Sugarcane streak mosaic virus: distribution, prevalence and severity in the integrated farming units of Zuénoula and Borotou-Koro, Côte d'Ivoire

Sugarcane streak mosaic virus: distribution, prevalence and severity in the integrated farming units of Zuénoula and Borotou-Koro, Côte d'Ivoire | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Sugarcane streak mosaic virus: distribution, prevalence and severity in the integrated farming units of Zuénoula and Borotou-Koro, Côte d'Ivoire Migninlbin Marcel OUATTARA, Konan Didier KOUAME, Cécile DESBIEZ, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4109330/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 17 Sep, 2024 Read the published version in European Journal of Plant Pathology → Version 1 posted 5 You are reading this latest preprint version Abstract Sugarcane streak mosaic is an emerging viral disease caused by sugarcane streak mosaic virus (SCSMV) recently reported in Ivorian sugar production areas. A 5-year study was performed to determine the spatial distribution, incidence and severity of SCSMV on commercial varieties in two of the three sugarcane production basins of Côte d'Ivoire. In Zuénoula, 104 plots were evaluated between 2018 and 2021. In Borotou-Koro, 72 plots were evaluated between 2019 and 2022. Disease prevalence and severity were assessed using a 0 to 4 rating scale based on the percentage of symptomatic leaf area. In Zuénoula, overall disease prevalence was 98% in 2018, 100% in 2020 and 98% in 2021. Varieties M1400/86, M2593/92, R570 and SP711406 were monitored during the three years. M1400/86 and M2593/92 showed a moderately susceptible profile, whereas R570 was susceptible to moderately susceptible and SP711406 was susceptible. In Borotou-Koro, overall disease prevalence was 21% in 2019, 48% in 2020 and 61% in 2022. Varieties Co449, M1400/86, R570 and SP711406 were monitored during the three years. Co449 remained moderately susceptible throughout the monitoring, while M1400/86, R570 and SP711406 moved from partially resistant to moderately susceptible. This study showed that SCSMV is highly prevalent in the Zuénoula sugar complex and is rapidly evolving in the Borotou-Koro complex. In this epidemic context, varieties showed either a stable or increasing susceptibility profile. In vitro regeneration permitted significant reduction in prevalence and severity but efforts must be maintained to achieve higher levels of resistance. Côte d'Ivoire prevalence spatial distribution sugarcane streak mosaic virus severity sugarcane Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 INTRODUCTION Sugarcane cultivation has played an important role in Côte d'Ivoire's economy since its expansion in the 1970s. It is produced on an area of 25,400 ha in four agro-industrial complexes located in Borotou-Koro (North-West), Ferkessédougou (Ferké 1 and Ferké 2, North) and Zuénoula (Centre) (MINADER, 2019 ). These complexes are specialized in the industrial production and processing of sugarcane. In addition, there are also small sugarcane farms around the large plantations. National sugar production is estimated at over 214,000 t/year, representing 3.3% of agricultural Gross Domestic Product (GDP), or 1% of national GDP and providing over 10,000 employments (FAO, 2019 ). The dynamism of this sector has enabled Côte d'Ivoire to have the leading sugar industry in the UEMOA (West African Monetary and Economic Union) zone (MINADER, 2019 ). Numerous biological constraints, including pests and diseases, contribute to limiting sugarcane production. Eldana saccharina is the main sugarcane stem-boring insect in Côte d’Ivoire (Kouamé et al., 2010 ). Sugarcane smut ( Sporisorium scitamineum ) and rust ( Puccinia kuehnii ) are the main fungal diseases of sugarcane (Bhuiyan, 2021). Scald ( Xanthomonas albilineans ) is the main bacterial disease (N’guessan et al., 2019 ). Viral diseases include yellow leaf syndrome, characterized by varying degrees of vein yellowing caused by sugarcane yellow leaf virus (SCYLV, luteovirus) (Holkar et al., 2020 ) and sugarcane mosaic. Several viruses cause sugarcane mosaic disease (Lu et al., 2021 ): sugarcane mild mosaic virus (SCMMV), sugarcane striate mosaic associated virus (SCMaV), sugarcane mosaic virus (SCMV), sorghum mosaic virus (SrMV) and sugarcane streak mosaic virus (SCSMV). Among these viral diseases, streak mosaic of sugarcane caused by SCSMV is one of the most damaging. The first report of streak mosaic virus was made by Hall et al. ( 1998 ) from quarantined germplasm imported from Pakistan to the USA and showing mosaic symptoms. Subsequently, the virus has also been reported in most Asian countries such as Bangladesh, India, Indonesia, Iran, Sri Lanka, Thailand, Vietnam and China (Hema et al., 2002 ; Kasemsin et al., 2016 ; Putra et al., 2014 ; Xu et al., 2010 ; Moradi et al., 2015 ; Moradi et al., 2018 ; Zhang et al., 2018 ). SCSMV is a Poacevirus in the Potyviridae family (Li et al., 2011 ). The natural hosts of SCSMV are plants belonging to the Poaceae family, including sugarcane, maize and sorghum (Srinivas et al., 2010 ; Fu et al., 2015 ). Putra et al. ( 2014 ) have shown that this virus can cause yield losses in sugarcane tonnage and sugar of 16–17% and 19–22% respectively in Indonesia. SCSMV has been described mainly in Asian countries but was recently discovered in sugar complexes in Côte d'Ivoire, West Africa (Sorho et al., 2020 ; Daugrois et al., 2020 ; Lu et al., 2021 ). In order to evaluate the threat this emerging virus could pose to the Ivorian sugar industry, an extensive study was initiated within two sugar complexes in Côte d'Ivoire. The objectives were to assess the spatial distribution, prevalence and severity of SCSMV, as well as the level of susceptibility of the sugarcane varieties grown in these complexes. MATERIALS AND METHODS Study areas The study was carried out on SUCRIVOIRE's Integrated Agricultural Units (IAU) located in Zuénoula and Borotou-Koro. In Zuénoula, the study was carried out from October 2018 to October 2021 and in Borotou-Koro, the study was carried out from November 2019 to April 2022. The Zuénoula IAU covers an area of 11,000 hectares, including 6,223 hectares of industrial plantations, either irrigated (pivots) or rainfed between latitudes 7°30 and 7°40 North and longitudes 6°5 and 6°15 West. It is located in a transition zone (Forest-Savannah), with an equatorial and subtropical climate. The Borotou-Koro IAU covers an area of 9,702 hectares industrial plantations (irrigated or rainfed) between latitudes 8°20 and 8°40 North, and longitudes 7°5 and 7°15 West. It belongs to the sub-Sudanese zone, with a humid tropical Sudano-Guinean climate. Plant material The evaluation of the spatial distribution, prevalence and severity of SCSMV was carried out at three periods on sugarcane plots that were between 3 and 8 months old. For Zuénoula, the first period took place between February and October 2018 on 9 commercial varieties (55 irrigated plots and 12 rainfed plots), the second in October 2020 on 6 commercial varieties (21 irrigated plots and 1 rainfed plot) and the third in October 2021 on 12 commercial varieties (18 irrigated plots and 7 rainfed plots). For Borotou-Koro, the first period took place between October and November 2019 on 8 commercial varieties (21 irrigated plots and 6 rainfed plots), the second in October 2020 on 8 commercial varieties (16 irrigated plots and 6 rainfed plots) and the third from March to April 2022 on 10 commercial varieties (20 irrigated plots and 3 rainfed plots). These varieties were of diverse origins (Table 1 ). Selected plots represented the crop age range (virgin crop established from cuttings from nurseries to 5-cycle regrown crops). Table 1 Sugarcane varieties evaluated for SCSMV susceptibility between 2018 and 2022 in Zuénoula and Borotou-Koro Zuénoula Number of plots Borotou-Koro Number of plots Cultivar Origin Year of probable introduction in CI 2018 2020 2021 2019 2020 2022 Co449 Coimbatore (India) 1963 2 4 3 1 Co997 Coimbatore (India) 1981 10 4 4 3 FR8783 Guadeloupe 2019 2 M1176/77 Mauritius 2015 4 4 3 M1954/91 Mauritius 2015 1 3 M1400/86 Mauritius 2015 4 4 4 2 3 3 M2580/95 Mauritius 2015 2 1 1 M2593/92 Mauritius 2015 6 4 1 R570 Reunion Island 1988 20 4 3 4 3 3 R579 Reunion Island 1994 7 3 3 R93/0136 Reunion Island 2019 2 4 R96/2116 Reunion Island 2019 2 R96/2569 Reunion Island 2019 1 R97/0391 Reunion Island 2019 2 2 R98/4001 Reunion Island 2019 1 R98/4158 Reunion Island 2019 3 1 RB725147 Brazil 1987 2 SP711406 Sao Polo (Brazil) 1987 12 4 2 4 3 3 SP711406Rég* Sao Polo (Brazil) 2021 1 3 Diverse** 1 Total 67 22 25 27 22 23 * variety regenerated by in vitro culture ** nursery with several sugarcane varieties Assessment of symptoms The size of the rainfed plots at both sites ranged from 1 to 30 hectares, and that of the quarter pivot plots from 12 to 36 hectares. A M-type device with 5 microplots (quadrats) per plot was adopted for symptom assessment (Fig. 1 ). Each quadrat was 100 m 2 (10 m x 10 m) with 7 rows. Observations were made on 30 sugarcane plants randomly selected over 10 m for each of the 7 rows, for a total of 210 plants per quadrat and 1,050 plants per plot. A severity score (Si, i∈[0 ;4]) was assigned to each plant based on the percentage of symptomatic leaf area of leaf N°3 extended from the apex using a scoring scale adapted from Putra et al. (Fig. 2 ; Table 2 ). Mean prevalence (P) and mean severity (S) were calculated per quadrat and per plot with the following formulas: Table 2 Rating scale used to assess the severity of SCSMV in sugarcane plots in Zuénoula and Borotou-Koro Severity score (Si) % of leaf area with symptoms Characteristics 0 0 Apparently healthy plant (a variety is highly resistant if S = 0) 1 1–10% Slight presence of mottling or streaking on the plant (a variety is partially resistant if S∈ [0.01; 1]) 2 11–30% Moderate presence of mottling or streaking on the plant (a variety is moderately susceptible if S∈ [1.01; 2]) 3 31–50% Strong presence of mottling or streaking, stunting of leaves, plant continues to grow (a variety is susceptible if S∈ [2.01; 3]) 4 51–100% Heavy mottling or streaking, stunting of leaves and/or plant, plant no longer growing or dead (a variety is highly susceptible if S∈ [3.01; 4]) with Si the severity score, Ni the number of plants with severity score Si in the area unit considered (quadrat or plot), N the number of plants observed per area unit considered (quadrat or plot). Maps of spatial distribution of SCSMV were established based on the prevalence of SCSMV with the following categories: Healthy (P = 0%), Low (0% < P ≤ 10%), Moderate (10% < P ≤ 70%) and High (70% < P ≤ 100%). Sampling method and sample conditioning The calculations of mean prevalence presented previously are only reliable if the score 0 (absence of symptoms) assigned based on visual observation corresponds to an absence of disease. For 8 of the 22 plots assessed in 2020 in Borotou-Koro, visual scoring on leaf N°3 was coupled with leaf testing for SCSMV infection by RT-PCR. Three to four samples were taken from each of the 5 ‘’M’’ quadrats, for a total of 147 samples tested in the laboratory. To assess the impact of sample dehydration and conditioning methods on the detection of SCSMV by RT-PCR, all samples were dehydrated and conditioned in duplicate using two different methods. 1) calcium chloride dehydration (CCD) according to the method of Bos ( 1969 ): a 6.5g leaf subsample was finely chopped with a single-use razor blade and packaged in an absorbent paper pad inserted in a jar containing 3.5g calcium chloride (CaCl2), hermetically sealed and stored at 4°C; 2) hot-air dehydration (HAD): sampled leaves were roughly cut into strips, packed in kraft paper envelopes and oven-dried at 30°C for 48 hours in the laboratory. Molecular detection of SCSMV Total RNA extraction Samples were prepared in individual extraction bags (Bioreba): 0.3 g dehydrated leaves were rehydrated in 4 mL phosphate solution (Na 2 HPO 4 12H 20 0.03M, DIECA 0.2%) for 2 h at 4°C before grinding. Two more ml of phosphate solution were added to the extraction bag after grinding. A 250 µL aliquot of crude extract was collected and stored at -20°C until use. Total RNAs were extracted with Tri-reagent (Molecular Research Center, Cincinnati, OH) with some modifications of the manufacturer’s protocol. A 500 µL volume of Tri-reagent was added to the 250 µL sample, homogenized by vortexing for 2–3 s and left for 5 min at room temperature. Next, 100 µL of chloroform was added to each tube, homogenized by vortexing and left for 10 min at room temperature. The tubes were centrifuged at 4°C, 14,000 rpm, for 10 min. At the end of the first centrifugation, 450 µL of the upper aqueous phase was removed from each tube and added to 150 µL of isopropanol and 150 µL of sodium acetate (3M pH 5,2). After precipitation at -20°C for at least 30 min, a second centrifugation was performed at 4°C, 14,000 rpm for 15 min. The pellet was washed with 500 µL of 70% ethanol. After centrifugation at 4°C, 14,000 rpm for 5 min, the supernatant was discarded and the pellet was resuspended in 20 µL of RNAse-free distilled water and stored at -20°C. Amplification of viral RNAs by RT-PCR The fifteen complete nucleotide sequences of SCSMV available in GenBank and belonging to the two major molecular groups known for this virus (Kasemsin et al., 2016 ) were downloaded and aligned with ClustalW included in MEGA6: KJ187047- KJ187048 KJ187049, JF488066, JF488064, JF488065, JN163911, JN941985, GQ246187, GQ388116, KX430771, KX430772, KX823354, KX823355, KX823356 (Fig. 3 ). Primers were chosen on either side of the N-terminal region of the capsid, in regions as conserved as possible between all the sequences: SCSMV-9280-R CCACTTGTACGCCAATTCGCC and SCSMV-8450-F CCAAARCTATCACGAGAACG, the names of the primers indicating their position in the genome, yielding an expected 830-nt fragment (fig S1 ). RNAs were denatured by adding 8 µl of sterile water to 2 µl of total RNA and heating at 80°C for 3 min. Fifteen µl of RT-PCR mix were added to each tube of 10 µl denatured RNA to obtain a total reaction volume of 25 µl, with a final composition of 1X RT-PCR buffer (Sigma), 1.5 mM MgCl2, 0.25 mM dNTPs, 0.5 µM of each primer, 2.5 U of M-MLV reverse transcriptase (Promega), 2.5 U of Taq hot Start (Promega). One-step RT-PCR was performed with a reverse transcription (RT) at 42°C for 1 h, denaturation at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, primer hybridization at 60°C for 30 s, elongation at 72°C for 50 s and final elongation at 72°C for 10 min. Next, 2.5 µl of the products obtained from each RT-PCR tube were analyzed on a 1.5% electrophoresis agarose gel. Statistical analysis Statistical analyses were performed using SATISTICA 7.1 and XLSTAT 2016 in EXCEL. A Shapiro-wik normality test was performed for the variables prevalence and severity of the different sugarcane varieties. The test showed that both variables follow the normal distribution. An analysis of variance was applied to these data, and the comparison of means was carried out using the Newman-Keuls test (post-hoc ANOVA) at the 5% significance level. Distribution maps of sugarcane streak mosaic prevalence were produced using ArcMap 10.8 software, at a scale of 1:80,000 for maps of the Zuénoula IAU and 1:100,000 for maps of the Borotou-Koro IAU. RESULTS Spatial distribution and overall SCSMV prevalence in Zuénoula Symptoms were widespread on all cane plots (nurseries, industrial plots) in the three sectors of the Zuénoula IAU. All varieties evaluated showed typical sugarcane streak mosaic symptoms. Streaks were distributed over the entire leaf surface and tended to be more diffuse on older leaves. For varieties Co449, M1400/86, M2593/92, R570, SP711406Rég, M1954/91, R98/4001, R98/4158, R96/2569, R97/0391 and R93/0136 symptoms were very visible on the five youngest leaves and less visible on the older leaves. For Co997, M1176/77, M2580/95, R96/2116 and R579, symptoms were visible on almost all leaves and generally at the same intensity. For Co997, R579 and SP711406, some plants were severely stunted with leaf yellowing and shortened internodes (Fig. 4 ). In 2018, the overall prevalence of sugarcane streak mosaic symptoms was 98%. Mean prevalences were 100% for 60/67 plots (high) and below 70% (moderate) for 7/67 plots (Fig. 5 a). In 2020, prevalence was 100% (high) in all observed plots (Fig. 5 b). In 2021, overall prevalence was 98%. Mean prevalences were 100% (high) for 18/22 plots and below 70% (moderate) for 4/22 plots (Fig. 5 c). Mean prevalence and severity of SCSMV on sugarcane varieties in Zuénoula In 2018, mean prevalences were very high (98–100%) for 8 of the 9 varieties assessed (Fig. 6 a). Only variety M2593/92 had a significantly lower prevalence than the others (85% ; P < 0.005). Mean severity was high for M2580/95, Co997, R579, M1176/77, SP711406 and Co449 (susceptible). The mean severity of varieties R570, M1400/86 and M2593/92 was significantly lower than the previous ones, they were partially susceptible (Fig. 6 b). In 2020, only 6 sugarcane varieties were evaluated. Some varieties were excluded from the industrial plots due to their high susceptibility to SCSMV. Mean prevalence was 100% for all 6 varieties tested (Fig. 7 a). Mean severity was high for Co997, SP711406 and R570. The mean severities of varieties M1400/86, M2593/92 and M1954/91 were lower although the difference with SP711406 and R570 was not significant for M1400/86 and M2593/92 (Fig. 7 b). In 2021, 12 sugarcane varieties were evaluated. New varieties were introduced in industrial plots and one variety was regenerated. Mean prevalences were very high for all varieties assessed: 100% for 5 varieties and 77–99% for 7 varieties (Fig. 8 a). Mean severity was high for SP71106 and R96/2116. The mean severities of varieties R570, M1400/86, R97/0391, SP711406Rég (regenerated), M1954/91, M2593/92, R96/2569, R98/4158 and R98/4001 were lower than the previous ones but the difference was not always significant (Fig. 8 b). The in vitro regenerated variety SP711406Reg showed a significant reduction in prevalence (-22%) and severity (-45%) compared to its parent variety. SP711406, M1400/86, M2593/92 and R570 were monitored during the three years. SP711406 showed a susceptible profile during the three years: prevalence was 100% and severity was consistently higher than 2. R570 showed a susceptible to moderately susceptible profile: prevalence was 100% and severity was close to 2. M1400/86 and M2593/92 showed a moderately susceptible profile: prevalence was higher than 80% and severity was between 1 and 2. Spatial distribution and overall prevalence of SCSMV in Borotou-Koro All varieties evaluated showed typical sugarcane streak mosaic symptoms. Streaks were distributed over the entire leaf surface and tended to be more diffuse on older leaves. For varieties Co449, M1400/86, R570, SP711406Rég, R98/4158, R97/0391, R93/0136, RB725147 and FR8783, symptoms were very visible on the five youngest leaves and less visible on the older leaves. For Co997, M1176/77, M2580/95 and R579, symptoms were visible on almost all leaves and generally at the same intensity. In 2019, the overall prevalence of the disease was 21%. The spatial distribution of the disease presented a disparity between sectors: high prevalences (around 100%) for 4 plots exclusively located in sector E, composed solely of rainfed plots. Prevalences in the other sectors (B, C, D) were moderate for 9 plots (10–50%) and low for 14 plots (Fig. 9 a). In 2020, the overall prevalence of sugarcane streak mosaic was 48%, with high prevalences for 3 plots in sector E and moderate to low prevalences in sectors B, C and D (Fig. 9 b). In 2022, overall prevalence was 61%. Sugarcane streak mosaic was distributed across all sectors, with high prevalences in all sectors, moderate prevalences only in sectors B and C and low prevalences restricted to sector D (Fig. 9 c). Mean prevalence and severity of SCSMV in sugarcane varieties in Borotou-Koro In 2019, the highest mean prevalence was recorded for Co449 (54%). Varieties SP711406, R579, RB725147, M1400/86 and M1176/77 showed significantly lower prevalences with 13%, 11%, 10%, 8% and 3% respectively (Fig. 10 a). The mean severity of Co449 was 1.29, while that of varieties Co997, R570, SP711406, M1400/86, RB725147 and M1176/77 was 0.75, 0.57, 0.22, 0.15, 0.13 and 0.06 respectively (Fig. 10 b). In 2020, the prevalences of varieties Co449, SP711406, Co997, R570, M2580/95, R579, and M1176/77 were 45–60%. Disease prevalence was significantly lower in M11400/86, at 25% (Fig. 11 a). The mean SCSMV severities of varieties Co449, SP711406, M2580/95, Co997, R579, R570 were 2.01, 1.85, 1.85, 1.75, 1.58, 1.48 respectively. Mean severity was significantly lower on varieties M1176/77 (0.98) and M1400/86 (0.46) (Fig. 11 b). In 2022, 10 sugarcane varieties were evaluated. Mean prevalences exceeded 80% on varieties R93/0136, Co449, R97/0391, M1400/86, R570. M2580/95, SP711406, R98/4158, FR8783 and SP711406Rég showed significantly lower prevalences with respectively 65%, 46%, 23%, 17%, 12%. (Fig. 12 a). Mean severities of varieties R93/0136, M1400/86, M2580/95, R570, R97/0391, Co449, SP711406 was 1.45, 1.44, 1.41, 1.40, 1.38, 1.20, 1.13 respectively. Mean severity was significantly lower on FR8783, R98/418, SP711406Rég than on the previous varieties, with 0.32, 0.24, 0.23 respectively (Fig. 12 b). The in vitro regenerated variety SP711406Reg showed a significant reduction in prevalence (-75%) and severity (-80%) compared to its parent variety. A follow-up was carried out on the following 4 varieties: Co449, R570, SP711406 and M1400/86, that were planted during the 3 years of surveys. For these 4 varieties, prevalence increased considerably over time, with the exception of SP711406 whose prevalence decreased slightly in the third year of evaluation. The same was true for mean severity, with the exception of Co449, whose severity dit not change considerably the 3rd year of evaluation. Virus detection as a function of sample storage type and severity score Both CCD and HAD conditioning methods enabled amplification of SCSMV (Fig. S2 ,). For asymptomatic samples (severity score = 0), no amplification was observed whatever the type of sample storage (Table 3 ). For symptomatic samples (severity score > 0), the molecular detection method developed enabled amplification in 88% of cases. For score 1, the percentage of detection was 80% and 60% for CCD and HAD dehydration respectively, but the number of samples tested was low. The percentage of detection was over 90% from score 2 onwards, whatever the type of sample storage. Table 3 SCSMV detection from samples varying in severity score and dehydration technique: chloride dehydration (CCD) and hot-air dehydration (HAD) Severity score Nb of plants sampled (duplicates) Nb of amplifications after CCD Nb of amplifications after HAD % detection after CCD % detection after HAD 0 9 0 0 0 0 1 5 4 3 80 60 2 32 30 32 94 100 3 77 70 74 91 96 4 24 24 23 100 96 Total 147 127 131 DISCUSSION This 5-year study provides a detailed assessment of the evolution of the prevalence and severity of SCSMV in two of the three sugarcane production basins of Côte d'Ivoire. The assessment was based on a visual assessment of the presence and intensity of foliar symptoms. A molecular detection test targeting SCSMV was developed and implemented on samples of varying severity. The asymptomatic samples (severity score = 0) were never amplified, confirming that the visual assessment of leaf symptoms is a reliable proxi of the sanitary status of the plant: a plant with a severity score of 0 can be considered healthy with confidence. This information is particularly important for epidemiological surveillance and prophylaxis management in nurseries in case of introduction and evaluation of new sugarcane varieties or on-site multiplication for planting new plots. Indeed Putra et al. ( 2015 ) showed that to avoid increased spread of SCSMV, the use of virus-free plant material is recommended. For symptomatic plants (severity score > 0), molecular detection was function of the intensity of foliar symptoms with a minimum probability of 90% of detecting SCSMV when the severity score was greater than 1. Low detection efficiency obtained for samples with a severity score of 1 could be explained by a lower viral titer in the plants associated to a greater degradation of the viral RNA during storage and/or non-optimal specificity of the primers. Regarding the conditioning method, hot-air dehydration and calcium chloride dehydration were found to be equally effective. This result allows us to prioritize the hot-air dehydration method for future studies because it is easier and faster to implement. The epidemiological situation of sugarcane streak mosaic was very different in the two sites monitored. In Zuénoula, the overall prevalence was extremely high (> 98%) throughout monitoring. The virus was widespread in the three sectors of this site with moderate to high mean prevalences in the plots, which confirms the build-up of strong viral pressure since its first observation in 2015 by Kouamé (pers. comm.). Conversely, in Borotou-Koro, the epidemiological situation evolved gradually throughout monitoring: the overall prevalence was 21% in 2019, 48% in 2020 and 61% in 2022. Sector E, made up entirely of rainfed plots, was the most attacked sector. This could be explained by the multiplication of susceptible varieties in this sector, such as Co449 and Co997. Krishna et al. ( 2023 ) showed recently that Co449 and Co997 are varieties susceptible to sugarcane streak mosaic virus. These results corroborate those of Putra et al. ( 2014 ) who showed in Indonesia that SCSMV spread rapidly due to the extension and planting of the highly susceptible variety PS 864, and that the prevalence increased from 0.44–86.75% between 2007 and 2011. Putra et al. ( 2014 ) also showed that the rapid distribution of SCSMV in fields can be facilitated by mechanical transmission with knives during plantation preparation or harvest. Nineteen varieties of sugarcane from various origins were evaluated during the study. Their sensitivity to SCSMV was assessed using a severity scale and the distinct epidemiological situations between the two sites made it possible to test their behaviour in contrasting contexts. In Zuénoula, the varieties M2580/95, Co997, R579, M1176/77, SP711406 and Co449 were the most susceptible, with mean severities greater than 2. The variety SP711406 was susceptible throughout the three years of evaluation. Varieties M1400/86 and M2593/92 remained in the moderately susceptible range (1 ≤ S < 2) throughout the three years of evaluation, while variety R570 was classified as either susceptible or moderately susceptible depending on the year of assessment. In Borotou-Koro, four varieties were monitored throughout the three years of evaluation: Co449, M1400/86, R570 and SP711406. Co449 remained in the moderately susceptible range (1 ≤ S < 2) throughout the three years of evaluation, while M1400/86, R570 and SP711406 moved from partially resistant (0.1 ≤ S < 1) to moderately susceptible (1 ≤ S < 2) during the study. This shows that as disease prevalence increases, disease severity in these varieties also increases. On both sites, the in vitro regenerated variety SP711406Reg showed a significant reduction in prevalence and severity compared to its parent variety but was not completely virus-free, demonstrating that in vitro cultivation is a means of reducing risk but does not eliminate it. Either the in vitro regeneration did not completely eliminate the virus (Lu et al., 2021 ; Cheong et al., 2012 ; Subba et al., 2011), or the recontamination was quick during the growing season. On both sites, SP711406Reg was tested only during the last year of the survey, so there is no information about the evolution of virus prevalence and severity after several years of field multiplication. In vitro culture is an efficient way to reduce virus prevalence (Lu et al., 2021 , Subba et al., 2011). It can be associated with the use of partially or highly resistant varieties. Indeed, the rational selection and distribution of disease-resistant varieties are the most economical and effective prevention and control measures against viruses (Lu et al., 2021 ). Declarations Acknowledgments We would like to thank the Center of excellence on Climate Change, Biodiversity and Sustainable Agriculture of Félix Houphouët-Boigny University, for its support and collaboration with the company SUCRIVOIRE through agreement number 3004_2019, which allowed us to carry out this field work. We would like to thank the plant pathology unit of INRAE, Avignon (France), where the molecular analysis work was carried out, for its technical facilities and financial support. We would also like to thank the French Embassy in Côte d'Ivoire and the Campus France agency for granting us a mobility grant for our thesis, which also allowed us to carry out this work. Competing interests The authors have no competing interests that are relevant to the content of this article to declare. References Bhuiyan, S, A., Magarey, R. C., McNeil, M. D. & Aitken, K. S., (2021). Sugarcane Smut, Caused by Sporisorium scitamineum, a Major Disease of Sugarcane: A Contemporary Review. Phytopathology 111:1905-1917. doi :10.1094/PHYTO-05-21-0221-RVW Bos, L., (1969). Experiences with a collection of plant viruses in leaf material dried and stored over calcium chloride, and a discussion of literature on virus preservation. Meded. Rijksfak. Landbouwwetensch. Gent 34: 875–887. Cheong, E. J., Mock, R. & Li, R. (2012). Elimination of five viruses from sugarcane using in vitro culture of axillary buds and apical meristems. Plant Cell, Tissue and Organ Culture . 109:439-445. doi: 10.1007/s11240-011-0108-3 Daugrois, J. H., Roumagnac, P., Kouakou, Y., Oura, O. J. & Pita, J. S. (2020). First report of Sugarcane streak mosaic virus in sugarcane (Saccharum spp.) in Côte d'Ivoire. New Disease Report , 41:22. doi:10.5197/j.2044-0588.2020.041.022 FAO (2019). Principaux pays agricoles et alimentaires et producteurs. Classification des pays dans le monde, par produit. Division de la statistique de la FAO . (Visited on 2019/12/12) www.fao.org/es/ess/top/commodity.html. Fu, W. L., Sun, S. R., Fu, H. Y., Chen, R. K., Su, J. W. & Gao, S. J., (2015) A One-Step Real-Time RT-PCR Assay for the Detection and Quantitation of Sugarcane Streak Mosaic Virus. BioMed Research International, Volume 2015, Article ID 569131, 9 pages doi:10.1155/2015/569131. Hall, J. S., Adams, B., Parsons, T. J, French, R., Lane, L. C. & Jensen, S. G. (1998). Molecular cloning, sequencing and phylogenetic relationships of a new potyvirus: sugarcane streak mosaic virus, and a reevaluation of the classification of the Potyviridae. Molecular Phylogenetics and Evolution , 10:323–332. doi:10.1006/mpev.1998.0535 Hema, M., Sreenivasulu, P. & Savithri, H. (2002). Taxonomic position of sugarcane streak mosaic virus in the family Potyviridae. Archives of Virology , 147:1997–2007. doi:10.1007/s00705-002-0851-1 Holkar, S. K., Balasubramaniam, P., Kumar, A., Kadirvel, N., Shingote, P. R., Chhabra, M. L., Kumar, S., Kumar, P., Viswanathan, R, Jain, R. K. & Pathak, A. D. (2020). Present Status and Future Management Strategies for Sugarcane Yellow Leaf Virus: A Major Constraint to the Global Sugarcane Production. Plant Pathology Journal , 36:536-557. doi:10.5423/PPJ.RW.09.2020.0183. Kasemsin P., Chiemsombat, P. & Hongprayoon, R. (2016). Characterization and genetic variation of sugarcane streak mosaic virus, a Poacevirus infecting sugarcane in Thailand. Modern Applied Science, 10: 137–149. doi:10.5539/mas.v10n4p137 Kouamé, D. K., Péné, B. C. & Zouzou, M. (2010). Evaluation de la résistance variétale de la canne à sucre au foreur de tiges tropical Africain (Eldana saccharina Walker) en Côte d’Ivoire. [Evaluation of varietal resistance of sugarcane to the African tropical stem borer (Eldana saccharina Walker) in Côte d’Ivoire]. (Publication in french). Journal of Applied Biosciences , 26:1614-1622, ISSN 1997–5902 Krishna, G. V., Kumar, M., Varma, P. K., Bhavani, B., & Kumar, G. V. (2023). Identification of resistance to Sugarcane mosaic virus, Sugarcane streak mosaic virus, and Sugarcane bacilliform virus in new elite sugarcane accessions in India. Frontiers in Microbiology , 14:1276932. doi:10.3389/fmicb.2023.1276932 Li, W., He Z., Li, S., Huang, Y. & Zhang, Z. (2011). Molecular characterization of a new strain of Sugarcane streak mosaic virus (SCSMV). Archives Virology , 156:2101-2104. doi:10.1007/s00705-011-1090-0 Lu, G., Wang, Z., Xu, F., Pan, Y. B., Grisham, M. P. & Xu, L. (2021). Sugarcane Mosaic Disease: Characteristics, Identification and Control. Microorganisms , 9:1984. doi:10.3390/ microorganisms 9091984. MINADER (2019) Ministère de l'agriculture et du développement rural production de sucre www.gouv.ci/_actualite-article.php?recordid=10005&d=4 Moradi, N., Rajabi-Memari, H., Mehrabi-Koushki, M., Taherkhani, K., Moazzen, M. H., Sheikhi, F., Nasirpour, N. & Sanjabifard, Z. (2015). First report of Sugarcane streak mosaic virus in Iran. New Disease Report , 32: 2. doi:10.5197/j.2044-0588.2015.032.002 Moradi, Z., Mehrvar, M. & Nazifi, E. (2018). Genetic diversity and biological characterization of sugarcane streak mosaic virus isolates from Iran. VirusDisease , 29:316–323. doi:10.1007/s13337-018-0461-5 N’guessan, A. C., Kouamé, K. D., Kassi, K. F., Kouamé, K. G., Konan, D. R., Yao, K. J. & Koné, D. (2019) Sugarcane Leaf Scald Disease in Côte d'Ivoire: Pathogenicity and Biocontrol of Xanthomonas albilineans isolates. Journal of Experimental Agriculture International , 41: 1-11. doi:10.9734/jeai/2019/v41i130388 Putra, L. K., Kristini, A., Achadian, E. M. & Damayanti, T. A. (2014). Sugarcane streak mosaic virus in Indonesia: Distribution, characterization, yield losses and management approaches. Sugar Tech , 16:392-399. doi:10.3923/ijv.2015.32.40 Putra, L. K., Astono, T. H., Syamsidi, S. R., & Djauhari, S. (2015) Investigation on transmission modes and host range of Sugarcane streak mosaic virus in sugarcane (Saccharum officinarum L.) in Indonesia. Journal of Agricultural and Crop Research , 3:59-66. Sorho, F., Sérémé, D., Kouamé, D. K., Koné, N., Yao, K. J., Ouattara, M. M., Tapsoba, W. P., Ouattara, B. & Koné, D. (2020). First report of Sugarcane Streak Mosaic Virus infecting sugarcane in Côte d’Ivoire. Plant Disease , 105: 0191-2917 doi:0.1094/PDIS-07-19-1398-PDN Srinivas, K. P., Reddy, C. V., Ramesh, B., Kumar, P. L., & Sreenivasulu, P (2010) Identification of a virus naturally infecting sorghum in India as Sugarcane streak mosaic virus. European Journal of Plant Pathology , 127:13–19. https://doi.org/10.1007/s10658-010-9580-6 Subba, R., & Sreenivasulu, P. (2011). Generation of Sugarcane streak mosaic virus-free sugarcane (Saccharum spp. hybrid) from infected plants by in vitro meristem tip culture. European Journal of Plant Pathology , 130:597–604. DOI:10.1007/s10658-011-9781-7 Xu, D. L., Zhou, G. H., Xie, Y. J., Mock, R. & Li, R. (2010). Complete nucleotide sequence and taxonomy of Sugarcane streak mosaic virus, member of a novel genus in the family Potyviridae. Virus Genes , 40:432-439. http://dx.doi.org/10.1007/s11262-010-0457-8 Zhang RY, Li WF, & Huang YK (2018) Genetic diversity and population structure of Sugarcane streak mosaic virus in Yunnan province, China. Tropical Plant Pathology , 43:514-519. https://doi.org/10.1007/s40858-018-0244-y Supplementary Files Supplementarymaterial.docx Cite Share Download PDF Status: Published Journal Publication published 17 Sep, 2024 Read the published version in European Journal of Plant Pathology → Version 1 posted Reviewers agreed at journal 26 Apr, 2024 Reviewers invited by journal 23 Apr, 2024 Editor invited by journal 21 Mar, 2024 Editor assigned by journal 17 Mar, 2024 First submitted to journal 15 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4109330","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":294489068,"identity":"f391ec9c-f314-49c5-9885-970feea97742","order_by":0,"name":"Migninlbin Marcel OUATTARA","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYFADZiD+AMRs7ITVMjYcgGphnAHSwky0FpAuHph1+AC/RPLzxx9q7snrtrNfe2zza5s8HzMD44ePObi1SM5IM2w4cKzYcNthnnLj3L7bhm3MDMySM7fh1mJwIwGohS2BEaglTTq35zYjUAsbMy9eLekfGw78S7AHa7HsuW1PhJYcw4aDbQmJ2w6zH5Nm+HE7kaAWyZ43hTPO9iUkA21hk+xtuJ3cxszYjNcv/OzpGz5UfEuw3Xb++DOJH39u285vbz744SMeLUiAx4CBsQ3EYGwgSj0QsD9gYPhDrOJRMApGwSgYSQAA+cFUsVLrkRcAAAAASUVORK5CYII=","orcid":"https://orcid.org/0009-0003-6867-508X","institution":"Wascal/CCBAD-Center of Excellence on Climate Change, Biodiversity and Suitainable Agriculture, Félix Houphouët-Boigny Univerity, 01 BPV 34 Abidjan 01, Côte d'Ivoire","correspondingAuthor":true,"prefix":"","firstName":"Migninlbin","middleName":"Marcel","lastName":"OUATTARA","suffix":""},{"id":294489069,"identity":"4f6c93b1-81d4-46eb-a0af-a6519e3afaf3","order_by":1,"name":"Konan Didier KOUAME","email":"","orcid":"","institution":"UFR Biosciences/Laboratory of Biotechnology, Agriculture and Valorization of Biological Resources/UPR Plant Physiology and Pathologies, Félix Houphouët-Boigny University, 22 PIO Box 582 Abidjan 22, Côte d'Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Konan","middleName":"Didier","lastName":"KOUAME","suffix":""},{"id":294489070,"identity":"dccf4ac2-b716-4019-a10b-161a19239df2","order_by":2,"name":"Cécile DESBIEZ","email":"","orcid":"","institution":"INRAE, Pathologie Végétale, F-84140, Montfavet, France","correspondingAuthor":false,"prefix":"","firstName":"Cécile","middleName":"","lastName":"DESBIEZ","suffix":""},{"id":294489071,"identity":"5e1bd4a1-4c64-4ddd-b9c6-aec37d166907","order_by":3,"name":"Grégory GIRARDOT","email":"","orcid":"","institution":"INRAE, Pathologie Végétale,F-84140, Montfavet, France","correspondingAuthor":false,"prefix":"","firstName":"Grégory","middleName":"","lastName":"GIRARDOT","suffix":""},{"id":294489072,"identity":"69f60cd7-7c2b-4c7c-b675-3f22ed33b637","order_by":4,"name":"Binaté BLE","email":"","orcid":"","institution":"Agronomic Department, UAI de Zuénoula, SUCRIVOIRE, PO Box 100 Borotou-Koro, Côte d'Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Binaté","middleName":"","lastName":"BLE","suffix":""},{"id":294489073,"identity":"0900d921-286a-4209-a9da-1fa841b5b7dd","order_by":5,"name":"Kouakou YAO","email":"","orcid":"","institution":"Agronomic Department, Field Department, UAI de Zuénoula, SUCRIVOIRE, PO Box 100 Borotou-Koro, Côte d'Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Kouakou","middleName":"","lastName":"YAO","suffix":""},{"id":294489074,"identity":"43498fb7-5a8b-41a5-bf17-953d6dd0085f","order_by":6,"name":"Fatogoma SORHO","email":"","orcid":"","institution":"UFR Biosciences/Laborotory of Biotechnology, Agriculture and Valorization of Biological Resources/UPR Plant Physiology and Pathologies, Félix Houphouët-Boigny, 22 PO Box 582 Abidjan 22, Côte d'Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Fatogoma","middleName":"","lastName":"SORHO","suffix":""},{"id":294489075,"identity":"623129da-3de3-476e-bfe1-8322a146c1c6","order_by":7,"name":"Mamadou CHERIF","email":"","orcid":"","institution":"UFR Biosciences/Laboratory of Biotechnology, Agriculture and Valorization of Biological Resources/UPR Plant Physiology and Pathologies, Félix Houphouët-Boigny University, 22 PO Box 582 Abidjan 22, Côte d'Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Mamadou","middleName":"","lastName":"CHERIF","suffix":""},{"id":294489076,"identity":"c00199fb-145c-4b8c-9496-d0a12ae30e3d","order_by":8,"name":"Nahoua KONE","email":"","orcid":"","institution":"Plant Biology Department, Peleforo Gon Coulibaly University, Biological Sciences RFU, BP 1328 Korhogo, Côte d'Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Nahoua","middleName":"","lastName":"KONE","suffix":""},{"id":294489077,"identity":"96962817-624c-42e6-8e99-184f0d96874c","order_by":9,"name":"Daouda KONE","email":"","orcid":"","institution":"UFR Biosciences/Laborotory of Biotechnology, Agriculture and Valorization of Biological Resources/UPR Plant Physiology and Pathologies, Félix Houphouët-Boigny University, 22 PO Box 582 Abidjan 22, Côte d'Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Daouda","middleName":"","lastName":"KONE","suffix":""},{"id":294489078,"identity":"5692d028-fdf7-4ce5-a6b1-8d3fa62865ab","order_by":10,"name":"Alexandra SCHOENY","email":"","orcid":"","institution":"INRAE, Pathologie Végétale, F-84140, Montfavet, France","correspondingAuthor":false,"prefix":"","firstName":"Alexandra","middleName":"","lastName":"SCHOENY","suffix":""}],"badges":[],"createdAt":"2024-03-15 16:33:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4109330/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4109330/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10658-024-02951-9","type":"published","date":"2024-09-17T15:57:25+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":55405953,"identity":"933530ed-3bc8-49c4-9c77-389b62707295","added_by":"auto","created_at":"2024-04-26 20:51:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":433886,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/80c5ca2bef68caa012d4b6ce.png"},{"id":55405951,"identity":"177cce88-1d75-48fc-9c39-2bd6e85abaf4","added_by":"auto","created_at":"2024-04-26 20:51:33","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1100527,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/d035cb324f055e493f48b4a9.png"},{"id":55406189,"identity":"e42cf886-c447-44da-b0fc-1183aa6c44ef","added_by":"auto","created_at":"2024-04-26 20:59:33","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":114887,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/d22c692bdc8605a8f36cb36b.png"},{"id":55406190,"identity":"c272def3-73a7-455e-89a4-9a746eeec801","added_by":"auto","created_at":"2024-04-26 20:59:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2015937,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/3bbe5040646d16da5cb60f2d.png"},{"id":55405964,"identity":"c73c2fce-8acc-4f94-b64d-bfab793512a1","added_by":"auto","created_at":"2024-04-26 20:51:34","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3137705,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/deee0d734c532476238206f0.png"},{"id":55405956,"identity":"0072242c-0cfb-4185-9ce6-de5c56577eee","added_by":"auto","created_at":"2024-04-26 20:51:34","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":25503,"visible":true,"origin":"","legend":"\u003cp\u003eMean prevalence (a) and severity (b) of SCSMV on 9 sugarcane varieties grown in Zuénoula (October 2018).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHistogram bars surmounted by the same letters are not significantly different at the 5% threshold according to the Student Newman-Keuls test.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/2300b539db64893e985d6d70.png"},{"id":55406191,"identity":"8b9761c9-87da-44c3-9015-f4ac1dfd0918","added_by":"auto","created_at":"2024-04-26 20:59:34","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":21951,"visible":true,"origin":"","legend":"\u003cp\u003eMean prevalence (a) and severity (b) of SCSMV on 6 sugarcane varieties grown in Zuénoula (October 2020).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHistogram bars surmounted by the same letters are not significantly different at the 5% threshold according to the Student Newman-Keuls test\u003c/em\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/3e3f8d2d14d5ac469f4c51bf.png"},{"id":55405959,"identity":"3cdae3cd-b7ce-493f-8582-8be04dbd4ab9","added_by":"auto","created_at":"2024-04-26 20:51:34","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":30600,"visible":true,"origin":"","legend":"\u003cp\u003eMean prevalence (a) and severity (b) of SCSMV on 12 sugarcane varieties grown in Zuénoula (October 2021)\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHistogram bars surmounted by the sameletters are not significantlydifferent at the 5% thresholdaccording to the Student\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eNewman-Keuls test\u003c/em\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/630b7e46e9f726c1ca842e0c.png"},{"id":55405957,"identity":"d09a3cb4-6e47-435c-af16-f69514949d38","added_by":"auto","created_at":"2024-04-26 20:51:34","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":2320972,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/8c33bb982905cead788fa5c4.png"},{"id":55405961,"identity":"64e99342-bb26-4f7c-871b-128136e9a9b4","added_by":"auto","created_at":"2024-04-26 20:51:34","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":21292,"visible":true,"origin":"","legend":"\u003cp\u003eMean prevalence (a) and severity (b) of SCSMV on 8 sugarcane varieties grown in Borotou-Koro (November 2019)\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHistogram bars surmounted by the same letters are not significantly different at the 5% threshold according to the Student Newman-Keuls test.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/d598c59f9290f1d7279a09ec.png"},{"id":55405958,"identity":"5a4bf339-7dce-49ee-97c4-392628303b03","added_by":"auto","created_at":"2024-04-26 20:51:34","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":23658,"visible":true,"origin":"","legend":"\u003cp\u003eMean prevalence (a) and severity (b) of SCSMV on 8 sugarcane varieties grown in Borotou-Koro (October 2020)\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHistogram bars surmounted by the same letters are not significantly different at the 5% threshold according to the Student Newman-Keuls test.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/292afcf9e6a8a32b4a5a6c53.png"},{"id":55405962,"identity":"de160861-b7d7-4f33-af35-cbb3571a81ae","added_by":"auto","created_at":"2024-04-26 20:51:34","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":26595,"visible":true,"origin":"","legend":"\u003cp\u003eMean prevalence (a) and severity (b) of SCSMV on 10 sugarcane varieties grown in Borotou-Koro (April 2022)\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHistogram bars surmounted by the sameletters are not significantlydifferent at the 5% thresholdaccording to the Student Newman-Keuls test.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"12.png","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/d3837045c8d1b34e73d76e61.png"},{"id":65103990,"identity":"224931cd-2aa6-4aa0-b3e9-8175d646f5ec","added_by":"auto","created_at":"2024-09-23 16:10:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":13607224,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/1675f542-f022-4adc-8d28-05a81a5456aa.pdf"},{"id":55405955,"identity":"e60c2931-b2c9-4efd-9602-3e3de8b4a4da","added_by":"auto","created_at":"2024-04-26 20:51:34","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":210858,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-4109330/v1/eed7dd001ada5cb16727f581.docx"}],"financialInterests":"","formattedTitle":"Sugarcane streak mosaic virus: distribution, prevalence and severity in the integrated\n\nfarming units of Zuénoula and Borotou-Koro, Côte d'Ivoire","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eSugarcane cultivation has played an important role in C\u0026ocirc;te d'Ivoire's economy since its expansion in the 1970s. It is produced on an area of 25,400 ha in four agro-industrial complexes located in Borotou-Koro (North-West), Ferkess\u0026eacute;dougou (Ferk\u0026eacute; 1 and Ferk\u0026eacute; 2, North) and Zu\u0026eacute;noula (Centre) (MINADER, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These complexes are specialized in the industrial production and processing of sugarcane. In addition, there are also small sugarcane farms around the large plantations. National sugar production is estimated at over 214,000 t/year, representing 3.3% of agricultural Gross Domestic Product (GDP), or 1% of national GDP and providing over 10,000 employments (FAO, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The dynamism of this sector has enabled C\u0026ocirc;te d'Ivoire to have the leading sugar industry in the UEMOA (West African Monetary and Economic Union) zone (MINADER, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNumerous biological constraints, including pests and diseases, contribute to limiting sugarcane production. \u003cem\u003eEldana saccharina\u003c/em\u003e is the main sugarcane stem-boring insect in C\u0026ocirc;te d\u0026rsquo;Ivoire (Kouam\u0026eacute; et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Sugarcane smut (\u003cem\u003eSporisorium scitamineum\u003c/em\u003e) and rust (\u003cem\u003ePuccinia kuehnii\u003c/em\u003e) are the main fungal diseases of sugarcane (Bhuiyan, 2021). Scald (\u003cem\u003eXanthomonas albilineans\u003c/em\u003e) is the main bacterial disease (N\u0026rsquo;guessan et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Viral diseases include yellow leaf syndrome, characterized by varying degrees of vein yellowing caused by sugarcane yellow leaf virus (SCYLV, luteovirus) (Holkar et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) and sugarcane mosaic. Several viruses cause sugarcane mosaic disease (Lu et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e): sugarcane mild mosaic virus (SCMMV), sugarcane striate mosaic associated virus (SCMaV), sugarcane mosaic virus (SCMV), sorghum mosaic virus (SrMV) and sugarcane streak mosaic virus (SCSMV). Among these viral diseases, streak mosaic of sugarcane caused by SCSMV is one of the most damaging. The first report of streak mosaic virus was made by Hall et al. (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1998\u003c/span\u003e) from quarantined germplasm imported from Pakistan to the USA and showing mosaic symptoms. Subsequently, the virus has also been reported in most Asian countries such as Bangladesh, India, Indonesia, Iran, Sri Lanka, Thailand, Vietnam and China (Hema et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Kasemsin et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Putra et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Xu et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Moradi et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Moradi et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Zhang et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). SCSMV is a Poacevirus in the Potyviridae family (Li et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The natural hosts of SCSMV are plants belonging to the Poaceae family, including sugarcane, maize and sorghum (Srinivas et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Fu et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Putra et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) have shown that this virus can cause yield losses in sugarcane tonnage and sugar of 16\u0026ndash;17% and 19\u0026ndash;22% respectively in Indonesia.\u003c/p\u003e \u003cp\u003eSCSMV has been described mainly in Asian countries but was recently discovered in sugar complexes in C\u0026ocirc;te d'Ivoire, West Africa (Sorho et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Daugrois et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Lu et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In order to evaluate the threat this emerging virus could pose to the Ivorian sugar industry, an extensive study was initiated within two sugar complexes in C\u0026ocirc;te d'Ivoire. The objectives were to assess the spatial distribution, prevalence and severity of SCSMV, as well as the level of susceptibility of the sugarcane varieties grown in these complexes.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\"\u003e\n \u003ch2\u003eStudy areas\u003c/h2\u003e\n \u003cp\u003eThe study was carried out on SUCRIVOIRE\u0026apos;s Integrated Agricultural Units (IAU) located in Zu\u0026eacute;noula and Borotou-Koro. In Zu\u0026eacute;noula, the study was carried out from October 2018 to October 2021 and in Borotou-Koro, the study was carried out from November 2019 to April 2022. The Zu\u0026eacute;noula IAU covers an area of 11,000 hectares, including 6,223 hectares of industrial plantations, either irrigated (pivots) or rainfed between latitudes 7\u0026deg;30 and 7\u0026deg;40 North and longitudes 6\u0026deg;5 and 6\u0026deg;15 West. It is located in a transition zone (Forest-Savannah), with an equatorial and subtropical climate. The Borotou-Koro IAU covers an area of 9,702 hectares industrial plantations (irrigated or rainfed) between latitudes 8\u0026deg;20 and 8\u0026deg;40 North, and longitudes 7\u0026deg;5 and 7\u0026deg;15 West. It belongs to the sub-Sudanese zone, with a humid tropical Sudano-Guinean climate.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\"\u003e\n \u003ch2\u003ePlant material\u003c/h2\u003e\n \u003cp\u003eThe evaluation of the spatial distribution, prevalence and severity of SCSMV was carried out at three periods on sugarcane plots that were between 3 and 8 months old. For Zu\u0026eacute;noula, the first period took place between February and October 2018 on 9 commercial varieties (55 irrigated plots and 12 rainfed plots), the second in October 2020 on 6 commercial varieties (21 irrigated plots and 1 rainfed plot) and the third in October 2021 on 12 commercial varieties (18 irrigated plots and 7 rainfed plots). For Borotou-Koro, the first period took place between October and November 2019 on 8 commercial varieties (21 irrigated plots and 6 rainfed plots), the second in October 2020 on 8 commercial varieties (16 irrigated plots and 6 rainfed plots) and the third from March to April 2022 on 10 commercial varieties (20 irrigated plots and 3 rainfed plots). These varieties were of diverse origins (Table \u003cspan\u003e1\u003c/span\u003e). Selected plots represented the crop age range (virgin crop established from cuttings from nurseries to 5-cycle regrown crops).\u003c/p\u003e\n \u003cdiv\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eSugarcane varieties evaluated for SCSMV susceptibility between 2018 and 2022 in Zu\u0026eacute;noula and Borotou-Koro\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"9\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eZu\u0026eacute;noula\u003c/p\u003e\n \u003cp\u003eNumber of\u003c/p\u003e\n \u003cp\u003eplots\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eBorotou-Koro\u003c/p\u003e\n \u003cp\u003eNumber of\u003c/p\u003e\n \u003cp\u003eplots\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCultivar\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eOrigin\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eYear of probable introduction in CI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u003cstrong\u003e2018\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u003cstrong\u003e2020\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u003cstrong\u003e2021\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u003cstrong\u003e2019\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u003cstrong\u003e2020\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u003cstrong\u003e2022\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCo449\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCoimbatore (India)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1963\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCo997\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCoimbatore (India)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1981\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFR8783\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGuadeloupe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM1176/77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMauritius\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM1954/91\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMauritius\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM1400/86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMauritius\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM2580/95\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMauritius\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM2593/92\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMauritius\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR570\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReunion Island\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1988\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR579\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReunion Island\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1994\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR93/0136\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReunion Island\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR96/2116\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReunion Island\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR96/2569\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReunion Island\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR97/0391\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReunion Island\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR98/4001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReunion Island\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR98/4158\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReunion Island\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRB725147\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBrazil\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1987\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSP711406\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSao Polo (Brazil)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1987\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSP711406R\u0026eacute;g*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSao Polo (Brazil)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2021\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDiverse**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u003cstrong\u003e67\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u003cstrong\u003e22\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u003cstrong\u003e25\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u003cstrong\u003e27\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u003cstrong\u003e22\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e\u003cstrong\u003e23\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"9\"\u003e\u003cem\u003e* variety regenerated by in vitro culture\u003c/em\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"9\"\u003e\u003cem\u003e** nursery with several sugarcane varieties\u003c/em\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\"\u003e\n \u003ch2\u003eAssessment of symptoms\u003c/h2\u003e\n \u003cp\u003eThe size of the rainfed plots at both sites ranged from 1 to 30 hectares, and that of the quarter pivot plots from 12 to 36 hectares. A M-type device with 5 microplots (quadrats) per plot was adopted for symptom assessment (Fig. \u003cspan\u003e1\u003c/span\u003e). Each quadrat was 100 m\u003csup\u003e2\u003c/sup\u003e (10 m x 10 m) with 7 rows. Observations were made on 30 sugarcane plants randomly selected over 10 m for each of the 7 rows, for a total of 210 plants per quadrat and 1,050 plants per plot. A severity score (Si, i\u0026isin;[0 ;4]) was assigned to each plant based on the percentage of symptomatic leaf area of leaf N\u0026deg;3 extended from the apex using a scoring scale adapted from Putra et al. (Fig. \u003cspan\u003e2\u003c/span\u003e; Table \u003cspan\u003e2\u003c/span\u003e). Mean prevalence (P) and mean severity (S) were calculated per quadrat and per plot with the following formulas:\u003c/p\u003e\n \u003cdiv\u003e\n \u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 2\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eRating scale used to assess the severity of SCSMV in sugarcane plots in Zu\u0026eacute;noula and Borotou-Koro\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSeverity score (Si)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e% of leaf area with symptoms\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCharacteristics\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eApparently healthy plant (a variety is highly resistant if S\u0026thinsp;=\u0026thinsp;0)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u0026ndash;10%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSlight presence of mottling or streaking on the plant\u003c/p\u003e\n \u003cp\u003e(a variety is partially resistant if S\u0026isin; [0.01; 1])\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11\u0026ndash;30%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eModerate presence of mottling or streaking on the plant (a variety is moderately susceptible if S\u0026isin; [1.01; 2])\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e31\u0026ndash;50%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eStrong presence of mottling or streaking, stunting of leaves, plant continues to grow (a variety is susceptible if S\u0026isin; [2.01; 3])\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e51\u0026ndash;100%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeavy mottling or streaking, stunting of leaves and/or plant, plant no longer growing or dead (a variety is highly susceptible if S\u0026isin; [3.01; 4])\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Equa\"\u003e\n \u003cdiv id=\"FileID_Equa\" name=\"EquationSource\"\u003e\u003cbr\u003e\u003c/div\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Equb\"\u003e\u003cbr\u003e\u003c/div\u003e\n \u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAQkAAAC0CAYAAACHS9l7AAATgElEQVR4Ae2djZHUPBOESYEYSIEcCIEYSIEMyIAMiIAISIAEyIAc7qvn3q+5YZBk78prS7pW1ZZt/Y56Zloj2QdvnpyMgBEwAg0E3jTKXGQEjIAReDJJ2AiMgBFoImCSaMLjQiNgBEwStgEjYASaCJgkmvC40AgYAZOEbcAIGIEmAiaJJjwuNAJGwCRhGzACRqCJgEmiCY8LjYARMEnYBoyAEWgiYJJowuNCI2AETBK2ASNgBJoImCSa8LjQCBgBk4RtwAgYgSYCJokmPC40AkbAJGEbMAJGoImASaIJjwuNgBEwSdgGjIARaCJgkmjC40IjYARMEhPZwM+fP5/evHlz82+iKVrUAREwSQyolJZIHz58eCaJt2/fPv369atY9ffv30+fPn36Qyaq9PXr1yfavX///jnr8+fPz8+tvtTW19eLgEliMt1DDIomPn78WJUeosD5qUv68ePHEyTBlTwIgnvq8fzly5dqXz0FyPvu3bs/MiNDToytOXFFLiWVxTyV+XoOAiaJc3A+dBQ5TnaoPIiiiZj/7du3Z4eU04l09BzrHnUvIkJeiIvnnCCt0nw010fKl2Xx898ImCT+xmOKJ5xMqzPXWvr+/fuz48VyiEPbDfJFGrHOI+4hAMblCiHkJDLI+X6+HgGTxPU6uEsCEQBOVwrha51CKjikElsWzjkenZATmbUF4hA2JpNERGOse5PEWPq4SZp4iFkK4XNnpa2FSINw/hayyX1vPYskGIP7TEwmiS0Erys3SVyHfffI8ZUo24itpK1FJBSdBXCN+Vt93VoOMSiC0VaJyEJJkZGeuYo4aOsziYjMufcmiXPxPnw0OfnojhRJAofnGbIQMSkvA6TDV5NERua8Z5PEeVg/ZCScTPv8eCD5kME6Oo0kQTechcS8GkkomjBJdIDf2dQk0QngCM21jYAsRk2REJBR5yPIzL1JYlTNPfk/DB5XNfsl02EgZDFqyiSBnIoSiCpMEqNqziQxrmZ2SsbhJatx6+vL3BVvFvLbhVzn6OcSSbBV0iGmCCOPq3xvNzIy5z17u3Ee1g8ZiXMISEIHgHsGoT7O15NwWohmb/RSIgnGj1sl6uRkksiInP/8r1bOl8Ej3onAFQ7E+YG+2sSp967wNZJg6pAN5SaJOw3hwc1MEg8G+FHdaw9f+sS5NqbOLkrOWGuT8xlXX0vSzx6SIMqhbk3W+L1HHk+vQPdGLLm9n/sRMEn0Y3h6D9rLs9VobTP0BiE6Mk6XzyPiSo4z51+urwnvIQlk0LlDa5sjMlDfXCOp0TZ+fBXr+f6xCExPEqxCHNrVVql74cNAcY7oYPf2dXQ7fWOgFb3Wv5wMR1ViTr3nEeprD0morq/zInApSbRWMMq2QkyMnRUm12PF0erFNZdHdamP0ooMQdCeVW6UpM+XtxwdAgEbHFlJYf9RxPeaSAKi3UOw1FNUBD5Ee60ICF1EP2AB2CJ/6fOs64sFnTViGgcQs7EBqvJrEQL5OEEGFCXRH6soCWfK/UuEXFf58YpjIcsIRIG8cnzmtPen+YhgMiFGIy31SXkp1XAt1Z05TwsJ822Rs/SDvYAxPxFGaaGSPmRbtKdtya6vxO9ykpCB5tUN55fBAl5M1KWsBDyAA3JM1JUiYj5jo5StJFlEPFv1H1WubYZw2XuVPBg4kRHGS189STqokXhP36O0Re/YB3aiyLRFEiKEaK9gjT3y4z4m+uQXk3CtEXOse9b9sCQBAFJMJhAprQQSZRngUp5YPPdd6pM8kU9WdK3+iPmaM7jmCGyvvDLiTFAt59nbd289Fo3SYpD7pU5pgcn1sBvZB/NjzrV5YheUlxYdkXscU7ookSyEQl+RbLJsZz4PTRIoCbCkKIDZWtVLhJDzUCiOssegpAwp9epoQvL4+i8C6BN7aelVdaLD/tvTvzlbJCH7KI2ttpEQuEfWkhyye/ocIQ1NEook4qoncCNxRCAzIVCW81AabH0rU6NU+nIaFwGRQGnFV1nJMbdmJEcv9UvbVjnjZdsREZTsWHLWxtqS9ejyYUkC8AAWoohJ4Ma8eE95bgMhiOEhBp7vUQChJDLtSTIa6u/9mYD2ILtdR04WyaCUt93TSw3ps2Y3rXLZctSv7LhEEq2+XiQ6726fxT9QnhJYhFk4Mr8YRSAGDkd+LYm1Bb4UpGf2h5FEiEzoj36RJY8Xx5Gst0YgsQ/fn4NAJIV4f+/oW47bKpcNYj9KsiXZpfK5tvqK9c66H4Yk4mqLE6PYkjPKmVsAyShQBASgvaCUJcWQz1iMwzkFkUIkkDxGS7G57iOeI0av9f4WXGUHYBWjilv6UN0tx22Vy+5MEkLzxuutjreHJBABx0c5kWgggPjqj75QrlKOQpSv662yqp2v1yAwCknoUHMvSejcLdrmNQj+N+owkYRW9y0w9pJE7kdML9IQu8cTZOXV3mDcQhIaD3n3/qIRZfn9fBsCIgiIP97f1stLbemz5rhaYOIipNaltpKpZGu32JnGeOR1SpLA6W5JEAPbjqhgEUIkJ+XFenEcKU9EE8t8Pw4CcsC4xSjl3SJxydFje72aL21XNXZckCAH7JiynOiDslG+ybnN2/JsDniW40VnbXWr+q06uUyHlRF0EUI0pFJe7OuWtxuxne/PQ0AOGfWq0VtlqlO7bpEE7eTc+fCbBSqTBwsNREBZTCKbEnnEemfeX04ScrxS2FUCQvu1vaQix48sTr8QBkrSoSZ52jtmJcf6kJTTmAjsIQEtMiUSqc0KW1G70nZC7WRr2DQkQDvJVLJXEQ91qEsb2kIcPI+SLiUJAMdRxah7iEKKiM7dAhPQa47N+ChECm3VFYHskbElzwxlzBVcpJsSacppVGeEeeFsW84vhy/NKc+BvrAJzTFemX9pLOwztsHGSgShsbAnRSBgzhywx5HSpSRxLxCAmsO3Ul8oAMXWQMdgIlFxX2NwEUqtvDT+zHkiRfCrkSzOMNqqNzPmo8o+JUkomjhrVdd4tQPNUZXbI5fmrFUR0sgJ8qgRSK7r53kRmJIkgJvtBqvYnrCxRz1EDkQtRBKvKYkkdAWDHEWZJF6HRUxLEqiHlR2ieFREgYNon5gdZHXzEDkwb23JciRlkljdCv6b39QkwRQwZox470HmXrVCPDgB/b/GJJLgypkOZxMQZjzfAXNvN9a3julJYn0VXTPDSBJIoNd1cdtFnkniGv2cOapJ4ky0Jxork4TOZogoKCOZJCZSaIeoJokO8FZumkmCufJdACTBGw+SSWJlC3iZm0niBQvfBQRKJEEx2wuIgjMbk0QAbOFbk8TCyu2ZWo0keOWsQ0wfXPYgPE9bk8Q8ujpV0hpJIIT+HoG3HT64PFUtlwxmkrgE9vEHbZEEh5gQBBGFSWJ8XfZKaJLoRXDR9vrbjdLn2EyZMwmTxKLKT9MySSRA/Pjfn8wrUuBz7BpRUOZIYn2LMUmsr2PP0Ah0IWCS6ILPjY3A+giYJNbXsWdoBLoQMEl0wefGRmB9BEwS6+vYMzQCXQiYJLrgc2MjsD4CJon1dewZGoEuBEwSXfC5sRFYHwGTxPo69gyNQBcCJoku+NzYCKyPgElifR17hkagCwGTRBd8bmwE1kfAJLG+jj1DI9CFgEmiCz43NgLrI2CSWF/HnqER6ELAJNEFnxsbgfURMEmsr2PP0Ah0IWCS6ILPjY3A+giYJNbXsWdoBLoQMEl0wefGRmB9BEwS6+vYMzQCXQiYJLrgc2MjsD4CJon1dewZGoEuBEwSXfC5sRFYHwGTxPo69gyNQBcCJoku+NzYCKyPgElifR17hkagCwGTRBd8bmwE1kfAJLG+jj1DI9CFgEmiCz43NgLrI2CSWF/HnqER6ELAJNEFnxsbgfURMEmsr2PP0Ah0IWCS6ILPjY3A+giYJNbXsWdoBLoQMEl0wefGRmB9BEwS6+vYMzQCXQiYJLrgc2MjsD4CJon1dewZGoEuBEwSXfC5sRFYHwGTxPo69gyNQBcCJoku+NzYCKyPgElifR17hkagCwGTRBd8fY1//vz59ObNm5t/faO6tRG4DQGTxG14HV77w4cPzyTx9u3bp1+/fhX7//3799OnT5/+kAmVyPv8+fNzHleeP378+Pz8/v37Yj/ONAL3IGCSuAe1A9tADIomcPJaggQgEuqSvn79+vTjx4+nL1++PEEKkAh9ff/+/bkOZY9M9I+8kgm5JEccVyQY80a5B6937979wR9McwJf6YdrxHXkueV59DybJHrQO6htNMRohLl7RRMxnzwcFRIhffv27Q+RxHpH3ouIGFvjIrcII441uiMhv0gg4hjnoIgt62b0ucU59NybJHrQO6gthqoVjWstyTljOfUxYiUcF+N9ZMKZSnKeQVCPmJeiIK4RS40lEtfza7uaJAbRuAgAQy2FvSUxtVWJKxwOjFE/KumwtUREWpWPGpv+GIcxW4ly6lH/ngTm4K9IKI9nkrgHVbd5CAIYOgZbC3vzoHnljqShM4vcpvdZYyDnvU65VwacFSz4ZcdVH6rDeci98ogkwIz7TIAmCaHt6+UIYPAYKT+2DVuJOvlNBs841d5oZGuMUrnIjLEgjVpSPeZzbxIJlIhTZT0EgVzIp+hL2z4iCyVFeXrmesTcYn8j39+vvZFnNbFsOiTDcOM2YqQp4ZxyJpwXB6ut4qrXI3+JDEp5944RSQLMeUZuzUl5uf8j5pb7HPHZJDGYVjBMHA9DzVHCSKIiZyQ0ZGb7k5NW3Jx/63MkBZyW8XojCMkQSYI8fW+i6KJGEkfNTXKMejVJDKgZnTXgCKMnthtse3C07GzIfqQjiShEoFrpezHKcuvcBfy5N0n0Iuz2hyOgA7TSynz4YAd1KGLD4eI5xYwkASQ6rCSqMEkcZCTu5hgEtFq2vr7MI+WVMJef9Uz4jyw4ldJRJCFcGIP+H7ndQHaiFJ05iDA0J12Pmpv6G/Xq7cZgmsEJcIC9oTTOkx3zninheBj9VvRCPZynlHRGcTRJRIIQLqW8kkx78mokq+gIfVAnJ5NERsTPD0dAK1Z0skcPqjOFUhRQGhvZaqSkPo7cbrTIoFVWkr2WVyMJ6osITBI19Jx/GgJyvtJnwTUhdAqPId+bGBdnI9WcP/YtORX2U8bqLoLL8itkj8QR+2vd7yGBKI+ijFafuYw2zDvLrXrIQHmJJHrmpv5nuP4bQ80g9WIyYqgYHI7XMnQcLTsy7XDQmOLqJwOP1xqp5L5jn7pHBhwqj8Fz3qqIxOgXOW8lChyUfluYIBfj7vn4THPQFXnk6GwpMo6qp7c3eubaO7fY1+j3JokBNCSD04peE0lvPaKz7XHsWn85/8i+ct9+nheBZUmCMBTn06ETDsBKfc+K80j16pPf2iqmsRV6Mw8ltdVz79Uk0Yvgmu1fLG6h+cl5IASFqpCGCGOUqRIRSCYcdO9P8hP2Q3w55a1A7pfyUjJJlFBx3pIkgeOx18xJr7Ry/lXP2mZkJ956lrw4O0RIlFE7eFPdrasOAHv72RrH5fMhsBxJ4DA4WWm1JKqgbJWEQ2uuiphunZvIIRPT1vbn1nFcf14E1vGY/+uAEF4Gf6/jzKtOS24EjkdgOZIAIu3J2a/HNwHHw+cejcD6CCxJEmw58vvvW6IKQm1FI3uvpe3N+ubjGb4GBJYkCRQHKWjPjqNzmJk/9nkNCvYcjUAvAsuShIBhu6Ev5iCLkQ7k9kYprrf/9fCVWMnmVrsuTxJSmF5/YkQ+pxAqvhqBbQReDUkABQeZkASv/VrJZxItdFz22hBYjiQggNKHVChWZxRbJPHajMDzNQItBJYkiVq0oEjC242WSbjMCPyNwLIkASEoYuBNh7YQ/uz4bwPwkxHYQmA5kiBKgAj0QZVOu3n2K9Atc+grj5jzdyk5QdrSB9eR3jRlWf38gsByJPEyNd9dgYC2dLUtn/5C1wRxhXbuG9MkcR9ublVBgGhCRME1J0UT2grmcj+Ph4BJYjydTC0RJEGUoK1H/j9JTRLzqdckMZ/OhpYYcuBMSH+yz+fw8e9mTBJDq68onEmiCIsz70UAkuBH0ufw8Y0ShFE7r7h3TLd7LAImicfi++p6jyQBIeif5yOyUDJJCIk5riaJOfQ0jZSRJBBa/8K3ogvyTBLTqPNZUJPEXPoaXtpMEgisf9uD158kk8TwavxLQJPEX3D4oReBEknosBKy8JlEL8LntzdJnI/50iOWSIIJ618G1+fx/k5iHjMwScyjqykkrZEEn8uzzdBBpkliCnU+C2mSmEdXU0haIwmEVxThM4kpVPlHSJPEHyh8cwQCfIpd+hybvjmP0CGmI4kj0D6nD5PEOTi/ilGIIogS+JX+ChQQ9M8ImiTmMQmTxDy6sqRG4BIETBKXwO5BjcA8CJgk5tGVJTUClyBgkrgEdg9qBOZBwCQxj64sqRG4BAGTxCWwe1AjMA8CJol5dGVJjcAlCJgkLoHdgxqBeRAwScyjK0tqBC5BwCRxCewe1AjMg4BJYh5dWVIjcAkCJolLYPegRmAeBEwS8+jKkhqBSxAwSVwCuwc1AvMgYJKYR1eW1AhcgoBJ4hLYPagRmAcBk8Q8urKkRuASBEwSl8DuQY3APAiYJObRlSU1ApcgYJK4BHYPagTmQcAkMY+uLKkRuAQBk8QlsHtQIzAPAiaJeXRlSY3AJQj8D1cgOnb9U+15AAAAAElFTkSuQmCC\"\u003e\u003c/p\u003e\n \u003cp\u003ewith Si the severity score, Ni the number of plants with severity score Si in the area unit considered (quadrat or plot), N the number of plants observed per area unit considered (quadrat or plot).\u003c/p\u003e\n \u003cp\u003eMaps of spatial distribution of SCSMV were established based on the prevalence of SCSMV with the following categories: Healthy (P\u0026thinsp;=\u0026thinsp;0%), Low (0% \u0026lt; P\u0026thinsp;\u0026le;\u0026thinsp;10%), Moderate (10% \u0026lt; P\u0026thinsp;\u0026le;\u0026thinsp;70%) and High (70% \u0026lt; P\u0026thinsp;\u0026le;\u0026thinsp;100%).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\"\u003e\n \u003ch2\u003eSampling method and sample conditioning\u003c/h2\u003e\n \u003cp\u003eThe calculations of mean prevalence presented previously are only reliable if the score 0 (absence of symptoms) assigned based on visual observation corresponds to an absence of disease. For 8 of the 22 plots assessed in 2020 in Borotou-Koro, visual scoring on leaf N\u0026deg;3 was coupled with leaf testing for SCSMV infection by RT-PCR. Three to four samples were taken from each of the 5 \u0026lsquo;\u0026rsquo;M\u0026rsquo;\u0026rsquo; quadrats, for a total of 147 samples tested in the laboratory.\u003c/p\u003e\n \u003cp\u003eTo assess the impact of sample dehydration and conditioning methods on the detection of SCSMV by RT-PCR, all samples were dehydrated and conditioned in duplicate using two different methods.\u003c/p\u003e\n \u003cp\u003e1) calcium chloride dehydration (CCD) according to the method of Bos (\u003cspan\u003e1969\u003c/span\u003e): a 6.5g leaf subsample was finely chopped with a single-use razor blade and packaged in an absorbent paper pad inserted in a jar containing 3.5g calcium chloride (CaCl2), hermetically sealed and stored at 4\u0026deg;C;\u003c/p\u003e\n \u003cp\u003e2) hot-air dehydration (HAD): sampled leaves were roughly cut into strips, packed in kraft paper envelopes and oven-dried at 30\u0026deg;C for 48 hours in the laboratory.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\"\u003e\n \u003ch2\u003eMolecular detection of SCSMV\u003c/h2\u003e\n \u003cdiv id=\"Sec8\"\u003e\n \u003ch2\u003eTotal RNA extraction\u003c/h2\u003e\n \u003cp\u003eSamples were prepared in individual extraction bags (Bioreba): 0.3 g dehydrated leaves were rehydrated in 4 mL phosphate solution (Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e12H\u003csub\u003e20\u003c/sub\u003e 0.03M, DIECA 0.2%) for 2 h at 4\u0026deg;C before grinding. Two more ml of phosphate solution were added to the extraction bag after grinding. A 250 \u0026micro;L aliquot of crude extract was collected and stored at -20\u0026deg;C until use. Total RNAs were extracted with Tri-reagent (Molecular Research Center, Cincinnati, OH) with some modifications of the manufacturer\u0026rsquo;s protocol. A 500 \u0026micro;L volume of Tri-reagent was added to the 250 \u0026micro;L sample, homogenized by vortexing for 2\u0026ndash;3 s and left for 5 min at room temperature. Next, 100 \u0026micro;L of chloroform was added to each tube, homogenized by vortexing and left for 10 min at room temperature. The tubes were centrifuged at 4\u0026deg;C, 14,000 rpm, for 10 min. At the end of the first centrifugation, 450 \u0026micro;L of the upper aqueous phase was removed from each tube and added to 150 \u0026micro;L of isopropanol and 150 \u0026micro;L of sodium acetate (3M pH 5,2). After precipitation at -20\u0026deg;C for at least 30 min, a second centrifugation was performed at 4\u0026deg;C, 14,000 rpm for 15 min. The pellet was washed with 500 \u0026micro;L of 70% ethanol. After centrifugation at 4\u0026deg;C, 14,000 rpm for 5 min, the supernatant was discarded and the pellet was resuspended in 20 \u0026micro;L of RNAse-free distilled water and stored at -20\u0026deg;C.\u003c/p\u003e\n \u003cp\u003eAmplification of viral RNAs by RT-PCR\u003c/p\u003e\n \u003cp\u003eThe fifteen complete nucleotide sequences of SCSMV available in GenBank and belonging to the two major molecular groups known for this virus (Kasemsin et al., \u003cspan\u003e2016\u003c/span\u003e) were downloaded and aligned with ClustalW included in MEGA6: KJ187047- KJ187048 KJ187049, JF488066, JF488064, JF488065, JN163911, JN941985, GQ246187, GQ388116, KX430771, KX430772, KX823354, KX823355, KX823356 (Fig. \u003cspan\u003e3\u003c/span\u003e). Primers were chosen on either side of the N-terminal region of the capsid, in regions as conserved as possible between all the sequences: SCSMV-9280-R CCACTTGTACGCCAATTCGCC and SCSMV-8450-F CCAAARCTATCACGAGAACG, the names of the primers indicating their position in the genome, yielding an expected 830-nt fragment (fig \u003cspan\u003eS1\u003c/span\u003e). RNAs were denatured by adding 8 \u0026micro;l of sterile water to 2 \u0026micro;l of total RNA and heating at 80\u0026deg;C for 3 min. Fifteen \u0026micro;l of RT-PCR mix were added to each tube of 10 \u0026micro;l denatured RNA to obtain a total reaction volume of 25 \u0026micro;l, with a final composition of 1X RT-PCR buffer (Sigma), 1.5 mM MgCl2, 0.25 mM dNTPs, 0.5 \u0026micro;M of each primer, 2.5 U of M-MLV reverse transcriptase (Promega), 2.5 U of Taq hot Start (Promega). One-step RT-PCR was performed with a reverse transcription (RT) at 42\u0026deg;C for 1 h, denaturation at 94\u0026deg;C for 5 min, followed by 35 cycles of denaturation at 94\u0026deg;C for 30 s, primer hybridization at 60\u0026deg;C for 30 s, elongation at 72\u0026deg;C for 50 s and final elongation at 72\u0026deg;C for 10 min. Next, 2.5 \u0026micro;l of the products obtained from each RT-PCR tube were analyzed on a 1.5% electrophoresis agarose gel.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eStatistical analyses were performed using SATISTICA 7.1 and XLSTAT 2016 in EXCEL. A Shapiro-wik normality test was performed for the variables prevalence and severity of the different sugarcane varieties. The test showed that both variables follow the normal distribution. An analysis of variance was applied to these data, and the comparison of means was carried out using the Newman-Keuls test (post-hoc ANOVA) at the 5% significance level. Distribution maps of sugarcane streak mosaic prevalence were produced using ArcMap 10.8 software, at a scale of 1:80,000 for maps of the Zu\u0026eacute;noula IAU and 1:100,000 for maps of the Borotou-Koro IAU.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eSpatial distribution and overall SCSMV prevalence in Zu\u0026eacute;noula\u003c/h2\u003e \u003cp\u003eSymptoms were widespread on all cane plots (nurseries, industrial plots) in the three sectors of the Zu\u0026eacute;noula IAU. All varieties evaluated showed typical sugarcane streak mosaic symptoms. Streaks were distributed over the entire leaf surface and tended to be more diffuse on older leaves. For varieties Co449, M1400/86, M2593/92, R570, SP711406R\u0026eacute;g, M1954/91, R98/4001, R98/4158, R96/2569, R97/0391 and R93/0136 symptoms were very visible on the five youngest leaves and less visible on the older leaves. For Co997, M1176/77, M2580/95, R96/2116 and R579, symptoms were visible on almost all leaves and generally at the same intensity. For Co997, R579 and SP711406, some plants were severely stunted with leaf yellowing and shortened internodes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In 2018, the overall prevalence of sugarcane streak mosaic symptoms was 98%. Mean prevalences were 100% for 60/67 plots (high) and below 70% (moderate) for 7/67 plots (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). In 2020, prevalence was 100% (high) in all observed plots (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). In 2021, overall prevalence was 98%. Mean prevalences were 100% (high) for 18/22 plots and below 70% (moderate) for 4/22 plots (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eMean prevalence and severity of SCSMV on sugarcane varieties in Zu\u0026eacute;noula\u003c/h2\u003e \u003cp\u003eIn 2018, mean prevalences were very high (98\u0026ndash;100%) for 8 of the 9 varieties assessed (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). Only variety M2593/92 had a significantly lower prevalence than the others (85% ; P\u0026thinsp;\u0026lt;\u0026thinsp;0.005). Mean severity was high for M2580/95, Co997, R579, M1176/77, SP711406 and Co449 (susceptible). The mean severity of varieties R570, M1400/86 and M2593/92 was significantly lower than the previous ones, they were partially susceptible (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn 2020, only 6 sugarcane varieties were evaluated. Some varieties were excluded from the industrial plots due to their high susceptibility to SCSMV. Mean prevalence was 100% for all 6 varieties tested (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea). Mean severity was high for Co997, SP711406 and R570. The mean severities of varieties M1400/86, M2593/92 and M1954/91 were lower although the difference with SP711406 and R570 was not significant for M1400/86 and M2593/92 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn 2021, 12 sugarcane varieties were evaluated. New varieties were introduced in industrial plots and one variety was regenerated. Mean prevalences were very high for all varieties assessed: 100% for 5 varieties and 77\u0026ndash;99% for 7 varieties (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea). Mean severity was high for SP71106 and R96/2116. The mean severities of varieties R570, M1400/86, R97/0391, SP711406R\u0026eacute;g (regenerated), M1954/91, M2593/92, R96/2569, R98/4158 and R98/4001 were lower than the previous ones but the difference was not always significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb). The in vitro regenerated variety SP711406Reg showed a significant reduction in prevalence (-22%) and severity (-45%) compared to its parent variety.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSP711406, M1400/86, M2593/92 and R570 were monitored during the three years. SP711406 showed a susceptible profile during the three years: prevalence was 100% and severity was consistently higher than 2. R570 showed a susceptible to moderately susceptible profile: prevalence was 100% and severity was close to 2. M1400/86 and M2593/92 showed a moderately susceptible profile: prevalence was higher than 80% and severity was between 1 and 2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eSpatial distribution and overall prevalence of SCSMV in Borotou-Koro\u003c/h2\u003e \u003cp\u003eAll varieties evaluated showed typical sugarcane streak mosaic symptoms. Streaks were distributed over the entire leaf surface and tended to be more diffuse on older leaves. For varieties Co449, M1400/86, R570, SP711406R\u0026eacute;g, R98/4158, R97/0391, R93/0136, RB725147 and FR8783, symptoms were very visible on the five youngest leaves and less visible on the older leaves. For Co997, M1176/77, M2580/95 and R579, symptoms were visible on almost all leaves and generally at the same intensity. In 2019, the overall prevalence of the disease was 21%. The spatial distribution of the disease presented a disparity between sectors: high prevalences (around 100%) for 4 plots exclusively located in sector E, composed solely of rainfed plots. Prevalences in the other sectors (B, C, D) were moderate for 9 plots (10\u0026ndash;50%) and low for 14 plots (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ea). In 2020, the overall prevalence of sugarcane streak mosaic was 48%, with high prevalences for 3 plots in sector E and moderate to low prevalences in sectors B, C and D (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eb). In 2022, overall prevalence was 61%. Sugarcane streak mosaic was distributed across all sectors, with high prevalences in all sectors, moderate prevalences only in sectors B and C and low prevalences restricted to sector D (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eMean prevalence and severity of SCSMV in sugarcane varieties in Borotou-Koro\u003c/h2\u003e \u003cp\u003eIn 2019, the highest mean prevalence was recorded for Co449 (54%). Varieties SP711406, R579, RB725147, M1400/86 and M1176/77 showed significantly lower prevalences with 13%, 11%, 10%, 8% and 3% respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003ea). The mean severity of Co449 was 1.29, while that of varieties Co997, R570, SP711406, M1400/86, RB725147 and M1176/77 was 0.75, 0.57, 0.22, 0.15, 0.13 and 0.06 respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn 2020, the prevalences of varieties Co449, SP711406, Co997, R570, M2580/95, R579, and M1176/77 were 45\u0026ndash;60%. Disease prevalence was significantly lower in M11400/86, at 25% (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003ea). The mean SCSMV severities of varieties Co449, SP711406, M2580/95, Co997, R579, R570 were 2.01, 1.85, 1.85, 1.75, 1.58, 1.48 respectively. Mean severity was significantly lower on varieties M1176/77 (0.98) and M1400/86 (0.46) (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn 2022, 10 sugarcane varieties were evaluated. Mean prevalences exceeded 80% on varieties R93/0136, Co449, R97/0391, M1400/86, R570. M2580/95, SP711406, R98/4158, FR8783 and SP711406R\u0026eacute;g showed significantly lower prevalences with respectively 65%, 46%, 23%, 17%, 12%. (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003ea). Mean severities of varieties R93/0136, M1400/86, M2580/95, R570, R97/0391, Co449, SP711406 was 1.45, 1.44, 1.41, 1.40, 1.38, 1.20, 1.13 respectively. Mean severity was significantly lower on FR8783, R98/418, SP711406R\u0026eacute;g than on the previous varieties, with 0.32, 0.24, 0.23 respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003eb). The in vitro regenerated variety SP711406Reg showed a significant reduction in prevalence (-75%) and severity (-80%) compared to its parent variety.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eA follow-up was carried out on the following 4 varieties: Co449, R570, SP711406 and M1400/86, that were planted during the 3 years of surveys. For these 4 varieties, prevalence increased considerably over time, with the exception of SP711406 whose prevalence decreased slightly in the third year of evaluation. The same was true for mean severity, with the exception of Co449, whose severity dit not change considerably the 3rd year of evaluation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eVirus detection as a function of sample storage type and severity score\u003c/h2\u003e \u003cp\u003eBoth CCD and HAD conditioning methods enabled amplification of SCSMV (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e,). For asymptomatic samples (severity score\u0026thinsp;=\u0026thinsp;0), no amplification was observed whatever the type of sample storage (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). For symptomatic samples (severity score\u0026thinsp;\u0026gt;\u0026thinsp;0), the molecular detection method developed enabled amplification in 88% of cases. For score 1, the percentage of detection was 80% and 60% for CCD and HAD dehydration respectively, but the number of samples tested was low. The percentage of detection was over 90% from score 2 onwards, whatever the type of sample storage.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSCSMV detection from samples varying in severity score and dehydration technique: chloride dehydration (CCD) and hot-air dehydration (HAD)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSeverity score\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNb of plants sampled (duplicates)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNb of amplifications after CCD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNb of amplifications after HAD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e% detection after CCD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e% detection after HAD\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e96\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e96\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e147\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e127\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e131\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThis 5-year study provides a detailed assessment of the evolution of the prevalence and severity of SCSMV in two of the three sugarcane production basins of C\u0026ocirc;te d'Ivoire. The assessment was based on a visual assessment of the presence and intensity of foliar symptoms. A molecular detection test targeting SCSMV was developed and implemented on samples of varying severity. The asymptomatic samples (severity score\u0026thinsp;=\u0026thinsp;0) were never amplified, confirming that the visual assessment of leaf symptoms is a reliable proxi of the sanitary status of the plant: a plant with a severity score of 0 can be considered healthy with confidence. This information is particularly important for epidemiological surveillance and prophylaxis management in nurseries in case of introduction and evaluation of new sugarcane varieties or on-site multiplication for planting new plots. Indeed Putra et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) showed that to avoid increased spread of SCSMV, the use of virus-free plant material is recommended. For symptomatic plants (severity score\u0026thinsp;\u0026gt;\u0026thinsp;0), molecular detection was function of the intensity of foliar symptoms with a minimum probability of 90% of detecting SCSMV when the severity score was greater than 1. Low detection efficiency obtained for samples with a severity score of 1 could be explained by a lower viral titer in the plants associated to a greater degradation of the viral RNA during storage and/or non-optimal specificity of the primers. Regarding the conditioning method, hot-air dehydration and calcium chloride dehydration were found to be equally effective. This result allows us to prioritize the hot-air dehydration method for future studies because it is easier and faster to implement.\u003c/p\u003e \u003cp\u003eThe epidemiological situation of sugarcane streak mosaic was very different in the two sites monitored. In Zu\u0026eacute;noula, the overall prevalence was extremely high (\u0026gt;\u0026thinsp;98%) throughout monitoring. The virus was widespread in the three sectors of this site with moderate to high mean prevalences in the plots, which confirms the build-up of strong viral pressure since its first observation in 2015 by Kouam\u0026eacute; (pers. comm.). Conversely, in Borotou-Koro, the epidemiological situation evolved gradually throughout monitoring: the overall prevalence was 21% in 2019, 48% in 2020 and 61% in 2022. Sector E, made up entirely of rainfed plots, was the most attacked sector. This could be explained by the multiplication of susceptible varieties in this sector, such as Co449 and Co997. Krishna et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) showed recently that Co449 and Co997 are varieties susceptible to sugarcane streak mosaic virus. These results corroborate those of Putra et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) who showed in Indonesia that SCSMV spread rapidly due to the extension and planting of the highly susceptible variety PS 864, and that the prevalence increased from 0.44\u0026ndash;86.75% between 2007 and 2011. Putra et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) also showed that the rapid distribution of SCSMV in fields can be facilitated by mechanical transmission with knives during plantation preparation or harvest. Nineteen varieties of sugarcane from various origins were evaluated during the study. Their sensitivity to SCSMV was assessed using a severity scale and the distinct epidemiological situations between the two sites made it possible to test their behaviour in contrasting contexts. In Zu\u0026eacute;noula, the varieties M2580/95, Co997, R579, M1176/77, SP711406 and Co449 were the most susceptible, with mean severities greater than 2. The variety SP711406 was susceptible throughout the three years of evaluation. Varieties M1400/86 and M2593/92 remained in the moderately susceptible range (1\u0026thinsp;\u0026le;\u0026thinsp;S\u0026thinsp;\u0026lt;\u0026thinsp;2) throughout the three years of evaluation, while variety R570 was classified as either susceptible or moderately susceptible depending on the year of assessment. In Borotou-Koro, four varieties were monitored throughout the three years of evaluation: Co449, M1400/86, R570 and SP711406. Co449 remained in the moderately susceptible range (1\u0026thinsp;\u0026le;\u0026thinsp;S\u0026thinsp;\u0026lt;\u0026thinsp;2) throughout the three years of evaluation, while M1400/86, R570 and SP711406 moved from partially resistant (0.1\u0026thinsp;\u0026le;\u0026thinsp;S\u0026thinsp;\u0026lt;\u0026thinsp;1) to moderately susceptible (1\u0026thinsp;\u0026le;\u0026thinsp;S\u0026thinsp;\u0026lt;\u0026thinsp;2) during the study. This shows that as disease prevalence increases, disease severity in these varieties also increases. On both sites, the in vitro regenerated variety SP711406Reg showed a significant reduction in prevalence and severity compared to its parent variety but was not completely virus-free, demonstrating that in vitro cultivation is a means of reducing risk but does not eliminate it. Either the in vitro regeneration did not completely eliminate the virus (Lu et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e ; Cheong et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2012\u003c/span\u003e ; Subba et al., 2011), or the recontamination was quick during the growing season. On both sites, SP711406Reg was tested only during the last year of the survey, so there is no information about the evolution of virus prevalence and severity after several years of field multiplication. In vitro culture is an efficient way to reduce virus prevalence (Lu et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Subba et al., 2011). It can be associated with the use of partially or highly resistant varieties. Indeed, the rational selection and distribution of disease-resistant varieties are the most economical and effective prevention and control measures against viruses (Lu et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank the Center of excellence on Climate Change, Biodiversity and Sustainable Agriculture of F\u0026eacute;lix Houphou\u0026euml;t-Boigny University, for its support and collaboration with the company SUCRIVOIRE through agreement number 3004_2019, which allowed us to carry out this field work. We would like to thank the plant pathology unit of INRAE, Avignon (France), where the molecular analysis work was carried out, for its technical facilities and financial support. We would also like to thank the French Embassy in C\u0026ocirc;te d\u0026apos;Ivoire and the Campus France agency for granting us a mobility grant for our thesis, which also allowed us to carry out this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests \u0026nbsp;\u0026nbsp;\u003c/strong\u003eThe authors have no competing interests that are relevant to the content of this article to declare.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBhuiyan, S, A., Magarey, R. C., McNeil, M. D. \u0026amp; Aitken, K. S., (2021). Sugarcane Smut, Caused by Sporisorium scitamineum, a Major Disease of Sugarcane: A Contemporary Review. \u003cem\u003ePhytopathology\u003c/em\u003e 111:1905-1917. doi :10.1094/PHYTO-05-21-0221-RVW\u003c/li\u003e\n \u003cli\u003eBos, L., (1969). Experiences with a collection of plant viruses in leaf material dried and stored over calcium chloride, and a discussion of literature on virus preservation. Meded. Rijksfak. Landbouwwetensch. Gent 34: 875\u0026ndash;887.\u003c/li\u003e\n \u003cli\u003eCheong, E. J., Mock, R. \u0026amp; Li, R. (2012). Elimination of five viruses from sugarcane using in vitro culture of axillary buds and apical meristems. \u003cem\u003ePlant Cell, Tissue and Organ Culture\u003c/em\u003e. 109:439-445. doi: 10.1007/s11240-011-0108-3\u003c/li\u003e\n \u003cli\u003eDaugrois, J. H., Roumagnac, P., Kouakou, Y., Oura, O. J. \u0026amp; Pita, J. S. (2020). First report of Sugarcane streak mosaic virus in sugarcane (Saccharum spp.) in C\u0026ocirc;te d\u0026apos;Ivoire. \u003cem\u003eNew Disease Report\u003c/em\u003e, 41:22. doi:10.5197/j.2044-0588.2020.041.022\u003c/li\u003e\n \u003cli\u003eFAO (2019). Principaux pays agricoles et alimentaires et producteurs. Classification des pays dans le monde, par produit. \u003cem\u003eDivision de la statistique de la FAO\u003c/em\u003e. (Visited on 2019/12/12) www.fao.org/es/ess/top/commodity.html.\u003c/li\u003e\n \u003cli\u003eFu, W. L., Sun, S. R., Fu, H. Y., Chen, R. K., Su, J. W. \u0026amp; Gao, S. J., (2015) A One-Step Real-Time RT-PCR Assay for the Detection and Quantitation of Sugarcane Streak Mosaic Virus. \u003cem\u003eBioMed Research International, \u003c/em\u003e Volume 2015, Article ID 569131, 9 pages doi:10.1155/2015/569131.\u003c/li\u003e\n \u003cli\u003eHall, J. S., Adams, B., Parsons, T. J, French, R., Lane, L. C. \u0026amp; Jensen, S. G. (1998). Molecular cloning, sequencing and phylogenetic relationships of a new potyvirus: sugarcane streak mosaic virus, and a reevaluation of the classification of the Potyviridae. \u003cem\u003eMolecular Phylogenetics and Evolution\u003c/em\u003e, 10:323\u0026ndash;332. doi:10.1006/mpev.1998.0535 \u003c/li\u003e\n \u003cli\u003eHema, M., Sreenivasulu, P. \u0026amp; Savithri, H. (2002). Taxonomic position of sugarcane streak mosaic virus in the family Potyviridae. \u003cem\u003eArchives of Virology\u003c/em\u003e, 147:1997\u0026ndash;2007. doi:10.1007/s00705-002-0851-1\u003c/li\u003e\n \u003cli\u003eHolkar, S. K., Balasubramaniam, P., Kumar, A., Kadirvel, N., Shingote, P. R., Chhabra, M. L., Kumar, S., Kumar, P., Viswanathan, R, Jain, R. K. \u0026amp; Pathak, A. D. (2020). Present Status and Future Management Strategies for Sugarcane Yellow Leaf Virus: A Major Constraint to the Global Sugarcane Production. \u003cem\u003ePlant Pathology Journal\u003c/em\u003e, 36:536-557. doi:10.5423/PPJ.RW.09.2020.0183.\u003c/li\u003e\n \u003cli\u003eKasemsin P., Chiemsombat, P. \u0026amp; Hongprayoon, R. (2016). Characterization and genetic variation of sugarcane streak mosaic virus, a Poacevirus infecting sugarcane in Thailand. \u003cem\u003eModern Applied Science,\u003c/em\u003e 10: 137\u0026ndash;149. doi:10.5539/mas.v10n4p137\u003c/li\u003e\n \u003cli\u003eKouam\u0026eacute;, D. K., P\u0026eacute;n\u0026eacute;, B. C. \u0026amp; Zouzou, M. (2010). Evaluation de la r\u0026eacute;sistance vari\u0026eacute;tale de la canne \u0026agrave; sucre au foreur de tiges tropical Africain (Eldana saccharina Walker) en C\u0026ocirc;te d\u0026rsquo;Ivoire. [Evaluation of varietal resistance of sugarcane to the African tropical stem borer (Eldana saccharina Walker) in C\u0026ocirc;te d\u0026rsquo;Ivoire]. (Publication in french). \u003cem\u003eJournal of Applied Biosciences\u003c/em\u003e, 26:1614-1622, ISSN 1997\u0026ndash;5902\u003c/li\u003e\n \u003cli\u003eKrishna, G. V., Kumar, M., Varma, P. K., Bhavani, B., \u0026amp; Kumar, G. V. (2023). Identification of resistance to Sugarcane mosaic virus, Sugarcane streak mosaic virus, and Sugarcane bacilliform virus in new elite sugarcane accessions in India. \u003cem\u003eFrontiers in Microbiology\u003c/em\u003e, 14:1276932. doi:10.3389/fmicb.2023.1276932\u003c/li\u003e\n \u003cli\u003eLi, W., He Z., Li, S., Huang, Y. \u0026amp; Zhang, Z. (2011). Molecular characterization of a new strain of Sugarcane streak mosaic virus (SCSMV). \u003cem\u003eArchives Virology\u003c/em\u003e, 156:2101-2104. doi:10.1007/s00705-011-1090-0 \u003c/li\u003e\n \u003cli\u003eLu, G., Wang, Z., Xu, F., Pan, Y. B., Grisham, M. P. \u0026amp; Xu, L. (2021). Sugarcane Mosaic Disease: Characteristics, Identification and Control. \u003cem\u003eMicroorganisms\u003c/em\u003e, 9:1984. doi:10.3390/ microorganisms 9091984.\u003c/li\u003e\n \u003cli\u003eMINADER (2019) Minist\u0026egrave;re de l\u0026apos;agriculture et du d\u0026eacute;veloppement rural production de sucre www.gouv.ci/_actualite-article.php?recordid=10005\u0026amp;d=4\u003c/li\u003e\n \u003cli\u003eMoradi, N., Rajabi-Memari, H., Mehrabi-Koushki, M., Taherkhani, K., Moazzen, M. H., Sheikhi, F., Nasirpour, N. \u0026amp; Sanjabifard, Z. (2015). First report of Sugarcane streak mosaic virus in Iran. \u003cem\u003eNew Disease Report\u003c/em\u003e, 32: 2. doi:10.5197/j.2044-0588.2015.032.002 \u003c/li\u003e\n \u003cli\u003eMoradi, Z., Mehrvar, M. \u0026amp; Nazifi, E. (2018). Genetic diversity and biological characterization of sugarcane streak mosaic virus isolates from Iran. \u003cem\u003eVirusDisease\u003c/em\u003e, 29:316\u0026ndash;323. doi:10.1007/s13337-018-0461-5\u003c/li\u003e\n \u003cli\u003eN\u0026rsquo;guessan, A. C., Kouam\u0026eacute;, K. D., Kassi, K. F., Kouam\u0026eacute;, K. G., Konan, D. R., Yao, K. J. \u0026amp; Kon\u0026eacute;, D. (2019) Sugarcane Leaf Scald Disease in C\u0026ocirc;te d\u0026apos;Ivoire: Pathogenicity and Biocontrol of Xanthomonas albilineans isolates. \u003cem\u003eJournal of Experimental Agriculture International\u003c/em\u003e, 41: 1-11. doi:10.9734/jeai/2019/v41i130388\u003c/li\u003e\n \u003cli\u003ePutra, L. K., Kristini, A., Achadian, E. M. \u0026amp; Damayanti, T. A. (2014). Sugarcane streak mosaic virus in Indonesia: Distribution, characterization, yield losses and management approaches. \u003cem\u003eSugar Tech\u003c/em\u003e, 16:392-399. doi:10.3923/ijv.2015.32.40\u003c/li\u003e\n \u003cli\u003ePutra, L. K., Astono, T. H., Syamsidi, S. R., \u0026amp; Djauhari, S. (2015) Investigation on transmission modes and host range of Sugarcane streak mosaic virus in sugarcane (Saccharum officinarum L.) in Indonesia. \u003cem\u003eJournal of Agricultural and Crop Research\u003c/em\u003e, 3:59-66. \u003c/li\u003e\n \u003cli\u003eSorho, F., S\u0026eacute;r\u0026eacute;m\u0026eacute;, D., Kouam\u0026eacute;, D. K., Kon\u0026eacute;, N., Yao, K. J., Ouattara, M. M., Tapsoba, W. P., Ouattara, B. \u0026amp; Kon\u0026eacute;, D. (2020). First report of Sugarcane Streak Mosaic Virus infecting sugarcane in C\u0026ocirc;te d\u0026rsquo;Ivoire. \u003cem\u003ePlant Disease\u003c/em\u003e, 105: 0191-2917 doi:0.1094/PDIS-07-19-1398-PDN \u003c/li\u003e\n \u003cli\u003eSrinivas, K. P., Reddy, C. V., Ramesh, B., Kumar, P. L., \u0026amp; Sreenivasulu, P (2010) Identification of a virus naturally infecting sorghum in India as Sugarcane streak mosaic virus. \u003cstrong\u003e\u003cem\u003eEuropean Journal of Plant Pathology\u003c/em\u003e\u003c/strong\u003e, 127:13\u0026ndash;19. https://doi.org/10.1007/s10658-010-9580-6 \u003c/li\u003e\n \u003cli\u003eSubba, R., \u0026amp; Sreenivasulu, P. (2011). Generation of Sugarcane streak mosaic virus-free sugarcane (Saccharum spp. hybrid) from infected plants by in vitro meristem tip culture. \u003cstrong\u003e\u003cem\u003eEuropean Journal of Plant Pathology\u003c/em\u003e\u003c/strong\u003e, 130:597\u0026ndash;604. DOI:10.1007/s10658-011-9781-7\u003c/li\u003e\n \u003cli\u003eXu, D. L., Zhou, G. H., Xie, Y. J., Mock, R. \u0026amp; Li, R. (2010). Complete nucleotide sequence and taxonomy of Sugarcane streak mosaic virus, member of a novel genus in the family Potyviridae. \u003cem\u003eVirus Genes\u003c/em\u003e, 40:432-439. http://dx.doi.org/10.1007/s11262-010-0457-8\u003c/li\u003e\n \u003cli\u003eZhang RY, Li WF, \u0026amp; Huang YK (2018) Genetic diversity and population structure of Sugarcane streak mosaic virus in Yunnan province, China. \u003cem\u003eTropical Plant Pathology\u003c/em\u003e, 43:514-519. https://doi.org/10.1007/s40858-018-0244-y\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-plant-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ejpp","sideBox":"Learn more about [European Journal of Plant Pathology](http://link.springer.com/journal/10658)","snPcode":"10658","submissionUrl":"https://www.editorialmanager.com/ejpp/default2.aspx","title":"European Journal of Plant Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Côte d'Ivoire, prevalence, spatial distribution, sugarcane streak mosaic virus, severity, sugarcane","lastPublishedDoi":"10.21203/rs.3.rs-4109330/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4109330/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSugarcane streak mosaic is an emerging viral disease caused by sugarcane streak mosaic virus (SCSMV) recently reported in Ivorian sugar production areas. A 5-year study was performed to determine the spatial distribution, incidence and severity of SCSMV on commercial varieties in two of the three sugarcane production basins of C\u0026ocirc;te d'Ivoire. In Zu\u0026eacute;noula, 104 plots were evaluated between 2018 and 2021. In Borotou-Koro, 72 plots were evaluated between 2019 and 2022. Disease prevalence and severity were assessed using a 0 to 4 rating scale based on the percentage of symptomatic leaf area.\u003c/p\u003e \u003cp\u003eIn Zu\u0026eacute;noula, overall disease prevalence was 98% in 2018, 100% in 2020 and 98% in 2021. Varieties M1400/86, M2593/92, R570 and SP711406 were monitored during the three years. M1400/86 and M2593/92 showed a moderately susceptible profile, whereas R570 was susceptible to moderately susceptible and SP711406 was susceptible. In Borotou-Koro, overall disease prevalence was 21% in 2019, 48% in 2020 and 61% in 2022. Varieties Co449, M1400/86, R570 and SP711406 were monitored during the three years. Co449 remained moderately susceptible throughout the monitoring, while M1400/86, R570 and SP711406 moved from partially resistant to moderately susceptible.\u003c/p\u003e \u003cp\u003eThis study showed that SCSMV is highly prevalent in the Zu\u0026eacute;noula sugar complex and is rapidly evolving in the Borotou-Koro complex. In this epidemic context, varieties showed either a stable or increasing susceptibility profile. In vitro regeneration permitted significant reduction in prevalence and severity but efforts must be maintained to achieve higher levels of resistance.\u003c/p\u003e","manuscriptTitle":"Sugarcane streak mosaic virus: distribution, prevalence and severity in the integrated\nfarming units of Zuénoula and Borotou-Koro, Côte d'Ivoire","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-26 20:51:29","doi":"10.21203/rs.3.rs-4109330/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2024-04-26T15:46:35+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-04-23T10:26:18+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"European Journal of Plant Pathology","date":"2024-03-22T03:45:55+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-17T23:19:57+00:00","index":"","fulltext":""},{"type":"submitted","content":"European Journal of Plant Pathology","date":"2024-03-15T12:33:22+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-plant-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ejpp","sideBox":"Learn more about [European Journal of Plant Pathology](http://link.springer.com/journal/10658)","snPcode":"10658","submissionUrl":"https://www.editorialmanager.com/ejpp/default2.aspx","title":"European Journal of Plant Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"0f9a6cae-b528-43f1-94c5-d35032e6b9d6","owner":[],"postedDate":"April 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-09-23T16:01:20+00:00","versionOfRecord":{"articleIdentity":"rs-4109330","link":"https://doi.org/10.1007/s10658-024-02951-9","journal":{"identity":"european-journal-of-plant-pathology","isVorOnly":false,"title":"European Journal of Plant Pathology"},"publishedOn":"2024-09-17 15:57:25","publishedOnDateReadable":"September 17th, 2024"},"versionCreatedAt":"2024-04-26 20:51:29","video":"","vorDoi":"10.1007/s10658-024-02951-9","vorDoiUrl":"https://doi.org/10.1007/s10658-024-02951-9","workflowStages":[]},"version":"v1","identity":"rs-4109330","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4109330","identity":"rs-4109330","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}