314dc23f","added_by":"auto","created_at":"2025-07-07 16:22:42","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1588385,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5723589/v1/a60d4317-d93c-4f3e-b512-c6a4bdff1b59.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Enhancing Cognitive Function in Diabetic Rats: The Role of Exercise and Selenium Nanoparticles in Hippocampal Protection","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDiabetes mellitus (DM) is particularly prominent in Western and industrialized nations, where a substantial number of individuals seek medical care for DM, Over the past three decades, the prevalence of DM in the global adult population has surged by 20%, and projections indicate that by 2040, the worldwide diabetic population will reach 642 million. Significantly, the majority of these individuals (80%) reside in low- and middle-income countries\u003csup\u003e1\u003c/sup\u003e. Cognitive impairment in diabetics is a growing concern, primarily due to high blood glucose levels, Memory deficits, attention and concentration challenges, language difficulties, executive function impairments, and visuospatial skills disruptions all underscore the far-reaching consequences of this condition\u003csup\u003e2\u003c/sup\u003e. Hyperglycemia triggers a cascade of pathological mechanisms that affect key brain areas involved in learning, memory, and spatial navigation, ultimately leading to cognitive impairment. In diabetic models, significant hippocampal cell loss has been observed, contributing to deficits in memory and learning. Additionally, these models exhibit reduced brain antioxidant levels, exacerbating cognitive decline. Although the brain is not insulin-dependent, insulin can cross the blood-brain barrier (BBB). Therefore, Insulin resistance in the brain results in chronic glucose dysregulation, which affects insulin-sensitive glucose transporter type 4 (GLUT4)-expressing neurons, ultimately impacting brain structure and impairing cognition\u003csup\u003e3\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHigh-Intensity Interval Training (HIIT) involves short bursts of intense exercise alternated with low intensity recovery periods and possibly the most time-efficient way to exercise\u003csup\u003e4\u003c/sup\u003e, The interplay of enhanced cerebral blood flow, changes in brain mechanical properties and the release of neurotrophic factors such as Brain-derived neurotrophic factor (BDNF), contributing to enhanced neurogenesis and cognitive performance. This complex relationship underscores the potential of HIIT in promoting brain health and cognitive function\u003csup\u003e5\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eSelenium's potential for neuroprotection, diabetic control, and oxidative stress management has been widely studied\u003csup\u003e6\u003c/sup\u003e. Selenium nanoparticles (SeNPs) have emerged as promising drug delivery carriers due to their low toxicity, strong biocompatibility, and antioxidation capacities\u003csup\u003e6\u003c/sup\u003e. SeNPs enhance bioavailability and show potential in diabetes management, involving complex mechanisms across multiple pathways\u003csup\u003e6\u003c/sup\u003e. Treatment with SeNPs improves insulin sensitivity and glucose metabolism, acting as hypoglycaemic agents and boosting insulin secretion\u003csup\u003e7\u003c/sup\u003e. Furthermore, decreased plasma selenium is linked to cognitive decline, with the brain remaining selenium-replete the longest during deficiency, highlighting its importance in brain function\u003csup\u003e8\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eIrisin influences biological responses and contributes to DM pathology. It crosses the BBB and is expressed in the hippocampus, which is involved in learning\u003csup\u003e9\u003c/sup\u003e. Exercise-induced irisin secretion has been linked to increased hippocampal BDNF expression\u003csup\u003e9\u003c/sup\u003e. While selenium influences insulin-regulated glucose transporters, like glucose transporter type 4 (GLUT4)\u003csup\u003e10\u003c/sup\u003e, irisin modulates cognitive function, especially during exercise, by activating pathways that increase BDNF expression in neurons\u003csup\u003e11\u003c/sup\u003e. Exercise raises hippocampal BDNF levels, addressing cognitive deficits\u003csup\u003e12\u003c/sup\u003e. BDNF is essential for neuronal health, survival, neurogenesis, learning and memory\u003csup\u003e13\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHowever, dysfunctional glucose metabolism is present in brain regions of neurodegenerative disease patients\u003csup\u003e11\u003c/sup\u003e. DM significantly threatens brain health, contributing to cognitive decline and neurodegeneration, with impaired insulin signalling and glucose metabolism linked to these processes\u003csup\u003e14\u003c/sup\u003e. Specifically, hippocampal insulin resistance is crucial for cognitive impairment in DM. Dysregulation of the GLUT4 leads to reduced glucose supply to neurons, explaining the comorbidity of insulin resistance and cognitive deficits\u003csup\u003e15\u003c/sup\u003e. Impaired GLUT4 is linked to cognitive challenges in hippocampal tasks, while enhancing GLUT4 activity can improve memory\u003csup\u003e15\u003c/sup\u003e. Insulin plays multiple roles in the brain, particularly in regulating hippocampal processes and metabolism; overall, reduced GLUT4 activation due to insulin resistance is central to cognitive impairments in DM\u003csup\u003e15\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe relationship between selenium and diabetes has sparked significant interest, yielding mixed findings. Some studies indicate a strong connection between selenium levels and diabetes risk, while others find no significant association, highlighting the complexity of selenium's role in metabolic health\u003csup\u003e16,17\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eWhile HIIT and selenium independently benefit neuroprotection and glucose metabolism, their combined effect on cognitive function in diabetes remains unexplored. HIIT enhances neurotrophic factors like BDNF, while SeNPs combat oxidative stress and improve insulin signalling. Given their complementary mechanisms, we investigate whether HIIT and SeNPs\u0026nbsp;together provide superior neuroprotection and cognitive benefits in DM. Our study examines spatial learning, memory, hippocampal cell viability, and the expression of irisin, BDNF, and GLUT4 to uncover their synergistic effects.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eAnimals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThirty-one male Wistar rats (age\u0026thinsp;=\u0026thinsp;8 weeks, weight= 250 \u0026plusmn; 38 gr) were provided by the Animals Center of the Pasteur Institute of Iran and were kept for 11 weeks (one week of familiarization, one week of induction of diabetes, one week of familiarization with the training protocol, and eight weeks of the main training protocol) in a standard environment (temperature of 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2 \u0026deg;C, and a 12-h light/dark cycle) in the animal house of Histogenotech lab, with ad libitum access to food and water. The study protocol was approved by the Ethics Committee in biomedical research of Guilan University (IR.GUILAN.REC.1401.063), and all methods used in this study are reported in accordance with ARRIVE guidelines. All methods were performed in accordance with the relevant guidelines and regulations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDiabetes mellitus induction\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOne week after familiarization with the new environment, all rats were injected once with 65 mg/kg streptozotocin (STZ) solution (cat No: S0130, Sigma-Aldrich Co., USA, prepared in 0.5 M citrate buffer/pH 4.5). 7 days later, all rats with fasting blood glucose higher than 280 mg/kg were considered diabetic\u003csup\u003e18\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGroup allocation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter diabetes induction rats were randomly allocated into five groups (n\u0026thinsp;=\u0026thinsp;5 per group + 2 additional rat for reserve in treatment groups to account for potential mortality. As no exclusions were necessary, these reserve rats were included in the final analysis, resulting in a total of n = 7 per treatment group): Control Group (CO); Placebo Control Group, which received a nano solvent (water) as a placebo (PCO); selenium nanoparticles group (SeNPs); high-intensity interval training Group (HIIT) and combining selenium nanoparticles and high-intensity interval training group (SeNPs+HIIT). The experimental design is shown in detail in Fig \u003ca href=\"#fig1\"\u003e1\u003c/a\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcclimatization stage and VO2max measurement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo learn how to run on an animal treadmill, the rats in the HIIT and SeNPs+HIIT groups were forced to run on the treadmill for 15 minutes at a speed of 10 to 15 m/min for 5 days in one week. Aligns with protocols in prior studies, to avoid unintended metabolic adaptations Sedentary groups (CO, PCO, SeNPs) were not exposed to the treadmill\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003csup\u003e19\u003c/sup\u003e.\u0026nbsp;Before the training protocol, an incremental test was performed to exhaustion (starting at 10 m/min with increments of 3 m/min every 2 min). Exhaustion was defined as the inability of the rats to run on the treadmill despite electric shocks\u003csup\u003e20\u003c/sup\u003e. (additional information are available in repository).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSelenium Nanoparticles supplementation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSeNPs (cat no: 919519, Sigma Aldrich) were purchased from Merck Life Science UK Limited (New Road, The Old Brickyard, Gillingham, Dorset, SP8 4XT, United Kingdom) and were administered by gavage to the SeNPs and SeNPs+HIIT group rats at a dose of 0.1 mg/kg every other day for 8 weeks\u003csup\u003e21\u003c/sup\u003e.\u0026nbsp;Selenium has a narrow therapeutic window, and its nanoparticles have been optimized to enhance bioavailability while minimizing toxicity. Studies suggest that doses exceeding 0.9 mg/kg could lead to selenium toxicity, whereas 0.1 mg/kg remains within a safe and effective range in diabetic models\u003csup\u003e22\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eExercise protocol\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAn HIIT program was performed in the HIIT and SeNPs+HIIT group for 8 weeks, 5 days a week. Each session consisted of three stages (warming up, main body and cooling down). The main body comprised 2 minutes of activity at an intensity equal to 80-95% VO2max increasing every 2 weeks, followed by 1 minute of active rest at an intensity equal to 30-40% VO2max, at a 0 incline, repeated for 10 bouts.\u003c/p\u003e\n\u003col\u003e\n \u003cli\u003eWarm-up (5 minutes): at an intensity equal to 30\u0026ndash;40% VO₂max.\u003c/li\u003e\n \u003cli\u003eMain body (2 min activity +1 min active rest) \u0026times;10 bouts:\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003eWeeks 1\u0026ndash;2: high-intensity intervals equal to 80% VO₂max.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWeeks 3\u0026ndash;4: high-intensity intervals equal to 85% VO₂max.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWeeks 5\u0026ndash;6: High-intensity intervals equal to 90% VO₂max.\u003c/p\u003e\n\u003cp\u003eWeeks 7\u0026ndash;8: High-intensity intervals equal to 95% VO₂max.\u003c/p\u003e\n\u003col start=\"3\"\u003e\n \u003cli\u003eCool-down (5 minutes): at an intensity equal to 30\u0026ndash;40% VO₂max.\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003e\u003cstrong\u003eBehavioural assessment protocol\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpatial learning and memory were analyzed with Morris water maze (MWM). a black circular pool (diameter 160 cm, height 80 cm) filled with the opaque water (temperature 25 \u0026plusmn; 2 \u0026deg;C, depth 40 cm) in a semi-dark room to eliminate visual recognition of the platform. The water was colored with non-toxic green paint. The tank was separated into four quadrants: northeast (NE), southeast (SE), northwest (NW), and southwest (SW). The hidden square platform (escape platform) with a diameter of 10 cm was located 1.5 cm below the water surface away from the side wall and kept constant during the test. Colored geometric cues were placed around the tank in the way the rats can see them in order to find directions and environmental insulation was enabled.\u0026nbsp;Rats underwent a 60-second habituation session in the pool without the escape platform one day before training to reduce stress and ensure familiarity with the water environment. Then\u0026nbsp;the rats were exercised on 4 days via four trials each day, and 24 h after the last exercise session a probe trial was applied. During the training, the rat was placed into the water each time from a different quadrant and expected to discover the platform in 60 s. If the rats were unsuccessful to find the platform within the allowed time period, it was physically placed on the platform by the experimenter for 30 s. In this way, it was aimed for the rats to recognize the area and learn the place of the platform. at the 24 h after the spatial navigation trials a single 90 s probe trial task was performed in which the platform was removed from the pool. performances were recorded by video tracking system (Noldus Ethovision\u0026reg; system, version 7, The Netherlands), allowing their movements to be tracked on a computer screen\u003csup\u003e23\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTissue sampling\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAt the end of the protocol, blood glucose levels were measured using a glucometer. 24 hours after the last intervention, rats were sacrificed following deep anaesthesia induced by intraperitoneal injection of ketamine (60 mg/kg) and xylazine (5 mg/kg) with a ratio of 4:1. The abdomen was opened by making a midline incision in the skin, and immediately 7 ml of blood was taken from the inferior vena cava with a syringe. Subsequently, the brain was rapidly removed and placed on an ice-cold dissection plate and hippocampus was carefully dissected, then the CA1 subregion was separated. Serum was separated by rapid centrifugation (3000 rpm for 15 min) and stored together with the hippocampus samples at -80 \u0026deg;C for subsequent biochemical measurements.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eELISA assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSerum irisin was determined using a commercial enzyme linked immunosorbent assay kit following the manufacturer\u0026apos;s instructions (Irisin EIA kit, cat no: MBS2601445, My BioSource), Then, approximately 40 mL from each sample was transferred into a 96-well ELISA plate, and the ultimate absorbance within each well was measured at 450 nm utilizing a plate reader\u003csup\u003e24\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-time PCR protocols\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ehippocampus samples were homogenized in TRIzol solution using a tissue homogenizer (Tissue-Lyser LT; Qiagen, Valencia, CA) and total RNA was extracted according to the procedures described in the manufacturer\u0026apos;s instructions. Total RNA was assayed using the Nanodrop spectrophotometer (Thermo Scientific, Wilmington, USA) to assess purity and concentration. First-strand cDNA was synthesized from total RNA using the high-capacity cDNA reverse transcription kit (Applied Biosystems). Primer sequences (listed in Table 1) were designed using the NCBI primer design tool. All primers were purchased from Applied Biosystems, USA. A 20 \u0026micro;l reaction mixture containing 10 \u0026micro;l SYBR Green Mastermix (Amplicon) and the appropriate concentrations of gene specific primers plus 1000 ng/\u0026micro;l of cDNA template were loaded in each well of a 96-well plate. All PCR reactions were performed in duplicate. PCR was performed with thermal conditions as follows: 95\u0026deg;C for 10min, followed by 40 cycles of 95\u0026deg;C for 15 s, and 60\u0026deg;C for 45s. A dissociation melt curve analysis was performed to verify the specificity of the PCR products. GAPDH primers were used to amplify the endogenous control product. The mRNA expression relative values were analysed by the 2\u0026ndash;\u0026Delta;\u0026Delta;Ct method\u003csup\u003e25\u003c/sup\u003e. The sequences of the Real-Time PCR primers are shown in Table \u003ca href=\"#table1\"\u003e1\u003c/a\u003e.\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"465\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 87px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTargeted genes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 324px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer sequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 87px;\"\u003e\n \u003cp\u003e\u003cstrong\u003er-GAPDH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 324px;\"\u003e\n \u003cp\u003eAGGTCGGTGTGAACGGATTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 324px;\"\u003e\n \u003cp\u003eTGTAGACCATGTAGTTGAGGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 87px;\"\u003e\n \u003cp\u003e\u003cstrong\u003er-BDNF\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 324px;\"\u003e\n \u003cp\u003eGTCCCTTCTACACTTTACCTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 324px;\"\u003e\n \u003cp\u003eTCTTTCACCCTTTCCACTCC \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 87px;\"\u003e\n \u003cp\u003e\u003cstrong\u003er-GLUT4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 324px;\"\u003e\n \u003cp\u003eTTCATCTTCACCTTCCTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 324px;\"\u003e\n \u003cp\u003eCCTAAGTATTCAAGTTCTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 87px;\"\u003e\n \u003cp\u003e\u003cstrong\u003er-Irisin R\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 324px;\"\u003e\n \u003cp\u003eCCAGCAATCAGAGATGGATACTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 324px;\"\u003e\n \u003cp\u003eTGGGCTTGAAACTCCTCTTATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e Primer sequences used in Real-time PCR analysis. F: Forward and R: Reverse primers, are listed for each target gene.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHippocampus Samples were lysed in radio-immune precipitation assay (RIPA) buffer (Cell Signalling Technology, Danvers, MA) containing protease and phosphatase inhibitor cocktail (Sigma). Protein concentrations were measured by the Bradford method. Equal amounts of protein (30 \u0026micro;g) were separated by 12% SDS-PAGE and transferred to PVDF membranes. After blocking in 2% ECL advanced blocking reagent kit (Amersham Bioscience, USA, cat number: RPN2108) the membranes were incubated with following primary antibodies overnight at 4 \u0026deg;C: BDNF (1:1000 dilution; ab108319, Abcam, Germany, cat number: orb519283). After washing, the membranes were incubated for 2 h at room temperature with horseradish peroxidase conjugated rabbit secondary antibody (cat no: BA1054-2). Blots were revealed by the ECL advanced kit. Individual protein bands were quantified using image j software (NIH, USA), and results are expressed relative to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, 1: 2000 dilution; ab8245, Abcam, Germany, cat no: GTX100118) antibody\u003csup\u003e25\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCrystal violet staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter the dehydration, infiltration, and paraffin embedding of the samples, the successive slices to 5 \u0026mu;m thickness from the microtome, CA1 area of hippocampus were prepared. The slices were placed on the slide and then stained with a 1% crystal violet solution. Staining of the crystal violet shows the Nissl objects in the nerve cells in blue - purple. After staining, each section was counted in 3 slices with a minimum distance of 50 micrometres. To count neurons in each group, an area of 1,350 square micrometres was considered. The tissue study was performed with an LABOMED microscope\u003csup\u003e26\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData were analyzed using GraphPad Prism 8.4.3 software (GraphPad Software, San Diego, CA, USA), and statistical significance values were set at P\u0026thinsp;\u0026le;\u0026thinsp;0.05. Biomarkers were computed for each group and subsequently compared using either One-way ANOVA or Two-way ANOVA with Tukey\u0026rsquo;s multiple comparisons test. The data, representing three or more biological replicates, is presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). Statistical significance is denoted as follows: (*) P\u0026thinsp;\u0026le;\u0026thinsp;0.05, (**) P\u0026thinsp;\u0026le;\u0026thinsp;0.01, (***) P\u0026thinsp;\u0026le;\u0026thinsp;0.001, (****) P\u0026thinsp;\u0026le;\u0026thinsp;0.0001.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eEffects of HIIT and SeNPs on learning and memory\u003c/h2\u003e \u003cp\u003eThe data showed that escape latency significantly decreased over the 4-day acquisition period (F(2.66, 69.33)\u0026thinsp;=\u0026thinsp;14.71, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and there was significant difference between all experimental groups in learning the hidden platform location (F(4, 26)\u0026thinsp;=\u0026thinsp;12.25, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). On day 1 and day 2 The mean escape latency did not differ between any of the groups, but on day 3 the SeNPs\u0026thinsp;+\u0026thinsp;HIIT group showed a better performance in finding the platform compared to PCO group (P\u0026thinsp;=\u0026thinsp;0.01). on the final day of acquisition, all treatment groups (SeNPs\u0026thinsp;+\u0026thinsp;HIIT, HIIT and SeNPs) showed significant decrease (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 and P\u0026thinsp;\u0026lt;\u0026thinsp;0.005, and P\u0026thinsp;\u0026lt;\u0026thinsp;0.03 respectively) in escape latency compared to control groups (CO, PCO) and still, SeNPs\u0026thinsp;+\u0026thinsp;HIIT group had a shorter escape latency compare to other groups. notably, there was no significant difference between treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003eThe probe trial designed to assess spatial memory retention, revealed that all treatment groups demonstrated a preference for the target quadrant, as evidenced by their swim paths (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). Analysis of the percentage of total crossings at the platform location showed significant differences between all experimental groups (F(4, 26)\u0026thinsp;=\u0026thinsp;7.06, P\u0026thinsp;=\u0026thinsp;0.0005) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed); Specifically, the SeNPs\u0026thinsp;+\u0026thinsp;HIIT and HIIT groups exhibited significantly higher percentages of crossings at the platform(P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 and P\u0026thinsp;\u0026lt;\u0026thinsp;0.009, respectively) compared to the control groups (CO, PCO). In contrast, the SeNPs group did not show any significant differences (P\u0026thinsp;\u0026gt;\u0026thinsp;0.17) when compared to the control groups (CO, PCO). Also, there is no significant difference between treatment groups. Time spent in the target quadrant also varied significantly among groups (F(4, 26)\u0026thinsp;=\u0026thinsp;142.9, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). all treatment groups (HIIT, SeNPs, SeNPs\u0026thinsp;+\u0026thinsp;HIIT) spent significantly more time in the target quadrant compared to control groups (CO, PCO) (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Among the treatment groups, the SeNPs\u0026thinsp;+\u0026thinsp;HIIT group was found to spend a significantly longer time in the target quadrant than both the HIIT group and the SeNPs group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 for both comparisons). However, no significant difference was observed between the SeNPs and HIIT groups (P\u0026thinsp;=\u0026thinsp;0.83) or between the control groups (P\u0026thinsp;=\u0026thinsp;0.99).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEffect of HIIT and SeNPs on neuronal cell viability\u003c/h2\u003e \u003cp\u003eCresyl violet staining analysis of the hippocampal CA1 region (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea,b) demonstrated significant differences in neuronal cell counts among all experimental groups (F(4, 10)\u0026thinsp;=\u0026thinsp;36.89, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The treatment groups (HIIT, SeNPs, SeNPs\u0026thinsp;+\u0026thinsp;HIIT) exhibited significantly higher numbers of living cells compared to the control groups (CO, PCO) (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for all comparisons). Within the treatment groups, the SeNPs\u0026thinsp;+\u0026thinsp;HIIT group showed significantly higher cell viability than both the HIIT (P\u0026thinsp;=\u0026thinsp;0.004) and SeNPs (P\u0026thinsp;=\u0026thinsp;0.008) groups. However, no significant difference was observed between the SeNPs and HIIT groups (P\u0026thinsp;=\u0026thinsp;0.98) or between the control groups (P\u0026thinsp;=\u0026thinsp;0.99).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eEffect of HIIT and SeNPs on serum level of Irisin\u003c/h2\u003e \u003cp\u003eAnalysis revealed a significant difference in irisin protein concentrations across all experimental groups (F(4, 10)\u0026thinsp;=\u0026thinsp;334.2, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Treatment groups (HIIT, SeNPs, and SeNPs\u0026thinsp;+\u0026thinsp;HIIT) demonstrated markedly higher irisin levels when compared to the control groups (CO, PCO). Notably, a significant difference was observed between the SeNPs\u0026thinsp;+\u0026thinsp;HIIT and SeNPs groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). In contrast, the comparison between the SeNPs\u0026thinsp;+\u0026thinsp;HIIT and HIIT groups did not yield a significant difference (P\u0026thinsp;=\u0026thinsp;0.11). Furthermore, the HIIT group exhibited significantly higher irisin protein levels than the SeNPs group (P\u0026thinsp;=\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eEffect of HIIT and SeNPs on Brain irisin receptor\u003c/h2\u003e \u003cp\u003eRelative expression of the irisin receptor gene in hippocampus displayed significant differences among all experimental groups (F(4, 20)\u0026thinsp;=\u0026thinsp;129.0, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Each treatment group (HIIT, SeNPs, SeNPs\u0026thinsp;+\u0026thinsp;HIIT) demonstrated significantly elevated expression compared to the control groups (CO, PCO). The SeNPs\u0026thinsp;+\u0026thinsp;HIIT group had a significantly higher expression than both the HIIT (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and SeNPs (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) groups. However, the comparison between the SeNPs and HIIT groups did not reveal significant differences (P\u0026thinsp;=\u0026thinsp;0.73), nor did the control groups show significant variation (P\u0026thinsp;=\u0026thinsp;0.99).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eEffects of HIIT and SeNPs on BDNF changes\u003c/h2\u003e \u003cp\u003eBoth BDNF protein concentrations (F (4, 10)\u0026thinsp;=\u0026thinsp;93.41, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and gene expression levels (F (4, 20)\u0026thinsp;=\u0026thinsp;39.32, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) demonstrated significant differences among all experimental groups. Both Increased significantly in all treatment groups (HIIT, SeNPs, SeNPs\u0026thinsp;+\u0026thinsp;HIIT) compared to the control groups (CO, PCO), with protein levels showing a significance of P\u0026thinsp;\u0026le;\u0026thinsp;0.0001 and gene expression P\u0026thinsp;\u0026le;\u0026thinsp;0.0004. The SeNPs\u0026thinsp;+\u0026thinsp;HIIT group presented significantly higher levels of BDNF protein than the SeNPs group (P\u0026thinsp;=\u0026thinsp;0.0001) and the HIIT group (P\u0026thinsp;=\u0026thinsp;0.002) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea,c). For BDNF gene expression, the SeNPs\u0026thinsp;+\u0026thinsp;HIIT group also exhibited a significant difference from the SeNPs group (P\u0026thinsp;=\u0026thinsp;0.01) and had elevated gene levels compared to the HIIT group (P\u0026thinsp;=\u0026thinsp;0.0003) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). No significant differences were found between the SeNPs and HIIT groups for either protein (P\u0026thinsp;=\u0026thinsp;0.18) or gene levels (P\u0026thinsp;=\u0026thinsp;0.46), nor between the PCO and CO groups for protein (P\u0026thinsp;=\u0026thinsp;0.97) or gene expression (P\u0026thinsp;=\u0026thinsp;0.99).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eEffect of HIIT and SeNPs on GLUT4 gene\u003c/h2\u003e \u003cp\u003eAnalysis of GLUT4 gene expression revealed significant differences among all experimental groups (F(4, 20)\u0026thinsp;=\u0026thinsp;12.00, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). The SeNPs\u0026thinsp;+\u0026thinsp;HIIT group exhibited significantly higher GLUT4 expression compared to both control groups: PCO (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and CO (P\u0026thinsp;=\u0026thinsp;0.0002). The SeNPs group also showed significant increases in GLUT4 expression compared to the control groups, with differences between SeNPs and PCO (P\u0026thinsp;=\u0026thinsp;0.03) and SeNPs and CO (P\u0026thinsp;=\u0026thinsp;0.01). However, no significant differences were noted between the HIIT group and the control groups (PCO, P\u0026thinsp;=\u0026thinsp;0.21; CO, P\u0026thinsp;=\u0026thinsp;0.08). Among the treatment groups, a significant difference was found between the SeNPs\u0026thinsp;+\u0026thinsp;HIIT and HIIT groups (P\u0026thinsp;=\u0026thinsp;0.02), indicating that the SeNPs\u0026thinsp;+\u0026thinsp;HIIT group had higher GLUT4 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). No significant differences were observed between the SeNPs\u0026thinsp;+\u0026thinsp;HIIT and SeNPs groups (P\u0026thinsp;=\u0026thinsp;0.19) or between the SeNPs and HIIT groups (P\u0026thinsp;=\u0026thinsp;0.86).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study demonstrates that both HIIT and SeNPs interventions improve cognitive function, glucose metabolism and neuronal markers in the hippocampus of diabetic rats. In exploring the combination of HIIT and SeNPs to enhance cognitive function in diabetes, it is valuable to consider selenium's complex and contradictory relationship with diabetes\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. The risk of DM is best represented in a wide dose-dependent manner, getting often the U-graph, indicating that both too low and too high selenium intakes could increase the risk of diabetes\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e,\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e suggesting a \"threshold effect\" where optimal selenium concentrations are crucial for maximizing antidiabetic\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e and cognitive benefits while avoiding risks associated with excessive intake\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. But a similar relationship between SeNPs and diabetes has not yet been discovered\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn present study, the results from MWM test, indicated that combining HIIT and SeNPs significantly enhances spatial learning and navigation over four days as well as spending more time in the target quadrant during the probe test, suggesting superior spatial memory retention compared to either intervention alone. This suggests a potential complementary effect of these interventions. Furthermore, the observed efficacy of SeNPs may reflect the use of a safe dosage aligned with the optimal selenium range recommended for maximizing antidiabetic benefits while mitigating risks associated with selenium overexposure\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e,\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eOur study demonstrates that combining HIIT and SeNPs significantly enhances spatial learning and memory retention in diabetic rats. During the 4-day MWM acquisition, the SeNPs\u0026thinsp;+\u0026thinsp;HIIT group exhibited a 61% reduction in escape latency by Day 4 (from 52.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.1 s on Day 1 to 20.4\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1 s on Day 4; P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 vs. CO/PCO), outperforming HIIT (28.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5 s; P\u0026thinsp;=\u0026thinsp;0.004) and SeNPs (31.7\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0 s; P\u0026thinsp;=\u0026thinsp;0.008) alone. In the probe trial, this group spent 48% more time in the target quadrant (42.1\u0026thinsp;\u0026plusmn;\u0026thinsp;1.8 s vs. 28.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6 s in HIIT and 27.9\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9 s in SeNPs; P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and showed a 2.3-fold increase in platform crossings (6.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 vs. 2.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 in CO/PCO; P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating robust spatial memory retention.\u003c/p\u003e \u003cp\u003eThis contrasts with Orumiyehei et al. 2022, who reported no HIIT-induced cognitive improvements in diabetic rats using a single-day MWM protocol \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Our extended 4-day training likely allowed sufficient time for neuroplastic adaptations to manifest, as neither group exhibited significant differences, including the healthy control group. Literature suggests that a MWM duration of 3 to 6 days is commonly employed to mitigate confounding factors\u003csup\u003e\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. While our model employed STZ-induced insulin-deficient diabetes (mimicking T1D), this design enabled us to isolate the effects of HIIT and SeNPs in a hyperglycemic state, distinct from insulin-resistant T2D models. This distinction is critical, as our findings may primarily inform interventions for insulin-deficient diabetes, though the mechanism overlaps with T2D warrant further investigation.\u003c/p\u003e \u003cp\u003eWhile Intense physical training is suggested to be harmful to cognitive function, HIIT not only had no deleterious effects on rats\u0026rsquo; cognitive function, but also contribute to avoid cognitive impairment\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. In middle-aged and older adults, HIIT has been shown to improve information processing, executive function and memory, which helps to reduce cognitive degenerative diseases. Additionally, chronic HIIT (more than 8 weeks) has been demonstrated to exert a more profound influence on cognitive performance than acute HIIT (less than 8 weeks)\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn the present study, the lack of a statistically significant difference between the SeNPs and HIIT groups may reflect the fact that each intervention independently contributes to neuroprotective through distinct mechanisms. However, the SeNPs\u0026thinsp;+\u0026thinsp;HIIT combination appear to exert greater effects, as evidenced by our results, where the enhanced learning and memory observed in the combined treatment group.\u003c/p\u003e \u003cp\u003eTo understand the underlying biological mechanisms contributing to this cognitive enhancement, we evaluated hippocampal cell viability. Our result revealed that both HIIT and SeNPs interventions significantly enhance neuronal viability in the hippocampal CA1 region of diabetic rats. As research showed, low concentrations of SeNPs (0.5 \u0026micro;g/ml) increase neuroprotection, while High concentrations (2.5\u0026ndash;10 \u0026micro;g/ml) have toxic effects leading to neuronal loss\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. In our study SeNPs\u0026thinsp;+\u0026thinsp;HIIT group increased surviving neurons by 37% compared to HIIT (214\u0026thinsp;\u0026plusmn;\u0026thinsp;12 vs. 156\u0026thinsp;\u0026plusmn;\u0026thinsp;10 cells/mm\u0026sup2;; P\u0026thinsp;=\u0026thinsp;0.004) and 41% versus SeNPs (214\u0026thinsp;\u0026plusmn;\u0026thinsp;12 vs. 152\u0026thinsp;\u0026plusmn;\u0026thinsp;9 cells/mm\u0026sup2;; P\u0026thinsp;=\u0026thinsp;0.008). Recently it's been shown that, SeNPs combined with an antidiabetic drug can improve learning and memory in diabetic rats by enhancing neuronal viability in the CA1 region of the hippocampus\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. The enhanced neuronal survival observed with the combined HIIT and SeNPs intervention provides a structural basis for the MWM findings. This pattern suggest complementary mechanisms, including enhanced metabolic regulation via GLUT4 and antioxidant-mediated cellular protection.\u003c/p\u003e \u003cp\u003eExercise training and selenium appear to regulate glucose metabolism through improvement of GLUT4 expression in diabetic rats\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e, a critical glucose transporter in the hippocampus\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Our findings indicate that SeNPs supplementation significantly increased hippocampal GLUT4 expression (1.8-fold vs. CO, P\u0026thinsp;=\u0026thinsp;0.01; 1.6-fold vs. PCO, P\u0026thinsp;=\u0026thinsp;0.03), whereas HIIT alone showed no effect (P\u0026thinsp;=\u0026thinsp;0.21 vs. PCO). While there is Multiple studies report that HIIT increases GLUT4 protein and improves glucose metabolism in skeletal muscle of diabetic rodents\u003csup\u003e\u003cspan additionalcitationids=\"CR41\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. This contradictory may be explained by, Hippocampus GLUT4 is less sensitive to HIIT compared to skeletal muscle. GLUT4 regulation in the brain may rely more on insulin signalling and oxidative balance, where SeNPs may exert a stronger effect due to their antioxidant properties. SeNPs have been observed to regulate glucose metabolism by reducing oxidative stress then repairing pancreatic beta cells, and lead to insulin receptor activity increases\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAdditionally, when HIIT combined with SeNPs it resulted in the greatest increase in GLUT4 expression in compare to other groups (2.1-fold vs. CO, P\u0026thinsp;=\u0026thinsp;0.0002), Same as improved cognitive function in the HIIT\u0026thinsp;+\u0026thinsp;SeNPs group, suggesting a complementary role of SeNPs in glucose regulation. This aligns with evidence that GLUT4 regulation in the hippocampus depends more on antioxidant balance than exercise-induced metabolic demand \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. However, a previous study reported that elevated GLUT4 levels had no positive correlation with spatial memory improvements in diabetic rats\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. This discrepancy may arise from differences in intervention duration or the multifactorial nature of cognitive outcomes (e.g., GLUT4\u0026rsquo;s role in glucose supply vs. BDNF\u0026rsquo;s direct neurotrophic effects), suggesting that GLUT4 influences cognitive function through a distinct yet complementary pathway that ultimately converges on the same functional outcome.\u0026mdash;. Notably, while HIIT enhances skeletal muscle GLUT4 in diabetic models\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e, our findings reveal tissue-specific responses, underscoring the complexity of glucose metabolism in neurocognitive contexts.\u003c/p\u003e \u003cp\u003eThese results conflict with reports linking elevated hippocampal GLUT4 to negligible cognitive improvements in diabetic rats.\u003c/p\u003e \u003cp\u003eIn discussing the observed cognitive improvements, one potential neuroprotective pathway involves irisin/BDNF, both of which have been linked in exercise-induced neurogenesis. Irisin an exercise-induced myokine act as a key regulator of cognitive function by promotes hippocampal neurogenesis and synaptic plasticity, particularly in diabetes\u003csup\u003e\u003cspan additionalcitationids=\"CR46\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. It appears that exercise training and SeNPs are able to increase the serum levels of irisin\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. Our study aligns with these findings, Both SeNPs and HIIT interventions independently elevated serum irisin, with HIIT inducing a 3.2-fold increase (18.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2 ng/mL vs. 5.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 ng/mL in PCO; P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and SeNPs a 1.9-fold increase (10.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.8 ng/mL; P\u0026thinsp;=\u0026thinsp;0.001 vs. PCO). The combined group further increased hippocampal irisin receptor expression (4.5-fold vs. CO, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), greater than HIIT (2.1-fold, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and SeNPs (2.3-fold, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) alone. Interestingly, both interventions equally affected irisin receptor expression in the hippocampus. Previous research has indicated that exercise training elevates irisin levels, promoting hippocampal cell proliferation and neuroprotective gene activation\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. Given that circulating irisin can crosses the BBB and that how it exerts hippocampal protective properties \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e,\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. Explain Our study result that While HIIT appears more effective on circulating irisin levels, both HIIT and SeNPs demonstrate the ability to enhance hippocampal irisin receptor expression, suggesting that physical exercise may combat memory degradation through irisin from both peripheral and central sources\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. And may have distinct but complementary mechanisms to enabling neuroprotective functions and contributing to improved cognitive function.\u003c/p\u003e \u003cp\u003ePrevious studies link irisin expression in exercised diabetic rats to Stimulates BDNF \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e, According to our findings, HIIT and SeNPs leads to increase both BDNF gene expression and protein levels. Similar to irisin, BDNF protein levels yielding the most profound effects in the SeNPs\u0026thinsp;+\u0026thinsp;HIIT group (3.4-fold vs. CO, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), with HIIT and SeNPs yielding comparable increases (2.1-fold and 1.9-fold, respectively; P\u0026thinsp;=\u0026thinsp;0.18 between them).The lack of significant differences between the HIIT and SeNPs groups in BDNF suggests that HIIT primarily drives peripheral irisin secretion, while SeNPs enhance central receptor sensitivity\u0026mdash;a complementary interaction that may converge on BDNF-mediated neuroprotection. SeNPs only/with other neurodegenerative treatments (e.g., stem cells)\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e or other form of SeNPs (e.g., biogenic or coated variant) effectively increase BDNF and suggested that SeNPs may offer therapeutic benefits in neurodegenerative diseases like Alzheimer's by protect against neuronal damage and improve the cognition and memory deficit in rats\u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e,\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eWhile, Orumiyehei et al. 2022, reported that HIIT-induced hippocampal molecular changes were not associated with cognitive function in rats with T2D\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Other studies have demonstrated long-term maintenance of HIIT to enhanced hippocampal BDNF expression and improved cognition aged population\u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. Despite concerns regarding feasibility, HIIT can provide significant protection against hippocampal cognitive decline as an exercise-based interventions\u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. considering diabetes get more complicated with age, using HIIT because of its sustained improvement support its potential as an optimal exercise regimen to promote cognitive improvement\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e,\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eCollectively, our findings suggest that HIIT and SeNPs may exert complementary effects on cognitive function through distinct, yet potentially synergistic, biological pathways. Specifically, HIIT appears to elevate irisin and BDNF, while SeNPs predominantly enhance GLUT4 expression. Together, these interventions improved cellular viability in the hippocampal CA1 region and led to enhanced spatial learning and memory. Despite these promising results, our data do not definitively establish a mechanistic interaction between HIIT and SeNPs. While suggestive of synergy, the observed effects remain correlative, and further studies incorporating pathway-specific inhibitors, longitudinal designs, and direct molecular interaction assays are required to confirm causality.\u003c/p\u003e \u003cp\u003eAlthough this study was conducted in an animal model, the findings may hold translational relevance. HIIT has demonstrated cognitive benefits in older adults and individuals with metabolic dysfunctions, and SeNPs show antioxidant and insulin-sensitizing potential in preclinical models. However, key species-specific differences\u0026mdash;such as variations in blood-brain barrier permeability, selenium metabolism, and hippocampal insulin signaling\u0026mdash;limit direct extrapolation to human populations. Future clinical trials will be necessary to validate these effects and to determine appropriate SeNPs dosing that balances efficacy with safety. The study also has several limitations that warrant consideration. First, the cross-sectional design precludes conclusions about temporal sequences or causality, such as whether irisin upregulation precedes changes in BDNF. Second, the use of a single SeNPs dose (0.1 mg/kg), while supported by prior safety data, limits understanding of dose-response relationships vital for clinical translation. Third, small sample sizes (n\u0026thinsp;=\u0026thinsp;5\u0026ndash;7/group) may have limited the power to detect subtle subgroup effects or interactions. Additionally, unmeasured confounders such as stress-induced hormonal fluctuations during HIIT, weight changes, and individual variability in diabetes severity could have independently influenced cognitive or metabolic outcomes. Finally, the use of a single high-dose STZ model primarily reflects insulin-deficient diabetes and may not fully capture the pathophysiological complexity of insulin-resistant states.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur study demonstrates that combining HIIT and selenium nanoparticles (SeNPs) significantly improves spatial learning (61% reduction in escape latency, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), memory retention (48% longer target quadrant time, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), and hippocampal neuronal survival (37% increase vs. monotherapies, P\u0026thinsp;\u0026lt;\u0026thinsp;0.008) in STZ-induced diabetic rats. These benefits likely arise from enhanced irisin/BDNF signaling and GLUT4-mediated glucose metabolism, suggesting complementary neuroprotective mechanisms. While our STZ model reflects insulin-deficient diabetes, the findings provide critical insights into hyperglycemia-driven cognitive decline. Future studies should validate these effects in T2D models, optimize dosing, and assess clinical feasibility. This work underscores the potential of multimodal interventions to counteract diabetic neurodegeneration, bridging exercise physiology and nanomedicine.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eAuthor contributions statement\u003c/h2\u003e \u003cp\u003eContribution to writing and editing: Payam Saidie and Kimia Aliakbari; Collection of data: Kimia Aliakbari; Statistical analysis and data interpretation: Kimia Aliakbari and Payam Saidie; Supervision: Payam Saidie.\u003c/p\u003e \u003c/p\u003e\u003cp\u003eContribution to writing and editing: P.S and K.A; Collection of data: K.A; Statistical analysis and data interpretation: K.A and P.S; Supervision: P.S.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets generated during and/or analyzed during the current study and its supplementary information are available in the figshare repository: https://doi.org/10.6084/m9.figshare.c.7602587 .\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBodke, H., Wagh, V. \u0026amp; Kakar, G. Diabetes Mellitus and Prevalence of Other Comorbid Conditions: A Systematic Review. Cureus 15, (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRandv\u0026auml;li, M., Toomsoo, T. \u0026amp; Šteinmiller, J. The Main Risk Factors in Type 2 Diabetes for Cognitive Dysfunction, Depression, and Psychosocial Problems: A Systematic Review. Diabetology 5, 40\u0026ndash;59 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta, M., Pandey, S., Rumman, M., Singh, B. \u0026amp; Mahdi, A. A. Molecular mechanisms underlying hyperglycemia associated cognitive decline. IBRO Neurosci Rep 14, 57\u0026ndash;63 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlansare, A., Alford, K., Lee, S., Church, T. \u0026amp; Jung, H. C. The effects of high-intensity interval training vs. moderate-intensity continuous training on heart rate variability in physically inactive adults. Int J Environ Res Public Health 15, 1508 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcIlvain, G. et al. Acute effects of high-intensity exercise on brain mechanical properties and cognitive function. Brain Imaging Behav 18, 863\u0026ndash;874 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarthik, K. K., Cheriyan, B. V., Rajeshkumar, S. \u0026amp; Gopalakrishnan, M. A review on selenium nanoparticles and their biomedical applications. Biomedical Technology 6, 61\u0026ndash;74 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePyrzynska, K. \u0026amp; Sentkowska, A. Selenium Species in Diabetes Mellitus Type 2. Biol Trace Elem Res 202, 2993\u0026ndash;3004 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerr, C., Arnaud, J. \u0026amp; Akbaraly, T. N. Selenium and cognitive impairment: A brief-review based on results from the EVA study. Biofactors 38, 139\u0026ndash;144 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJo, D. \u0026amp; Song, J. Irisin Acts via the PGC-1α and BDNF Pathway to Improve Depression-like Behavior. Clin Nutr Res 10, 292 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, T., Yuan, B., Zou, Y. \u0026amp; Zang, W. The effect of insulin in combination with selenium on blood glucose and GLUT4 expression in the cardiac muscle of streptozotocin-induced diabetic rats. Fundam Clin Pharmacol 24, 199\u0026ndash;204 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu, Y. et al. Recent advances on the molecular mechanisms of exercise-induced improvements of cognitive dysfunction. Transl Neurodegener 12, 9 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDadkhah, M., Saadat, M., Ghorbanpour, A. M. \u0026amp; Moradikor, N. Experimental and clinical evidence of physical exercise on BDNF and cognitive function: a comprehensive review from molecular basis to therapy. Brain Behavior and Immunity Integrative 21, 100017 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJaberi, S. \u0026amp; Fahnestock, M. Mechanisms of the beneficial effects of exercise on brain-derived neurotrophic factor expression in Alzheimer\u0026rsquo;s disease. Biomolecules 13, 1577 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantiago, J. A., Karthikeyan, M., Lackey, M., Villavicencio, D. \u0026amp; Potashkin, J. A. Diabetes: a tipping point in neurodegenerative diseases. Trends Mol Med S1471-4914 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcNay, E. C. \u0026amp; Pearson-Leary, J. GluT4: A central player in hippocampal memory and brain insulin resistance. Exp Neurol 323, 113076 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng, W., Jiang, S., Cun, D., Huang, F. \u0026amp; Jiang, Z. Tracing links between micronutrients and type 2 diabetes risk: the singular role of selenium. Front Endocrinol (Lausanne) 15, (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerri, G. et al. The association between selenium status and cognitive decline in very old adults: The Newcastle 85\u0026thinsp;+\u0026thinsp;Study. Proceedings of the Nutrition Society 83, (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlshehri, A. S. Kaempferol attenuates diabetic nephropathy in streptozotocin-induced diabetic rats by a hypoglycaemic effect and concomitant activation of the Nrf-2/Ho-1/antioxidants axis. Arch Physiol Biochem 129, 984\u0026ndash;997 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKunstetter, A. C. et al. Pre-exercise exposure to the treadmill setup changes the cardiovascular and thermoregulatory responses induced by subsequent treadmill running in rats. Temperature 5, 109\u0026ndash;122 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomas, C., Bishop, D., Moore-Morris, T. \u0026amp; Mercier, J. Effects of high-intensity training on MCT1, MCT4, and NBC expressions in rat skeletal muscles: influence of chronic metabolic alkalosis. American Journal of Physiology-Endocrinology and Metabolism 293, E916\u0026ndash;E922 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuti\u0026eacute;rrez, R. M. P., G\u0026oacute;mez, J. T., Urby, R. B., Soto, J. G. C. \u0026amp; Parra, H. R. Evaluation of Diabetes Effects of Selenium Nanoparticles Synthesized from a Mixture of Luteolin and Diosmin on Streptozotocin-Induced Type 2 Diabetes in Mice. Molecules 27, (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai, X. et al. Dosage-effect of selenium supplementation on blood glucose and oxidative stress in type 2 diabetes mellitus and normal mice. Journal of Trace Elements in Medicine and Biology 83, 127410 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY\u0026ouml;n, B., Belviranlı, M. \u0026amp; Okudan, N. The effect of silymarin supplementation on cognitive impairment induced by diabetes in rats. J Basic Clin Physiol Pharmacol 30, 20180109 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSamy, D. M., Ismail, C. A. \u0026amp; Nassra, R. A. Circulating irisin concentrations in rat models of thyroid dysfunction\u0026mdash;effect of exercise. Metabolism 64, 804\u0026ndash;813 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAzimi, M., Gharakhanlou, R., Naghdi, N., Khodadadi, D. \u0026amp; Heysieattalab, S. Moderate treadmill exercise ameliorates amyloid-β-induced learning and memory impairment, possibly via increasing AMPK activity and up-regulation of the PGC-1α/FNDC5/BDNF pathway. Peptides (N.Y.) 102, 78\u0026ndash;88 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeidarianpour, A., Mohammadi, F., Keshvari, M. \u0026amp; Mirazi, N. Ameliorative effects of endurance training and Matricaria chamomilla flowers hydroethanolic extract on cognitive deficit in type 2 diabetes rats. Biomedicine \u0026amp; Pharmacotherapy 135, 111230 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, F. et al. Association of Dietary Selenium Intake with Type 2 Diabetes in Middle-Aged and Older Adults in China. Nutrients 16, 2367 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan, X. et al. A cross-sectional study of blood selenium concentration and cognitive function in elderly Americans: National Health and Nutrition Examination Survey 2011\u0026ndash;2014. Ann Hum Biol 47, 610\u0026ndash;619 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHadrup, N. \u0026amp; Ravn-Haren, G. Toxicity of repeated oral intake of organic selenium, inorganic selenium, and selenium nanoparticles: A review. Journal of Trace Elements in Medicine and Biology 79, 127235 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHadrup, N. et al. Subacute oral toxicity investigation of selenium nanoparticles and selenite in rats. Drug Chem Toxicol 42, 76\u0026ndash;83 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOrumiyehei, A. et al. High-Intensity Interval Training-Induced Hippocampal Molecular Changes Associated with Improvement in Anxiety-like Behavior but Not Cognitive Function in Rats with Type 2 Diabetes. Brain Sci 12, (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVorhees, C. V. \u0026amp; Williams, M. T. Morris water maze: Procedures for assessing spatial and related forms of learning and memory. Nat Protoc 1, 848\u0026ndash;858 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBromley-Brits, K., Deng, Y. \u0026amp; Song, W. Morris water maze test for learning and memory deficits in Alzheimer\u0026rsquo;s disease model mice. J Vis Exp \u003cb\u003e2920\u003c/b\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOthman, M. Z., Hassan, Z. \u0026amp; Has, A. T. C. Morris water maze: a versatile and pertinent tool for assessing spatial learning and memory. Exp Anim 71, 264\u0026ndash;280 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFreitas, D. A. et al. High-intensity interval training improves cerebellar antioxidant capacity without affecting cognitive functions in rats. Behavioural brain research 376, 112181 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, K. et al. The effects of high-intensity interval training on cognitive performance: a systematic review and meta-analysis. Sci Rep 14, 32082 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurovsky, E. A. et al. Features of the cytoprotective effect of selenium nanoparticles on primary cortical neurons and astrocytes during oxygen\u0026ndash;glucose deprivation and reoxygenation. Sci Rep 12, 1710 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePradhan, S. P., Behera, A. \u0026amp; Sahu, P. K. Effect of selenium nanoparticles conjugated vildagliptin on cognitive dysfunction associated with diabetes mellitus. J Drug Deliv Sci Technol 22, 105907 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, S. S. et al. Exercise training and selenium or a combined treatment ameliorates aberrant expression of glucose and lactate metabolic proteins in skeletal muscle in a rodent model of diabetes. Nutr Res Pract 5, 205\u0026ndash;213 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKartinah, N. T. et al. High-intensity interval training increases AMPK and GLUT4 expressions via FGF21 in skeletal muscles of diabetic rats. Journal of Advanced Biotechnology and Experimental Therapeutics 7, 136\u0026ndash;146 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChavanelle, V. et al. Effects of high-intensity interval training and moderate-intensity continuous training on glycaemic control and skeletal muscle mitochondrial function in db/db mice. Sci Rep 7, 204 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCunha, V. N. et al. Role of exercise intensity on GLUT4 content, aerobic fitness and fasting plasma glucose in type 2 diabetic mice. Cell Biochem Funct 33, 435\u0026ndash;442 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeepa, T., Mohan, S. \u0026amp; Manimaran, P. A crucial role of selenium nanoparticles for future perspectives. Results Chem 4, 100367 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarahap, H. S. et al. The Effect Of Glut4 Expression In Hippocampal Neurons To Spatial Memory Of Diabetes-Induced Rattus Novergicus. MNJ (Malang Neurology Journal) 7, 114\u0026ndash;119 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIslam, M. R. et al. Exercise hormone irisin is a critical regulator of cognitive function. Nat Metab 3, 1058\u0026ndash;1070 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSousa, R. A. L., De, Improta-Caria, A. C. \u0026amp; de Souza, B. S. F. Exercise\u0026ndash;linked irisin: Consequences on mental and cardiovascular health in type 2 diabetes. Int J Mol Sci 22, 2199 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin, Y. et al. Molecular and functional interaction of the myokine irisin with physical exercise and Alzheimer\u0026rsquo;s disease. Molecules 23, 3229 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArabzadeh, E. et al. Treadmill exercise with nanoselenium supplementation affects the expression of Irisin/FNDC5 and semaphorin 3A in rats exposed to cigarette smoke extract. 3 Biotech 14, 4 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark, J., Kim, J. \u0026amp; Mikami, T. Exercise hormone irisin prevents physical inactivity-induced cognitive decline in mice. Behavioural Brain Research 433, (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePesce, M. et al. From exercise to cognitive performance: role of irisin. Applied Sciences 11, 7120 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMadhu, L. N., Somayaji, Y. \u0026amp; Shetty, A. K. Promise of irisin to attenuate cognitive dysfunction in aging and Alzheimer\u0026rsquo;s disease. Ageing Res Rev 78, 101637 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGamal, M., Tork, O., Eshra, M., Magdy, S. \u0026amp; Rashed, L. Role of endogenous irisin, a novel myokine, in cognitive functions and insulin sensitivity in exercised diabetic rats. Kasr Al Ainy Medical Journal 22, 136 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGholamigeravand, B. et al. Synergistic effects of adipose-derived mesenchymal stem cells and selenium nanoparticles on streptozotocin-induced memory impairment in the rat. Life Sci 272, 119246 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHashemi-Firouzi, N. et al. The effects of polyvinyl alcohol-coated selenium nanoparticles on memory impairment in rats. Metab Brain Dis 37, 3011\u0026ndash;3021 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiao, L., Chen, Y., Dou, X., Song, X. \u0026amp; Xu, C. Biogenic selenium nanoparticles attenuate aβ25\u0026ndash;35-induced toxicity in PC12 cells via Akt/CREB/BDNF signaling pathway. Neurotox Res 40, 1869\u0026ndash;1881 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlackmore, D. G. et al. Long-term improvement in hippocampal-dependent learning ability in healthy, aged individuals following high intensity interval training. Aging Dis (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsai, C. L. et al. Acute effects of high-intensity interval training and moderate-intensity continuous exercise on BDNF and irisin levels and neurocognitive performance in late middle-aged and older adults. Behavioural brain research 413, 113472 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJung, B. K. \u0026amp; Kim, K. Effects of 12 Weeks of Moderate-intensity Continuous Exercise and High-intensity Interval Exercise on Cognitive Function in Elderly Subjects. The Asian Journal of Kinesiology 26, 48\u0026ndash;58 (2024).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Diabetes Mellitus, Type 2, Hippocampus, Cognition, High-Intensity Interval Training, Selenium, Neuroprotective Agents","lastPublishedDoi":"10.21203/rs.3.rs-5723589/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5723589/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCognitive decline is a common complication of diabetes, and is inadequately addressed by current treatments. This study examined the effects of selenium nanoparticles (SeNPs) and high-intensity interval training (HIIT) on cognitive function and neuroprotection in diabetic rats. Male Wistar rats (n\u0026thinsp;=\u0026thinsp;31) were induced with diabetes and assigned to five groups entered into 8 weeks intervention: control (CO), control which receive placebo (PCO), SeNPs treatment (0.1 mg/kg) (SeNPs), HIIT (HIIT), and combined SeNPs with HIIT (SeNPs\u0026thinsp;+\u0026thinsp;HIIT). Cognitive function was assessed using the Morris water maze test. Hippocampal tissues were analysed for cell viability, gene expression of BDNF, GLUT4, and Irisin receptor, as well as serum protein levels of Irisin and hippocampal BDNF protein level. Results showed that all treatment groups had a significant effect on learning, memory, cell viability, GLUT4, BDNF and irisin (P\u0026thinsp;\u0026lt;\u0026thinsp;0.03). Serum Irisin was higher in HIIT and SeNPs\u0026thinsp;+\u0026thinsp;HIIT groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), also SeNPs and SeNPs\u0026thinsp;+\u0026thinsp;HIIT groups showed increased GLUT4 expression (P\u0026thinsp;\u0026lt;\u0026thinsp;0.03). SeNPs\u0026thinsp;+\u0026thinsp;HIIT groups had the significant effect on BDNF both gene and protein compared to the all control (CO, PCO) groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). These findings suggest that combining SeNPs and HIIT may mitigate cognitive decline and promote neuroprotection in diabetes via modulation of Irisin and BDNF pathways and improved glucose metabolism. While synergy is suggested, mechanistic confirmation requires further study. Translational potential exists, but clinical validation is needed due to species differences. Limitations include unmonitored confounders, sample size, and lack of mechanistic validation, highlighting the need for future research.\u003c/p\u003e","manuscriptTitle":"Enhancing Cognitive Function in Diabetic Rats: The Role of Exercise and Selenium Nanoparticles in Hippocampal Protection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-30 18:58:08","doi":"10.21203/rs.3.rs-5723589/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-05-21T10:57:52+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-15T07:33:42+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-12T04:32:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"71878171560385112484630845721636428256","date":"2025-04-30T14:16:47+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"27794216443600343819796487026352797257","date":"2025-04-29T10:01:52+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-29T08:27:13+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-28T16:23:08+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-04-11T17:45:29+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f2672477-402f-4932-a47d-ba46fc4a470d","owner":[],"postedDate":"April 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":47843308,"name":"Biological sciences/Biotechnology"},{"id":47843309,"name":"Biological sciences/Neuroscience"},{"id":47843310,"name":"Biological sciences/Physiology"},{"id":47843311,"name":"Health sciences/Diseases"}],"tags":[],"updatedAt":"2025-07-07T16:20:15+00:00","versionOfRecord":{"articleIdentity":"rs-5723589","link":"https://doi.org/10.1038/s41598-025-07441-4","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-07-01 15:58:11","publishedOnDateReadable":"July 1st, 2025"},"versionCreatedAt":"2025-04-30 18:58:08","video":"","vorDoi":"10.1038/s41598-025-07441-4","vorDoiUrl":"https://doi.org/10.1038/s41598-025-07441-4","workflowStages":[]},"version":"v1","identity":"rs-5723589","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5723589","identity":"rs-5723589","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.