Hamsters immunized with formalin-inactivated SARS- CoV-2 develop accelerated lung histopathological lesions and Th2-biased response following infection

Hamsters immunized with formalin-inactivated SARS- CoV-2 develop accelerated lung histopathological lesions and Th2-biased response following infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Hamsters immunized with formalin-inactivated SARS- CoV-2 develop accelerated lung histopathological lesions and Th2-biased response following infection Rineke Jong, Sandra Vreman, Katrin E. Wiese, Nora M. Gerhards, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5254288/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 04 Jul, 2025 Read the published version in npj Vaccines → Version 1 posted 10 You are reading this latest preprint version Abstract One of the concerns regarding vaccine safety during the COVID-19 pandemic was the potential manifestation of vaccine-associated enhancement of disease (VAED) upon SARS-CoV-2 infection. To investigate the suitability of the Syrian hamster model to test for VAED, we immunized animals with an experimental formaldehyde-inactivated, alum-adjuvanted SARS-CoV-2 vaccine preparation. In two independent experiments, challenge infection did not result in an enhancement of the clinical disease in vaccinated animals. However, at early timepoints (2–5 days) after challenge infection, lung tissue of vaccinated hamsters showed elevated mRNA levels of IL-4 and IL-13 and lung histopathology progressed faster and was more prominent than in mock-vaccinated animals. At later time points, cytokine responses and lung pathology were comparable between vaccinated and mock-vaccinated hamsters, underscoring the transient nature of the pathological aggravation. With this work we show that the Syrian hamster model can be used to assess possible vaccine safety considerations in a preclinical setting. Health sciences/Diseases Health sciences/Medical research Health sciences/Pathogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The coronavirus disease 2019 (COVID-19) pandemic led to an unprecedented global effort to develop SARS-CoV-2 vaccines. As a result, a wide range of vaccines were approved worldwide for use in humans during the pandemic. These vaccines include mRNA vaccines, vector vaccines, subunit vaccines and inactivated whole virus vaccines. At the dawn of the vaccine development for SARS-CoV-2, one of the safety concerns was related to manifestation of events of vaccine-associated enhancement of disease (VAED). Up until now, there are no records for such events in individuals that have received any type of vaccine against COVID-19. Nevertheless, it remains important to monitor the phenotype of the immune response and the possible display of VAED in newly developed and in existing vaccines. VAED can manifest in individuals that have been vaccinated and subsequently have contracted an infection with the pathogen against which they have been vaccinated. It is defined as a disease presented with more severe symptoms, or disease with modified/unusual clinical manifestation 1 . VAED is a well-described phenomenon in the context of formalin-inactivated whole virus vaccines against human respiratory syncytial virus (HRSV) and measles virus (MeV) used in the 1960s. A formalin-inactivated alum-adjuvanted HRSV vaccine was applied to young children and, upon exposure to natural infection, was associated with significantly increased hospitalization rate and two fatalities in the vaccinees as compared to the control group 2 . The disease was characterized by high fever and massive infiltration of immune cells into the lungs, pointing to an immunopathological mechanism. This was further supported by studies in animal models, where challenge infection of vaccinated animals induced severe lung lesions associated with infiltration of granulocytes (e.g. neutrophils and eosinophils), and monocytes/macrophages, Th2-bias of the immune response and the presence of low-avidity, non-protective antibody responses that contributed to accumulation and deposition of immune complexes and complement-mediated injury in lungs (reviewed in 3 – 6 ). Similar mechanisms have been described as the cause for developing “atypical measles” in association with a formalin-inactivated MeV vaccine 3 , 7 . For both vaccines, formalin inactivation is suspected to be a contributing factor to the Th2 polarization of the immune response, since carbonyl groups generated during the inactivation process were shown to favor Th2 response in mice 8 . Furthermore, alum-based adjuvants are recognized for driving Th2 skewing of the immune response 9 , 10 , and aluminum hydroxide was used as adjuvant for the formalin-inactivated HRSV vaccine. With respect to human respiratory coronaviruses, two new coronaviruses had emerged before the currently pandemic SARS-CoV-2, namely SARS-CoV (in 2002–2003) and MERS-CoV (in 2012). For both viruses, diverse vaccines were tested in preclinical models and results that potentially reflect VAED were reported. In the context of SARS-CoV, a formalin-inactivated SARS-CoV vaccine was associated with increased lung lesions after challenge infection in non-human primates 11 . A double-inactivated (with formalin and ultraviolet irradiation) whole SARS-CoV vaccine, either adjuvanted with alum or not, was poorly protective against disease and viral replication, and induced eosinophilic immunopathology in the lungs of aged mice following either homologous or heterologous challenge infection. Young mice were well-protected and did not show lung pathology following homologous challenge but were partially protected and displayed lung pathology following heterologous challenge 12 . Other types of vaccines have also been shown to induce immunopathological lesions in the lungs of mice 13 – 15 or non-human primates 16 . For MERS-CoV, a gamma-irradiated whole virus vaccine (either adjuvanted with Alum, MF59 or non-adjuvanted) was found to bear risk for hypersensitive-type lung pathology in mice, characterized by lung infiltrates consisting of mononuclear cells and eosinophils, and increased levels of IL-5 and IL-13 17 . A similar hypersensitivity-type response was reported in mice vaccinated with UV-inactivated, alum adjuvanted MERS-CoV 18 . It should be noted that the pathological results of some of these studies 11 , 13 , 16 , 17 were discussed controversially by others 6 . However, collectively these studies suggest that VAED can be induced by inactivated coronavirus vaccines in preclinical models, therefore implying that initial safety concerns regarding vaccines developed against SARS-CoV-2 were reasonable. To support safety assessment of novel vaccines for COVID-19, several animal models were used with the aim to test if VAED can be induced by a SARS-CoV-2 infection in the context of vaccine-induced immunity. In all studies, vaccine preparations that are expected to induce VAED were used, such as formalin-inactivated whole virus preparations 19 – 21 , denatured S protein vaccines 21 or recombinant spike protein 22 – 24 , for all of which except one study 20 , alum was used as adjuvant. While no VAED was observed in macaques, vaccinated ferrets did show a transient increased pathology compared to mock-vaccinated animals, characterized by eosinophilic infiltrates and perivascular cuffing in the lung observed at 6 to 7 days post infection (DPI), which resolved by 13 to 15 DPI 19 . In mice, Th2 skewing as well as eosinophilic and neutrophilic infiltrates in the lungs were found early post infection, at 3 or 4 DPI, while the animals were partially protected from clinical signs and viral replication 21 , 22 . At a later time point post infection (7 DPI), murine lungs exhibited severe immunopathology, characterized by a significant perivascular infiltration of eosinophils and CD4 + T cells, and increased expression of Th2/Th17 cytokines 24 . Two studies have been described in golden Syrian hamsters, with opposing findings. In one study, hamsters vaccinated twice with a formalin inactivated vaccine had only limited pulmonary inflammatory infiltrates confined to the alveolar walls at 4 DPI, and had more pronounced Th1 cytokines in lungs as compared with control hamsters (Th2 cytokines were not reported) 20 . In the other study, alum-adjuvanted, non-stabilized spike protein vaccine induced VAED represented by pronounced Th2 cytokine production and massive eosinophilic infiltration in lung tissue at 4 DPI 23 . In all aforementioned studies, a single necropsy point after challenge was used to evaluate lung pathology. To investigate the conditions for the potential occurrence of VAED in Syrian hamsters in the context of a formalin-inactivated whole virus preparation (FIWV) adjuvanted with alum, we performed two experiments. In the first experiment, four different vaccine regimens comprising two different antigen doses applied in either single or prime-boost administration regiment were used to determine if and under which condition(s) VAED would occur. Based on the outcome of the first experiment, a second experiment was designed with the vaccine regimen that had resulted in the most pronounced VAED to study the kinetics of VAED during the course of infection. Vaccinated hamsters were compared with mock-vaccinated hamsters and hamsters that had recovered from a previous homologous SARS-CoV-2 challenge (re-challenge group). Our findings reveal an accelerated onset of lung lesions in vaccinated hamsters compared to mock-vaccinated controls. The differences were transient and were associated with lack of neutralizing antibodies after vaccination, and more pronounced Th2 responses in the lung tissue early after infection. Materials and Methods Ethical statement Wageningen Bioveterinary Research is authorized to perform animal experiments according to the Dutch Law on Animal Experiments (WoD) and in accordance with European legislations and guidelines. The current study was performed under project license no. AVD4010020209446 of the Dutch Central Authority for Scientific procedures on Animals (CCD). The experimental plan was approved by the Animal Welfare Body of Wageningen University and Research prior to the start of the in-life phase. Protocols were prepared in compliance with 3R policies, and the study reports are presented in compliance with the ARRIVE guidelines 25 . Vaccine preparation For production of the virus stock, Vero/hSLAM cells (Sigma-Aldrich, Merck, Darmstadt, Germany, Cat# 04091501-1VL) were used, cultured in minimum essential medium (Life Technologies, Carlsbad, CA, USA) supplemented with 4% heat-inactivated FBS (Sigma-Aldrich), 25 mM Hepes (Life Technologies) and geneticin (0.4 µg/ml) (Gibco, Thermo Fischer Scientific; Waltham, MA, USA). Production of the stock, preparation of the formalin-inactivated whole virus (FIWV) SARS-CoV-2 vaccine, and the subsequent purification and characterization of the FIWV have been described previously 19 . Prior to administration, frozen formalin-inactivated whole virus was thawed, diluted with phosphate buffered saline (PBS), and mixed 1:1 with 2% Alhydrogel (InvivoGen, Toulouse, France) to a final concentration of 0.5 µg vaccine antigen per dose (low dose) or 5 µg vaccine antigen per dose (high dose) for the first study, or to 5 µg vaccine antigen per dose for the second study. Viruses and cells The virus used for inoculation in both studies was SARS-CoV-2 D614G, strain SARS-CoV-2/human/NL/Lelystad/2020 26 . In the first study, an undiluted virus stock prepared as previously described 26 was used at dose 10 4.22 TCID 50 per hamster. For the second study, the virus stock was obtained following a second passage of the original isolate on Vero/hSLAM cells at MOI 0.0001. The culture medium consisted of MEM (Gibco, Thermo Fischer Scientific; Waltham, MA, USA, Cat# 21090;), supplemented with 2% FCS, 1% antibiotic/antimycotic, 1% L-glutamine, 1% Minimal Essential Medium Non-Essential Amino Acids (MEM-NEAA) (all from Gibco). Inoculations of hamsters were performed with undiluted virus stock at a dose of 10 4.13 TCID 50 per hamster. Sequences of both virus stocks were determined by next generation sequencing and were identical to the original isolate, with no notable deletions in the furin cleavage site. For virus neutralization test, VERO-E6 cells (ATCC® CRL-1586™; Manassas, VA, USA) were used, cultured in MEM (Gibco, Cat# 21090;), supplemented with 5% FCS, 1% antibiotic/antimycotic, 1% L-glutamine, 1% Minimal Essential Medium Non-Essential Amino Acids (MEM-NEAA) (all from Gibco). Experimental design For both studies, Syrian hamsters ( Mesocricetus auratus ), strain RjHan:AURA were obtained from Janvier, France. All hamsters were housed solitary in cages with open grids in one animal room under BSL3 containment level. Water and food were provided ad libitum . Hamsters were monitored daily for their general health from the day of arrival until the end of the study and were allowed to acclimatize for at least 7 days before subjected to any study-related handlings. Vaccines and mock-treatment (phosphate buffered saline (PBS)) were administered intramuscularly (IM) by injection of 100 µL in the left hind leg. Where relevant, booster vaccination was administered IM in the right hind leg. Body weights of all hamsters were measured approximately twice per week during the acclimatization and vaccination period. Blood drawn from the retroorbital sinus and challenge infection with SARS-CoV-2 via the intranasal (IN) route were performed under general anesthesia with 0.15 mg/kg medetomidine (Sedastart, ASTfarma; Oudewater, The Netherlands) and 100 mg/kg ketamine (Narketan, Vetoquinol; Breda, The Netherlands). The anesthesia was antagonized with atipamezole (Sedastop, ASTfarma; Oudewater, The Netherlands). Animals were euthanized by anesthesia with 0.25 mg/kg medetomidine and 200 mg/kg ketamine, followed by exsanguination of the animals. Definition of humane endpoints (HEPs) were described previously 26 . Study 1 (Figure 1, upper panel) A total of 60 golden Syrian hamsters, (30 male and 30 female), 6-8 weeks of age at arrival, were used for the study. Hamsters from the same sex were assigned to one of 5 treatment groups (n=6 males and n=6 females per group) based on equal distribution of body weights across groups and subgroups (per day of euthanasia). One group of hamsters was immunized with low (0.5 µg) dose, and one with a high (5 µg) dose of vaccine at day 0 (D0) and at D19 (prime-boost regimen). Another two groups received either a single low or high dose of the same vaccine on D19 only. The fifth group received a vaccination with PBS on D19 and served as mock-vaccinated control. All vaccinations were applied in a volume of 100 µl via the intramuscular (IM) route. Two weeks post last vaccination (D32), n=4 hamsters of each group were sacrificed for necropsy on D32 and served as unchallenged controls. The rest of the hamsters (n=8 hamsters per group) were inoculated with SARS-CoV-2 on D33. From the inoculated hamsters, n=4 per group were euthanized at 5 days post inoculation (DPI) and the other n=4 per group were sacrificed at 13 DPI. During the challenge phase, body weights were measured daily starting 7 days prior to challenge and ending on the day of necropsy. In addition, activity of the hamsters to be sacrificed on 13 DPI (n=4 per group) was monitored daily by means of individual activity tracking wheels (Tecnilab BMI, Someren, The Netherlands) 26 for the same time period as the body weights. The running wheel were connected to an automatic rotation counter. Counts were recorded once per 24 h at approximately the same time of day and the counters were reset to 0. One complete wheel rotation corresponded to 4 counts. Serum samples were collected on the day prior to each vaccination (D -1 and D18), prior to challenge (D31) and on both necropsy days (D38 and D46) by retroorbital puncture under general anesthesia. At necropsy, the left lung lobe was weighed and collected for pathological investigation, while cranial, medial and caudal right lung lobes were collected for viral load. The cardiac lung lobe was collected for cytokine measurements. One hamster of the 1x high dose vaccine group reached a HEP on 7 DPI, showing depression, abdominal breathing and 19% body weight loss, and it was euthanized. This hamster had the lowest body weight prior challenge, which might suggest a suboptimal condition before challenge. Therefore it was difficult to determine whether reaching HEP was solely because of the challenge infection, or because of a combination of the infection, together with other unknown factors. For that reason, data of this hamster were excluded from all graphical representations and statistical analyses. Study 2 (Figure 1, lower panel) A total of 45 female golden Syrian hamsters, 8 weeks of age at arrival, were assigned to one of 3 treatment groups (n=15 per group in total) based on equal distribution of body weights across groups and subgroups (according to day of euthanasia). One group of hamsters was inoculated IN with SARS-CoV-2 (re-challenge group). To confirm successful infection in this group, oropharyngeal swabs (MW100, Medical Wire, Corsham, UK) were collected every 2 to 3 days, starting 3 days prior inoculation until 10 days post inoculation. Hamsters from the other two groups were injected IM with either vaccine (5 µg vaccine antigen) or with PBS (vaccinated and mock-vaccinated groups respectively), both in a volume of 100 µl. Two weeks post vaccination (vaccinated and mock-vaccinated groups) and approximately three weeks post first challenge (re-challenge group), all hamsters were inoculated IN with SARS-CoV-2. At 2, 4, 6, 8 and 10 DPI, n=3 hamsters per group were euthanized to perform necropsies and to collect lung tissue. The left lung lobe was collected for pathological analysis and the right caudal and cardiac lobes for virological and mRNA expression analysis (Nanostring® nCounter technology, Seattle, WA, USA). During the challenge phase, body weights were measured once daily starting 5 days prior to challenge and ending on the day of necropsy. Serum samples were collected before vaccination, prior to challenge and during necropsy by retroorbital puncture under general anesthesia. Pathological evaluation of lung tissue and immunohistochemistry The left lung lobe was removed and weighed, and the weight was expressed as percentage of the body weight measured on the day of challenge (relative lung weight). Subsequently, the left lung lobe was gently inflated and immersed in 10% neutral buffered formalin, fixed for 14 days and embedded in paraffin, sectioned at 5 μm and stained with hematoxylin and eosin (H&E) for histological examination. The percentage of the total extent of the left lung lobe that was microscopically affected by SARS-CoV-2-related lesions, was estimated in a blinded fashion by a board-certified veterinary pathologist. Three blinded estimates with different order of slides were performed and averaged for a final score. For study 1, a section from the lung of each hamster from both 5 and 13 DPI was evaluated by a second, independent board-certified veterinary pathologist in a blinded fashion. Percentage of affected lung tissue was calculated using digital image analysis (Nikon NIS-Ar software, Tokyo, Japan). The agreement between the scores assigned by both pathologists was assessed by correlation analysis (GraphPad (San Diego, CA, USA) software Prism v. 9.4.0). The severity and characteristics of the histopathological lesions were scored semi-quantitatively as described previously 26 with slight modifications as shown in Table 1. To account for the different scales of the 6 individual parameters that were scored, all scores were normalized by multiplying by a correction factor (4/highest score of each scale). Normalized scores were used to calculate cumulative (“sum”) scores, for visual representation and for statistical analysis. The severity and characteristics of the lung lesions were also analyzed by the second pathologist in a blinded fashion and in a descriptive way. Table 1 Scoring system for the severity and characteristics of lung histopathology (H&E staining) and for level of SARS-CoV-2 antigen expression in the lungs (only modifications in comparison with the previously described system 26 are shown). Score Bronchi and bronchioles 0 no changes 1 Peribronchiolar infiltrate or in lumina with no or mild epithelial degeneration 20-50 % of bronchi/bronchioles 3 Peribronchiolar infiltrate or in lumina with severe epithelial degeneration and necrosis > 50% of bronchi/bronchioles Blood vessels 0 no changes 1 perivascular clear spaces (edema) with only mild infiltrates of inflammatory cells > 15% of large blood vessels 2 clear perivascular cuffing in > 15- 30 % of blood vessels, with occasionally presence of inflammatory cell in blood vessel wall without clear degeneration 3 extensive perivascular cuffing often of more than 5 cell layers, also in large arteries with clear infiltrates of inflammatory cells in blood vessel walls Level of antigen expression 0 No staining 1 Focal or multifocal staining (< 5 foci) en 40-70 % of the tissue 4 Diffuse staining in > 70% of the tissue SARS-CoV antigen expression was evaluated with immunohistochemistry (IHC) on formalin-fixed and paraffin-embedded (FFPE) lung tissue sections. Heat-induced epitope retrieval (HIER) method was used to prepare slides for IHC stain as previously described 26 . Briefly, after routinely dewaxing and endogenous peroxidase quenching (methanol/0,3%H 2 O 2 ), the sections were heated for 15 min at 100°C (Pascal, Dako, Agilent, Santa Clara, CA, USA pressure cooker) in 10 mmol citrate buffer pH 6,0 (Dako, Cat# S1699). The slides were blocked with 10% goat serum (Dako) and stained with primary polyclonal rabbit anti-SARS-CoV NucleoProtein (Sino Biological, Beijing, China, Cat# 40163-T62) and secondary HRP-conjugated anti-rabbit reagent (Envision + Single Reagent, Dako, Cat# K4003). For visualization, the 3,3'-diaminobenzidine (DAB) (Dako, Cat# K3468) substrate was used. Slides were counterstained with haematoxylin. The semiquantitative scoring system for the level of SARS-CoV-2 virus antigen expression in the lungs is shown in Table 1 (Level of antigen expression). Oropharyngeal swab sampling and analysis Following sampling, the swabs were directly submerged in 2 ml of complete culture medium and kept on melting ice until transport to the lab and freezing at ≤-70°C. Upon thawing, swab samples were vortexed, and 200 µl of the sample was mixed with 211 µl lysis master mix, consisting of 200 µl lysis buffer supplemented with 1 µl Poly-A RNA and 10 µl Proteinase K solution (Molgen Pureprep Pathogens Kit, Utrecht, The Netherlands). Lysis buffer-inactivated samples were stored at ≤-15°C until RNA isolation and PCR analysis. RNA from oropharyngeal swabs was isolated by an automated robot system (PurePrep 96, Molgen), using the Pureprep Pathogens RNA isolation kit (Molgen) according to manufacturer instructions. Assessment of viral genome loads In study 1, the collected cranial, medial and caudal right lung lobes were kept on melting ice until initial storage at ≤-70°C. Upon further processing, tissue samples were weighed, thawed and homogenized in 6 mL Earl’s MEM (Gibco), supplemented with 1% antibiotic/antimycotic (Gibco), using DT-20 Tubes with Rotor Stator Element (Thermo Fisher Scientific) and an Ultra-Turrax® homogenizer (IKA; Staufen, Germany). The tissue homogenates were centrifuged for 15 minutes at 3400g at 4°C and 85 µl of the supernatant was mixed with 255 µl Trizol-LS and stored at ≤-15°C. In study 2, right cranial and middle lung lobes were directly snap-frozen in liquid nitrogen and kept on dry ice until initial storage at ≤-70°C. Upon further processing, snap-frozen lung tissue samples were weighed and homogenized in 5 mL Trizol by an Ultra-Turrax® homogenizer. The tissue homogenate was centrifuged for 15 minutes at 3400g at 4°C and supernatants were aliquoted and stored at ≤-15°C. RNA extraction from the lung suspensions in Trizol was performed manually with individual columns of the Direct-zol Miniprep Kit (Zymogen, Irvine, CA, USA) following manufacturer instructions. The isolated RNA samples were stored at ≤-70°C until further use for analysis by SARS-CoV-2 qPCR to assess total viral RNA levels and subgenomic RNA levels. Viral RNA loads were measured by qPCR essentially as previously described 26 , using primer/probe sets for both total viral E-gene PCR 27 and subgenomic PCR (sgPCR) 28 . The former PCR detects all positive RNA species (genomic and subgenomic) containing the E-gene sequence, while the latter detects only the subgenomic species generated during active virus replication. Cytokine PCR Lung tissue samples were used for analyses with qPCR to assess mRNA expression levels of Th1 ( Ifng, Tnf, Il2, Il6 ) and Th2 ( Il4, Il13 ) cytokines. To that end, in study 1 the accessory lung lobe was submerged in 1 mL Trizol in a vial prefilled with lysing beads (matrix D, MP Biomedicals, Irvine, CA, USA). Subsequently the lobe was grinded using a Fastprep-24 instrument (MP Biomedicals) and then stored at ≤-70°C at WBVR until further processing. In study 2, the right cranial and middle lung lobes were used and were processed as described above (“Assessment of viral genome loads”). RNA extraction in both studies was performed as described above, using individual columns of the Direct-zol Miniprep Kit (Zymogen), according to manufacturer instruction, including a DNAse step performed on the columns to degrade host DNA. To prepare cDNA, 200 ng RNA per sample (study 1) or 100 ng RNA (study 2) was used as an input for a reverse transcription reaction, using the Superscript IV First-strand synthesis system Thermo Fisher Scientific, Waltham, MA, USA), following the manufacturer’s instructions. The cDNA reaction was performed on an Applied Biosystems 7500 Instrument with the following temperature conditions: 10 min at 23 o C (annealing step); 10 min at 50 o C (reverse transcription step); 10 min at 80 o C (denaturation); 4 o C (termination). For normalization, the reference genes RPL18 and Ywhaz were selected, following an initial screening of 6 housekeeping genes ( Rpl18, Rpl13, Pp1a, Ywhaz, B-actin, B2m ) and determining the two most stable ones with the GeNex Software v.7 (MultiD Analyses AB, Götenburg, Sweden). For the screening, half of the samples were used in study 1 and selection was confirmed on one third of the samples in study 2. Primer sequences and cycling conditions are provided in Tables 2 and 3. Primers were ordered at Biolegio (Nijmegen, The Netherlands). All PCRs were performed using Power SYBR Green PCR Master mix (Thermo Fisher Scientific) according to manufacturer’s instructions with 1:10 diluted sample cDNA and primer concentrations as indicated in Table 2 in a total reaction volume of 20 µl (study 1) or 50 µl (study 2). All PCRs were performed on an Applied Biosystems 7500 Instrument. Table 2. List of primer sequences, final primer concentrations and temperature conditions of the qPCRs. Gene Primer concentration (µM) Amplification temperature (°C) Forward sequence Reverse sequence Sequence source NCBI reference number of the transcript Rpl18 0,25 58 GTTTATGAGTCGCACTAACCG TGTTCTCTCGGCCAGGAA Zivcec et al. Journal of Immunological methods (2011) XM_005084699.3 Ywhaz 0,125 60 GAAGCGGAAGCAGGAGAAG TATTTGTGGGACAGCATGGA Self-developed, using Primer 3 software (on-line) AY569127.1 Il6 0,5 62 CCTGAAAGCACTTGAAGAATTCC GGTATGCTAAGGCACAGCACACT Self-developed, using Primer 3 software (on-line) XM_005087110.2 Il13 0,075 60 GCACTCTGGGTGACCGTAGT GCCCTCTGGTCTTGTGTGAT Self-developed, using Primer 3 software (on-line) XM_005067910.3 Tnf 0,25 60 TGAGCCATCGTGCCAATG AGCCCGTCTGCTGGTATCAC Espitia et al. BMC Immunology 2010 XM_005086799.3 Ifng 0,125 63 TGTTGCTCTGCCTCACTCAGG AAGACGAGGTCCCCTCCATTC Espitia et al. BMC Immunology 2010 NM_001281631 Il4 0,075 60 ACCGAGATGGTCGTACCAGA CACAGGGTCACCTCATGTTG Self-developed, using Primer 3 software (on-line) XM_005067769.2 Il2 0,125 60 AGTGCACCCACTTCAAGCTC GCCTTCTTGGGCATGTAAAA Self-developed, using Primer 3 software NM_001281629.1 Table 3. Cycling conditions for the qPCRs Stage Repetitions Temperature Time 1 1 95.0 °C 10:00 2 40 95.0 °C 0:15 XX.0 °C* 1:00 3** (Dissociation) 1 95.0 °C 0:15 60.0 °C 1:00 95.0 °C 0:15 60.0 °C 0:15 *This temperature is primer-specific and was optimized for each primer set. The relevant temperatures are listed in Table 2 (Amplification temperature). **Step 3 was used to generate dissociation curves. Quality of the PCRs and the generated fragments were evaluated per PCR run based on the melting curves. Samples that had PCR products with melting temperatures different than the expected PCR product were excluded from the analysis. Relative expression of the genes of interest (GOI) was determined with the ΔΔCT method 29 , using Rpl18 and Ywhaz as housekeeping genes for normalization. This method generates a unit-free number indicating expression of the GOI relative to a reference gene, taking variations among PCR plates into consideration. Before normalizing the GOI, the ΔCt values obtained for the two housekeeping genes were averaged. Standard curves for each gene were prepared by 5-fold serial dilutions of a sample pool, including pre-selected samples mixed in equal amounts ( Rpl18 , Ywhaz and Tnf ) or the sample pool was spiked with 5-fold serial dilutions of a synthetic DNA fragment (synthesized by GenScript Biotech, Piscataway, NJ, USA), encompassing the generated by PCR amplicon ( Il2, Il4, Il6, Il13 and Ifng ). A standard curve was included on each PCR test plate. Virus neutralization test Serial 3-fold dilutions of sera were prepared in duplicates, starting at 1:10 initial dilution. A standard dose of ~100 TCID 50 of SARS-CoV-2/human/NL/Lelystad/2020 was mixed with the serum dilutions and incubated for 1 hour. Subsequently, VERO-E6 cells were added to the mixture, at a density of 2x10 4 cells/well. The plates were incubated for 4 days at 37 o C and 5% CO 2 , after which cell monolayers were fixed with 4% formaldehyde, followed by a fixation with pure methanol (kept at -20°C) for additional safety and for cell permeabilization. Cell monolayers were then washed 3 times with PBS and stored at 4 o C until staining with an immunoperoxidase monolayer assay to visualize viral antigen, as described previously 26 . Briefly, cell monolayers were stained using primary anti-SARS-CoV-2 S1 (Wuhan strain) polyclonal antibody (custom-made by Davids Biotechnologie GmbH and obtained by immunization of rabbits with S1 protein; kindly provided by Dr. Berend Jan Bosch and Dr. Wentao Li, University of Utrecht, The Netherlands) and secondary HRP-conjugated anti-rabbit antibody (DAKO Cat# P0448). Both antibodies were diluted in PBS supplemented with 5% horse serum and incubated with the cell monolayer for 1h at RT. Between the incubation steps, cell monolayers were washed 3 times with PBS, supplemented with 0,5% Tween-80. Staining was visualized following 30-40 min incubation with AEC substrate (4 mg/ml AEC in DMSO), freshly dissolved in substrate buffer (0.05 M NaAc buffer, pH adjusted to 5.0 using 0.05 M HAc) in the following manner: 19 mL substrate buffer + 1 mL 4 mg/mL AEC + 50 µL 3% H 2 O 2 . Evaluation of staining was performed using a standard light microscope. The titer of each duplicate was determined as the average of the reciprocal value of the last dilution that showed ≥50% neutralization (lack of staining) in the well, evaluated by eye. The detection limit of the assay in this experimental setting was a titer of 5.7. All samples with undetectable titer were attributed a titer of 3.3. Enzyme-linked immunosorbent assay (ELISA) Anti-N and anti-S total IgG titers were determined by end-point dilutions of serum samples using a custom ELISA test. ELISA plates (medium bind, Greiner Bio-One, Krensmünster, Austria) were coated with 50 ng/well of either N or S protein (40588-V08B and 40589-V08B1 respectively, both purchased from Sino Biological, Beijing, China), dissolved in coating buffer (0.05M Na2CO3 and 0.05M NaHCO3, pH 9.6) overnight at 4 o C. Blocking was performed with StabilBlock (Surmodics, Eden Prairie, MN, USA) blocking buffer for 1h at 37 o C. Test sera and the secondary antibody were diluted in dilution buffer (PBS, supplemented with 0,05% Tween 20 and 5% bovine serum albumin, sterile filtered with 0,45 µm filter) and incubated on the plates for 1h at 37 o C with gentle agitation. Serum samples were serially diluted (2-fold dilution step), starting at dilution 1:50 (low positive sera), 1:200 (mid positive sera) or 1:1600 (high positive sera), based on a pilot test. As secondary antibody, anti-hamster IgG (Thermo Fischer Scientific Cat# HA6007) was used. For color development, TMB substrate (ImmunoChemistry Technologies, Davis, CA, USA) was added to the plates and incubated for 15 minutes at room temperature. Reaction was stopped with 0.5M sulphuric acid and OD values were measured at 450 nm on a SpectraMax ABS Plus spectrophotometer (VWR; Radnor, PA, USA). All reagents were added to the ELISA plate wells in a volume of 100 ul (except the blocking solution, which was added in a volume of 300 ul). Between all incubation steps, the plates were washed 2x3 times with wash buffer (distilled water, supplemented with 0,05% Tween 20). On each plate, the same negative and positive control were taken in duplicates. These controls consisted of pooled sera obtained from previous experiments involving naive hamsters or hamsters recovered from SARS-CoV-2 infection, respectively. The negative control was diluted 1:50 and the positive control was diluted 1:250 (N-ELISA) or 1:500 (S-ELISA). The positive and negative controls were used to determine an S/P (sample/positive control) ratio for each sample according to the formula: SP = (OD_SAMPLE - OD_NEG)/(OD_POS - OD_NEG ) For determination of the cut-off, nine pools were prepared from the serum samples obtained prior to vaccination of the current experiment. These pools were diluted 1:50 and taken along on each plate. The cut-off of the ELISA was defined as the average S/P ratio of these pools plus 3x the standard deviation (SD). The ELISA titers of the tested sera were determined as the log2 value of the last serum dilution that showed a S/P ratio above the detection limit. Samples for which the starting dilution of 1:50 was negative were assigned the log2 value of one (theoretical) reciprocal dilution step lower (1:25). Gene expression analysis in lung samples on the nCounter® platform Digital nCounter® technology (NanoString Technologies) was used to assess mRNA expression levels of selected genes (n=128) associated with Th1, Th2, Th17, and Treg pathways, and with genes associated with different immune cell types in hamster lungs. Custom nCounter panel selection was based on human and/or mouse genes from relevant pathway annotations in the human CAR-T (Chimeric antigen receptor T-cell) Characterization Panel (NanoString Technologies, Seattle, WA, USA), as well as on genes related to different immune cell types based on available literature for mice. In addition, n=3 reference genes identified as stable/suitable based on previous qRT-PCR analyses were included for normalization purposes ( Rpl13 , Rpl18 , and Ywhaz ). Hamster-specific probes for transcripts homologous to the selected genes were designed and manufactured by NanoString Technologies, resulting in a custom hamster Code Set. Total RNA was isolated from hamster lungs as described in section “Assessment of viral genome loads”. RNA concentrations were quantified with a Qubit™ RNA HS Assay Kit on a Qubit® 2.0 Fluorometer (Invitrogen) and the percentage of RNA fragments >200 nucleotides (“DV200”) was determined with an RNA screen tape on an Agilent Technologies 220 TapeStation.. Except for two samples from the mock-vaccinated group on DPI 4 (22.8% and 29.7%), the DV200 was >35% (range 35.1% - 91.2%). Multiplexed hybridization reactions were performed by Prof. Stephen Gordon and Dr. John A. Browne on an SFI-funded nCounter®MAX Analysis System (NanoString Technologies) at the UCD Veterinary Sciences Centre (Dublin, Ireland), according to manufacturer’s guidelines and as originally described by Geiss et al. 30 . Hybridization reactions contained 300 ng of total RNA in a 5 µl volume (except for all DPI 2 samples and DPI 4 samples of the re-challenge group, which contained 100 ng), as well as fluorescent barcode-labeled (reporter and capture) probes for endogenous and reference genes, six pairs of positive control probes, and eight pairs of negative control probes. Hybridized probes were loaded onto cartridges (n=12 per run) and imaged on the nCounter® MAX instrument. Analysis of raw RCC (Reporter Code Count) files was performed using nSolver Analysis Software (version 4.0) and nCounter Advanced Analysis Plugin (version 2.0.134). The analysis was run with standard settings, and included normalization, differential expression, and pathway scoring modules. Low count data were not excluded from the analysis. Automatic normalization of raw counts based on housekeeping (reference) gene abundance was performed by the software, leading to exclusion of Rpl13 as normalization probe. A probe annotation file for pathway enrichment analysis was provided by NanoString Technologies and was based on the nCounter® CAR-T characterization and host response panels. During basic analysis, all samples passed standard QC requirements regarding imaging, binding density, and positive control linearity. To analyze differential expression (DE), samples from all three treatment groups were analyzed separately per necropsy day (n=9) with the same settings described above. Either mock-vaccinated or re-challenge groups were used as categorial reference (baseline) in the ‘fast/recommended’ DE analysis module which fits all genes with a negative binomial model and fold changes as well as univariate p-values were calculated by the software. Normalized count data and pathway scores were visualized with GraphPad Prism. The web app ClustVis (https://biit.cs.ut.ee/clustvis/; Metsalu and Vilo, 2015) was used to for Principal Component Analysis (PCA) and generation of heatmaps. For heatmaps, normalized expression counts were ln(x)-transformed, centered around the mean per gene, and unit variance scaling was applied to rows. Rows were clustered using Manhattan distance and average linkage. Statistics Analysis of the relative body weight losses for both studies was performed on the data between 5 DPI and 7 DPI for the hamsters present in the study up to 7 DPI (Study 1: n=4, subgroup sacrificed on 13 DPI, Study 2: n=6, subgroups sacrificed on 8 and 10 DPI). This time window was chosen because it encompasses the period with the largest body weight loss in the control mock-vaccinated group. Each hamster’s relative body weight was quantified by calculating the area under the curve (AUC). Between-group comparisons of the AUCs were made with one-way analysis of variance (ANOVA). Activity wheel count analysis (Study 1) was performed on the data between 7 DPI and 10 DPI. This time window was chosen because it encompasses the period of activity recovery following the challenge-induced activity reduction. Data from 9 DPI was excluded from the analysis, because of an unexpected dip of activity in all groups, which was attributed to technical issue of unknown origin in the animal facility. Activity was analyzed by estimating the activity AUC and between groups comparisons were made by one-way ANOVA. The analysis was performed on log-transformed counts. Group means of the VNT titers, lung pathology parameters (relative lung weights, extent of lung histopathology lesions, severity of histopathology lung lesions sum scores), viral loads (total E gene PCR) and cytokine data for Study 1 were compared using two-way ANOVA, where DPI, group and interaction between DPI and group were assessed. Group means of the lung viral loads, as measured by subgenomic PCR on 5 DPI for Study 1 were compared with one-way ANOVA, since all values on 13 DPI were “0”. ELISA antibody titers for Study 2 on 0 DPI of the vaccinated and the re-challenged group were compared with a (non-parametric) Mann-Whitney test. In all cases where ANOVA was used, multiple comparisons were performed following a significant ANOVA test. ANOVA was applied with relaxed rule for data normality and variance equality. One-way ANOVA was followed by a Dunnett’s multiple comparison test between the control group (mock-vaccinated) and each of the treatment groups (Study 1) or between the vaccinated group and the two control groups (re-challenge and Mock-vaccinated, Study 2). Two-way ANOVA was followed by a Dunnett’s multiple comparison test (to determine differences between the control group (mock-vaccinated) and each of the treatment groups per necropsy day) or by Sidak’s multiple comparison’s test (to test for change over time within a group). To compare changes in kinetics of serology titers, pathological parameters and Th-pathways over time among groups (Study 2), a multivariate linear regression model (interaction Group:time) was used. To account for non-linear changes in time, we introduced natural spline terms to the time variable. Pairwise comparisons between the groups were corrected using the Tukey method. Standardly, an alpha of 0.05 and two-tailed tests were used. For all cases when multiple comparisons were made, the p-value was corrected for multiple comparisons. The ANOVA and the non-parametric tests were performed with GraphPad (San Diego, CA, USA) software Prism v. 9.4.0, and the multivariate linear regression modelling was performed with software R version 4.2.2 (Team R.C. R: A Language and Environment for Statistical Computing. Available online: https://www.R-project.org/). Data availability statement The source datasets used and analyzed during the current study are available from the corresponding authors on request. Results Study 1. Partial protection and no enhancement of clinical signs in FIWV-vaccinated animals after SARS-CoV-2 infection In the first study, four different immunization regimens with FIWV SARS-CoV-2 preparations were tested (Figure 1, upper panel) and one group of hamsters served as mock-vaccinated control (mock-vaccinated group). Following challenge infection, all groups exhibited loss of body weight (Figure 2a), which in the mock-vaccinated group was most pronounced between 5 and 7 DPI. Only the 2x high dose vaccine regimen showed significant reduction of body weight loss as compared to the mock-vaccinated group (Figure 2b). The hamsters of the 1x high dose group also trended towards a reduction in body weight loss albeit not significantly (Figure 2a and b). There was a reduction in activity post SARS-CoV-2 inoculation in all groups, starting from 2 DPI (Figure 2c and d). From 6 DPI onwards, activity increased and pre-inoculation activity levels were reached on 10 DPI. No statistically significant differences between the groups were found (Figure 2d). Furthermore, no aggravation of clinical signs was observed in vaccinated groups as compared with the mock-vaccinated group. Study 1. Vaccination resulted in minor reduction of lung viral loads after challenge and induced low to undetectable levels of neutralizing antibodies Viral loads in lung tissue samples were assessed by subgenomic (sg)RNA PCR, which is indicative for virus replication 28 . High viral loads were detected in lung tissue of the hamsters from the mock-vaccinated group collected at 5 DPI (9.32 log10 RNA copies per gram tissue on average) (Figure 2e). The vaccinated groups trended towards slightly decreased RNA loads, most obvious in the group vaccinated with the 2x high dose (Supplementary table S1). Differences between the treatment groups and the mock-vaccinated group were not significant. On 13 DPI, no sgRNA was detected anymore. Neutralizing antibodies were not detected in any of the pre-challenge sera (D31/D32), except in two samples with low titers (5.7 and 10) in the group vaccinated with 2x high dose regimen. All groups had measurable neutralizing titers post challenge and interestingly, no significant differences were observed between vaccinated and mock-vaccinated hamsters at 5 DPI (Figure 2f and Supplementary table S2). These results indicate that neither of the vaccination regimens provided sufficient priming of a neutralizing antibody response. Two of the groups, 1x high dose and 1x low dose, showed significant increase in titers between 5 and 13 DPI, and the 1x low dose group was the only one with higher titers than the mock-vaccinated animals at 13 DPI, indicating overall different kinetics between the groups that had received different vaccination regimens. Study 1: Evidence of enhanced lung pathology at 5 DPI in vaccinated hamsters On -1, 5 and 13 DPI, four animals per group were sacrificed and SARS-CoV-2-related lung lesions were evaluated. Relative lung weights of hamsters from all groups were comparable on -1 DPI. Hamsters in all treatment groups showed a significant increase in relative lung weight at 5 DPI, reflecting the presence of inflammatory responses in the lung (Figure 3a, significance annotation not shown). At 13 DPI lung weights had decreased again but did not reach baseline levels. The decrease was significant only in the 1x high dose group, suggestive of an inflammation process that is more acute and/or with different dynamics in this group. There were no significant differences in relative lung weights between any of the treatment groups and the mock-vaccinated group on either time points post challenge infection (5 or 13 DPI). However, lungs of most vaccinated hamsters trended towards a higher relative weight as compared with the mock-vaccinated group on 5 DPI and this trend was the most pronounced in the 1x high dose vaccinated group. No histopathological lesions were observed in any of the lungs before challenge infection (Figure 3b, -1 DPI). On 5 DPI, lungs of hamsters of all groups showed clear SARS-CoV-2-related histopathologic changes. Interestingly, the estimated extent of the lung lesions was the least prominent in the animals from the mock-vaccinated group, as compared to the vaccinated animals (Figure 3d and e and Supplementary table S3). The differences between the mock-vaccinated group and the two groups that had received single vaccinations were significant (Figure 3b). These results were confirmed in an independent evaluation performed by a second pathologist (Supplementary figure S1, R 2 = 0.94). Histopathological changes were further graded for six different parameters (see materials and methods). Overall, histopathological changes were present in all vaccination groups (Supplementary figure S2), but the cumulative (“sum”) severity score was the highest in the 1x high dose group (grade 3) compared to the mock-vaccinated group (grade 1 or 2) at 5 DPI (Figure 3c). The main lesions in the mock-vaccinated animals included mild to moderate thickening of alveolar walls, hemorrhages and alveolar infiltrates consisting of macrophages, granulocytes and to a lesser extent of lymphocytes (Figure 3d). These changes were often centered around the bronchiole (Figure 3e). The lungs of vaccinated animals showed more extensive and coalescing changes (Figure 3 f and g), characterized by severe type II pneumocyte proliferation (bulging cells with plump nuclei), prominent alveolar infiltrates of granulocytes, macrophages and to a lesser extent lymphocytes and plasma cells. Prominent hemorrhages (Figure 3h) and perivascular infiltrates up to 5 rows were also present (Figure 3i). The perivascular cuffs were mainly composed of mononuclear cells with fewer interspersed granulocytes. On 13 DPI, most histopathologic changes were resolved and there was only a mild type II pneumocyte hyperplasia with minimal perivascular infiltrates. There was no clear difference between the mock-vaccinated and the vaccination groups. Evaluation for virus infection of lung tissue collected on 5 DPI with immunohistochemistry (IHC) staining revealed viral nucleoprotein (N) expression in nearly all animals in lung tissues collected on 5 DPI, with a variable extent from grade 1 to grade 3 (Supplementary figure S3a). N-protein expression was mainly found in pneumocytes and alveolar macrophages and to a lesser extent in bronchi and bronchiole (data not shown). There were no significant differences between mock-vaccinated and vaccination groups and no correlation between the presence of viral antigen and the extent (Supplementary figure S3b) or severity (Supplementary figure S3c) of histological lesions. No nucleoprotein expression was detected by IHC on 13 DPI. Study 1: Cytokine gene expression in lungs reveals a Th2-skewed profile in vaccinated animals Expression of key Th1 and Th2 cytokines was quantified by qPCR (Figure 4). Ifng , Il6 and Il2 expression was elevated in all groups at 5 DPI and returned to (nearly) baseline levels at 13 DPI, while an increasing trend was observed for Tnf in time from -1 to 13 DPI. No significant differences amongst the groups were observed for any of these cytokines at any time point. Il4 and Il13 were markedly increased in all vaccination groups at 5 DPI with significantly differences in the groups 2x low dose (only Il4 ), 1x high dose and 1x low dose as compared to the mock-vaccinated animals. At 13 DPI, Il4 and Il13 mRNA levels returned to near baseline levels with no significant differences between groups. Collectively, Study 1 showed that the 1x high dose group had the most pronounced histopathology on 5 DPI, as well as significant upregulation of Th2-associated cytokines. Therefore, this vaccination regimen was selected for a follow-up experiment (Study 2), in which the kinetics of pathology and expression of genes associated with Th-type immune biases were evaluated. Study 2. Reduced relative body weight loss and no enhancement of clinical signs in vaccinated animals after SARS-CoV-2 infection In Study 2, one group of hamsters (n=15) was vaccinated once with high dose of FIWV. Two groups served as controls: one vaccinated with PBS (mock), and another was challenged with SARS-CoV-2 D614G three weeks prior challenge infection of all three groups with the same virus strain (re-challenge group) (Figure 1, lower panel). The first infection of the re-challenge group was monitored by evaluation of viral loads in oropharyngeal swabs (Supplementary figure S4). Similar to Study 1, post challenge, the highest relative body weight loss in the mock-vaccinated group was observed between 5 and 7 DPI (Figure 5a) and maximum weight loss was comparable (average of 14.9% and 15.9% for Study 1 and Study 2, respectively). The control re-challenged animals were protected from body weight loss. The vaccinated hamsters in this study lost significantly less body weight compared to mock-vaccinated animals, but significantly more than the fully protected re-challenged hamsters (Figure 5b). Study 2: Vaccination resulted in reduction of pulmonary viral loads after challenge and induced S-protein binding antibodies but no detectable levels of neutralizing antibodies Subgenomic RNA (sgRNA) in lung samples was not detectable in the re-challenged animals, indicating lack of active virus replication (Figure 5c). The vaccinated animals were positive for sgRNA in lungs collected on 2 and 4 DPI. From 6 DPI onwards, sgRNA was not detectable in the vaccinated animals any longer, while sgRNA was detected in all tested mock-vaccinated animals up to 8 DPI. No neutralizing antibodies (NA) were detected in the vaccinated group of animals prior challenge (Figure 5d), corroborating results obtained in Study 1. Following challenge, only one of three vaccinated animal had detectable NAs on 2 DPI and another one (out of three) on 4 DPI. From 6 DPI onwards, all vaccinated and all mock-vaccinated animals were already NAs positive. The overall kinetics of the NA responses of the vaccinated hamsters was similar to the hamsters of the mock-vaccinated group, and significantly different from the re-challenged group. All re-challenged animals had NAs already at 0 DPI, three weeks after the first virus inoculation (GMT=375, range 270 to 810) and titers increased further following re-challenge, three weeks after the first challenge. In contrast to the NAs, spike-binding IgG antibodies were found in all but one vaccinated hamster (Figure 5e) at 0 DPI, although titers were significantly lower and more variable than the titers in the re-challenged group. However, contrary to the NAs, the overall kinetics of the anti-spike (S) binding antibodies of the vaccinated hamsters was similar to the re-challenged hamsters and significantly different from the one in the naïve hamsters from the mock-vaccinated group. Anti-nucleoprotein (N) antibodies were found in 3 out of 15 of the vaccinated hamsters prior to challenge (Figure 5f). Titers of these antibodies increased earlier than in the hamsters of the mock-vaccinated group, but followed the same kinetics. The re-challenged group had the highest anti-N titers early after infection and the titers remained stable over time. Study 2: Accelerated lung pathology with more prominent perivascular infiltrates in vaccinated animals as compared to mock-vaccinated animals In study 2, the lung pathology was monitored over time by performing necropsies at 2, 4, 6, 8 and 10 DPI, thereby allowing for more detailed evaluation of pathology kinetics compared to study 1. Both on macroscopic level (based on relative lung weights, Figure 6a) and on histological level (based on extent and severity of pathological lesions, Figure 6b and c), the kinetics of pathological lesions was accelerated in the vaccinated group as compared to the mock-vaccinated group. The scores of all evaluated histopathological parameters increased earlier in the vaccinated group (between 2 and 6 DPI) (Figure 6a-f and Supplementary figure S5). These results corroborate the findings from study 1, where evaluation was performed at a single time point early after infection (5 DPI). Notably, SARS-CoV-2-related pathological lung changes in the mock-vaccinated group reached similar magnitude as in the vaccinated group, but at a later timepoint (at 8 DPI), when the lung pathological lesions in the vaccinated group were already resolving. However, two observations revealed more prominent lesions in the vaccinated, as compared to the mock-vaccinated hamsters. First, on macroscopic level, the peak in relative lung weight in the mock-vaccinated animals was observed at 6 DPI, but overall remained lower than in the vaccinated group (Figure 6a), suggestive of higher inflammation burden in the lungs of the vaccinated hamsters. Second, on histological level, the perivascular cuffing up to 6 DPI was consistently more pronounced in the vaccinated animals as compared to the mock-vaccinated animals and from 8 DPI decreased in both groups (Figure 6d, g-h and Supplementary figure S5). Perivascular infiltrates were composed of mononuclear cells intermingled with granulocytic cells (eosinophilic, heterophilic or neutrophilic) (Figure 6i). In the re-challenged group, hamsters displayed only mild histopathological changes characterized by a mild increase of inflammatory cells within the alveoli (throughout the whole observation period), mild thickening of the alveolar walls (between 4 and 10 DPI) and small perivascular infiltrates (observed only on 2 DPI) (Figure 7j and Supplementary figure S5). No other histopathological lesions were observed in this group. Viral protein expression in the lungs of the vaccinated animals clearly trended towards reduced expression over time as compared to the mock-vaccinated animals (Supplementary figure S6a). The immunohistochemistry scores (used to evaluate the spread of virus in lungs) and the results found by the sgRNA PCR correlated well in the vaccinated and the mock-vaccinated groups (Supplementary figure S6b). Similar to study 1, also in study 2 no correlation was observed between viral protein expression in lungs and extent or severity of histopathological lesions (Supplementary figure S6c and d). No viral protein expression was detected in any of the lungs of the re-challenged animals (Supplementary figure S6a). Study 2: Gene expression in lungs of vaccinated hamsters shows a predominant Th2 signatures early after infection A multiplex mRNA analysis of the local immune response to SARS-CoV-2 infection in hamster lungs was performed on n=128 selected genes that are associated with Th1, Th2, Th17 and Treg pathways, and with several immune cell populations (Supplementary table S4). Gene expression in lungs of vaccinated hamsters was more comparable to mock-vaccinated hamsters, than of the re-challenged animals, which showed a different expression pattern (Figure 7a). Principle component analysis (PCA) revealed that most samples of the re-challenge group clustered relatively close together regardless of the necropsy day (Figure 7b). This observation indicates limited consistent changes in gene expression of the surveyed transcripts over time in response to the second SARS-CoV-2 infection over time in this group. Based on the first PCA, samples of the vaccinated group from 2 DPI separated more clearly from the bulk of both the mock-vaccinated group and the re-challenge group from the same DPI, which points towards an earlier (“faster”) vaccine-dependent response on gene expression level in the immunized animals. Samples from 4 and 6 DPI formed separate clusters, but overlapped for both the vaccinated and the mock-vaccinated group. Samples obtained on 8 DPI were most variable and spread most heterogeneously. Samples taken on 10 DPI clustered closely with the re-challenge group, suggesting that gene expression changes in response to infection were already attenuated at this point. Pathway analysis revealed that the Th1, Th2, Th17 and Treg pathways were differently regulated in the mock-vaccinated and the vaccinated groups as compared to the re-challenge group (Figure 7c). Notably, they followed a similar trend over time: Th1, Th17 and Treg pathways were downregulated, while Th2 pathway was up-regulated in both groups. The Th2 pathway upregulation had similar kinetics over time in both groups. However, the magnitude of activation was significantly higher in the vaccinated group on 2 DPI, and still higher (without reaching significance) on 4 DPI (Figure 7c). Expression levels of individual genes corroborated the pathways score, since transcripts associated with Th2-skewing of the immune response were upregulated in the vaccinated group predominantly early after infection (2 and 4 DPI) (Figure 7d). There was a marked upregulation of the Th2-accosiated cytokines Il4 and IL13 in this group as measured by both nCounter technology and qPCR (Supplementary figure S7). Although the correlation between the two measurements (qPCR and nCounter) was moderate (R 2 =0.45 for Il4, R 2 =0.19 for Il13) , both revealed the same trend early post infection (2 and 4 DPI) (Supplementary figure S7). Furthermore, the chemokine Ccl-22 was markedly increased (Figure 7d). This chemokine is mainly expressed by macrophages and dendritic cells 31 and attracts Th2-polarized lymphocytes via their CCR4 receptor 32 . The Th1 pathway differed in kinetics between the vaccinated and the mock-vaccinated group, showing a faster recovery in the former group (Figure 7c), which coincided with significant upregulation of several genes associated with Th1/Th17-response on 6 DPI and 8 (Figure 7d). Similar to Study 1, individually measured transcripts of Ifng, Tnf, Il6 and Il2 did not show clear differences between the vaccinated and the mock-vaccinated animals (Figure S9). The Th17 pathway was the least activated in the vaccinated group at 2 DPI, and overlapped with the mock-vaccinated group at later timepoints (Figure 7c). In contrast, the Treg pathway score overlapped for the vaccinated and mock-vaccinated group early post infection (2 and 4 DPI), but showed a trend of faster recovery in the vaccinated group from 6 DPI onwards (Figure 7c). Transcripts associated with the Th17 and the Treg pathways were heterogeneously represented, with some genes upregulated and some downregulated in the vaccinated group (Figure 7d). Next to the Th pathway-associated genes, a significant upregulation of a cluster of genes associated with immune cells was also observed in the vaccinated group, most prominently on 4 and 6 DPI (Figure 7d). Of note, this coincided with the increased perivascular cuffing observed in this group (Figure 6d). Transcripts associated with T-cells and cytotoxic cells were enriched mainly at 6 and 8 DPI, which correlated with the faster activation of the Th1 and the Treg pathways in vaccinated animals (Figure 7b). Transcripts associated with neutrophils and macrophages were less abundant in the vaccinated group at 4 and 6 DPI, respectively. Given the pronounced cellular infiltration of the lungs of the hamsters in the vaccinated group at these time points, this finding most likely reflects changing ratios between cell populations, rather than increased abundance of macrophages and neutrophils in absolute numbers. Discussion Vaccine Associated Enhanced Disease (VAED) is a well-described phenomenon in the context of formalin-inactivated whole virus vaccines against human respiratory syncytial virus (HRSV) and measles virus (MeV) used in the 1960s 7,33 . However, a unified definition of this phenomenon remains challenging. In 2021, a case definition of the term ‘‘Vaccine Associated Enhanced Disease” was proposed by a group of experts within the Brighton Collaboration, summoned by the Coalition for Epidemic Preparedness Innovations (CEPI) in the context of active development of vaccines for SARS-CoV-2 vaccines and other emerging pathogens 1 . According to the definitions from this working group, a probable case of VAED of a previously seronegative vaccinated individual is characterized by the following criteria: i) Laboratory confirmed infection with the pathogen targeted by the vaccine; AND ii) Clinical findings of disease involving one or more organ systems (a case of VAERD (vaccine-associated enhanced respiratory disease) if the lung is the primarily affected organ); AND iii) Severe disease as evaluated by a clinical severity index/score (systemic in VAED or specific to the lungs in VAERD); AND iv) Increased frequency of severe outcomes (including severe disease, hospitalization and mortality) when compared to a mock-vaccinated population (control group or background rates); AND v) Evidence of immunopathology in target organs involved by histopathology, when available, including among others: present or elevated tissue eosinophils in tissue and elevated pro-inflammatory Th2 cytokines in tissue (IL4, IL5, IL10, IL13) AND the absence of identified alternative etiology 34 ). Early in the COVID-19 pandemic, it was disputed whether Syrian hamsters were a suitable model for studying VAED in the context of candidate SARS-CoV-2 vaccines. These doubts were based on previous results obtained in hamsters in the context of SARS-CoV infection 13,35 . Recently, a study in golden Syrian hamsters vaccinated with formalin-inactivated whole SARS-CoV-2-based vaccine preparation showed no evidence of enhanced pathology of vaccinated hamsters at 4 DPI 20 . In that study, an unadjuvanted vaccine preparation was used, and neutralizing antibodies were measurable prior to challenge. In contrast, in another study in golden Syrian hamsters designed to promote the emergence of VAED by using as a vaccine a non-stabilized SARS-CoV-2 spike protein adjuvanted with aluminum hydroxide, did report a VAED associated with up-regulation of Th2 cytokines (IL-4, IL-5 and IL-13), inadequate levels of neutralizing antibodies and presence of non-neutralizing antibodies 23 . The results of this study are in line with he definition for VAED cited above, and with our findings in both performed studies. We consistently observed aggravated lung pathology, associated with increased perivascular infiltration of mononuclear cells and granulocytes, and the upregulation of Th2 cytokines (IL-4 and IL-13) in lung tissue of vaccinated hamster when compared to naïve hamsters. We did not detect an increased severity or frequency of clinical outcomes. However, to our knowledge, clinical aggravation has never been reported in animal models in the context of SARS-CoV-2. In our first study, animals were sacrificed at 5 or 13 DPI. The study showed a transiently enhanced severity of pathological lesions in the vaccinated hamsters at 5 DPI, as compared to the mock-vaccinated hamsters. However, it shed insufficient light on the kinetics of the observed processes. Therefore, in the second study, the development of lung pathology was followed over time. It became evident that the kinetics and types of lesions of the pathological changes is what distinguished the vaccinated from the mock-vaccinated hamsters, and not necessarily the overall severity of histological lung lesions. The pathological lesions associated with the vaccination had accelerated kinetics, manifesting with faster exacerbation, followed also by faster recovery as compared to the mock-vaccinated group. An important exception to the overall trend of faster recovery in the vaccinated animals were the perivascular infiltrates, which remained most pronounced in these animals up to 6 DPI, and gene expression profiles showing enrichment of immune cell-associated transcripts up to 8 DPI. The perivascular infiltrates consisted of mononuclear cell and several granulocyte cell types (eosinophilic, heterophilic or neutrophilic). Eosinophils are known to play an important role in the vaccine-associated immunopathology of the lung. However, in hamsters, it is particularly challenging to distinguish eosinophils from other types of granulocytes. The predominant type of granulocyte in blood of hamsters are neutrophilic granulocytes 36 , which are also known as pseudoeosinophils or heterophils, because their granules stain with eosin 37 . True eosinophils compose only a small percentage of the blood cell fraction and differentiation from neutrophils based on their morphology is unreliable 38 . Additional staining methods have been suggested to discriminate eosinophils from neutrophils/heterophils 23,39 . However, we were unable to establish a satisfactory method for eosinophil-specific differentiation. Furthermore, dense inflammatory infiltrates in both naïve and vaccinated hamsters further complicated the differentiation between eosinophils and neutrophils. Therefore, here we did not discriminate between the different types of granulocytes in the histology analysis. Overall, we observed more pronounced infiltrates in the perivascular space with an increase in eosinophilic and heterophilic/neutrophilic cell populations in the vaccinated hamsters as compared to the mock-vaccinated hamsters. Concurrent with the accelerated lung histopathology, gene expression profiles revealed more prominent Th2 skewing of the immune response in the vaccinated compared with mock-vaccinated hamsters early after infection (2 and 4 DPI). This activation was associated with increased production of the Th2 cytokines IL-4 and IL-13, and the chemokine CCL-22. Despite this early and stronger skewing of the immune response towards a Th2 phenotype, the vaccinated hamsters recovered faster in terms of Th1 and Treg regulation, and from histological lesions observed in the lung. By 10 DPI histological changes were largely resolved and expression of the genes associated with Th-pathways and immune cells were comparable in re-challenged, mock-vaccinated and vaccinated animals. This observation contrasts with results found in mice with both SARS-CoV and SARS-CoV-2, where enhanced lung histology accompanied by pronounced eosinophilic infiltration was observed at 10 DPI in association with vaccination 22,40,41 , underscoring species-specific differences in the animal models used for preclinical studies. Intriguingly, in a recent work in ACE2‐humanized mice, local and systemic upregulation of Th17 was reported at 7 DPI in animals vaccinated with S1 and S2 extracellular domain of the SARS‐CoV‐2 Spike protein, adjuvanted with alum 24 . This finding contrasts our results in hamsters. From all genes associated with differential T-cell regulation, the selected genes associated with the Th17 pathway were the most abundant (Supplementary table S4), yet the only difference between vaccinated and mock-vaccinated animals was observed very early post infection (at 2 DPI), when the Th17 pathway was the least activated in the vaccinated group. The observed difference could be a result of species differences, dissimilar vaccines used, and the distinct challenge used in the mouse study, namely first a low dose, followed three days later by a high dose of the same challenge virus. In our studies, we established the presence of binding, but the absence of neutralizing antibodies in the vaccinated hamsters. Antibody disease enhancement (ADE) mediated by vaccine-induced non-protective antibodies is well-studied for HRSV, measles and DENV (summarized by 1 ). For SARS-CoV-2, in vitro evidence for antibody-mediated enhanced cell entry has been found in experiments with human lymphoid cell lines and in other cell lines expressing Fcγ receptor or hACE2 receptor (reviewed by 42 ). In human macrophages however, despite Fcγ-mediated internalization of SARS-CoV-2, the virus is uncapable of productive replication in those cells 42 , arguing against the possibility of a direct macrophage-driven ADE. Furthermore, when antibodies found to be enhancing in vitro were administered to mice and NHP, no disease or pathology enhancement in vivo was observed 43 . These results in preclinical models, together with studies proposing antibody effector functions other than neutralization playing a role in preventing of ADE manifestation 42,44-46 , suggest that the accelerated pathology observed in our study is not a sole result of the presence of non-protective antibodies. Rather, a combination of lack of neutralizing antibodies, a Th-2 skewed immune response, and the presence of non-protective antibodies facilitating possible immune complexes formation seem to be responsible for the lung pathology in vaccinated hamsters. With respect to the nucleoprotein (N) and anti-N antibodies, it has been shown that the N protein has the ability of inducing macrophages to produce high levels of IL-6, one of the cytokines associated with severe disease in COVID-19 patients 47 . Moreover, the N protein aggravates lung injury and promotes IL-1β and IL-6 secretion in mouse models 48 . Anti-N antibodies enhanced the effect of N on IL-6 production by macrophages 49 and sera from patients with severe COVID-19 had high concentration of anti-N IgG 50 . However, in our hamster model, only 3 vaccinated animals had detectable levels of anti-N antibodies prior to challenge. Although anti-N antibodies increased earlier in vaccinated hamsters, the overall kinetics followed the same slope as in mock-vaccinated hamsters. Moreover, we did not observe increased production of IL-6 on transcriptional level in vaccinated as compared with mock-vaccinated animals. Collectively, these findings suggest that anti-N antibodies did not play a role in the accelerated lung pathology in our hamster model. One point of attention indicated by Munoz et al is the importance of methodically clearing challenge materials and vaccines from cellular debris, which may otherwise enhance reactogenicity in animal models and bias observations 1 . In our study, significant effort was devoted to purifying the vaccine preparation from culture contaminants to avoid sensitization of vaccinated animals towards those contaminants, but the inoculum itself was administered unpurified. In that context, it cannot be ruled out entirely that the accelerated Th-2-enhanced response is (partially) associated with sensitization towards inoculum contaminants. However, if that would be the case, double vaccination regimen would be expected to manifest with stronger pathological response towards challenge infection, but we did not observe such a trend in our first study. Therefore, it is unlikely that sensitization towards inoculum contaminants can explain the Th-2 polarization and the accelerated lung pathology in vaccinated hamsters. To avoid concerns about challenge inoculum purification, a standardized transmission model can be considered for future studies exploring VAED. The study presents several limitations. We chose to perform a gene expression survey with pre-selected genes, instead of complete transcriptomics analysis. The power of such a survey is the focused inquiry of target genes of interest. However, at the time of selecting gene target for our study, information about the hamster genome, and genes of interest in the context of SARS-CoV-2 infection were still largely unavailable. Therefore, some of the genes identified by Ebenig et al 23 as important players behind the VAED mechanism (i.e. IL19 and CCL-11) or by Nouallies et al 51 as genetic markers for immune cells were not included in our custom multiplexed hybridization panel, which can be recognized as a limitation. Another limitation of our study is the translatability of the obtained data in hamsters to the human situation. Up to date, there is no evidence of vaccine-associated disease enhancement in humans following natural infection with SARS-CoV-2. Given the vast number of people that have been vaccinated with different types of inactivated vaccines during the pandemic, it is relatively safe to state that even if VAED did occur, it is of limited importance in the context of SARS-CoV-2. It is however important to have readily available models in which safety of new vaccines for SARS-CoV-2 or other pathogens can be tested 1 . In conclusion, our data support the hypothesis that Syrian hamsters are a suitable model for inducing VAED with whole-virus FIWV adjuvanted with alum. The VAED is manifested with early upregulation of Th-2 cytokines (IL-4 and IL-13) and chemokines (CCL-22) and faster progression of immunopathology, characterized by more pronounced and prolonged perivascular infiltrates, dominated by eosinophilic and heterophilic/neutrophilic cell species. Hamsters did not display clinical disease aggravation, virtually lacked neutralizing antibodies before challenge and had spike-binding antibodies. Declarations Funding This research was funded by the Coalition for Epidemic Preparedness Innovations (CEPI). Author Contribution R.dJ. performed the two experiments, N.O., S.V., R.dJ, and K.W. wrote the main manuscript, K.B. and Y.H. prepared and characterized the experimental vaccine preparation, N.O., R.dJ and N.G designed the experiment, J.L.G. performed the statistical analysis, N.O., R.dJ, S.V., J.S., M.C. and K.W. analysed the data, all authors participated in data interpretation and have read and approved the submitted version of the manuscript. Acknowledgement AcknowledgementsWe thank Berend Jan Bosch and Wentao Li (University of Utrecht, The Netherlands) for providing us the anti-spike S1 antibody used in this study for staining of the cell monolayers in the virus neutralization assay. Illustrations in Figure 1 were created with BioRender.com. We thank Stephen Gordon and John Browne (UCD Veterinary Sciences Centre, Dublin, Ireland) for performing the measurements on the nCounter®MAX Analysis System (NanoString Technologies, Seattle, WA, USA). We are grateful to all animal biotechnicians, laboratory and pathology colleagues of Wageningen Bioveterinary Research for their excellent work and support. We thank Amy C. Shurtleff, Trevor Brasel, Victoria Graham, William Dowling and Javier Castillo-Olivares from CEPI (Coalition for Epidemic Preparedness Innovations) for sharing ideas and expertise on study design and data interpretation. Finally, we would like to honour the memory of Robert D. Small, who was instrumental in designing and statistical analysis of the experiments included in this work. His inspirational attitude and ingenious insights into the use of statistics for (pre) clinical study designs are greatly missed.FundingThis research was funded by the Coalition for Epidemic Preparedness Innovations (CEPI). References Munoz, F. M. et al. Vaccine-associated enhanced disease: Case definition and guidelines for data collection, analysis, and presentation of immunization safety data. Vaccine 39, 3053–3066 (2021). https://doi.org:10.1016/j.vaccine.2021.01.055 Kim, H. W. et al. Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine. Am J Epidemiol 89, 422–434 (1969). https://doi.org:10.1093/oxfordjournals.aje.a120955 Delgado, M. F. & Polack, F. P. Involvement of antibody, complement and cellular immunity in the pathogenesis of enhanced respiratory syncytial virus disease. Expert Rev Vaccines 3, 693–700 (2004). https://doi.org:10.1586/14760584.3.6.693 Bigay, J., Le Grand, R., Martinon, F. & Maisonnasse, P. Vaccine-associated enhanced disease in humans and animal models: Lessons and challenges for vaccine development. Front Microbiol 13, 932408 (2022). https://doi.org:10.3389/fmicb.2022.932408 Smatti, M. K., Al Thani, A. A. & Yassine, H. M. Viral-Induced Enhanced Disease Illness. Front Microbiol 9, 2991 (2018). https://doi.org:10.3389/fmicb.2018.02991 Gartlan, C. et al. Vaccine-Associated Enhanced Disease and Pathogenic Human Coronaviruses. Front Immunol 13, 882972 (2022). https://doi.org:10.3389/fimmu.2022.882972 Polack, F. P. Atypical measles and enhanced respiratory syncytial virus disease (ERD) made simple. Pediatr Res 62, 111–115 (2007). https://doi.org:10.1203/PDR.0b013e3180686ce0 Moghaddam, A. et al. A potential molecular mechanism for hypersensitivity caused by formalin-inactivated vaccines. Nat Med 12, 905–907 (2006). https://doi.org:10.1038/nm1456 Brewer, J. M. (How) do aluminium adjuvants work? Immunol Lett 102, 10–15 (2006). https://doi.org:10.1016/j.imlet.2005.08.002 HogenEsch, H. Mechanisms of stimulation of the immune response by aluminum adjuvants. Vaccine 20 Suppl 3, S34–39 (2002). https://doi.org:10.1016/s0264-410x(02)00169-x Wang, Q. et al. Correction: Immunodominant SARS Coronavirus Epitopes in Humans Elicited Both Enhancing and Neutralizing Effects on Infection in Non-human Primates. ACS Infect Dis 6, 1284–1285 (2020). https://doi.org:10.1021/acsinfecdis.0c00148 Bolles, M. et al. A double-inactivated severe acute respiratory syndrome coronavirus vaccine provides incomplete protection in mice and induces increased eosinophilic proinflammatory pulmonary response upon challenge. J Virol 85, 12201–12215 (2011). https://doi.org:10.1128/JVI.06048-11 Tseng, C. T. et al. Immunization with SARS coronavirus vaccines leads to pulmonary immunopathology on challenge with the SARS virus. PLoS One 7, e35421 (2012). https://doi.org:10.1371/journal.pone.0035421 Deming, D. et al. Vaccine efficacy in senescent mice challenged with recombinant SARS-CoV bearing epidemic and zoonotic spike variants. PLoS Med 3, e525 (2006). https://doi.org:10.1371/journal.pmed.0030525 Yasui, F. et al. Prior immunization with severe acute respiratory syndrome (SARS)-associated coronavirus (SARS-CoV) nucleocapsid protein causes severe pneumonia in mice infected with SARS-CoV. J Immunol 181, 6337–6348 (2008). https://doi.org:10.4049/jimmunol.181.9.6337 Liu, L. et al. Anti-spike IgG causes severe acute lung injury by skewing macrophage responses during acute SARS-CoV infection. JCI Insight 4 (2019). https://doi.org:10.1172/jci.insight.123158 Agrawal, A. S. et al. Immunization with inactivated Middle East Respiratory Syndrome coronavirus vaccine leads to lung immunopathology on challenge with live virus. Hum Vaccin Immunother 12, 2351–2356 (2016). https://doi.org:10.1080/21645515.2016.1177688 Li, K. et al. Single-Dose, Intranasal Immunization with Recombinant Parainfluenza Virus 5 Expressing Middle East Respiratory Syndrome Coronavirus (MERS-CoV) Spike Protein Protects Mice from Fatal MERS-CoV Infection. mBio 11 (2020). https://doi.org:10.1128/mBio.00554-20 Bewley, K. R. et al. Immunological and pathological outcomes of SARS-CoV-2 challenge following formalin-inactivated vaccine in ferrets and rhesus macaques. Sci Adv 7, eabg7996 (2021). https://doi.org:10.1126/sciadv.abg7996 Li, C. et al. Absence of Vaccine-enhanced Disease With Unexpected Positive Protection Against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) by Inactivated Vaccine Given Within 3 Days of Virus Challenge in Syrian Hamster Model. Clin Infect Dis 73, e719-e734 (2021). https://doi.org:10.1093/cid/ciab083 DiPiazza, A. T. et al. COVID-19 vaccine mRNA-1273 elicits a protective immune profile in mice that is not associated with vaccine-enhanced disease upon SARS-CoV-2 challenge. Immunity 54, 1869–1882 e1866 (2021). https://doi.org:10.1016/j.immuni.2021.06.018 Iwata-Yoshikawa, N. et al. A lethal mouse model for evaluating vaccine-associated enhanced respiratory disease during SARS-CoV-2 infection. Sci Adv 8, eabh3827 (2022). https://doi.org:10.1126/sciadv.abh3827 Ebenig, A. et al. Vaccine-associated enhanced respiratory pathology in COVID-19 hamsters after TH2-biased immunization. Cell Rep 40, 111214 (2022). https://doi.org:10.1016/j.celrep.2022.111214 Zhang, T. et al. Th2 and Th17-associated immunopathology following SARS-CoV-2 breakthrough infection in Spike-vaccinated ACE2-humanized mice. J Med Virol 96, e29408 (2024). https://doi.org:10.1002/jmv.29408 Percie du Sert, N. et al. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol 18, e3000410 (2020). https://doi.org:10.1371/journal.pbio.3000410 Gerhards, N. M. et al. Predictive Value of Precision-Cut Lung Slices for the Susceptibility of Three Animal Species for SARS-CoV-2 and Validation in a Refined Hamster Model. Pathogens 10 (2021). https://doi.org:10.3390/pathogens10070824 Corman, V. M. et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill 25 (2020). https://doi.org:10.2807/1560-7917.ES.2020.25.3.2000045 Wolfel, R. et al. Virological assessment of hospitalized patients with COVID-2019. Nature 581, 465–469 (2020). https://doi.org:10.1038/s41586-020-2196-x Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29, e45 (2001). https://doi.org:10.1093/nar/29.9.e45 Geiss, G. K. et al. Direct multiplexed measurement of gene expression with color-coded probe pairs. Nat Biotechnol 26, 317–325 (2008). https://doi.org:10.1038/nbt1385 Godiska, R. et al. Human macrophage-derived chemokine (MDC), a novel chemoattractant for monocytes, monocyte-derived dendritic cells, and natural killer cells. J Exp Med 185, 1595–1604 (1997). https://doi.org:10.1084/jem.185.9.1595 Imai, T. et al. Selective recruitment of CCR4-bearing Th2 cells toward antigen-presenting cells by the CC chemokines thymus and activation-regulated chemokine and macrophage-derived chemokine. Int Immunol 11, 81–88 (1999). https://doi.org:10.1093/intimm/11.1.81 Polack, F. P., Hoffman, S. J., Crujeiras, G. & Griffin, D. E. A role for nonprotective complement-fixing antibodies with low avidity for measles virus in atypical measles. Nat Med 9, 1209–1213 (2003). https://doi.org:10.1038/nm918 Heininger, U. et al. The concept of vaccination failure. Vaccine 30, 1265–1268 (2012). https://doi.org:10.1016/j.vaccine.2011.12.048 Roberts, A. et al. Immunogenicity and protective efficacy in mice and hamsters of a beta-propiolactone inactivated whole virus SARS-CoV vaccine. Viral Immunol 23, 509–519 (2010). https://doi.org:10.1089/vim.2010.0028 Lindstrom, N. M., Moore, D. M., Zimmerman, K. & Smith, S. A. Hematologic Assessment in Pet Rats, Mice, Hamsters, and Gerbils: Blood Sample Collection and Blood Cell Identification. Clin Lab Med 35, 629–640 (2015). https://doi.org:10.1016/j.cll.2015.05.011 Fingerhut, L., Dolz, G. & de Buhr, N. What Is the Evolutionary Fingerprint in Neutrophil Granulocytes? Int J Mol Sci 21 (2020). https://doi.org:10.3390/ijms21124523 Siegel, A. & R, M. W. Hematology and Biochemistry of Small Mammals. Ferrets, Rabbits, and Rodents, 569–582 (2020). Tomasi, V. H., Perez, M. A. & Itoiz, M. E. Modification of Luna's technique for staining eosinophils in the hamster cheek pouch. Biotech Histochem 83, 147–151 (2008). https://doi.org:10.1080/10520290802352424 Sekimukai, H. et al. Gold nanoparticle-adjuvanted S protein induces a strong antigen-specific IgG response against severe acute respiratory syndrome-related coronavirus infection, but fails to induce protective antibodies and limit eosinophilic infiltration in lungs. Microbiol Immunol 64, 33–51 (2020). https://doi.org:10.1111/1348-0421.12754 Iwata-Yoshikawa, N. et al. Effects of Toll-like receptor stimulation on eosinophilic infiltration in lungs of BALB/c mice immunized with UV-inactivated severe acute respiratory syndrome-related coronavirus vaccine. J Virol 88, 8597–8614 (2014). https://doi.org:10.1128/JVI.00983-14 Nakayama, E. E. & Shioda, T. SARS-CoV-2 Related Antibody-Dependent Enhancement Phenomena In Vitro and In Vivo. Microorganisms 11 (2023). https://doi.org:10.3390/microorganisms11041015 Li, D. et al. In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies. Cell 184, 4203–4219 e4232 (2021). https://doi.org:10.1016/j.cell.2021.06.021 Bournazos, S., Gupta, A. & Ravetch, J. V. The role of IgG Fc receptors in antibody-dependent enhancement. Nat Rev Immunol 20, 633–643 (2020). https://doi.org:10.1038/s41577-020-00410-0 Schafer, A. et al. Antibody potency, effector function, and combinations in protection and therapy for SARS-CoV-2 infection in vivo. J Exp Med 218 (2021). https://doi.org:10.1084/jem.20201993 Blue, C. E., Spiller, O. B. & Blackbourn, D. J. The relevance of complement to virus biology. Virology 319, 176–184 (2004). https://doi.org:10.1016/j.virol.2003.11.029 Karwaciak, I., Salkowska, A., Karas, K., Dastych, J. & Ratajewski, M. Nucleocapsid and Spike Proteins of the Coronavirus SARS-CoV-2 Induce IL6 in Monocytes and Macrophages-Potential Implications for Cytokine Storm Syndrome. Vaccines (Basel) 9 (2021). https://doi.org:10.3390/vaccines9010054 Pan, P. et al. SARS-CoV-2 N protein promotes NLRP3 inflammasome activation to induce hyperinflammation. Nat Commun 12, 4664 (2021). https://doi.org:10.1038/s41467-021-25015-6 Nakayama, E. E. et al. Anti-nucleocapsid antibodies enhance the production of IL-6 induced by SARS-CoV-2 N protein. Sci Rep 12, 8108 (2022). https://doi.org:10.1038/s41598-022-12252-y Batra, M. et al. Role of IgG against N-protein of SARS-CoV2 in COVID19 clinical outcomes. Sci Rep 11, 3455 (2021). https://doi.org:10.1038/s41598-021-83108-0 Nouailles, G. et al. Temporal omics analysis in Syrian hamsters unravel cellular effector responses to moderate COVID-19. Nat Commun 12, 4869 (2021). https://doi.org:10.1038/s41467-021-25030-7 Additional Declarations No competing interests reported. Supplementary Files DeJongetalSupplementarydataNPJ.pdf Cite Share Download PDF Status: Published Journal Publication published 04 Jul, 2025 Read the published version in npj Vaccines → Version 1 posted Editorial decision: Revision requested 26 Jan, 2025 Reviews received at journal 19 Jan, 2025 Reviewers agreed at journal 27 Dec, 2024 Reviews received at journal 06 Dec, 2024 Reviewers agreed at journal 17 Nov, 2024 Reviewers agreed at journal 17 Nov, 2024 Reviewers invited by journal 15 Nov, 2024 Editor assigned by journal 15 Nov, 2024 Submission checks completed at journal 08 Nov, 2024 First submitted to journal 13 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5254288","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":379039301,"identity":"a7e3f9d6-0a65-4eed-aff8-cbe971274730","order_by":0,"name":"Rineke Jong","email":"","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":false,"prefix":"","firstName":"Rineke","middleName":"","lastName":"Jong","suffix":""},{"id":379039302,"identity":"d99c6745-dcdf-450a-b0e2-1f743bdeebb0","order_by":1,"name":"Sandra Vreman","email":"","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":false,"prefix":"","firstName":"Sandra","middleName":"","lastName":"Vreman","suffix":""},{"id":379039303,"identity":"1421a5ce-0019-4b8d-ab63-2dd56a46bbfc","order_by":2,"name":"Katrin E. Wiese","email":"","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":false,"prefix":"","firstName":"Katrin","middleName":"E.","lastName":"Wiese","suffix":""},{"id":379039304,"identity":"a93331e6-9910-4832-9fe0-ca34577ed4ce","order_by":3,"name":"Nora M. Gerhards","email":"","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":false,"prefix":"","firstName":"Nora","middleName":"M.","lastName":"Gerhards","suffix":""},{"id":379039305,"identity":"26417954-57a9-416b-b38f-f7df1d4f6cdf","order_by":4,"name":"Kevin Bewley","email":"","orcid":"","institution":"United Kingdom Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Kevin","middleName":"","lastName":"Bewley","suffix":""},{"id":379039306,"identity":"e7aaee11-59d2-41a3-95ff-ee2b387e47f5","order_by":5,"name":"Yper Hall","email":"","orcid":"","institution":"United Kingdom Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Yper","middleName":"","lastName":"Hall","suffix":""},{"id":379039307,"identity":"aba29cb8-5efa-4cad-8049-128a2aaf34b6","order_by":6,"name":"Francisco Javier Salguero","email":"","orcid":"","institution":"United Kingdom Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Francisco","middleName":"Javier","lastName":"Salguero","suffix":""},{"id":379039308,"identity":"3d50f12b-3229-412d-9772-357e218a8b6a","order_by":7,"name":"Miles Carroll","email":"","orcid":"","institution":"The University of Oxford","correspondingAuthor":false,"prefix":"","firstName":"Miles","middleName":"","lastName":"Carroll","suffix":""},{"id":379039309,"identity":"1af62eb9-82b9-4f47-9ac9-1e7287dd6942","order_by":8,"name":"Rik L. de Swart","email":"","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":false,"prefix":"","firstName":"Rik","middleName":"L.","lastName":"de Swart","suffix":""},{"id":379039310,"identity":"87b3671f-cdd6-4d37-8d83-c119a2d075a0","order_by":9,"name":"Jose L. Gonzales","email":"","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":false,"prefix":"","firstName":"Jose","middleName":"L.","lastName":"Gonzales","suffix":""},{"id":379039311,"identity":"ddd79798-26c6-45b9-b98b-cf3288a11955","order_by":10,"name":"Nadia Oreshkova","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6ElEQVRIie3NsQrCMBCA4UjWQFcF0Ve4EhCFoq+iFNKl1Y4FB510EVzrWyiCq5EMLpGuGQXByUE3BwetioPQ1NEhPyFwhC+HkMn0hwFPzzOC07vyGsJsUv8m9P1VNnH45/VFOsNcshULfkVOz7J2Ai6jpjdXwR6HGlKTLNxMEGvM4q7bmY3cYK48wLGOcB84QQJAESqIxMFKMYSJhtDkBJvbg7QSmZKBV8sjtvJBPLcgn7okEu0fyDEUZWBQVD6142hrr+URCR2BxF1eTpED1lTS4hn61dKYFQ4kyiZv+DXzPGAymUwmfXevfFEniln02AAAAABJRU5ErkJggg==","orcid":"","institution":"Wageningen University \u0026 Research","correspondingAuthor":true,"prefix":"","firstName":"Nadia","middleName":"","lastName":"Oreshkova","suffix":""}],"badges":[],"createdAt":"2024-10-13 07:53:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5254288/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5254288/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41541-025-01160-7","type":"published","date":"2025-07-04T15:58:48+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":69923046,"identity":"093ee4f0-74c8-4bf0-9a1a-c906d5f3ad32","added_by":"auto","created_at":"2024-11-26 15:46:26","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1031095,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of study designs for Study 1 \u003cstrong\u003ea)\u003c/strong\u003e and Study 2 \u003cstrong\u003eb)\u003c/strong\u003e. Timelines for both studies are shown, with the respective handlings and measurements. Numbers in black – acclimatization days and days post vaccination; numbers in brown/red – days post challenge infection. Illustrations were created with \u003ca href=\"https://www.biorender.com/\"\u003ebiorender.com\u003c/a\u003e.\u003c/p\u003e","description":"","filename":"image1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5254288/v1/b42ca7e8f21c8c538ce0a9e1.jpeg"},{"id":69923869,"identity":"fe67a7c0-aaa5-4767-8248-bdff42588008","added_by":"auto","created_at":"2024-11-26 15:54:26","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":492914,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eStudy 1 –\u003c/strong\u003e \u003cstrong\u003eRelative body weight, activity, viral loads and neutralizing antibody responses\u003c/strong\u003e of groups of hamsters, vaccinated with different regimens of FIWV following SARS-CoV-2 challenge infection. \u003cstrong\u003ea)\u003c/strong\u003e Relative body weight over time expressed as percentage of body weight on the day of challenge (0 DPI) (n=8 per group up to 5 DPI and n=4 between 6 DPI and 13 DPI; n=7 and n=3 respectively for group 1x high dose). \u003cstrong\u003eb)\u003c/strong\u003e Area under the curve (AUC) of the three time points with the lowest relative body weight of the mock-vaccinated group (5 to 7 DPI), calculated for each hamster (n=4 (n=3 for group 1x high dose), subgroup sacrificed on 13 DPI). Only significant differences are indicated. \u003cstrong\u003ec)\u003c/strong\u003e Hamster activity over time, expressed as running wheel rotation counts (n=4 (n=3 for group 1x high dose)). \u003cstrong\u003ed) \u003c/strong\u003eAUC (log-transformed counts) of the four days encompassing the period of activity recovery (7 to 10 DPI), calculated for each hamster. Calculations and data display is performed on log-transformed counts. \u003cstrong\u003ee) \u003c/strong\u003eViral RNA loads in lungs. The 50% limit of detection of the PCR assay is indicated by the dotted line. \u003cstrong\u003ef)\u003c/strong\u003e Neutralizing antibody titers per treatment group displayed over time; n=4 per group per DPI, except for group 1x high dose on 13 DPI, where n=3. The dotted line represents the detection limit of the test. Only statistically significant differences are indicated. \u003cstrong\u003ea, b, c, and d)\u003c/strong\u003e Symbols show group means. \u003cstrong\u003ee and f)\u003c/strong\u003e Symbols show individual values and bars illustrate group means. Error bars in plots \u003cstrong\u003ea and c\u003c/strong\u003e show SD (standard deviation), and in all other plots 95% CI (confidence intervals). Differences with p values \u0026lt;0.05 were considered significant. Level of significance is illustrated with asterisks for the following p values: 0.01 to 0.05 - *; 0.001 to 0.01 - **; 0.0001 to 0.001 - ***; \u0026lt; 0.0001 - ****; ns—not significant (≥0.05). DPI – days post infection.\u003c/p\u003e","description":"","filename":"image2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5254288/v1/bcbb9d4da291a97319d8edc1.jpeg"},{"id":69923043,"identity":"bd5473fa-5a93-4aa3-b3f2-442ddb4ca791","added_by":"auto","created_at":"2024-11-26 15:46:26","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4552387,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eStudy 1 - Lung (histo)pathology.\u003c/strong\u003e \u003cstrong\u003ea)\u003c/strong\u003e Relative lung weight of the left lung lobe, expressed as percentage of the body weight determined on -1 DPI. \u003cstrong\u003eb) \u003c/strong\u003eExtent of histopathological lesions, expressed as percentage of the total lung area of a section of the whole left lung lobe. Three scorings were performed of each slice and the average values were calculated per hamster. \u003cstrong\u003ec)\u003c/strong\u003e Severity of histopathological lesions, expressed as the cumulative (sum) of scores for 6 independent parameters per hamster per time point. To account for the different scale of the scores, all scores were normalized before calculating the sum. \u003cstrong\u003ea to c)\u003c/strong\u003e Symbols show individual values and bars illustrate group means, n=4 per group except for group 1x high dose on 13 DPI, where n=3. Error bars: 95% CI. Significant differences between groups are illustrated with asterisks for the following p values: 0.01 to 0.05 - *; 0.001 to 0.01 - **; 0.0001 to 0.001 - ***; \u0026lt; 0.0001 - ****; ns—not significant (≥0.05). DPI – days post challenge infection. \u003cstrong\u003ed) \u003c/strong\u003eMock-vaccinated group with mild extent of lung pathology (grade 1-2), often centred around bronchioles, objective 2.5x; \u003cstrong\u003ee)\u003c/strong\u003e Vaccinated group 1 x high dose with extensive and coalescing lung histopathology (grade 3), objective 2.5x; \u003cstrong\u003ef)\u003c/strong\u003ealveolar lumina containing macrophages and granulocytes (arrow), mock-vaccinated group, objective 40x; \u003cstrong\u003eg)\u003c/strong\u003e coalescing lung changes with prominent perivascular infiltrates (arrowhead), 1 x high dose group, objective 10x; \u003cstrong\u003eh)\u003c/strong\u003e extensive type II pneumocyte proliferation (arrow) with alveolar haemorrhage (arrowhead), 1 x high dose group, objective 40x; \u003cstrong\u003ei) \u003c/strong\u003eperivascular infiltrates with more than 5 layers of cells (arrowhead), grade 3 blood vessel change, group 1 x high dose, objective 40x; \u003cstrong\u003ed to i)\u003c/strong\u003e Representative images from 5 DPI.\u003c/p\u003e","description":"","filename":"image3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5254288/v1/ba5284e7bcfa25f674220101.jpeg"},{"id":69923047,"identity":"7db34be3-fe9e-4471-9060-f506061ab1b7","added_by":"auto","created_at":"2024-11-26 15:46:26","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":490633,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eStudy 1 - Cytokine gene expression in lung tissue \u003c/strong\u003eas quantified with qRT-PCR. Quantities are expressed as fold change increase compared to baseline levels (determined on lungs harvested on the day prior to challenge). Symbols show individual values and bars illustrate group means, n=4 per group except for group 1x high dose on 13 DPI where n=3. Error bars: 95% CI. Significant differences between groups are illustrated with asterisks for the following p values: 0.01 to 0.05 - *; 0.001 to 0.01 - **; 0.0001 to 0.001 - ***; \u0026lt; 0.0001 - ****; ns—not significant (≥0.05). DPI – days post challenge infection.\u003c/p\u003e","description":"","filename":"image4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5254288/v1/0f55e498dcc442a642460358.jpeg"},{"id":69923045,"identity":"81ba6236-8f71-472e-82c3-b4b05c877b2c","added_by":"auto","created_at":"2024-11-26 15:46:26","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":568723,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eStudy 2: Relative body weight, viral loads and antibody responses\u003c/strong\u003e following challenge infection with SARS-CoV-2 . \u003cstrong\u003ea)\u003c/strong\u003eRelative body weight over time expressed as percentage of body weight at the day of challenge infection (0 DPI); n=15 on 0 DPI and decreasing with 3 hamsters on every even DPI. \u003cstrong\u003eb)\u003c/strong\u003e Area under the curve (AUC) for 5 to 7 DPI, calculated for each hamster and shown as group means (n=6, subgroups sacrificed on 8 and 10 DPI were used for graphical representation and statistical analysis). Only significant differences are indicated. \u003cstrong\u003ec) \u003c/strong\u003eViral RNA loads in lung tissue. The 50% limit of detection of the PCR assay is indicated by the dotted line. \u003cstrong\u003ed)\u003c/strong\u003e Neutralizing antibody titers (end-point titers). Left panel shows datapoints on 0 DPI (n=15). Right panel displays titers over time (n=3 per time point). \u003cstrong\u003ee) and f)\u003c/strong\u003e End-point ELISA titers of total anti-spike (e) and anti-nucleoprotein (N) (f) IgG antibodies. Left panels shows datapoints on 0 DPI (n=15). Right panels display titers over time (n=3 per time point). The dotted lines in all plots represent the detection limit of the respective test. \u003cstrong\u003ea and b) \u003c/strong\u003eSymbols show group means; \u003cstrong\u003ec – f)\u003c/strong\u003e Symbols show individual values, n=3 per group per timepoint;\u003cstrong\u003e d - f)\u003c/strong\u003e bars illustrate group means. Error bars in plot \u003cstrong\u003ea \u003c/strong\u003eshows SD, and in all other plots 95% CI. Differences in group means (b) and group contrasts over time between 2 and 6 DPI (d - e) with p values \u0026lt;0.05 were considered significant. Level of significance is illustrated with asterisks for the following p values: 0.01 to 0.05 - *; 0.001 to 0.01 - **; 0.0001 to 0.001 - ***; \u0026lt; 0.0001 - ****. DPI – days post challenge infection.\u003c/p\u003e","description":"","filename":"image5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5254288/v1/585482cf020ccd76106c3eea.jpeg"},{"id":69923870,"identity":"39fa5770-4c5e-47ba-9901-8dd705e3287c","added_by":"auto","created_at":"2024-11-26 15:54:26","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":4491892,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eStudy 2 Evaluation of lung histopathology. a)\u003c/strong\u003e Relative lung weight of the left lung lobe, expressed as percentage of the body weight determined on 0 DPI. \u003cstrong\u003eb) \u003c/strong\u003eExtent of histopathological lesions, expressed as percentage of the total lung area of a slice of the left lung lobe. Two scorings were performed of each slice and the average values were calculated per hamster. \u003cstrong\u003ec)\u003c/strong\u003eSeverity of histopathological lesions, expressed as cumulative (sum) score of 6 independent parameters per hamster per time point. Each of the parameters was scored separately. To account for the different scale of the scores, all scores were expressed with a normalized value before calculating the sum. \u003cstrong\u003ed)\u003c/strong\u003e Severity score for perivascular cuffing of the blood vessels. \u003cstrong\u003ea to d)\u003c/strong\u003e Symbols show individual values and lines represent the group means; n=3 per group per timepoint except for a) 6 DPI for the mock-vaccinated group (weight of one lung is missing).\u003cstrong\u003e e to j)\u003c/strong\u003e Representative lung histopathology images (H\u0026amp;E stain). \u003cstrong\u003ee)\u003c/strong\u003e Lower extent of lung pathology in mock-vaccinated group (4 DPI) compared to \u003cstrong\u003ef)\u003c/strong\u003e Vaccinated group, both images objective 2.5x. \u003cstrong\u003eg)\u003c/strong\u003e Mild perivascular infiltrates with edema (arrowhead) in mock-vaccinated group (6 DPI) compared to \u003cstrong\u003eh)\u003c/strong\u003e extensive perivascular infiltrates (arrowheads) in the vaccinated group, both images objective 20x. \u003cstrong\u003ei)\u003c/strong\u003e Vaccinated group (8 DPI) - extensive infiltrate around large blood vessel composed of lymphocytes, plasma cells (arrowhead) admixed with granulocytes (arrow) and macrophages, objective 40x. \u003cstrong\u003ej)\u003c/strong\u003e Mild histopathologic changes in re-challenge group at 8 DPI, composed of thickening alveolar walls (arrowhead) and infiltrates in alveolar lumina (arrow), objective 40x. Level of significance between group means in time in \u003cstrong\u003ea to d\u003c/strong\u003e is illustrated with asterisks for the following p values: 0.01 to 0.05 - *; 0.001 to 0.01 - **; 0.0001 to 0.001 - ***; \u0026lt; 0.0001 - ****. DPI – days post challenge infection.\u003c/p\u003e","description":"","filename":"image6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5254288/v1/a7efdd7044657670d46de595.jpeg"},{"id":69923051,"identity":"fb403d75-69b7-4f40-b256-4bb10fad2572","added_by":"auto","created_at":"2024-11-26 15:46:26","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2221909,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eStudy 2 Expression of selected genes and Th-2 skewing in lungs of infected hamsters. a)\u003c/strong\u003e Heatmap (based on normalized counts obtained by digital nCounter technology) showing the expression pattern of a gene panel, associated with Th1, Th2, Th17 and Treg pathways, as well as with different immune cells populations. \u003cstrong\u003eb) \u003c/strong\u003eClustering of samples based on expression of n=128 profiled genes with principal component analysis (PCA). Normalized counts for all n=45 samples were ln(x)-transformed and mean-centred per row. Unit variance scaling was applied to rows (n=128 genes). Singular value decomposition with imputation was used to calculate principal components 1 (PC1) and 2 (PC2), which are plotted on the X and Y axis and explain 32.9% and 29.3% of the variance in the dataset, respectively. Colours indicate treatment groups (covariates) and symbols represent different necropsy days. The ellipses in green are only for visualization purposes. \u003cstrong\u003ec)\u003c/strong\u003e Immune response patterns on Th-pathway level. Pathway scores related to the indicated 4 different T cell subsets were plotted over time. Symbols represent individual scores, and the lines shows the group means; n=3 per group per timepoint. Level of significance is illustrated with asterisks for the following p values: 0.01 to 0.05 - *; 0.001 to 0.01 - **; 0.0001 to 0.001 - ***; \u0026lt; 0.0001 - ****. DPI – days post challenge infection. \u003cstrong\u003ed)\u003c/strong\u003e Differentially expressed genes on at least one of the necropsy days (p \u0026lt; 0.05; no fold change cut-off; n=3 per group and DPI) when comparing vaccinated vs mock-vaccinated AND vaccinated vs re-challenge groups. n=37 genes fulfilled these criteria: n=28 were upregulated (upper cluster) and n=9 were downregulated (lower cluster) in association with the vaccination. For any given gene, brown indicates higher expression relative to all samples’ average and blue indicates lower expression (difference of +/- 1 = values are one SD away from the average of the row). Note that expression levels can only be compared within a row (i.e. per gene across samples), not between different rows. The numbers in column “DPI” indicate the day(s), when a specific gene was significantly upregulated, as compared to both the mock-vaccinated and re-challenge group. Genes associated with Th2 pathway are shown in pink, genes associated with Th1 pathway are shown in green, and immune cells are highlighted with blue.\u003c/p\u003e","description":"","filename":"image7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5254288/v1/bb8f7392c5672d6e52144f33.jpeg"},{"id":86179697,"identity":"eed59ede-3944-4689-a9d3-6f14dc454a80","added_by":"auto","created_at":"2025-07-07 16:18:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":14838459,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5254288/v1/1e4725b7-022b-49fd-bfec-b4ef54f6bfb6.pdf"},{"id":69923050,"identity":"608b3431-9bb8-41e7-8109-b3286d210f36","added_by":"auto","created_at":"2024-11-26 15:46:26","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":432373,"visible":true,"origin":"","legend":"","description":"","filename":"DeJongetalSupplementarydataNPJ.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5254288/v1/3312b0d18c372fb96e278f4a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Hamsters immunized with formalin-inactivated SARS- CoV-2 develop accelerated lung histopathological lesions and Th2-biased response following infection","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe coronavirus disease 2019 (COVID-19) pandemic led to an unprecedented global effort to develop SARS-CoV-2 vaccines. As a result, a wide range of vaccines were approved worldwide for use in humans during the pandemic. These vaccines include mRNA vaccines, vector vaccines, subunit vaccines and inactivated whole virus vaccines. At the dawn of the vaccine development for SARS-CoV-2, one of the safety concerns was related to manifestation of events of vaccine-associated enhancement of disease (VAED). Up until now, there are no records for such events in individuals that have received any type of vaccine against COVID-19. Nevertheless, it remains important to monitor the phenotype of the immune response and the possible display of VAED in newly developed and in existing vaccines.\u003c/p\u003e \u003cp\u003eVAED can manifest in individuals that have been vaccinated and subsequently have contracted an infection with the pathogen against which they have been vaccinated. It is defined as a disease presented with more severe symptoms, or disease with modified/unusual clinical manifestation \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. VAED is a well-described phenomenon in the context of formalin-inactivated whole virus vaccines against human respiratory syncytial virus (HRSV) and measles virus (MeV) used in the 1960s. A formalin-inactivated alum-adjuvanted HRSV vaccine was applied to young children and, upon exposure to natural infection, was associated with significantly increased hospitalization rate and two fatalities in the vaccinees as compared to the control group \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. The disease was characterized by high fever and massive infiltration of immune cells into the lungs, pointing to an immunopathological mechanism. This was further supported by studies in animal models, where challenge infection of vaccinated animals induced severe lung lesions associated with infiltration of granulocytes (e.g. neutrophils and eosinophils), and monocytes/macrophages, Th2-bias of the immune response and the presence of low-avidity, non-protective antibody responses that contributed to accumulation and deposition of immune complexes and complement-mediated injury in lungs (reviewed in \u003csup\u003e\u003cspan additionalcitationids=\"CR4 CR5\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e). Similar mechanisms have been described as the cause for developing \u0026ldquo;atypical measles\u0026rdquo; in association with a formalin-inactivated MeV vaccine \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. For both vaccines, formalin inactivation is suspected to be a contributing factor to the Th2 polarization of the immune response, since carbonyl groups generated during the inactivation process were shown to favor Th2 response in mice \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Furthermore, alum-based adjuvants are recognized for driving Th2 skewing of the immune response \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, and aluminum hydroxide was used as adjuvant for the formalin-inactivated HRSV vaccine.\u003c/p\u003e \u003cp\u003eWith respect to human respiratory coronaviruses, two new coronaviruses had emerged before the currently pandemic SARS-CoV-2, namely SARS-CoV (in 2002\u0026ndash;2003) and MERS-CoV (in 2012). For both viruses, diverse vaccines were tested in preclinical models and results that potentially reflect VAED were reported. In the context of SARS-CoV, a formalin-inactivated SARS-CoV vaccine was associated with increased lung lesions after challenge infection in non-human primates \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. A double-inactivated (with formalin and ultraviolet irradiation) whole SARS-CoV vaccine, either adjuvanted with alum or not, was poorly protective against disease and viral replication, and induced eosinophilic immunopathology in the lungs of aged mice following either homologous or heterologous challenge infection. Young mice were well-protected and did not show lung pathology following homologous challenge but were partially protected and displayed lung pathology following heterologous challenge \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Other types of vaccines have also been shown to induce immunopathological lesions in the lungs of mice \u003csup\u003e\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e or non-human primates \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. For MERS-CoV, a gamma-irradiated whole virus vaccine (either adjuvanted with Alum, MF59 or non-adjuvanted) was found to bear risk for hypersensitive-type lung pathology in mice, characterized by lung infiltrates consisting of mononuclear cells and eosinophils, and increased levels of IL-5 and IL-13 \u003csup\u003e17\u003c/sup\u003e. A similar hypersensitivity-type response was reported in mice vaccinated with UV-inactivated, alum adjuvanted MERS-CoV \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. It should be noted that the pathological results of some of these studies \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e were discussed controversially by others \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. However, collectively these studies suggest that VAED can be induced by inactivated coronavirus vaccines in preclinical models, therefore implying that initial safety concerns regarding vaccines developed against SARS-CoV-2 were reasonable.\u003c/p\u003e \u003cp\u003eTo support safety assessment of novel vaccines for COVID-19, several animal models were used with the aim to test if VAED can be induced by a SARS-CoV-2 infection in the context of vaccine-induced immunity. In all studies, vaccine preparations that are expected to induce VAED were used, such as formalin-inactivated whole virus preparations \u003csup\u003e\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, denatured S protein vaccines \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e or recombinant spike protein \u003csup\u003e\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e, for all of which except one study \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e, alum was used as adjuvant. While no VAED was observed in macaques, vaccinated ferrets did show a transient increased pathology compared to mock-vaccinated animals, characterized by eosinophilic infiltrates and perivascular cuffing in the lung observed at 6 to 7 days post infection (DPI), which resolved by 13 to 15 DPI \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. In mice, Th2 skewing as well as eosinophilic and neutrophilic infiltrates in the lungs were found early post infection, at 3 or 4 DPI, while the animals were partially protected from clinical signs and viral replication \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. At a later time point post infection (7 DPI), murine lungs exhibited severe immunopathology, characterized by a significant perivascular infiltration of eosinophils and CD4\u0026thinsp;+\u0026thinsp;T cells, and increased expression of Th2/Th17 cytokines \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Two studies have been described in golden Syrian hamsters, with opposing findings. In one study, hamsters vaccinated twice with a formalin inactivated vaccine had only limited pulmonary inflammatory infiltrates confined to the alveolar walls at 4 DPI, and had more pronounced Th1 cytokines in lungs as compared with control hamsters (Th2 cytokines were not reported)\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. In the other study, alum-adjuvanted, non-stabilized spike protein vaccine induced VAED represented by pronounced Th2 cytokine production and massive eosinophilic infiltration in lung tissue at 4 DPI \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. In all aforementioned studies, a single necropsy point after challenge was used to evaluate lung pathology.\u003c/p\u003e \u003cp\u003eTo investigate the conditions for the potential occurrence of VAED in Syrian hamsters in the context of a formalin-inactivated whole virus preparation (FIWV) adjuvanted with alum, we performed two experiments. In the first experiment, four different vaccine regimens comprising two different antigen doses applied in either single or prime-boost administration regiment were used to determine if and under which condition(s) VAED would occur. Based on the outcome of the first experiment, a second experiment was designed with the vaccine regimen that had resulted in the most pronounced VAED to study the kinetics of VAED during the course of infection. Vaccinated hamsters were compared with mock-vaccinated hamsters and hamsters that had recovered from a previous homologous SARS-CoV-2 challenge (re-challenge group). Our findings reveal an accelerated onset of lung lesions in vaccinated hamsters compared to mock-vaccinated controls. The differences were transient and were associated with lack of neutralizing antibodies after vaccination, and more pronounced Th2 responses in the lung tissue early after infection.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cem\u003eEthical statement\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWageningen Bioveterinary Research is authorized to perform animal experiments according to the Dutch Law on Animal Experiments (WoD) and in accordance with European legislations and guidelines. The current study was performed under project license no. AVD4010020209446 of the Dutch Central Authority for Scientific procedures on Animals (CCD). The experimental plan was approved by the Animal Welfare Body of Wageningen University and Research prior to the start of the in-life phase. Protocols were prepared in compliance with 3R policies, and the study reports are presented in compliance with the ARRIVE guidelines \u003csup\u003e25\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003e\u003cem\u003eVaccine preparation\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eFor production of the virus stock, Vero/hSLAM cells (Sigma-Aldrich, Merck, Darmstadt, Germany, Cat# 04091501-1VL) were used, cultured in minimum essential medium (Life Technologies, Carlsbad, CA, USA) supplemented with 4% heat-inactivated FBS (Sigma-Aldrich), 25 mM Hepes (Life Technologies) and geneticin (0.4 \u0026micro;g/ml) (Gibco, Thermo Fischer Scientific; Waltham, MA, USA). Production of the stock, preparation of the formalin-inactivated whole virus (FIWV) SARS-CoV-2 vaccine, and the subsequent purification and characterization of the FIWV have been described previously \u003csup\u003e19\u003c/sup\u003e. Prior to administration, frozen formalin-inactivated whole virus was thawed, diluted with phosphate buffered saline (PBS), and mixed 1:1 with 2% Alhydrogel (InvivoGen, Toulouse, France) to a final concentration of 0.5 \u0026micro;g vaccine antigen per dose (low dose) or 5 \u0026micro;g vaccine antigen per dose (high dose) for the first study, or to 5 \u0026micro;g vaccine antigen per dose for the second study.\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003e\u003cem\u003eViruses and cells\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe virus used for inoculation in both studies was SARS-CoV-2 D614G, strain SARS-CoV-2/human/NL/Lelystad/2020 \u003csup\u003e26\u003c/sup\u003e. In the first study, an undiluted virus stock prepared as previously described \u003csup\u003e26\u003c/sup\u003e was used at dose 10\u003csup\u003e4.22\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e per hamster. For the second study, the virus stock was obtained following a second passage of the original isolate on Vero/hSLAM cells at MOI 0.0001. The culture medium consisted of MEM (Gibco, Thermo Fischer Scientific; Waltham, MA, USA, Cat# 21090;), supplemented with 2% FCS, 1% antibiotic/antimycotic, 1% L-glutamine, 1% Minimal Essential Medium Non-Essential Amino Acids (MEM-NEAA) (all from Gibco). Inoculations of hamsters were performed with undiluted virus stock at a dose of 10\u003csup\u003e4.13\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e per hamster. Sequences of both virus stocks were determined by next generation sequencing and were identical to the original isolate, with no notable deletions in the furin cleavage site. For virus neutralization test, VERO-E6 cells (ATCC\u0026reg; CRL-1586\u0026trade;; Manassas, VA, USA) were used, cultured in MEM (Gibco, Cat# 21090;), supplemented with 5% FCS, 1% antibiotic/antimycotic, 1% L-glutamine, 1% Minimal Essential Medium Non-Essential Amino Acids (MEM-NEAA) (all from Gibco).\u003c/p\u003e\n\n\u003cp\u003e\u003cem\u003eExperimental design\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eFor both studies, Syrian hamsters (\u003cem\u003eMesocricetus auratus\u003c/em\u003e), strain RjHan:AURA were obtained from Janvier, France. All hamsters were housed solitary in cages with open grids in one animal room under BSL3 containment level. Water and food were provided \u003cem\u003ead libitum\u003c/em\u003e. Hamsters were monitored daily for their general health from the day of arrival until the end of the study and were allowed to acclimatize for at least 7 days before subjected to any study-related handlings. Vaccines and mock-treatment (phosphate buffered saline (PBS)) were administered intramuscularly (IM) by injection of 100 \u0026micro;L in the left hind leg. Where relevant, booster vaccination was administered IM in the right hind leg. Body weights of all hamsters were measured approximately twice per week during the acclimatization and vaccination period. Blood drawn from the retroorbital sinus and challenge infection with SARS-CoV-2 via the intranasal (IN) route were performed under general anesthesia with 0.15 mg/kg medetomidine (Sedastart, ASTfarma; Oudewater, The Netherlands) and 100 mg/kg ketamine (Narketan, Vetoquinol; Breda, The Netherlands). The anesthesia was antagonized with atipamezole (Sedastop, ASTfarma; Oudewater, The Netherlands). Animals were euthanized by anesthesia with 0.25 mg/kg medetomidine \u0026nbsp; and 200 mg/kg ketamine, followed by exsanguination of the animals. Definition of humane endpoints (HEPs) were described previously \u003csup\u003e26\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003e\u0026nbsp;\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eStudy 1 (Figure 1, upper panel)\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eA total of 60 golden Syrian hamsters, (30 male and 30 female), 6-8 weeks of age at arrival, were used for the study. Hamsters from the same sex were assigned to one of 5 treatment groups (n=6 males and n=6 females per group) based on equal distribution of body weights across groups and subgroups (per day of euthanasia). One group of hamsters was immunized with low (0.5 \u0026micro;g) dose, and one with a high (5 \u0026micro;g) dose of vaccine at day 0 (D0) and at D19 (prime-boost regimen). Another two groups received either a single low or high dose of the same vaccine on D19 only. The fifth group received a vaccination with PBS on D19 and served as mock-vaccinated control. All vaccinations were applied in a volume of 100 \u0026micro;l via the intramuscular (IM) route. Two weeks post last vaccination (D32), n=4 hamsters of each group were sacrificed for necropsy on D32 and served as unchallenged controls. The rest of the hamsters (n=8 hamsters per group) were inoculated with SARS-CoV-2 on D33. From the inoculated hamsters, n=4 per group were euthanized at 5 days post inoculation (DPI) and the other n=4 per group were sacrificed at 13 DPI. During the challenge phase, body weights were measured daily starting 7 days prior to challenge and ending on the day of necropsy. In addition, activity of the hamsters to be sacrificed on 13 DPI (n=4 per group) was monitored daily by means of individual activity tracking wheels (Tecnilab BMI, Someren, The Netherlands) \u003csup\u003e26\u003c/sup\u003e for the same time period as the body weights. The running wheel were connected to an automatic rotation counter. Counts were recorded once per 24 h at approximately the same time of day and the counters were reset to 0. One complete wheel rotation corresponded to 4 counts. Serum samples were collected on the day prior to each vaccination (D -1 and D18), prior to challenge (D31) and on both necropsy days (D38 and D46) by retroorbital puncture under general anesthesia. At necropsy, the left lung lobe was weighed and collected for pathological investigation, while cranial, medial and caudal right lung lobes were collected for viral load. The cardiac lung lobe was collected for cytokine measurements.\u003c/p\u003e\n\u003cp\u003eOne hamster of the 1x high dose vaccine group reached a HEP on 7 DPI, showing depression, abdominal breathing and 19% body weight loss, and it was euthanized. This hamster had the lowest body weight prior challenge, which might suggest a suboptimal condition before challenge. Therefore it was difficult to determine whether reaching HEP was solely because of the challenge infection, or because of a combination of the infection, together with other unknown factors. For that reason, data of this hamster were excluded from all graphical representations and statistical analyses.\u003c/p\u003e\n\n\u003cp\u003e\u003cu\u003eStudy 2 (Figure 1, lower panel)\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eA total of 45 female golden Syrian hamsters, 8 weeks of age at arrival, were assigned to one of 3 treatment groups (n=15 per group in total) based on equal distribution of body weights across groups and subgroups (according to day of euthanasia). One group of hamsters was inoculated IN with SARS-CoV-2 (re-challenge group). To confirm successful infection in this group, oropharyngeal swabs (MW100, Medical Wire, Corsham, UK) were collected every 2 to 3 days, starting 3 days prior inoculation until 10 days post inoculation. Hamsters from the other two groups were injected IM with either vaccine (5 \u0026micro;g vaccine antigen) or with PBS (vaccinated and mock-vaccinated groups respectively), both in a volume of 100 \u0026micro;l. Two weeks post vaccination (vaccinated and mock-vaccinated groups) and approximately three weeks post first challenge (re-challenge group), all hamsters were inoculated IN with SARS-CoV-2. At 2, 4, 6, 8 and 10 DPI, n=3 hamsters per group were euthanized to perform necropsies and to collect lung tissue. The left lung lobe was collected for pathological analysis and the right caudal and cardiac lobes for virological and mRNA expression analysis (Nanostring\u0026reg; nCounter technology, Seattle, WA, USA). During the challenge phase, body weights were measured once daily starting 5 days prior to challenge and ending on the day of necropsy. Serum samples were collected before vaccination, prior to challenge and during necropsy by retroorbital puncture under general anesthesia.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePathological evaluation of lung tissue and immunohistochemistry\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe left lung lobe was removed and weighed, and the weight was expressed as percentage of the body weight measured on the day of challenge (relative lung weight). Subsequently, the left lung lobe was gently inflated and immersed in 10% neutral buffered formalin, fixed for 14 days and embedded in paraffin, sectioned at 5 \u0026mu;m and stained with hematoxylin and eosin (H\u0026amp;E) for histological examination. The percentage of the total extent of the left lung lobe that was microscopically affected by SARS-CoV-2-related lesions, was estimated in a blinded fashion by a board-certified veterinary pathologist. Three blinded estimates with different order of slides were performed and averaged for a final score. For study 1, a section from the lung of each hamster from both 5 and 13 DPI was evaluated by a second, independent board-certified veterinary pathologist in a blinded fashion. Percentage of affected lung tissue was calculated using digital image analysis (Nikon NIS-Ar software, Tokyo, Japan). The agreement between the scores assigned by both pathologists was assessed by correlation analysis (GraphPad (San Diego, CA, USA) software Prism v. 9.4.0). The severity and characteristics of the histopathological lesions were scored semi-quantitatively as described previously \u003csup\u003e26\u003c/sup\u003e with slight modifications as shown in Table 1. To account for the different scales of the 6 individual parameters that were scored, all scores were normalized by multiplying by a correction factor (4/highest score of each scale). Normalized scores were used to calculate cumulative (\u0026ldquo;sum\u0026rdquo;) scores, for visual representation and for statistical analysis. The severity and characteristics of the lung lesions were also analyzed by the second pathologist in a blinded fashion and in a descriptive way.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e Scoring system for the severity and characteristics of lung histopathology (H\u0026amp;E staining) and for level of SARS-CoV-2 antigen expression in the lungs (only modifications in comparison with the previously described system \u003csup\u003e26\u003c/sup\u003e are shown).\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"614\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eScore\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBronchi and bronchioles\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003eno changes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003ePeribronchiolar infiltrate \u0026nbsp;or in lumina with no or mild epithelial degeneration \u0026lt; 20% of bronchi/bronchioles\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003ePeribronchiolar infiltrate or in lumina with mild to moderate epithelial degeneration \u0026gt; 20-50 % of bronchi/bronchioles\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003ePeribronchiolar infiltrate or in lumina with severe epithelial degeneration and necrosis \u0026gt; 50% of bronchi/bronchioles\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBlood vessels\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003eno changes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003eperivascular clear spaces (edema) \u0026nbsp; \u0026nbsp; with only mild infiltrates of inflammatory cells \u0026gt; 15% of large blood vessels\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003eclear perivascular cuffing in \u0026gt; 15- 30 % of blood vessels, with occasionally presence of inflammatory cell in blood vessel wall without clear degeneration\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003eextensive perivascular cuffing often of more than 5 cell layers, also in large arteries with clear infiltrates of inflammatory cells in blood vessel walls\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLevel of antigen expression\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003eNo staining\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003eFocal or multifocal staining (\u0026lt; 5 foci) en \u0026lt; 15% of tissue\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003eMultifocal staining in 15-40 % of the tissue\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003eMultifocal to coalescing staining in \u0026gt; 40-70 % of the tissue\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 8.46906%;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 91.5309%;\"\u003e\n \u003cp\u003eDiffuse staining in \u0026gt; 70% of the tissue\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\n\u003cp\u003eSARS-CoV antigen expression was evaluated with immunohistochemistry (IHC) on formalin-fixed and paraffin-embedded (FFPE) lung tissue sections. Heat-induced epitope retrieval (HIER) method was used to prepare slides for IHC stain as previously described \u003csup\u003e26\u003c/sup\u003e. Briefly, after routinely dewaxing and endogenous peroxidase quenching (methanol/0,3%H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e), the sections were heated for 15 min at 100\u0026deg;C (Pascal, Dako, Agilent, Santa Clara, CA, USA pressure cooker) in 10 mmol citrate buffer pH 6,0 (Dako, Cat# S1699). The slides were blocked with 10% goat serum (Dako) and stained with primary polyclonal rabbit anti-SARS-CoV NucleoProtein (Sino Biological, Beijing, China, Cat# 40163-T62) and secondary HRP-conjugated anti-rabbit reagent (Envision + Single Reagent, Dako, Cat# K4003). For visualization, the 3,3\u0026apos;-diaminobenzidine (DAB) (Dako, Cat# K3468) substrate was used. Slides were counterstained with haematoxylin. The semiquantitative scoring system for the level of SARS-CoV-2 virus antigen expression in the lungs is shown in Table 1 (Level of antigen expression).\u003c/p\u003e\n\n\n\u003cp\u003e\u003cem\u003eOropharyngeal swab sampling and analysis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eFollowing sampling, the swabs were directly submerged in 2 ml of complete culture medium and kept on melting ice until transport to the lab and freezing at \u0026le;-70\u0026deg;C. Upon thawing, swab samples were vortexed, and 200 \u0026micro;l of the sample was mixed with 211 \u0026micro;l lysis master mix, consisting of 200 \u0026micro;l lysis buffer supplemented with 1 \u0026micro;l Poly-A RNA and 10 \u0026micro;l Proteinase K solution (Molgen Pureprep Pathogens Kit, Utrecht, The Netherlands). Lysis buffer-inactivated samples were stored at \u0026le;-15\u0026deg;C until RNA isolation and PCR analysis. RNA from oropharyngeal swabs was isolated by an automated robot system (PurePrep 96, Molgen), using the Pureprep Pathogens RNA isolation kit (Molgen) according to manufacturer instructions.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAssessment of viral genome loads\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eIn study 1, the collected cranial, medial and caudal right lung lobes were kept on melting ice until initial storage at \u0026le;-70\u0026deg;C. Upon further processing, tissue samples were weighed, thawed and homogenized in 6 mL Earl\u0026rsquo;s MEM (Gibco), supplemented with 1% antibiotic/antimycotic (Gibco), using DT-20 Tubes with Rotor Stator Element (Thermo Fisher Scientific) and an Ultra-Turrax\u0026reg; homogenizer (IKA; Staufen, Germany). The tissue homogenates were centrifuged for 15 minutes at 3400g at 4\u0026deg;C and 85 \u0026micro;l of the supernatant was mixed with 255 \u0026micro;l Trizol-LS and stored at \u0026le;-15\u0026deg;C. In study 2, right cranial and middle lung lobes were directly snap-frozen in liquid nitrogen and kept on dry ice until initial storage at \u0026le;-70\u0026deg;C. Upon further processing, snap-frozen lung tissue samples were weighed and homogenized in 5 mL Trizol by an Ultra-Turrax\u0026reg; homogenizer. The tissue homogenate was centrifuged for 15 minutes at 3400g at 4\u0026deg;C and supernatants were aliquoted and stored at \u0026le;-15\u0026deg;C. RNA extraction from the lung suspensions in Trizol was performed manually with individual columns of the Direct-zol Miniprep Kit (Zymogen, Irvine, CA, USA) following manufacturer instructions. The isolated RNA samples were stored at \u0026le;-70\u0026deg;C until further use for analysis by SARS-CoV-2 qPCR to assess total viral RNA levels and subgenomic RNA levels. Viral RNA loads were measured by qPCR essentially as previously described \u003csup\u003e26\u003c/sup\u003e, using primer/probe sets for both total viral E-gene PCR \u003csup\u003e27\u003c/sup\u003e and subgenomic PCR (sgPCR) \u003csup\u003e28\u003c/sup\u003e. The former PCR detects all positive RNA species (genomic and subgenomic) containing the E-gene sequence, while the latter detects only the subgenomic species generated during active virus replication.\u003c/p\u003e\n\n\u003cp\u003e\u003cem\u003eCytokine PCR\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eLung tissue samples were used for analyses with qPCR to assess mRNA expression levels of Th1 (\u003cem\u003eIfng, Tnf, Il2, Il6\u003c/em\u003e) and Th2 (\u003cem\u003eIl4, Il13\u003c/em\u003e) cytokines. To that end, in study 1 the accessory lung lobe was submerged in 1 mL Trizol in a vial prefilled with lysing beads (matrix D, MP Biomedicals, Irvine, CA, USA). Subsequently the lobe was grinded using a Fastprep-24 instrument (MP Biomedicals) and then stored at\u0026nbsp;\u0026le;-70\u0026deg;C at WBVR until further processing. In study 2, the right cranial and middle lung lobes were used and were processed as described above (\u0026ldquo;Assessment of viral genome loads\u0026rdquo;). RNA extraction in both studies was performed as described above, using individual columns of the Direct-zol Miniprep Kit (Zymogen), according to manufacturer instruction, including a DNAse step performed on the columns to degrade host DNA. To prepare cDNA, 200 ng RNA per sample (study 1) or 100 ng RNA (study 2) was used as an input for a reverse transcription reaction, using the Superscript IV First-strand synthesis system Thermo Fisher Scientific, Waltham, MA, USA), following the manufacturer\u0026rsquo;s instructions. The cDNA reaction was performed on an Applied Biosystems 7500 Instrument with the following temperature conditions: 10 min at 23\u003csup\u003eo\u003c/sup\u003eC (annealing step); 10 min at 50\u003csup\u003eo\u003c/sup\u003eC (reverse transcription step); 10 min at 80\u003csup\u003eo\u003c/sup\u003eC (denaturation); 4\u003csup\u003eo\u003c/sup\u003eC (termination). For normalization, the reference genes \u003cem\u003eRPL18\u003c/em\u003e and \u003cu\u003eYwhaz\u003c/u\u003e were selected, following an initial screening of 6 housekeeping genes (\u003cem\u003eRpl18, Rpl13, Pp1a, Ywhaz, B-actin, B2m\u003c/em\u003e) and determining the two most stable ones with the GeNex Software v.7 (MultiD Analyses AB, G\u0026ouml;tenburg, Sweden). For the screening, half of the samples were used in study 1 and selection was confirmed on one third of the samples in study 2. Primer sequences and cycling conditions are provided in Tables 2 and 3. Primers were ordered at Biolegio (Nijmegen, The Netherlands). All PCRs were performed using Power SYBR Green PCR Master mix (Thermo Fisher Scientific) according to manufacturer\u0026rsquo;s instructions with 1:10 diluted sample cDNA and primer concentrations as indicated in Table 2 in a total reaction volume of 20 \u0026micro;l (study 1) or 50 \u0026micro;l (study 2). All PCRs were performed on an Applied Biosystems 7500 Instrument. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e2.\u0026nbsp;\u003c/strong\u003eList of primer sequences, final primer concentrations and temperature conditions of the qPCRs.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"627\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 7.49601%;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.09091%;\"\u003e\n \u003cp\u003ePrimer concentration (\u0026micro;M)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 11.1643%;\"\u003e\n \u003cp\u003eAmplification temperature (\u0026deg;C)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.5742%;\"\u003e\n \u003cp\u003eForward sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.0223%;\"\u003e\n \u003cp\u003eReverse sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19.6172%;\"\u003e\n \u003cp\u003eSequence source\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.0351%;\"\u003e\n \u003cp\u003eNCBI reference number of the transcript\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 7.49601%;\"\u003e\n \u003cp\u003e\u003cem\u003eRpl18\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.09091%;\"\u003e\n \u003cp\u003e0,25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 11.1643%;\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.5742%;\"\u003e\n \u003cp\u003eGTTTATGAGTCGCACTAACCG\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.0223%;\"\u003e\n \u003cp\u003eTGTTCTCTCGGCCAGGAA\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19.6172%;\"\u003e\n \u003cp\u003eZivcec et al. Journal of Immunological methods (2011)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.0351%;\"\u003e\n \u003cp\u003eXM_005084699.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 7.49601%;\"\u003e\n \u003cp\u003e\u003cem\u003eYwhaz\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.09091%;\"\u003e\n \u003cp\u003e0,125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 11.1643%;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.5742%;\"\u003e\n \u003cp\u003eGAAGCGGAAGCAGGAGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.0223%;\"\u003e\n \u003cp\u003eTATTTGTGGGACAGCATGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19.6172%;\"\u003e\n \u003cp\u003eSelf-developed, using Primer 3 software (on-line)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.0351%;\"\u003e\n \u003cp\u003eAY569127.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 7.49601%;\"\u003e\n \u003cp\u003e\u003cem\u003eIl6\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.09091%;\"\u003e\n \u003cp\u003e0,5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 11.1643%;\"\u003e\n \u003cp\u003e62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.5742%;\"\u003e\n \u003cp\u003eCCTGAAAGCACTTGAAGAATTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.0223%;\"\u003e\n \u003cp\u003eGGTATGCTAAGGCACAGCACACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19.6172%;\"\u003e\n \u003cp\u003eSelf-developed, using Primer 3 software (on-line)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.0351%;\"\u003e\n \u003cp\u003eXM_005087110.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 7.49601%;\"\u003e\n \u003cp\u003e\u003cem\u003eIl13\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.09091%;\"\u003e\n \u003cp\u003e0,075\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 11.1643%;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.5742%;\"\u003e\n \u003cp\u003eGCACTCTGGGTGACCGTAGT\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.0223%;\"\u003e\n \u003cp\u003eGCCCTCTGGTCTTGTGTGAT\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19.6172%;\"\u003e\n \u003cp\u003eSelf-developed, using Primer 3 software (on-line)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.0351%;\"\u003e\n \u003cp\u003eXM_005067910.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 7.49601%;\"\u003e\n \u003cp\u003e\u003cem\u003eTnf\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.09091%;\"\u003e\n \u003cp\u003e0,25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 11.1643%;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.5742%;\"\u003e\n \u003cp\u003eTGAGCCATCGTGCCAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.0223%;\"\u003e\n \u003cp\u003eAGCCCGTCTGCTGGTATCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19.6172%;\"\u003e\n \u003cp\u003eEspitia et al. BMC Immunology 2010\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.0351%;\"\u003e\n \u003cp\u003eXM_005086799.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 7.49601%;\"\u003e\n \u003cp\u003e\u003cem\u003eIfng\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.09091%;\"\u003e\n \u003cp\u003e0,125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 11.1643%;\"\u003e\n \u003cp\u003e63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.5742%;\"\u003e\n \u003cp\u003eTGTTGCTCTGCCTCACTCAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.0223%;\"\u003e\n \u003cp\u003eAAGACGAGGTCCCCTCCATTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19.6172%;\"\u003e\n \u003cp\u003eEspitia et al. BMC Immunology 2010\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.0351%;\"\u003e\n \u003cp\u003eNM_001281631\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 7.49601%;\"\u003e\n \u003cp\u003e\u003cem\u003eIl4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.09091%;\"\u003e\n \u003cp\u003e0,075\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 11.1643%;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.5742%;\"\u003e\n \u003cp\u003eACCGAGATGGTCGTACCAGA\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.0223%;\"\u003e\n \u003cp\u003eCACAGGGTCACCTCATGTTG\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19.6172%;\"\u003e\n \u003cp\u003eSelf-developed, using Primer 3 software (on-line)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.0351%;\"\u003e\n \u003cp\u003eXM_005067769.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 7.49601%;\"\u003e\n \u003cp\u003e\u003cem\u003eIl2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.09091%;\"\u003e\n \u003cp\u003e0,125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 11.1643%;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 20.5742%;\"\u003e\n \u003cp\u003eAGTGCACCCACTTCAAGCTC\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18.0223%;\"\u003e\n \u003cp\u003eGCCTTCTTGGGCATGTAAAA\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 19.6172%;\"\u003e\n \u003cp\u003eSelf-developed, using Primer 3 software\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.0351%;\"\u003e\n \u003cp\u003eNM_001281629.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\n\u003cp\u003e\u003cstrong\u003eTable 3.\u0026nbsp;\u003c/strong\u003eCycling conditions for the qPCRs\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"323\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003eStage\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 77px;\"\u003e\n \u003cp\u003eRepetitions\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 88px;\"\u003e\n \u003cp\u003eTemperature\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003eTime\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 77px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 88px;\"\u003e\n \u003cp\u003e95.0 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003e10:00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 94px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 77px;\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 88px;\"\u003e\n \u003cp\u003e95.0 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003e0:15\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 88px;\"\u003e\n \u003cp\u003eXX.0 \u0026deg;C*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003e1:00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"4\" style=\"width: 94px;\"\u003e\n \u003cp\u003e3** (Dissociation)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 77px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 88px;\"\u003e\n \u003cp\u003e95.0 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003e0:15\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 88px;\"\u003e\n \u003cp\u003e60.0 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003e1:00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 88px;\"\u003e\n \u003cp\u003e95.0 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003e0:15\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 88px;\"\u003e\n \u003cp\u003e60.0 \u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003e0:15\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e*This temperature is primer-specific and was optimized for each primer set. The relevant temperatures are listed in Table 2 (Amplification temperature).\u003c/p\u003e\n\u003cp\u003e**Step 3 was used to generate dissociation curves. Quality of the PCRs and the generated fragments were evaluated per PCR run based on the melting curves. Samples that had PCR products with melting temperatures different than the expected PCR product were excluded from the analysis.\u003c/p\u003e\n\n\u003cp\u003eRelative expression of the genes of interest (GOI) was determined with the \u0026Delta;\u0026Delta;CT method \u003csup\u003e29\u003c/sup\u003e, using \u003cem\u003eRpl18\u003c/em\u003e and \u003cem\u003eYwhaz\u003c/em\u003e as housekeeping genes for normalization. This method generates a unit-free number indicating expression of the GOI relative to a reference gene, taking variations among PCR plates into consideration. Before normalizing the GOI, the \u0026Delta;Ct values obtained for the two housekeeping genes were averaged. Standard curves for each gene were prepared by 5-fold serial dilutions of a sample pool, including pre-selected samples mixed in equal amounts (\u003cem\u003eRpl18\u003c/em\u003e, \u003cem\u003eYwhaz\u003c/em\u003e and \u003cem\u003eTnf\u003c/em\u003e) or the sample pool was spiked with 5-fold serial dilutions of a synthetic DNA fragment (synthesized by GenScript Biotech, Piscataway, NJ, USA), encompassing the generated by PCR amplicon (\u003cem\u003eIl2, Il4, Il6, Il13\u003c/em\u003e and \u003cem\u003eIfng\u003c/em\u003e). A standard curve was included on each PCR test plate.\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003e\u003cem\u003eVirus neutralization test\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eSerial 3-fold dilutions of sera were prepared in duplicates, starting at 1:10 initial dilution. A standard dose of ~100 TCID\u003csub\u003e50\u003c/sub\u003e of SARS-CoV-2/human/NL/Lelystad/2020 was mixed with the serum dilutions and incubated for 1 hour. Subsequently, VERO-E6 cells were added to the mixture, at a density of 2x10\u003csup\u003e4\u003c/sup\u003e cells/well. The plates were incubated for 4 days at 37\u003csup\u003eo\u003c/sup\u003eC and 5% CO\u003csub\u003e2\u003c/sub\u003e, after which cell monolayers were fixed with 4% formaldehyde, followed by a fixation with pure methanol (kept at -20\u0026deg;C) for additional safety and for cell permeabilization. Cell monolayers were then washed 3 times with PBS and stored at 4\u003csup\u003eo\u003c/sup\u003eC until staining with an immunoperoxidase monolayer assay to visualize viral antigen, as described previously \u003csup\u003e26\u003c/sup\u003e. Briefly, cell monolayers were stained using primary anti-SARS-CoV-2 S1\u0026nbsp;(Wuhan strain) polyclonal antibody (custom-made by Davids Biotechnologie GmbH and obtained by immunization of rabbits with S1 protein; kindly provided by Dr. Berend Jan Bosch and Dr. Wentao Li,\u0026nbsp;University of Utrecht, The Netherlands)\u0026nbsp;and secondary HRP-conjugated anti-rabbit antibody (DAKO Cat# P0448). Both antibodies were diluted in PBS supplemented with 5% horse serum and incubated with the cell monolayer for 1h at RT. Between the incubation steps, cell monolayers were washed 3 times with PBS, supplemented with 0,5% Tween-80. Staining was visualized following 30-40 min incubation with AEC substrate (4 mg/ml AEC in DMSO), freshly dissolved in substrate buffer (0.05 M NaAc buffer, pH adjusted to 5.0 using 0.05 M HAc) in the following manner: 19 mL substrate buffer + 1 mL 4 mg/mL AEC + 50 \u0026micro;L 3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. Evaluation of staining was performed using a standard light microscope.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe titer of each duplicate was determined as the average of the reciprocal value of the last dilution that showed \u0026ge;50% neutralization (lack of staining) in the well, evaluated by eye. The detection limit of the assay in this experimental setting was a titer of 5.7. All samples with undetectable titer were attributed a titer of 3.3.\u003c/p\u003e\n\n\u003cp\u003e\u003cem\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAnti-N and anti-S total IgG titers were determined by end-point dilutions of serum samples using a custom ELISA test. ELISA plates (medium bind, Greiner Bio-One, Krensm\u0026uuml;nster, Austria) were coated with 50 ng/well of either N or S protein (40588-V08B and 40589-V08B1 respectively, both purchased from Sino Biological, Beijing, China), dissolved in coating buffer (0.05M Na2CO3 and 0.05M NaHCO3, pH 9.6) overnight at 4\u003csup\u003eo\u003c/sup\u003eC. Blocking was performed with StabilBlock (Surmodics, Eden Prairie, MN, USA) blocking buffer for 1h at 37\u003csup\u003eo\u003c/sup\u003eC. Test sera and the secondary antibody were diluted in dilution buffer (PBS, supplemented with 0,05% Tween 20 and 5% bovine serum albumin, sterile filtered with 0,45 \u0026micro;m filter) and incubated on the plates for 1h at 37\u003csup\u003eo\u003c/sup\u003eC with gentle agitation. Serum samples were serially diluted (2-fold dilution step), starting at dilution 1:50 (low positive sera), 1:200 (mid positive sera) or 1:1600 (high positive sera), based on a pilot test. As secondary antibody, anti-hamster IgG (Thermo Fischer Scientific Cat# HA6007) was used. For color development, TMB substrate (ImmunoChemistry Technologies, Davis, CA, USA) was added to the plates and incubated for 15 minutes at room temperature. Reaction was stopped with 0.5M sulphuric acid and OD values were measured at 450 nm on a SpectraMax ABS Plus spectrophotometer (VWR; Radnor, PA, USA). All reagents were added to the ELISA plate wells in a volume of 100 ul (except the blocking solution, which was added in a volume of 300 ul). Between all incubation steps, the plates were washed 2x3 times with wash buffer (distilled water, supplemented with 0,05% Tween 20).\u003c/p\u003e\n\u003cp\u003eOn each plate, the same negative and positive control were taken in duplicates. These controls consisted of pooled sera obtained from previous experiments involving naive hamsters or hamsters recovered from SARS-CoV-2 infection, respectively. The negative control was diluted 1:50 and the positive control was diluted 1:250 (N-ELISA) or 1:500 (S-ELISA). The positive and negative controls were used to determine an S/P (sample/positive control) ratio for each sample according to the formula:\u003c/p\u003e\n\u003cp\u003eSP = (OD_SAMPLE - OD_NEG)/(OD_POS - OD_NEG )\u003c/p\u003e\n\u003cp\u003eFor determination of the cut-off, nine pools were prepared from the serum samples obtained prior to vaccination of the current experiment. These pools were diluted 1:50 and taken along on each plate. The cut-off of the ELISA was defined as the average S/P ratio of these pools plus 3x the standard deviation (SD). The ELISA titers of the tested sera were determined as the log2 value of the last serum dilution that showed a S/P ratio above the detection limit. Samples for which the starting dilution of 1:50 was negative were assigned the log2 value of one (theoretical) reciprocal dilution step lower (1:25).\u003c/p\u003e\n\n\u003cp\u003e\u003cem\u003eGene expression analysis in lung samples on the nCounter\u0026reg; platform\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eDigital nCounter\u0026reg; technology (NanoString Technologies) was used to assess mRNA expression levels of selected genes (n=128) associated with Th1, Th2, Th17, and Treg pathways, and with genes associated with different immune cell types in hamster lungs. Custom nCounter panel selection was based on human and/or mouse genes from relevant pathway annotations in the human CAR-T (Chimeric antigen receptor T-cell) Characterization Panel (NanoString Technologies, Seattle, WA, USA), as well as on genes related to different immune cell types based on available literature for mice. In addition, n=3 reference genes identified as stable/suitable based on previous qRT-PCR analyses were included for normalization purposes (\u003cem\u003eRpl13\u003c/em\u003e, \u003cem\u003eRpl18\u003c/em\u003e, and \u003cem\u003eYwhaz\u003c/em\u003e). Hamster-specific probes for transcripts homologous to the selected genes were designed and manufactured by NanoString Technologies, resulting in a custom hamster Code Set.\u003c/p\u003e\n\u003cp\u003eTotal RNA was isolated from hamster lungs as described in section \u0026ldquo;Assessment of viral genome loads\u0026rdquo;. RNA concentrations were quantified with a Qubit\u0026trade; RNA HS Assay Kit on a Qubit\u0026reg; 2.0 Fluorometer (Invitrogen) and the percentage of RNA fragments \u0026gt;200 nucleotides (\u0026ldquo;DV200\u0026rdquo;) was determined with an RNA screen tape on an Agilent Technologies 220 TapeStation.. Except for two samples from the mock-vaccinated group on DPI 4 (22.8% and 29.7%), the DV200 was \u0026gt;35% (range 35.1% - 91.2%).\u003c/p\u003e\n\u003cp\u003eMultiplexed hybridization reactions were performed by Prof. Stephen Gordon and Dr. John A. Browne on an SFI-funded nCounter\u0026reg;MAX Analysis System (NanoString Technologies) at the UCD Veterinary Sciences Centre (Dublin, Ireland), according to manufacturer\u0026rsquo;s guidelines and as originally described by Geiss et al. \u003csup\u003e30\u003c/sup\u003e. Hybridization reactions contained 300 ng of total RNA in a 5 \u0026micro;l volume (except for all DPI 2 samples and DPI 4 samples of the re-challenge group, which contained 100 ng), as well as fluorescent barcode-labeled (reporter and capture) probes for endogenous and reference genes, six pairs of positive control probes, and eight pairs of negative control probes. Hybridized probes were loaded onto cartridges (n=12 per run) and imaged on the nCounter\u0026reg; MAX instrument.\u003c/p\u003e\n\u003cp\u003eAnalysis of raw RCC (Reporter Code Count) files was performed using nSolver Analysis Software (version 4.0) and nCounter Advanced Analysis Plugin (version 2.0.134). The analysis was run with standard settings, and included normalization, differential expression, and pathway scoring modules. Low count data were not excluded from the analysis. Automatic normalization of raw counts based on housekeeping (reference) gene abundance was performed by the software, leading to exclusion of \u003cem\u003eRpl13\u003c/em\u003e as normalization probe. A probe annotation file for pathway enrichment analysis was provided by NanoString Technologies and was based on the nCounter\u0026reg; CAR-T characterization and host response panels. During basic analysis, all samples passed standard QC requirements regarding imaging, binding density, and positive control linearity.\u003c/p\u003e\n\u003cp\u003eTo analyze differential expression (DE), samples from all three treatment groups were analyzed separately per necropsy day (n=9) with the same settings described above. Either mock-vaccinated or re-challenge groups were used as categorial reference (baseline) in the \u0026lsquo;fast/recommended\u0026rsquo; DE analysis module which fits all genes with a negative binomial model and fold changes as well as univariate p-values were calculated by the software.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNormalized count data and pathway scores were visualized with GraphPad Prism. The web app ClustVis (https://biit.cs.ut.ee/clustvis/; Metsalu and Vilo, 2015) was used to for Principal Component Analysis (PCA) and generation of heatmaps. For heatmaps, normalized expression counts were ln(x)-transformed, centered around the mean per gene, and unit variance scaling was applied to rows. Rows were clustered using Manhattan distance and average linkage.\u003c/p\u003e\n\n\u003cp\u003e\u003cem\u003eStatistics\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAnalysis of the relative body weight losses for both studies was performed on the data between 5 DPI and 7 DPI for the hamsters present in the study up to 7 DPI (Study 1: n=4, subgroup sacrificed on 13 DPI, Study 2: n=6, subgroups sacrificed on 8 and 10 DPI). This time window was chosen because it encompasses the period with the largest body weight loss in the control mock-vaccinated group. Each hamster\u0026rsquo;s relative body weight was quantified by calculating the area under the curve (AUC). Between-group comparisons of the AUCs were made with one-way analysis of variance (ANOVA).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eActivity wheel count analysis (Study 1) was performed on the data between 7 DPI and 10 DPI. This time window was chosen because it encompasses the period of activity recovery following the challenge-induced activity reduction. Data from 9 DPI was excluded from the analysis, because of an unexpected dip of activity in all groups, which was attributed to technical issue of unknown origin in the animal facility. Activity was analyzed by estimating the activity AUC and between groups comparisons were made by one-way ANOVA. The analysis was performed on log-transformed counts.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGroup means of the VNT titers, lung pathology parameters (relative lung weights, extent of lung histopathology lesions, severity of histopathology lung lesions sum scores), viral loads (total E gene PCR) and cytokine data for Study 1 were compared using two-way ANOVA, where DPI, group and interaction between DPI and group were assessed. Group means of the lung viral loads, as measured by subgenomic PCR on 5 DPI for Study 1 were compared with one-way ANOVA, since all values on 13 DPI were \u0026ldquo;0\u0026rdquo;. ELISA antibody titers for Study 2 on 0 DPI of the vaccinated and the re-challenged group were compared with a (non-parametric) Mann-Whitney test.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn all cases where ANOVA was used, multiple comparisons were performed following a significant ANOVA test. ANOVA was applied with relaxed rule for data normality and variance equality. One-way ANOVA was followed by a Dunnett\u0026rsquo;s multiple comparison test between the control group (mock-vaccinated) and each of the treatment groups (Study 1) or between the vaccinated group and the two control groups (re-challenge and Mock-vaccinated, Study 2). Two-way ANOVA was followed by a Dunnett\u0026rsquo;s multiple comparison test (to determine differences between the control group (mock-vaccinated) and each of the treatment groups per necropsy day) or by Sidak\u0026rsquo;s multiple comparison\u0026rsquo;s test (to test for change over time within a group).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo compare changes in kinetics of serology titers, pathological parameters and Th-pathways over time among groups (Study 2), a multivariate linear regression model (interaction Group:time) was used. To account for non-linear changes in time, we introduced natural spline terms to the time variable. Pairwise comparisons between the groups were corrected using the Tukey method.\u003c/p\u003e\n\u003cp\u003eStandardly, an alpha of 0.05 and two-tailed tests were used. For all cases when multiple comparisons were made, the p-value was corrected for multiple comparisons.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe ANOVA and the non-parametric tests were performed with GraphPad (San Diego, CA, USA) software Prism v. 9.4.0, and the multivariate linear regression modelling was performed with software R version 4.2.2 (Team R.C. R: A Language and Environment for Statistical Computing. Available online: https://www.R-project.org/).\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe source datasets used and analyzed during the current study are available from the corresponding authors on request.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cem\u003eStudy 1. Partial protection and no enhancement of clinical signs in FIWV-vaccinated animals after SARS-CoV-2 infection\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eIn the first study, four different immunization regimens with FIWV SARS-CoV-2 preparations were tested (Figure 1, upper panel) and one group of hamsters served as mock-vaccinated control (mock-vaccinated group).\u0026nbsp;Following challenge infection,\u0026nbsp;all groups exhibited loss of body weight (Figure 2a), which in the mock-vaccinated group was most pronounced between 5 and 7 DPI. Only the 2x high dose vaccine regimen showed significant reduction of body weight loss as compared to the mock-vaccinated group (Figure 2b). The hamsters of the 1x high dose group also trended towards a reduction in body weight loss albeit not significantly (Figure 2a and b). There was a reduction in activity post SARS-CoV-2 inoculation in all groups, starting from 2 DPI (Figure 2c and d). From 6 DPI onwards, activity increased and pre-inoculation activity levels were reached on 10 DPI. No statistically significant differences between the groups were found (Figure 2d). Furthermore, no aggravation of clinical signs was observed in vaccinated groups as compared with the mock-vaccinated group.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStudy 1. Vaccination resulted in minor reduction of lung viral loads after challenge and \u0026nbsp;induced low to undetectable levels of neutralizing antibodies\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eViral loads in lung tissue samples were assessed by subgenomic (sg)RNA PCR, which is indicative for virus replication \u003csup\u003e28\u003c/sup\u003e. High viral loads were detected in lung tissue of the hamsters from the mock-vaccinated group collected at 5 DPI (9.32 log10 RNA copies per gram tissue on average) (Figure 2e). The vaccinated groups trended towards slightly decreased RNA loads, most obvious in the group vaccinated with the 2x high dose (Supplementary table S1). Differences between the treatment groups and the mock-vaccinated group were not significant.\u0026nbsp;On 13 DPI, no sgRNA was detected anymore.\u003c/p\u003e\n\u003cp\u003eNeutralizing antibodies were not detected in any of the pre-challenge sera (D31/D32), except in two samples with low titers (5.7 and 10) in the group vaccinated with 2x high dose regimen. All groups had measurable neutralizing titers post challenge and interestingly, no significant differences were observed between vaccinated and mock-vaccinated hamsters at 5 DPI (Figure 2f and Supplementary table S2). These results indicate that neither of the vaccination regimens provided sufficient priming of a neutralizing antibody response. Two of the groups, 1x high dose and 1x low dose, showed significant increase in titers between 5 and 13 DPI, and the 1x low dose group was the only one with higher titers than the mock-vaccinated animals at 13 DPI, indicating overall different kinetics between the groups that had received different vaccination regimens.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStudy 1: Evidence of enhanced lung pathology at 5 DPI in vaccinated hamsters\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eOn -1, 5 and 13 DPI, four animals per group were sacrificed and SARS-CoV-2-related lung lesions were evaluated. Relative lung weights of hamsters from all groups were comparable on -1 DPI. Hamsters in all treatment groups showed a significant increase in relative lung weight at 5 DPI, reflecting the presence of inflammatory responses in the lung (Figure 3a, significance annotation not shown). At 13 DPI lung weights had decreased again but did not reach baseline levels. The decrease was significant only in the 1x high dose group, suggestive of an inflammation process that is more acute and/or with different dynamics in this group. There were no significant differences in relative lung weights between any of the treatment groups and the mock-vaccinated group on either time points post challenge infection (5 or 13 DPI). However, lungs of most vaccinated hamsters trended towards a higher relative weight as compared with the mock-vaccinated group on 5 DPI and this trend was the most pronounced in the 1x high dose vaccinated group.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNo histopathological lesions were observed in any of the lungs before challenge infection (Figure\u0026nbsp;3b, -1\u0026nbsp;DPI). On 5\u0026nbsp;DPI, lungs of hamsters of all groups showed clear SARS-CoV-2-related histopathologic changes. Interestingly, the estimated extent of the lung lesions was the least prominent in the animals from the mock-vaccinated group, as compared to the vaccinated animals (Figure 3d and e and Supplementary table S3). The differences between the mock-vaccinated group and the two groups that had received single vaccinations were significant (Figure\u0026nbsp;3b). These results were confirmed in an independent evaluation performed by a second pathologist (Supplementary figure S1, R\u003csup\u003e2\u003c/sup\u003e = 0.94). Histopathological changes were further graded for six different parameters (see materials and methods). Overall, histopathological changes were present in all vaccination groups (Supplementary figure S2), but the cumulative (\u0026ldquo;sum\u0026rdquo;) severity score was the highest in the 1x high dose group (grade 3) compared to the mock-vaccinated group (grade 1 or 2) at 5 DPI (Figure 3c). The main lesions in the mock-vaccinated animals included mild to moderate thickening of alveolar walls, hemorrhages and alveolar infiltrates consisting of macrophages, granulocytes and to a lesser extent of lymphocytes (Figure 3d). These changes were often centered around the bronchiole (Figure 3e). The lungs of vaccinated animals showed more extensive and coalescing changes (Figure 3 f and g), characterized by severe type II pneumocyte proliferation (bulging cells with plump nuclei), prominent alveolar infiltrates of granulocytes, macrophages and to a lesser extent lymphocytes and plasma \u0026nbsp;cells. Prominent hemorrhages (Figure 3h) and perivascular infiltrates up to 5 rows were also present (Figure 3i). The perivascular cuffs were mainly composed of mononuclear cells with fewer interspersed granulocytes. On 13 DPI, most histopathologic changes were resolved and there was only a mild type II pneumocyte hyperplasia with minimal perivascular infiltrates. There was no clear difference between the mock-vaccinated and the vaccination groups.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEvaluation for virus infection of lung tissue collected on 5 DPI with immunohistochemistry (IHC) staining revealed viral nucleoprotein (N) expression in nearly all animals in lung tissues collected on 5 DPI, with a variable extent from grade 1 to grade 3 (Supplementary figure S3a). N-protein expression was mainly found in pneumocytes and alveolar macrophages and to a lesser extent in bronchi and bronchiole (data not shown). There were no significant differences between mock-vaccinated and vaccination groups \u0026nbsp;and no correlation between the presence of viral antigen and the extent (Supplementary figure S3b) or severity (Supplementary figure S3c) of histological lesions. No nucleoprotein expression was detected by IHC on 13 DPI.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStudy 1: Cytokine gene expression in lungs reveals a Th2-skewed profile in vaccinated animals\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eExpression of key Th1 and Th2 cytokines was quantified by qPCR (Figure 4). \u003cem\u003eIfng\u003c/em\u003e, \u003cem\u003eIl6\u003c/em\u003e and \u003cem\u003eIl2\u003c/em\u003e expression was elevated in all groups at 5 DPI and returned to (nearly) baseline levels at 13 DPI, while an increasing trend was observed for \u003cem\u003eTnf\u003c/em\u003e in time from -1 to 13 DPI. No significant differences amongst the groups were observed for any of these cytokines at any time point. \u003cem\u003eIl4\u003c/em\u003e and \u003cem\u003eIl13\u003c/em\u003e were markedly increased in all vaccination groups at 5 DPI with significantly differences in the groups 2x low dose (only \u003cem\u003eIl4\u003c/em\u003e), 1x high dose and 1x low dose as compared to the mock-vaccinated animals. At 13 DPI, \u003cem\u003eIl4\u003c/em\u003e and \u003cem\u003eIl13\u003c/em\u003e mRNA levels returned to near baseline levels with no significant differences between groups.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCollectively, Study 1 showed that the\u0026nbsp;1x high dose group had the most pronounced histopathology on 5 DPI, as well as significant upregulation of Th2-associated cytokines. Therefore, this vaccination regimen was selected for a follow-up experiment (Study 2), in which the kinetics of pathology and expression of genes associated with Th-type immune biases were evaluated.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStudy 2. Reduced relative body weight loss and no enhancement of clinical signs in vaccinated animals after SARS-CoV-2 infection\u003c/em\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn Study 2, one group of hamsters (n=15) was vaccinated once with high dose of FIWV. Two groups served as controls: one vaccinated with PBS (mock), and another was challenged with SARS-CoV-2 D614G three weeks prior challenge infection of all three groups with the same virus strain (re-challenge group) (Figure 1, lower panel). The first infection of the re-challenge group was monitored by evaluation of viral loads in oropharyngeal swabs (Supplementary figure S4). Similar to Study 1, post challenge, the highest relative body weight loss in the mock-vaccinated group was observed between 5 and 7 DPI (Figure 5a) and maximum weight loss was comparable (average of 14.9% and 15.9% for Study 1 and Study 2, respectively). The control re-challenged animals were protected from body weight loss. The vaccinated hamsters in this study lost significantly less body weight compared to mock-vaccinated animals, but significantly more than the fully protected re-challenged hamsters (Figure 5b).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStudy 2: Vaccination resulted in reduction of pulmonary viral loads after challenge and induced S-protein binding antibodies but no detectable levels of neutralizing antibodies\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eSubgenomic RNA (sgRNA) in lung samples was not detectable in the re-challenged animals, indicating lack of active virus replication (Figure 5c). The vaccinated animals were positive for sgRNA in lungs collected on 2 and 4 DPI. From 6 DPI onwards, sgRNA was not detectable in the vaccinated animals any longer, while sgRNA was detected in all tested mock-vaccinated animals up to 8 DPI.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNo neutralizing antibodies (NA) were detected in the vaccinated group of animals prior challenge (Figure 5d), corroborating results obtained in Study 1. Following challenge, only one of three vaccinated animal had detectable NAs on 2 DPI and another one (out of three) on 4 DPI. From 6 DPI onwards, all vaccinated and all mock-vaccinated animals were already NAs positive. The overall kinetics of the NA responses of the vaccinated hamsters was similar to the hamsters of the mock-vaccinated group, and significantly different from the re-challenged group. All re-challenged animals had NAs already at 0 DPI, three weeks after the first virus inoculation (GMT=375, range 270 to 810) and titers increased further following re-challenge, three weeks after the first challenge. In contrast to the NAs, spike-binding IgG antibodies were found in all but one vaccinated hamster (Figure 5e) at 0 DPI, although titers were significantly lower and more variable than the titers in the re-challenged group. However, contrary to the NAs, the overall kinetics of the anti-spike (S) binding antibodies of the vaccinated hamsters was similar to the re-challenged hamsters and significantly different from the one in the na\u0026iuml;ve hamsters from the mock-vaccinated group. Anti-nucleoprotein (N) antibodies were found in 3 out of 15 of the vaccinated hamsters prior to challenge (Figure 5f). Titers of these antibodies increased earlier than in the hamsters of the mock-vaccinated group, but followed the same kinetics. The re-challenged group had the highest anti-N titers early after infection and the titers remained stable over time.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStudy 2: Accelerated lung pathology with more prominent perivascular infiltrates in vaccinated animals as compared to\u0026nbsp;\u003c/em\u003e\u003cem\u003emock-vaccinated\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003eanimals\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eIn study 2, the lung pathology was monitored over time by performing necropsies at 2, 4, 6, 8 and 10 DPI, thereby allowing for more detailed evaluation of pathology kinetics compared to study 1. Both on macroscopic level (based on relative lung weights, Figure 6a) and on histological level (based on extent and severity of pathological lesions, Figure 6b and c), the kinetics of pathological lesions was accelerated in the vaccinated group as compared to the mock-vaccinated group. The scores of all evaluated histopathological parameters increased earlier in the vaccinated group (between 2 and 6 DPI) (Figure 6a-f and Supplementary figure S5). These results corroborate the findings from study 1, where evaluation was performed at a single time point early after infection (5 DPI). Notably, SARS-CoV-2-related pathological lung changes in the mock-vaccinated group reached similar magnitude as in the vaccinated group, but at a later timepoint (at 8 DPI), when the lung pathological lesions in the vaccinated group were already resolving. However, two observations revealed more prominent lesions in the vaccinated, as compared to the\u0026nbsp;mock-vaccinated\u0026nbsp;hamsters. First, on macroscopic level, the peak in relative lung weight in the\u0026nbsp;mock-vaccinated\u0026nbsp;animals was observed at 6 DPI, but overall remained lower than in the vaccinated group (Figure 6a), suggestive of higher inflammation burden in the lungs of the vaccinated hamsters. Second, on histological level, the perivascular cuffing up to 6 DPI was consistently more pronounced in the vaccinated animals as compared to the\u0026nbsp;mock-vaccinated\u0026nbsp;animals and from 8 DPI decreased in both groups (Figure 6d, g-h and Supplementary figure S5). Perivascular infiltrates were composed of mononuclear cells intermingled with granulocytic cells (eosinophilic, heterophilic or neutrophilic) (Figure 6i). In the re-challenged group, hamsters displayed only mild histopathological changes characterized by a mild increase of inflammatory cells within the alveoli (throughout the whole observation period), mild thickening of the alveolar walls (between 4 and 10 DPI) and small perivascular infiltrates (observed only on 2 DPI) (Figure 7j and Supplementary figure S5). No other histopathological lesions were observed in this group.\u003c/p\u003e\n\u003cp\u003eViral protein expression in the lungs of the vaccinated animals clearly trended towards reduced expression over time as compared to the mock-vaccinated animals (Supplementary figure S6a). The immunohistochemistry scores (used to evaluate the spread of virus in lungs) and the results found by the sgRNA PCR correlated well in the vaccinated and the mock-vaccinated groups (Supplementary figure S6b). Similar to study 1, also in study 2 no correlation was observed between viral protein expression in lungs and extent or severity of histopathological lesions (Supplementary figure S6c and d). No viral protein expression was detected in any of the lungs of the re-challenged animals (Supplementary figure S6a).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStudy 2: Gene expression in lungs of vaccinated hamsters shows a predominant Th2 signatures early after infection\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eA multiplex mRNA analysis of the local immune response to SARS-CoV-2 infection in hamster lungs was performed on n=128 selected genes that are associated with Th1, Th2, Th17 and Treg pathways, and with several immune cell populations (Supplementary table S4). Gene expression in lungs of vaccinated hamsters was more comparable to mock-vaccinated hamsters, than of the re-challenged animals, which showed a different expression pattern (Figure 7a). Principle component analysis (PCA) revealed that most samples of the re-challenge group clustered relatively close together regardless of the necropsy day (Figure 7b). This observation indicates limited consistent changes in gene expression of the surveyed transcripts over time in response to the second SARS-CoV-2 infection over time in this group. Based on the first PCA, samples of the vaccinated group from 2 DPI separated more clearly from the bulk of both the mock-vaccinated group and the re-challenge group from the same DPI, which points towards an earlier (\u0026ldquo;faster\u0026rdquo;) vaccine-dependent response on gene expression level in the immunized animals. Samples from 4 and 6 DPI formed separate clusters, but overlapped for both the vaccinated and the mock-vaccinated group. Samples obtained on 8 DPI were most variable and spread most heterogeneously. Samples taken on 10 DPI clustered closely with the re-challenge group, suggesting that gene expression changes in response to infection were already attenuated at this point.\u003c/p\u003e\n\u003cp\u003ePathway analysis revealed that the Th1, Th2, Th17 and Treg pathways were differently regulated in the mock-vaccinated and the vaccinated groups as compared to the re-challenge group (Figure 7c). Notably, they followed a similar trend over time: Th1, Th17 and Treg pathways were downregulated, while Th2 pathway was up-regulated in both groups. The Th2 pathway upregulation had similar kinetics over time in both groups. However, the magnitude of activation was significantly higher in the vaccinated group on 2 DPI, and still higher (without reaching significance) on 4 DPI (Figure 7c). Expression levels of individual genes corroborated the pathways score, since transcripts associated with Th2-skewing of the immune response were upregulated in the vaccinated group predominantly early after infection (2 and 4 DPI) (Figure 7d). There was a marked upregulation of the Th2-accosiated cytokines \u003cem\u003eIl4\u003c/em\u003e and \u003cem\u003eIL13\u003c/em\u003e in this group as measured by both nCounter technology and qPCR (Supplementary figure S7). Although the correlation between the two measurements (qPCR and nCounter) was moderate (R\u003csup\u003e2\u003c/sup\u003e=0.45 for \u003cem\u003eIl4,\u003c/em\u003e R\u003csup\u003e2\u003c/sup\u003e=0.19 for \u003cem\u003eIl13)\u003c/em\u003e , both revealed the same trend early post infection (2 and 4 DPI) (Supplementary figure S7). Furthermore, the chemokine \u003cem\u003eCcl-22\u003c/em\u003e was markedly increased (Figure 7d). This chemokine is mainly expressed by macrophages and dendritic cells \u003csup\u003e31\u003c/sup\u003e and attracts Th2-polarized lymphocytes via their CCR4 receptor \u003csup\u003e32\u003c/sup\u003e. The Th1 pathway differed in kinetics between the vaccinated and the mock-vaccinated group, showing a faster recovery in the former group (Figure 7c), which coincided with significant upregulation of several genes associated with Th1/Th17-response on 6 DPI and 8 (Figure 7d). Similar to Study 1, individually measured transcripts of \u003cem\u003eIfng, Tnf, Il6\u003c/em\u003e and \u003cem\u003eIl2\u003c/em\u003e did not show clear differences between the vaccinated and the mock-vaccinated animals (Figure S9). The Th17 pathway was the least activated in the vaccinated group at 2 DPI, and overlapped with the mock-vaccinated group at later timepoints (Figure 7c). In contrast, the Treg pathway score overlapped for the vaccinated and mock-vaccinated group early post infection (2 and 4 DPI), but showed a trend of faster recovery in the vaccinated group from 6 DPI onwards (Figure 7c). Transcripts associated with the Th17 and the Treg pathways were heterogeneously represented, with some genes upregulated and some downregulated in the vaccinated group (Figure 7d).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNext to the Th pathway-associated genes, a significant upregulation of a cluster of genes associated with immune cells was also observed in the vaccinated group, most prominently on 4 and 6 DPI (Figure 7d). Of note, this coincided with the increased perivascular cuffing observed in this group (Figure 6d). Transcripts associated with T-cells and cytotoxic cells were enriched mainly at 6 and 8 DPI, which correlated with the faster activation of the Th1 and the Treg pathways in vaccinated animals (Figure 7b). Transcripts associated with neutrophils and macrophages were less abundant in the vaccinated group at 4 and 6 DPI, respectively. Given the pronounced cellular infiltration of the lungs of the hamsters in the vaccinated group at these time points, this finding most likely reflects changing ratios between cell populations, rather than increased abundance of macrophages and neutrophils in absolute numbers.\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eVaccine Associated Enhanced Disease (VAED)\u0026nbsp;is a well-described phenomenon in the context of formalin-inactivated whole virus vaccines against human respiratory syncytial virus (HRSV) and measles virus (MeV) used in the 1960s\u0026nbsp;\u003csup\u003e7,33\u003c/sup\u003e.\u0026nbsp;However, a unified definition of this phenomenon remains challenging. In 2021, a case definition of the term \u0026lsquo;\u0026lsquo;Vaccine Associated Enhanced Disease\u0026rdquo; was proposed by a group of experts within the Brighton Collaboration, summoned by the Coalition for Epidemic Preparedness Innovations (CEPI) in the context of active development of vaccines for SARS-CoV-2 vaccines and other emerging pathogens\u0026nbsp;\u003csup\u003e1\u003c/sup\u003e. According to the definitions from this working group, a probable case of VAED of a previously seronegative vaccinated individual is characterized by the following criteria: i) Laboratory confirmed infection with the pathogen targeted by the vaccine; AND ii) Clinical findings of disease involving one or more organ systems (a case of VAERD\u0026nbsp;\u0026nbsp;(vaccine-associated enhanced respiratory disease)\u0026nbsp;if the lung is the primarily affected organ); AND iii) Severe disease as evaluated by a clinical severity index/score (systemic in VAED or specific to the lungs in VAERD); AND iv) Increased frequency of severe outcomes (including severe disease, hospitalization and mortality) when compared to a mock-vaccinated population (control group or background rates); AND v) Evidence of immunopathology in target organs involved by histopathology, when available, including among others: present or elevated tissue eosinophils in tissue and elevated pro-inflammatory Th2 cytokines in tissue (IL4, IL5, IL10, IL13) AND the absence of identified alternative etiology\u0026nbsp;\u003csup\u003e34\u003c/sup\u003e).\u003c/p\u003e\n\u003cp\u003eEarly in the COVID-19 pandemic, it was disputed whether Syrian hamsters were a suitable model for studying VAED in the context of candidate SARS-CoV-2 vaccines. These doubts were based on previous results obtained in hamsters in the context of SARS-CoV infection\u0026nbsp;\u003csup\u003e13,35\u003c/sup\u003e. Recently, a study in golden Syrian hamsters vaccinated with formalin-inactivated whole SARS-CoV-2-based vaccine preparation showed no evidence of enhanced pathology of vaccinated hamsters at 4 DPI\u0026nbsp;\u003csup\u003e20\u003c/sup\u003e. In that study, an unadjuvanted vaccine preparation was used, and neutralizing antibodies were measurable prior to challenge. In contrast, in another study in golden Syrian hamsters designed to promote the emergence of VAED by using as a vaccine a non-stabilized SARS-CoV-2 spike protein adjuvanted with aluminum hydroxide, did report a VAED associated with up-regulation of Th2 cytokines (IL-4, IL-5 and IL-13), inadequate levels of neutralizing antibodies and presence of non-neutralizing antibodies\u0026nbsp;\u003csup\u003e23\u003c/sup\u003e. The results of this study are in line with he definition for VAED cited above, and with our findings in both performed studies. We consistently observed aggravated lung pathology, associated with increased perivascular infiltration of mononuclear cells and granulocytes, and the upregulation of Th2 cytokines (IL-4 and IL-13) in lung tissue of vaccinated hamster when compared to na\u0026iuml;ve hamsters. We did not detect an increased severity or frequency of clinical outcomes. However, to our knowledge, clinical aggravation has never been reported in animal models in the context of SARS-CoV-2.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn our first study, animals were sacrificed at 5 or 13 DPI. The study showed a transiently enhanced severity of pathological lesions in the vaccinated hamsters at 5 DPI, as compared to the mock-vaccinated hamsters. However, it shed insufficient light on the kinetics of the observed processes. Therefore, in the second study, the development of lung pathology was followed over time. It became evident that the kinetics and types of lesions of the pathological changes is what distinguished the vaccinated from the\u0026nbsp;mock-vaccinated\u0026nbsp;hamsters, and not necessarily the overall severity of histological lung lesions. The pathological lesions associated with the vaccination had accelerated kinetics, manifesting with faster exacerbation, followed also by faster recovery as compared to the mock-vaccinated group. An important exception to the overall trend of faster recovery in the vaccinated animals were the perivascular infiltrates, which remained most pronounced in these animals up to 6 DPI, and gene expression profiles showing enrichment of immune cell-associated transcripts up to 8 DPI. The perivascular infiltrates consisted of mononuclear cell and several granulocyte cell types (eosinophilic, heterophilic or neutrophilic). Eosinophils are known to play an important role in the vaccine-associated immunopathology\u0026nbsp;of the lung. However, in hamsters, it is particularly challenging to distinguish eosinophils from other types of granulocytes. The predominant type of granulocyte in blood of hamsters are neutrophilic granulocytes\u0026nbsp;\u003csup\u003e36\u003c/sup\u003e, which are also known as pseudoeosinophils or heterophils, because their granules stain with eosin\u0026nbsp;\u003csup\u003e37\u003c/sup\u003e. True eosinophils compose only a small percentage of the blood cell fraction and differentiation from neutrophils based on their morphology is unreliable\u0026nbsp;\u003csup\u003e38\u003c/sup\u003e. Additional staining methods have been suggested to discriminate eosinophils from neutrophils/heterophils\u0026nbsp;\u003csup\u003e23,39\u003c/sup\u003e. However, we were unable to establish a satisfactory method for eosinophil-specific differentiation. Furthermore, dense inflammatory infiltrates in both na\u0026iuml;ve and vaccinated hamsters further complicated the differentiation between eosinophils and neutrophils. Therefore, here we did not discriminate between the different types of granulocytes in the histology analysis. Overall, we observed more pronounced infiltrates in the perivascular space with an increase in eosinophilic and heterophilic/neutrophilic cell populations in the vaccinated hamsters as compared to the\u0026nbsp;mock-vaccinated\u0026nbsp;hamsters.\u003c/p\u003e\n\u003cp\u003eConcurrent with the accelerated lung histopathology, gene expression profiles revealed more prominent Th2 skewing of the immune response in the vaccinated compared with\u0026nbsp;mock-vaccinated\u0026nbsp;hamsters early after infection (2 and 4 DPI). This activation was associated with increased production of the Th2 cytokines IL-4 and IL-13, and the chemokine CCL-22. Despite this early and stronger skewing of the immune response towards a Th2 phenotype, the vaccinated hamsters recovered faster in terms of Th1 and Treg regulation, and from histological lesions observed in the lung. By 10 DPI histological changes were largely resolved and expression of the genes associated with Th-pathways and immune cells were comparable in re-challenged,\u0026nbsp;mock-vaccinated\u0026nbsp;and vaccinated animals. This observation contrasts with results found in mice with both SARS-CoV and SARS-CoV-2, where enhanced lung histology accompanied by pronounced eosinophilic infiltration was observed at 10 DPI in association with vaccination\u0026nbsp;\u003csup\u003e22,40,41\u003c/sup\u003e, underscoring species-specific differences in the animal models used for preclinical studies. Intriguingly, in a recent work in ACE2‐humanized mice, local and systemic upregulation of Th17 was reported at 7 DPI in animals vaccinated with S1 and S2 extracellular domain of the SARS‐CoV‐2 Spike protein, adjuvanted with alum\u0026nbsp;\u003csup\u003e24\u003c/sup\u003e. This finding contrasts our results in hamsters. From all genes associated with differential T-cell regulation, the selected genes associated with the Th17 pathway were the most abundant (Supplementary table S4), yet the only difference between vaccinated and mock-vaccinated animals was observed very early post infection (at 2 DPI), when the Th17 pathway was the least activated in the vaccinated group. The observed difference could be a result of species differences, dissimilar vaccines used, and the distinct challenge used in the mouse study, namely first a low dose, followed three days later by a high dose of the same challenge virus.\u003c/p\u003e\n\u003cp\u003eIn our studies, we established the presence of binding, but the absence of neutralizing antibodies in the vaccinated hamsters. Antibody disease enhancement (ADE) mediated by vaccine-induced non-protective antibodies is well-studied for HRSV, measles and DENV (summarized by\u0026nbsp;\u003csup\u003e1\u003c/sup\u003e). For SARS-CoV-2, \u003cem\u003ein vitro\u003c/em\u003e evidence for antibody-mediated enhanced cell entry has been found in experiments with human lymphoid cell lines and in other cell lines expressing Fc\u0026gamma; receptor or hACE2 receptor (reviewed by\u0026nbsp;\u003csup\u003e42\u003c/sup\u003e). In human macrophages however, despite Fc\u0026gamma;-mediated internalization of SARS-CoV-2, the virus is uncapable of productive replication in those cells\u0026nbsp;\u003csup\u003e42\u003c/sup\u003e, arguing against the possibility of a direct macrophage-driven ADE. Furthermore, when antibodies found to be enhancing \u003cem\u003ein vitro\u003c/em\u003e were administered to mice and NHP, no disease or pathology enhancement \u003cem\u003ein vivo\u003c/em\u003e was observed\u0026nbsp;\u003csup\u003e43\u003c/sup\u003e. These results in preclinical models, together with studies proposing antibody effector functions other than neutralization playing a role in preventing of ADE manifestation\u0026nbsp;\u003csup\u003e42,44-46\u003c/sup\u003e, suggest that the accelerated pathology observed in our study is not a sole result of the presence of non-protective antibodies. Rather, a combination of lack of neutralizing antibodies, a Th-2 skewed immune response, and the presence of non-protective antibodies facilitating possible immune complexes formation seem to be responsible for the lung pathology in vaccinated hamsters. With respect to the nucleoprotein (N) and anti-N antibodies, it has been shown that the N protein has the ability of inducing macrophages to produce high levels of IL-6, one of the cytokines associated with severe disease in COVID-19 patients\u0026nbsp;\u003csup\u003e47\u003c/sup\u003e. Moreover, the N protein aggravates lung injury and promotes IL-1\u0026beta; and IL-6 secretion in mouse models\u0026nbsp;\u003csup\u003e48\u003c/sup\u003e. Anti-N antibodies enhanced the effect of N on IL-6 production by macrophages\u0026nbsp;\u003csup\u003e49\u003c/sup\u003e and sera from patients with severe COVID-19 had high concentration of anti-N IgG\u0026nbsp;\u003csup\u003e50\u003c/sup\u003e. However, in our hamster model, only 3 vaccinated animals had detectable levels of anti-N antibodies prior to challenge. Although anti-N antibodies increased earlier in vaccinated hamsters, the overall kinetics followed the same slope as in mock-vaccinated hamsters. Moreover, we did not observe increased production of IL-6 on transcriptional level in vaccinated as compared with mock-vaccinated animals. Collectively, these findings suggest that anti-N antibodies did not play a role in the accelerated lung pathology in our hamster model.\u003c/p\u003e\n\u003cp\u003eOne point of attention indicated by Munoz et al is the\u0026nbsp;importance of methodically clearing challenge materials and vaccines from cellular debris, which may otherwise enhance reactogenicity in animal models and bias observations\u0026nbsp;\u003csup\u003e1\u003c/sup\u003e. In our study, significant effort was devoted to purifying the vaccine preparation from culture contaminants to avoid sensitization of vaccinated animals towards those contaminants, but the inoculum itself was administered unpurified. In that context, it cannot be ruled out entirely that the accelerated Th-2-enhanced response is (partially) associated with sensitization towards inoculum contaminants. However, if that would be the case, double vaccination regimen would be expected to manifest with stronger pathological response towards challenge infection, but we did not observe such a trend in our first study. Therefore, it is unlikely that sensitization towards inoculum contaminants can explain the Th-2 polarization and the accelerated lung pathology in vaccinated hamsters. To avoid concerns about challenge inoculum purification, a standardized transmission model can be considered for future studies exploring VAED.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe study presents several limitations. We chose to perform a gene expression survey with pre-selected genes, instead of complete transcriptomics analysis. The power of such a survey is the focused inquiry of target genes of interest. However, at the time of selecting gene target for our study, information about the hamster genome, and genes of interest in the context of SARS-CoV-2 infection were still largely unavailable. Therefore, some of the genes identified by Ebenig et al\u0026nbsp;\u003csup\u003e23\u003c/sup\u003e as important players behind the VAED mechanism (i.e. IL19 and CCL-11) or by Nouallies et al\u0026nbsp;\u003csup\u003e51\u003c/sup\u003e as genetic markers for immune cells were not included in our custom multiplexed hybridization panel, which can be recognized as a limitation. Another limitation of our study is the translatability of the obtained data in hamsters to the human situation. Up to date, there is no evidence of vaccine-associated disease enhancement in humans following natural infection with SARS-CoV-2. Given the vast number of people that have been vaccinated with different types of inactivated vaccines during the pandemic, it is relatively safe to state that even if VAED did occur, it is of limited importance in the context of SARS-CoV-2. It is however important to have readily available models in which safety of new vaccines for SARS-CoV-2 or other pathogens can be tested\u0026nbsp;\u003csup\u003e1\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn conclusion, our data support the hypothesis that Syrian hamsters are a suitable model for inducing VAED with whole-virus FIWV adjuvanted with alum. The VAED is manifested with early upregulation of Th-2 cytokines (IL-4 and IL-13) and chemokines (CCL-22) and faster progression of immunopathology, characterized by more pronounced and prolonged perivascular infiltrates, dominated by eosinophilic and heterophilic/neutrophilic cell species. Hamsters did not display clinical disease aggravation, virtually lacked neutralizing antibodies before challenge and had spike-binding antibodies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis research was funded by the Coalition for Epidemic Preparedness Innovations (CEPI).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eR.dJ. performed the two experiments, N.O., S.V., R.dJ, and K.W. wrote the main manuscript, K.B. and Y.H. prepared and characterized the experimental vaccine preparation, N.O., R.dJ and N.G designed the experiment, J.L.G. performed the statistical analysis, N.O., R.dJ, S.V., J.S., M.C. and K.W. analysed the data, all authors participated in data interpretation and have read and approved the submitted version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eAcknowledgementsWe thank Berend Jan Bosch and Wentao Li (University of Utrecht, The Netherlands) for providing us the anti-spike S1 antibody used in this study for staining of the cell monolayers in the virus neutralization assay. Illustrations in Figure 1 were created with BioRender.com. We thank Stephen Gordon and John Browne (UCD Veterinary Sciences Centre, Dublin, Ireland) for performing the measurements on the nCounter\u0026reg;MAX Analysis System (NanoString Technologies, Seattle, WA, USA). We are grateful to all animal biotechnicians, laboratory and pathology colleagues of Wageningen Bioveterinary Research for their excellent work and support. We thank Amy C. Shurtleff, Trevor Brasel, Victoria Graham, William Dowling and Javier Castillo-Olivares from CEPI (Coalition for Epidemic Preparedness Innovations) for sharing ideas and expertise on study design and data interpretation. Finally, we would like to honour the memory of Robert D. Small, who was instrumental in designing and statistical analysis of the experiments included in this work. His inspirational attitude and ingenious insights into the use of statistics for (pre) clinical study designs are greatly missed.FundingThis research was funded by the Coalition for Epidemic Preparedness Innovations (CEPI).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMunoz, F. M. \u003cem\u003eet al.\u003c/em\u003e Vaccine-associated enhanced disease: Case definition and guidelines for data collection, analysis, and presentation of immunization safety data. Vaccine 39, 3053\u0026ndash;3066 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.vaccine.2021.01.055\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.vaccine.2021.01.055\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, H. W. \u003cem\u003eet al.\u003c/em\u003e Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine. Am J Epidemiol 89, 422\u0026ndash;434 (1969). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1093/oxfordjournals.aje.a120955\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1093/oxfordjournals.aje.a120955\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDelgado, M. F. \u0026amp; Polack, F. P. Involvement of antibody, complement and cellular immunity in the pathogenesis of enhanced respiratory syncytial virus disease. Expert Rev Vaccines 3, 693\u0026ndash;700 (2004). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1586/14760584.3.6.693\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1586/14760584.3.6.693\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBigay, J., Le Grand, R., Martinon, F. \u0026amp; Maisonnasse, P. Vaccine-associated enhanced disease in humans and animal models: Lessons and challenges for vaccine development. Front Microbiol 13, 932408 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3389/fmicb.2022.932408\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3389/fmicb.2022.932408\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmatti, M. K., Al Thani, A. A. \u0026amp; Yassine, H. M. Viral-Induced Enhanced Disease Illness. Front Microbiol 9, 2991 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3389/fmicb.2018.02991\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3389/fmicb.2018.02991\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGartlan, C. \u003cem\u003eet al.\u003c/em\u003e Vaccine-Associated Enhanced Disease and Pathogenic Human Coronaviruses. Front Immunol 13, 882972 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3389/fimmu.2022.882972\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3389/fimmu.2022.882972\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePolack, F. P. Atypical measles and enhanced respiratory syncytial virus disease (ERD) made simple. Pediatr Res 62, 111\u0026ndash;115 (2007). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1203/PDR.0b013e3180686ce0\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1203/PDR.0b013e3180686ce0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoghaddam, A. \u003cem\u003eet al.\u003c/em\u003e A potential molecular mechanism for hypersensitivity caused by formalin-inactivated vaccines. Nat Med 12, 905\u0026ndash;907 (2006). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/nm1456\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/nm1456\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrewer, J. M. (How) do aluminium adjuvants work? Immunol Lett 102, 10\u0026ndash;15 (2006). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.imlet.2005.08.002\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.imlet.2005.08.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHogenEsch, H. Mechanisms of stimulation of the immune response by aluminum adjuvants. Vaccine 20 Suppl 3, S34\u0026ndash;39 (2002). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/s0264-410x(02)00169-x\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/s0264-410x(02)00169-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Q. \u003cem\u003eet al.\u003c/em\u003e Correction: Immunodominant SARS Coronavirus Epitopes in Humans Elicited Both Enhancing and Neutralizing Effects on Infection in Non-human Primates. ACS Infect Dis 6, 1284\u0026ndash;1285 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1021/acsinfecdis.0c00148\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1021/acsinfecdis.0c00148\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolles, M. \u003cem\u003eet al.\u003c/em\u003e A double-inactivated severe acute respiratory syndrome coronavirus vaccine provides incomplete protection in mice and induces increased eosinophilic proinflammatory pulmonary response upon challenge. J Virol 85, 12201\u0026ndash;12215 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/JVI.06048-11\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/JVI.06048-11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTseng, C. T. \u003cem\u003eet al.\u003c/em\u003e Immunization with SARS coronavirus vaccines leads to pulmonary immunopathology on challenge with the SARS virus. PLoS One 7, e35421 (2012). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1371/journal.pone.0035421\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1371/journal.pone.0035421\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeming, D. \u003cem\u003eet al.\u003c/em\u003e Vaccine efficacy in senescent mice challenged with recombinant SARS-CoV bearing epidemic and zoonotic spike variants. PLoS Med 3, e525 (2006). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1371/journal.pmed.0030525\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1371/journal.pmed.0030525\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYasui, F. \u003cem\u003eet al.\u003c/em\u003e Prior immunization with severe acute respiratory syndrome (SARS)-associated coronavirus (SARS-CoV) nucleocapsid protein causes severe pneumonia in mice infected with SARS-CoV. J Immunol 181, 6337\u0026ndash;6348 (2008). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.4049/jimmunol.181.9.6337\u003c/span\u003e\u003cspan address=\"https://doi.org:10.4049/jimmunol.181.9.6337\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, L. \u003cem\u003eet al.\u003c/em\u003e Anti-spike IgG causes severe acute lung injury by skewing macrophage responses during acute SARS-CoV infection. JCI Insight 4 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1172/jci.insight.123158\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1172/jci.insight.123158\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgrawal, A. S. \u003cem\u003eet al.\u003c/em\u003e Immunization with inactivated Middle East Respiratory Syndrome coronavirus vaccine leads to lung immunopathology on challenge with live virus. Hum Vaccin Immunother 12, 2351\u0026ndash;2356 (2016). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1080/21645515.2016.1177688\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1080/21645515.2016.1177688\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, K. \u003cem\u003eet al.\u003c/em\u003e Single-Dose, Intranasal Immunization with Recombinant Parainfluenza Virus 5 Expressing Middle East Respiratory Syndrome Coronavirus (MERS-CoV) Spike Protein Protects Mice from Fatal MERS-CoV Infection. \u003cem\u003emBio\u003c/em\u003e 11 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/mBio.00554-20\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/mBio.00554-20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBewley, K. R. \u003cem\u003eet al.\u003c/em\u003e Immunological and pathological outcomes of SARS-CoV-2 challenge following formalin-inactivated vaccine in ferrets and rhesus macaques. Sci Adv 7, eabg7996 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1126/sciadv.abg7996\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1126/sciadv.abg7996\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, C. \u003cem\u003eet al.\u003c/em\u003e Absence of Vaccine-enhanced Disease With Unexpected Positive Protection Against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) by Inactivated Vaccine Given Within 3 Days of Virus Challenge in Syrian Hamster Model. Clin Infect Dis 73, e719-e734 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1093/cid/ciab083\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1093/cid/ciab083\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiPiazza, A. T. \u003cem\u003eet al.\u003c/em\u003e COVID-19 vaccine mRNA-1273 elicits a protective immune profile in mice that is not associated with vaccine-enhanced disease upon SARS-CoV-2 challenge. \u003cem\u003eImmunity\u003c/em\u003e 54, 1869\u0026ndash;1882 e1866 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.immuni.2021.06.018\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.immuni.2021.06.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIwata-Yoshikawa, N. \u003cem\u003eet al.\u003c/em\u003e A lethal mouse model for evaluating vaccine-associated enhanced respiratory disease during SARS-CoV-2 infection. Sci Adv 8, eabh3827 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1126/sciadv.abh3827\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1126/sciadv.abh3827\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEbenig, A. \u003cem\u003eet al.\u003c/em\u003e Vaccine-associated enhanced respiratory pathology in COVID-19 hamsters after TH2-biased immunization. Cell Rep 40, 111214 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.celrep.2022.111214\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.celrep.2022.111214\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, T. \u003cem\u003eet al.\u003c/em\u003e Th2 and Th17-associated immunopathology following SARS-CoV-2 breakthrough infection in Spike-vaccinated ACE2-humanized mice. J Med Virol 96, e29408 (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1002/jmv.29408\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1002/jmv.29408\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePercie du Sert, N. \u003cem\u003eet al.\u003c/em\u003e The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol 18, e3000410 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1371/journal.pbio.3000410\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1371/journal.pbio.3000410\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGerhards, N. M. \u003cem\u003eet al.\u003c/em\u003e Predictive Value of Precision-Cut Lung Slices for the Susceptibility of Three Animal Species for SARS-CoV-2 and Validation in a Refined Hamster Model. \u003cem\u003ePathogens\u003c/em\u003e 10 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3390/pathogens10070824\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3390/pathogens10070824\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCorman, V. M. \u003cem\u003eet al.\u003c/em\u003e Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill 25 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.2807/1560-7917.ES.2020.25.3.2000045\u003c/span\u003e\u003cspan address=\"https://doi.org:10.2807/1560-7917.ES.2020.25.3.2000045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWolfel, R. \u003cem\u003eet al.\u003c/em\u003e Virological assessment of hospitalized patients with COVID-2019. Nature 581, 465\u0026ndash;469 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/s41586-020-2196-x\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/s41586-020-2196-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 29, e45 (2001). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1093/nar/29.9.e45\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1093/nar/29.9.e45\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeiss, G. K. \u003cem\u003eet al.\u003c/em\u003e Direct multiplexed measurement of gene expression with color-coded probe pairs. Nat Biotechnol 26, 317\u0026ndash;325 (2008). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/nbt1385\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/nbt1385\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGodiska, R. \u003cem\u003eet al.\u003c/em\u003e Human macrophage-derived chemokine (MDC), a novel chemoattractant for monocytes, monocyte-derived dendritic cells, and natural killer cells. J Exp Med 185, 1595\u0026ndash;1604 (1997). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1084/jem.185.9.1595\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1084/jem.185.9.1595\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eImai, T. \u003cem\u003eet al.\u003c/em\u003e Selective recruitment of CCR4-bearing Th2 cells toward antigen-presenting cells by the CC chemokines thymus and activation-regulated chemokine and macrophage-derived chemokine. Int Immunol 11, 81\u0026ndash;88 (1999). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1093/intimm/11.1.81\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1093/intimm/11.1.81\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePolack, F. P., Hoffman, S. J., Crujeiras, G. \u0026amp; Griffin, D. E. A role for nonprotective complement-fixing antibodies with low avidity for measles virus in atypical measles. Nat Med 9, 1209\u0026ndash;1213 (2003). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/nm918\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/nm918\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeininger, U. \u003cem\u003eet al.\u003c/em\u003e The concept of vaccination failure. Vaccine 30, 1265\u0026ndash;1268 (2012). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.vaccine.2011.12.048\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.vaccine.2011.12.048\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoberts, A. \u003cem\u003eet al.\u003c/em\u003e Immunogenicity and protective efficacy in mice and hamsters of a beta-propiolactone inactivated whole virus SARS-CoV vaccine. Viral Immunol 23, 509\u0026ndash;519 (2010). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1089/vim.2010.0028\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1089/vim.2010.0028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLindstrom, N. M., Moore, D. M., Zimmerman, K. \u0026amp; Smith, S. A. Hematologic Assessment in Pet Rats, Mice, Hamsters, and Gerbils: Blood Sample Collection and Blood Cell Identification. Clin Lab Med 35, 629\u0026ndash;640 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.cll.2015.05.011\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.cll.2015.05.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFingerhut, L., Dolz, G. \u0026amp; de Buhr, N. What Is the Evolutionary Fingerprint in Neutrophil Granulocytes? Int J Mol Sci 21 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3390/ijms21124523\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3390/ijms21124523\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiegel, A. \u0026amp; R, M. W. Hematology and Biochemistry of Small Mammals. Ferrets, Rabbits, and Rodents, 569\u0026ndash;582 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTomasi, V. H., Perez, M. A. \u0026amp; Itoiz, M. E. Modification of Luna's technique for staining eosinophils in the hamster cheek pouch. Biotech Histochem 83, 147\u0026ndash;151 (2008). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1080/10520290802352424\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1080/10520290802352424\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSekimukai, H. \u003cem\u003eet al.\u003c/em\u003e Gold nanoparticle-adjuvanted S protein induces a strong antigen-specific IgG response against severe acute respiratory syndrome-related coronavirus infection, but fails to induce protective antibodies and limit eosinophilic infiltration in lungs. Microbiol Immunol 64, 33\u0026ndash;51 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1111/1348-0421.12754\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1111/1348-0421.12754\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIwata-Yoshikawa, N. \u003cem\u003eet al.\u003c/em\u003e Effects of Toll-like receptor stimulation on eosinophilic infiltration in lungs of BALB/c mice immunized with UV-inactivated severe acute respiratory syndrome-related coronavirus vaccine. J Virol 88, 8597\u0026ndash;8614 (2014). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/JVI.00983-14\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/JVI.00983-14\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakayama, E. E. \u0026amp; Shioda, T. SARS-CoV-2 Related Antibody-Dependent Enhancement Phenomena In Vitro and In Vivo. Microorganisms 11 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3390/microorganisms11041015\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3390/microorganisms11041015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, D. \u003cem\u003eet al.\u003c/em\u003e In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies. \u003cem\u003eCell\u003c/em\u003e 184, 4203\u0026ndash;4219 e4232 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.cell.2021.06.021\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.cell.2021.06.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBournazos, S., Gupta, A. \u0026amp; Ravetch, J. V. The role of IgG Fc receptors in antibody-dependent enhancement. Nat Rev Immunol 20, 633\u0026ndash;643 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/s41577-020-00410-0\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/s41577-020-00410-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchafer, A. \u003cem\u003eet al.\u003c/em\u003e Antibody potency, effector function, and combinations in protection and therapy for SARS-CoV-2 infection in vivo. J Exp Med 218 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1084/jem.20201993\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1084/jem.20201993\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlue, C. E., Spiller, O. B. \u0026amp; Blackbourn, D. J. The relevance of complement to virus biology. Virology 319, 176\u0026ndash;184 (2004). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.virol.2003.11.029\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.virol.2003.11.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarwaciak, I., Salkowska, A., Karas, K., Dastych, J. \u0026amp; Ratajewski, M. Nucleocapsid and Spike Proteins of the Coronavirus SARS-CoV-2 Induce IL6 in Monocytes and Macrophages-Potential Implications for Cytokine Storm Syndrome. Vaccines (Basel) 9 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3390/vaccines9010054\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3390/vaccines9010054\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan, P. \u003cem\u003eet al.\u003c/em\u003e SARS-CoV-2 N protein promotes NLRP3 inflammasome activation to induce hyperinflammation. Nat Commun 12, 4664 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/s41467-021-25015-6\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/s41467-021-25015-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakayama, E. E. \u003cem\u003eet al.\u003c/em\u003e Anti-nucleocapsid antibodies enhance the production of IL-6 induced by SARS-CoV-2 N protein. Sci Rep 12, 8108 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/s41598-022-12252-y\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/s41598-022-12252-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBatra, M. \u003cem\u003eet al.\u003c/em\u003e Role of IgG against N-protein of SARS-CoV2 in COVID19 clinical outcomes. Sci Rep 11, 3455 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/s41598-021-83108-0\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/s41598-021-83108-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNouailles, G. \u003cem\u003eet al.\u003c/em\u003e Temporal omics analysis in Syrian hamsters unravel cellular effector responses to moderate COVID-19. Nat Commun 12, 4869 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/s41467-021-25030-7\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/s41467-021-25030-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"npj-vaccines","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjvaccines","sideBox":"Learn more about [npj Vaccines](http://www.nature.com/npjvaccines/)","snPcode":"41541","submissionUrl":"https://submission.springernature.com/new-submission/41541/3?","title":"npj Vaccines","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-5254288/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5254288/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eOne of the concerns regarding vaccine safety during the COVID-19 pandemic was the potential manifestation of vaccine-associated enhancement of disease (VAED) upon SARS-CoV-2 infection. To investigate the suitability of the Syrian hamster model to test for VAED, we immunized animals with an experimental formaldehyde-inactivated, alum-adjuvanted SARS-CoV-2 vaccine preparation. In two independent experiments, challenge infection did not result in an enhancement of the clinical disease in vaccinated animals. However, at early timepoints (2\u0026ndash;5 days) after challenge infection, lung tissue of vaccinated hamsters showed elevated mRNA levels of IL-4 and IL-13 and lung histopathology progressed faster and was more prominent than in mock-vaccinated animals. At later time points, cytokine responses and lung pathology were comparable between vaccinated and mock-vaccinated hamsters, underscoring the transient nature of the pathological aggravation. With this work we show that the Syrian hamster model can be used to assess possible vaccine safety considerations in a preclinical setting.\u003c/p\u003e","manuscriptTitle":"Hamsters immunized with formalin-inactivated SARS- CoV-2 develop accelerated lung histopathological lesions and Th2-biased response following infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-26 15:46:22","doi":"10.21203/rs.3.rs-5254288/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-01-26T09:44:31+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-01-19T15:29:49+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"304714750864237773903631697479562286346","date":"2024-12-27T12:33:36+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-12-06T16:54:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"121730652421484337095011947348658762799","date":"2024-11-17T10:26:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"143106650764542315204488084110276803611","date":"2024-11-17T05:24:55+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-11-15T05:17:16+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-11-15T05:14:54+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-11-08T11:07:06+00:00","index":"","fulltext":""},{"type":"submitted","content":"npj Vaccines","date":"2024-10-13T07:50:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"npj-vaccines","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjvaccines","sideBox":"Learn more about [npj Vaccines](http://www.nature.com/npjvaccines/)","snPcode":"41541","submissionUrl":"https://submission.springernature.com/new-submission/41541/3?","title":"npj Vaccines","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"776867e6-bd8b-4631-817e-e06da3390ec0","owner":[],"postedDate":"November 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":40361531,"name":"Health sciences/Diseases"},{"id":40361532,"name":"Health sciences/Medical research"},{"id":40361533,"name":"Health sciences/Pathogenesis"}],"tags":[],"updatedAt":"2025-07-07T16:09:38+00:00","versionOfRecord":{"articleIdentity":"rs-5254288","link":"https://doi.org/10.1038/s41541-025-01160-7","journal":{"identity":"npj-vaccines","isVorOnly":false,"title":"npj Vaccines"},"publishedOn":"2025-07-04 15:58:48","publishedOnDateReadable":"July 4th, 2025"},"versionCreatedAt":"2024-11-26 15:46:22","video":"","vorDoi":"10.1038/s41541-025-01160-7","vorDoiUrl":"https://doi.org/10.1038/s41541-025-01160-7","workflowStages":[]},"version":"v1","identity":"rs-5254288","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5254288","identity":"rs-5254288","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}