Genetics of PLCG2 expression and splicing relative to Alzheimer’s disease risk

Genetics of PLCG2 expression and splicing relative to Alzheimer’s disease risk | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genetics of PLCG2 expression and splicing relative to Alzheimer’s disease risk Andrew K. Turner, Kennedy Dotson, Qi Qiao, Kailey Cain, James F. Simpson, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6735123/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Background PLCG2 is associated with the risk of Alzheimer’s disease (AD) through a rare missense polymorphism, rs72824905 (P522R) as well as a common variant, rs12445675, within a long non-coding RNA adjacent to PLCG2 . Elucidating the impact of genetics on PLCG2 expression and splicing will provide insights into the role of PLCG2 in AD risk and, potentially, treatments that might reduce AD risk. Objective To evaluate PLCG2 expression and splicing as a function of AD genetics. Methods PLCG2 isoform expression was detected by PCR and quantified by qPCR in AD and non-AD brain samples and in blood buffy coat samples. The function of a genetic variant, rs107164, was tested by using a minigene approach with both alleles in murine BV-2 microglial cells. The impact of ectopic splicing factor expression on PLCG2 minigene splicing was also tested in BV-2 cells. The extent that endogenous levels of a novel PLCG2 mRNA isoform lacking 65 bp within exon 28 (D65-PLCG2) were affected by nonsense mediated decay (NMD) was determined by using cycloheximide in vitro . Lastly, whether D65-PLCG2 manifested a Ca + 2 response similar to PLCG2 was tested by comparing D65-PLCG2-GFP and PLCG2-GFP fusion proteins in transfected HEK293 cells. Results We report PLCG2 isoforms that include (i) a transcript that replaces PLCG2 exon 1 with sequence from an adjacent long noncoding (LNC) RNA ( LNC-PLCG2 ) and (ii) a transcript that lacks 65 bp from the beginning of exon 28 ( D65-PLCG2 ). The ratio of LNC-PLCG2 to canonical PLCG2 was associated with rs12445675 genotype in both human brain and buffy coat samples. The proportion of PLCG2 expressed as D65-PLCG2 was increased by the T allele of rs1071644, a T/C SNP within the 65bp variably spliced portion of exon 28. This SNP was demonstrated to be functional in a minigene splicing assay. Moreover, the rs1071644-T allele was found to be associated with increased AD risk, independent of rs72824905 (P522R) and rs12445675. D65-PLCG2 was susceptible to nonsense mediated RNA decay. D65-PLCG2 was not responsive to Ca + 2 in a fashion similar to that observed for PLCG2. Hence, the rs1071644-T allele appears to increase AD risk by increasing the proportion of PLCG2 expressed as D65-PLCG2 , representing a loss of PLCG2 function. Conclusions We report that two AD genetic risk factors, rs12445675 and rs1071644, affect AD risk by impacting the LNC-PLCG2 to PLCG2 ratio and PLCG2 exon 28 splicing, respectively. Alzheimer’s disease RNA splicing genetics PLCG2 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Twin and family studies indicate that genetics underlies the majority of Alzheimer’s disease (AD) risk (Gatz et al., 2006 ). Elucidating the mechanisms underlying these AD risk factors will provide insights into disease mechanisms and may facilitate the identification of novel therapeutics. Two primary single nucleotide polymorphisms (SNP)s implicate PLCG2 in AD. First, a rare missense SNP, rs72824905 (P522R), reduces AD risk (Dalmasso et al., 2019 ; Kleineidam et al., 2020 ; Magno et al., 2019 ; Olive et al., 2020 ; Sims et al., 2017 ; Strickland et al., 2020 ; van der Lee et al., 2019 ) and appears a mild hypermorph in PLCG2 function (Magno et al., 2019 ; Solomon et al., 2022 ; Takalo et al., 2020 ). Second, a common SNP upstream of PLCG2 , rs12446759, within the LNC adjacent to PLCG2 , also reduces AD risk and has unclear actions on PLCG2 (Bellenguez et al., 2022 ; Dalmasso et al., 2019 ; Jansen et al., 2019 ; Kleineidam et al., 2020 ; Magno et al., 2019 ; Olive et al., 2020 ; Sims et al., 2017 ; Strickland et al., 2020 ; van der Lee et al., 2019 ). Prototypic PLCG2 contains 33 exons with translation beginning from an ATG within exon 2. PLCG2 encodes a phospholipase and, within the brain, is primarily expressed by microglia (Sims et al., 2017 ). While our understanding of microglial function in AD is still evolving, microglia are currently thought to be protective early in the AD process as they contribute to amyloid-beta clearance and possibly deleterious late in AD as their activation and associated inflammation may promote neurofibrillary tangle formation and cognitive decline (reviewed in (Leng & Edison, 2021 ; Sudwarts & Thinakaran, 2023 )). Within microglia, PLCG2 is activated by increased cytosolic Ca + 2 to cleave 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate (PIP2) to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG), which are key secondary messengers. As such, PLCG2 transduces signals from cell surface receptors such as TREM2, which has itself been associated with AD risk (Jay et al., 2017 ; Shi & Holtzman, 2018 ). Here, to gain insight into the role of PLCG2 expression and splicing in AD, we report an isoform that begins in an LNC RNA adjacent to PLCG2 ( LNC-PLCG2 ) and an isoform that lacks the initial 65bp of exon 28 ( D65-PLCG2 ). The ratio of the LNC-PLCG2 to prototypic PLCG2 was associated with rs12446759. The proportion of PLCG2 expressed as D65-PLCG2 was associated with rs1071644, a SNP within the skipped portion of exon 28. This SNP was found to be functional in modulating the proportion of PLCG2 expressed as D65-PLCG2 in minigene assays. Moreover, this SNP was associated with AD risk independent of either P522R or rs12445675. This aberrant PLCG2 splicing was correctable by ectopic expression of select splicing factors by using a minigene model. The loss of 65bp from exon 28 results in a premature termination codon such that this isoform encodes a PLCG2 lacking its carboxyl sequence, which includes a Ca + 2 binding domain. D65-PLCG2 was susceptible to nonsense mediated RNA decay and produced a protein lacking the Ca + 2 response observed in PLCG2. Overall, we report that rs12445675 and rs1071644 affect AD risk by impacting the LNC-PLCG2 to PLCG2 ratio and PLCG2 exon 28 splicing, respectively. 2. Materials and Methods Human Brain DNA and cDNA The genomic DNA and cDNA brain samples used have been described extensively (Shaw et al., 2021 ; Shaw et al., 2022 ; Zajac et al., 2023 ). In short, anterior cingulate samples were provided by the University of Kentucky AD Research Center and purified for RNA and genomic DNA, with the RNA converted to cDNA as described (Shaw et al., 2021 ; Shaw et al., 2022 ; Zajac et al., 2023 ). The National Institute on Aging-Reagan Institute criteria for neuropathological diagnosis of AD based on amyloid and tau deposits were used as a measure of AD neuropathology. Scores of “intermediate likelihood” or below were defined as low AD neuropathology and scores of “high likelihood” were defined as high AD neuropathology (reviewed in (Nelson et al., 2009 )). The samples for this study were from 25 brains with low neuropathology and 24 brains with high AD neuropathology, with an average age at death of the brain donors of 82.0 ± 9.1 (mean ± SD, n = 25) and 82.0 ± 6.5 (n = 24) years, respectively. The post-mortem interval for the high neuropathology and low neuropathology samples was 3.4 ± 0.6 and 2.8 ± 0.9 hours, respectively. Buffy coat samples were obtained from cognitively intact individuals, including 28 men with an average age of 72.6 ± 1.1 years and 29 women, average age of 71.0 ± 1.0 years. These samples were stored at -80C until RNA was purified by sequential TRIzol phase separation and RNeasy spin columns, as described (Haynes, 2015 ). RNA was converted to cDNA by using Superscript IV, as described by the manufacturer (Thermo). DNA was prepared from these samples by using Qiamp Blood DNA minikits, as directed by the manufacturer (Qiagen). PCR Genomic DNA samples were genotyped by using TaqMan Genotyping (Thermo) as directed by the manufacturer: initial denaturation at 95°C for 10 min, and PCR cycling at 95°C, 15s; 60°C, 1 min; 40 cycles. For the initial identification of LNC-PLCG2 isoforms, polymerase chain reaction (PCR) was performed with primers corresponding to sequences within the LNC exon 1 (5’ TGCAGTCACACAGCCAACTT) and PLCG2 exon 2 (GGGAGAAGGAAGGAATCGGG). To detect novel PLCG2 splice variants in human brain, PCRs were performed on cDNA samples corresponding to 30 ng of RNA with primers corresponding to sequences within: exon 1 (5’- CCGGAGCCCAAACCCG) and exon 6 (5’- GATCAGGGGCAAGATGGTCT), exon 5 (5’- CTGTGGATCAAACCAGAAGAAAC) and exon 10 (5’- ACTTTGTCATCCGCTCACGG), exon 9 (5’- ATGCCTCTGCTGTTTACCTG) and exon 14 (5’- TGTGACGCTGTTGCTCCA), exon 13 (5’- GCCATCAAAGACCACGCCTT) and exon 17 (5’- ACTTCTCGGCACTCGTCCT), exon 16 (5’- CACTACTGCGCCATTGCY) and exon 19 (5’- CAGCATGTCCTCTGCCTCTC), exon 18 (5’- CTATGCCCTCATCCAGCACT) and exon 22 (5’- ATCGCTTCGCTTGGCTTTGT), exon 20 (5’- AAGCATTGTCGCATCAACCG) and exon 26 (5’- TCCACATACATTCTGCTGACG), exon 25 (5’- TGAGTGGTTTCAGAGCATCCG) and exon 29 (5’- AGGGACAGGCAATACTTCGTC), exon 28 (5’- TATGACCCGATGCCACCCG) and exon 32 (5’- TTCAGTTCTTCTTGCCGCCT), and exon 31 (5’- TCCCTCCTGGTTTTCTGTGAG) and exon 33 (5’- ACTTGCTGTTGCTGACTCTCTT). After 30 cycles with Q5 DNA Polymerase (New England Biolabs), PCR products were separated by electrophoresis using a 10% polyacrylamide gel and visualized with SYBRgold staining. Isoforms were excised and eluted from the gel, reamplified with appropriate primers and sequenced (ACGT, Inc). qPCR To quantify PLCG2 isoforms, a series of qPCR assays were performed as described previously (Shaw et al., 2021 ; Shaw et al., 2022 ; Zajac et al., 2023 ). For each assay, copy numbers present in cDNA samples were determined relative to standard curves that were executed in parallel (Shaw et al., 2021 ; Shaw et al., 2022 ; Zajac et al., 2023 ). The LNC-PLCG2 was quantified using a forward primer corresponding to the LNC exon 2 (5’- CAGGCGTCAGGAAAAGAACA) and a reverse primer corresponding to PLCG2 exon 2 (5’- GGGAGAAGGAAGGAATCGGG). Results were compared with those for canonical PLCG2 which used a forward primer corresponding to PLCG2 exon 1 (5’- CGGAGGGCGTGAGCG) and an exon 2 reverse primer (5’-CGGGGGTGGACTTGCG). Total PLCG2 was quantified using a forward primer corresponding to constitutively present sequence in exon 28 (5’-GAATCACGCATTGTTTTCTCTCA) and in reverse primer corresponding to sequence in exon 29 (5’- AGGGACAGGCAATACTTCGTC). The D65-PLCG2 was quantified with the same reverse exon 29 primer and a forward primer corresponding to the novel junction between exons 27 and 28 created by the loss of the first 65 bp in exon 28 (5’- TTCCAGACGGCAGCCTG). The PCR cycling conditions for all qPCR were as follows: 95°C, 2 min; 95°C, 15 s, 60°C, 15 s, 72°C, 30 s, 40 cycles. Genetic Association Analyses Genetic data from the Alzheimer’s Disease Genetics Consortium (ADGC) were obtained and linked to participant data from the National Alzheimer’s Coordinating Center (NACC) as described previously (Katsumata et al., 2022 ). The variable defining presumptive etiologic diagnosis of the cognitive disorder - Alzheimer's disease (NACCALZD) was used to define AD cases and controls. Participants with mild cognitive impairment (MCI) or with impairment and no Alzheimer's disease etiologic diagnosis as defined in NACCUDSD were excluded, resulting in 8230 controls and 8215 AD cases. Logistic regression assuming an additive mode of inheritance and adjusting for sex, age, and 10 PCs was conducted in PLINK 2.0 (Chang et al., 2015 ; Purcell & Chang). PLCG2 Minigene To generate PLCG2 minigenes consisting of exon 27, exon 28, exon 29, and their intervening introns, primers corresponding to sequence in exon 27 (5’- CATCATCAGACAGAAGCCCGT) and exon 29 (5’- GTCATACTCGGCTCCACAGA) were used to PCR-amplify (Q5, NEB) genomic DNA from individuals homozygous for each allele of rs1071644. PCR products were separated by electrophoresis on a 1% agarose gel, excised, eluted, and then TA-cloned into pcDNA3.1 (Thermo). Clone sequences were confirmed via sequencing (Plasmidsaurus). In addition to rs1071644, clones also differed for rs4611451, rs12596299, rs4888191, rs488192 and rs4369659. To determine whether rs1071644 was indeed the functional SNP, the clone with rs1071644-C was mutated to rs1071644-T with a Quikchange Site Directed Mutagenesis kit (Agilent) as directed by the manufacturer by using HPLC purified primers 5'-CTCAATTTCCAGACGGCAAAGGGCAATTCTGCAGAT-3’ and 5'-ATCTGCAGAATTGCCCTTTGCCGTCTGGAAATTGAG-3. The resulting clone was then sequenced (Plasmidsaurus) to confirm mutagenesis at only the rs1071644 site. These three clones were then transfected in triplicate into murine microglial BV-2 cells using Lipofectamine 3000 reagent (Thermo), as directed by the manufacturer. Cells were incubated for 24 hours and RNA purified with RNeasy (Qiagen) following manufacturer’s directions. RNA was converted into cDNA via reverse transcription by using random primers and Superscript IV Reverse Transcriptase (Thermo). PLCG2 exon 28 splicing was then quantified by qPCR by using a reverse primer that corresponded to vector -derived transcript sequence (5’ AGACCGAGGAGAGGGTTAGG) and forward primers corresponding to either exon 27 (5’ - CATCATCAGACAGAAGCCCGT) or to the unique sequence corresponding to the exon-27-exon 28 junction observed in D65-PLCG2 (5’-TTCCAGACGGCAGCCTG). Nonsense Mediated Decay To determine if D65-PLCG2 undergoes NMD, the U937 human cell line, which constitutively expresses PLCG2 , was treated with cycloheximide (CHX) or a DMSO solvent control as described previously (Zajac et al., 2023 ). Briefly, U937 cells maintained in RPMI 1640 with HEPES (Invitrogen 42401-018), 10% v/v fetal calf serum (characterized, low lipopolysaccharide), 50 U/mL penicillin and 50 µg/mL streptomycin were plated in 0.9 mL media in a 24-well plate. CHX was dissolved in ethanol at 50 mg/mL and cells were treated in triplicate with either CHX (final concentration of 50µg/ml) or ethanol (0.1%). After 1, 3, 5, or 8 hours, cells were centrifuged and RNA purified using RNeasy according to the manufacturer’s instructions (Qiagen). RNA was converted to cDNA by using random hexamers and SuperScript IV (Thermo, Waltham, MA USA). D65-PLCG2 and PLCG2 were visualized by PCR followed by gel electrophoresis and SYBR-gold staining and quantified by qPCR, as described above. Splicing Factors To determine if the D65-PLCG2 isoform is a potential target for splicing modulators, we co-transfected the rs1071644-T allele minigene clone into HEK-293 cells in duplicate with splicing factors encoding SRSF1, SRSF2, SRSF5, SRSF6, SRSF7 or, as the negative control, empty pCDM8, as we previously described (Ling & Estus, 2010 ). After 24 hours, cellular RNA was purified, converted into cDNA, and D65-PLCG2 and total PLCG2 quantified as described above for minigene analyses. Expression Cloning of PLCG2 isoforms and Calcium Influx For expression cloning of PLCG2 and D65-PLCG2 , cDNA underwent PCR cycling with primers corresponding to sequences in the PLCG2 5’ UTR (5’- CCGATTCCTTCCTTCTCCCTG) and 3’ UTR (5’- CCCAGAGTGTGAATAGGGCA). PCR products corresponding to canonical PLCG2 and D65-PLCG2 were separated on a 1% agarose gel, reamplified separately, gel purified and then cloned in-frame at the carboxyl terminus of GFP by using NT-GFP Fusion-TOPO, as directed by the manufacturer (Thermo). Clone identities were confirmed by sequencing (ACGT, Inc). Clones were then transfected into HEK-293 cells by using Lipofectamine 3000 Reagent (Thermo) as directed by the manufacturer. After 24 hours, media was replaced with HBSS with or without 20uM A23187 calcium ionophore (Sigma) for five minutes. Cells were then washed with HBSS, fixed with 10% formalin for 7 minutes, rinsed, and mounted with NucBlueT Fixed Cell Ready Reagent (ThermoFisher). Cells were visualized and representative images obtained by using confocal microscopy (Nikon A1R HD). Additional Statistical Analyses Analyses were performed by using SPSS (V.29). The ratio of different isoforms as a function of genotype was analyzed by Kruskal-Wallis tests. P values for post-hoc analyses were Bonferroni-adjusted for multiple testing. 3. Results As an initial approach to identify PLCG2 isoforms in human brain, we noted that ENSEMBL (Cunningham et al., 2022) included an isoform wherein a LNC RNA (ENSG00000289733) that flanks PLCG2 is spliced onto PLCG2 exon 2, creating a fusion mRNA. Since the first ATG translation initiation site within this fusion mRNA is the canonical PLCG2 translation start site within exon 2, this fusion mRNA still encodes prototypic PLCG2. To check whether this isoform was expressed in human brain, we performed PCR from the novel LNC exon 1 to exon 2 of PLCG2 . When these products were visualized by PAGE, four isoforms were detected that were readily detectable in each sample examined (Fig. 1A). Subsequent sequencing of these PCR products found that the most abundant isoform consisted of canonical LNC exon 1 and exon 2 that was spliced onto PLCG2 exon 2 (Fig. 1A). We also detected several less abundant isoforms which sequencing established as (i) LNC exon 1 spliced directly onto PLCG2 exon 2, (ii) LNC exon 1 that retained 51 bp intron 1 and then spliced onto LNC exon 2 and PLCG2 exon 2, and (iii) LNC exon 1 that retained 51 bp of intron 1 that was spliced directly onto PLCG2 exon 2 (Fig. 1A). We proceeded to compare PLCG2 that arose from the LNC versus the canonical PLCG2 exon 1 by using qPCR on cDNA samples generated from AD and non-AD brains. For this effort, we used a reverse primer in PLCG2 exon 2 and forward primers in either PLCG2 exon 1 or LNC exon 2 to capture the most abundant novel isoform. This effort revealed that levels of the canonical PLCG2 and LNC-PLCG2 isoforms were comparable and were associated with the AD GWAS SNP rs12446759 (Fig. 1B-C). The minor rs12446759-A allele was associated with an increase in LNC-PLCG2 , compared to the canonical PLCG2 isoform. To test whether this finding was specific to the brain or relevant to PLCG2 expression in the periphery, we extended these findings by examining RNA purified from human buffy coat samples. The minor rs12446759-A allele was again associated with an increase in the ratio of LNC-PLCG2 compared to canonical PLCG2 (Fig. 1D-E). We proceeded to evaluate human brain cDNA samples for atypical PLCG2 splicing. For this effort, we used PCR with primers that generated overlapping fragments of PLCG2 . Hence, we used primers that corresponded to sequences in exons 1 and 6, exons 5 and 10, exons 9 and 14, exons 13 and 17, exons 16 and 19, exons 18 and 22, exons 20 and 26, exons 25 and 29, exons 28 and 32, and exons 31 and 33. The resulting PCR products were the expected sizes except for a product that appeared relatively common and was produced by the primers amplifying from exon 25 to exon 29 (Fig. 2A). This band as well as the expected PCR product were excised from the gel. Sequencing confirmed the larger PCR product was canonical PLCG2 from exon 25 to 29 and found that the smaller PCR product lacked the initial 65 bp of exon 28 (referred to as D65-PLCG2 ). The use of the atypical splice acceptor site within exon 28 is not unexpected because the underlying RNA sequence (GCACGGGCUACGUUCUGCAG) has a splice acceptor site score of 4.1 which is well above the threshold of 2.2 (Wang & Marin, 2006). That noted, this value of 4.1 is well below the score of 11.2 attained by the canonical splice acceptor site of intron 27 (gcguucacuuuccuucccag) (Wang & Marin, 2006). Regarding the impact of the 65 bp deletion on PLCG2 protein, this deletion causes a codon reading frameshift such that exon 28 encodes a single amino acid followed immediately by a termination codon. The resulting protein is predicted to lack the carboxyl-terminal 247 amino acids of PLCG2 (Fig. 2B) which includes the carboxyl portion of the enzymatic Y-box and the C-2 motif that mediates Ca 2+ binding (Fig. 2B). During this process, we noted that rs1071644 is at position 41 in exon 28, within the skipped 65bp portion. Moreover, DeepCLIP in-silico analyses (Gronning et al., 2020) predict that rs1071644 affects binding of splicing factors such as SRSF7; the C allele is predicted to be targeted by SRSF7 (binding score of 0.73) relative to the T allele (binding score of 0.26), and SRSF7 is well-expressed in microglia (Manning & Cooper, 2017). This suggested that rs1071644 may be a functional SNP that influences the proportion of PLCG2 expressed as D65-PLCG2 . To evaluate this possibility, we quantified PLCG2 and D65-PLCG2 as a function of rs1071644. This qPCR study used a common reverse primer corresponding to sequence within exon 29 and forward primers corresponding to either a constitutively present portion of exon 28 or the unique exon junction generated by exon 27 splicing onto the middle of exon 28. We found that the percent of PLCG2 that was present as D65-PLCG2 strongly correlated with rs1071644 in both brain and buffy coat samples (Fig. 3A-D). The proportion of PLCG2 expressed as D65-PLCG2 was not correlated with AD neuropathology or sex (p > 0.5). To determine whether rs1071644 is indeed a functional SNP that influences skipping of the first 65 bp of exon 28, we cloned minigenes for the rs1071644 major T and minor C alleles that contained PLCG2 exon 27 to 29, including their respective introns. To obviate the possibility that rs1071644 is a proxy for a different functional SNP that is co-inherited, we mutated the rs1071644 minor C allele clone to the major T allele by using site directed mutagenesis. These three clones were then transfected into murine BV-2 microglial cells. After 24 hours, RNA was prepared, converted into cDNA, and the percentage of PLCG2 expressed as D65-PLCG2 was quantified by using a vector specific reverse primer and forward primers corresponding to either the constitutive portion of exon 28 or the novel splice junction formed in D65-PLCG2 . We found that the percentage of D65-PLCG2 arising from the C and T allele clones was 1.4% and 11.1%, respectively, while the samples wherein the minor C allele was mutated to T showed 10.0% D65-PLCG2 (p = 2x10 -5 , F 1,2 = 108.4, Fig. 4). Hence, rs1071644 is a functional SNP that affects splicing of PLCG2 exon 28. Since rs1071644 is a functional SNP and PLCG2 has been previously implicated in AD by genetics (Bellenguez et al., 2022; Dalmasso et al., 2019; Jansen et al., 2019; Kleineidam et al., 2020; Magno et al., 2019; Olive et al., 2020; Sims et al., 2017; Strickland et al., 2020; van der Lee et al., 2019), we tested whether rs1071644 is associated with AD risk. Since SNPs are often co-inherited with other SNPs, we first checked whether rs1071644 was in linkage disequilibrium with either of the known AD-associated PLCG2 SNPs, the rare missense SNP, rs72824905 (P522R) and the GWAS SNP rs12446759. Within the European population that constitutes the samples used within this study, rs1071644 is not co-inherited with rs12446759 (r 2 = 0.0005, p = 0.758) and only modestly co-inherited with rs72824905 (r 2 = 0.0205, p = 0.044) (Machiela & Chanock, 2015). To examine the association of rs1071644 with AD further, we evaluated rs1071644 for association with AD by itself and in combination with P522R and rs12446759. We found that rs1071644-T was consistently associated with increased AD risk, independent of the other SNPs (Table 1). Table 1 Rs1071644 is associated with AD risk. Reference Allele Effect Allele* Model** OR (95% CI) Z Statistic P value C T rs1071644 1.065 (1.017–1.114) 2.706 0.0068 C T rs1071644 +P522R 1.067 (1.020–1.117) 2.795 0.0052 C T rs1071644 +P522R+ Rs12446759 1.068 (1.021–1.118) 2.843 0.0045 *Each regression models the count of T alleles of rs1071644, reflecting an additive mode of inheritance. **Sex, age, and the first 10 PCs are covariates in all the regression models. OR: Odds ratio, CI: 95% Confidence Interval Since D65-PLCG2 introduces a premature stop codon within exon 28, well before the usual termination codon in exon 33, we hypothesized that D65-PLCG2 was susceptible to NMD because this process often occurs when a ribosome encounters a termination codon upstream of an exon junction complex (Silva & Romao, 2009). To test this hypothesis, U937 cells, which naturally express PLCG2 , were treated with CHX. We and others have previously used CHX to inhibit protein synthesis and, thereby, NMD (Busi & Cresteil, 2005; Malik et al., 2015; Urano et al., 2012; Zajac et al., 2023). RNA was then prepared and reverse transcribed into cDNA. The percentage of PLCG2 expressed as D65-PLCG2 was visualized via staining on a polyacrylamide gel and quantified by using qPCR. We found that CHX increased the percentage of PLCG2 expressed as D65-PLCG2 (Fig. 5), supporting the hypothesis that D65-PLCG2 undergoes NMD. Hence, D65-PLCG2 likely represents a larger proportion of PLCG2 transcription than suggested by the steady state mRNA measurements. To discern whether D65-PLCG2 may encode a stable protein, we generated plasmids encoding PLCG2 and D65-PLCG2 as GFP fusion proteins, similar to the approach of Nishida et al who evaluated the role of PLCG2 domains in PLCG2 function (Nishida et al., 2003). Clones were transiently transfected into HEK293 cells which typically express PLCG2 . In resting cells, the subcellular localization of canonical PLCG2 and PLCG2-GFP was similar as both manifested a diffuse cytosolic localization (Fig. 6), suggesting that D65-PLCG2 may be expressed as a stable protein. Since Nishida et al reported that the Ca + 2 binding domain is critical for PLCG2 response to Ca + 2 (Nishida et al., 2003), we tested the response in cells treated with the Ca + 2 ionophore A23187 for five minutes. While D65-PLCG2 remained diffusely localized in the cytosol in response to this treatment, PLCG2 showed a pattern of marked condensation, likely reflecting a conformation change (Fig. 6). Hence, PLCG2 but not D65-PLCG2 responds to increases in cytosolic Ca + 2 . Since rs1071644-T is associated with increased AD risk and causes an increase in D65-PLCG2 , agents that promote canonical PLCG2 exon 28 splicing may reduce AD risk. Exon splicing is modulated by splicing enhancer and suppressor proteins that bind to sequence-specific elements within exons and introns and signal to other proteins involved in the splicing process (reviewed in (Manning & Cooper, 2017)). In recent years, pharmacologic agents targeting these splicing factors or the splice sites themselves have emerged as a viable therapeutic strategy (El Marabti & Abdel-Wahab, 2021). As a proof-of-concept study to investigate whether D65-PLCG23 could be reduced by modulators, the rs1071644-T allele minigene was co-transfected with plasmids encoding splicing modulators, as we and others have described previously (Ling & Estus, 2010; van Bergeijk et al., 2019). These splicing factors included SRSF7, which was noted above to target the rs1071644 sequence, as well as a negative control plasmid. We found that the proportion of D65-PLCG2 was reduced by ectopic expression of SRSF7, as well as SRSF1 and SRSF6 (Fig. 7), leading us to predict that SRSF1 and SRSF6 bind to other target elements within this minigene. Overall, these results support the concept that PLCG2 exon 28 splicing can be improved through splicing factor modulation. 4. Discussion This primary findings of this study include (i) a PLCG2 GWAS SNP, rs12446759, is associated with the proportion of PLCG2 transcripts that begin within an adjacent LNC versus canonical PLCG2 exon 1, (ii) levels of a novel PLCG2 isoform, which lacks the first 65bp of exon 28, are modulated by a SNP within the skipped sequence, rs1071644, that is itself associated with AD risk independent of rs12446759 and P522R, (iii) D65-PLCG2 is subject to NMD, suggesting that the D65-PLCG2 mRNA measurements in brain and buffy coat samples likely underestimate the proportion of PLCG2 expressed as D65-PLCG2 , (iv) ectopic expression of D65-PLCG2 as a GFP fusion protein found that D65-PLCG2 is localized to the cytosol but lacks a Ca + 2 response observed in PLCG2-GFP, and (v) the proportion of PLCG2 expressed as D65-PLCG2 is reduced by ectopic splicing factor expression, suggesting that this splicing event may be targetable by pharmacologic agents. In summary, we report mechanisms whereby two SNPs alter PLCG2 expression and AD risk, test whether a novel isoform is expressed as protein, and show that PLCG2 splicing can be modulated in a fashion that would reduce AD risk. The rs12446759-G allele, previously associated with reduced AD risk (Bellenguez et al., 2022 ), was associated here with a decrease in LNC-PLCG2 relative to canonical PLCG2 . Interestingly, rs12446759 is located within the first intron of LNC, 13bp after exon 1, and is therefore contained within the rare LNC-PLCG2 isoforms that retained 51 bp of LNC intron 1. Iin considering how the association of rs12446759 with LNC-PLCG2 versus PLCG2 may impact PLCG2 function, we note that both LNC-PLCG2 and canonical PLCG2 encode the same PLCG2 protein because the first ATG translation start site for either LNC-PLCG2 or PLCG2 is within exon 2 of canonical PLCG2 . This was also true for each of the multiple LNC-PLCG2 isoforms that we identified; the first ATG translation start codon for each of isoform is in the canonical PLCG2 exon 2. We speculate that differences in the 5’UTR sequences of LNC-PLCG2 and canonical PLCG2 may influence protein translation. Further work is required to clarify this possibility. The rs1071644-T allele was associated with an increase in the proportion of PLCG2 expressed as D65-PLCG2 in both brain and buffy coat samples (Fig. 3 ). To test whether rs1071644 may be functional, we compared splicing from minigenes that differed for the rs1071644 alleles. This effort found that rs1071644-T resulted in about 11% of the minigene being expressed as D65-PLCG2 compared to about 1% for the rs1071644-C allele. Since these minigenes also differed at other SNPs, including rs4611451, rs12596299, rs4888191, rs488192 and rs4369659, we tested whether rs1071644 was indeed functional by converting the rs1071644-C minigene to the T allele by using site-directed mutagenesis. This change was sufficient to change splicing from 1% D65-PLCG2 to 11% D65-PLCG2 , replicating the effect of the rs1071644-T allele minigene (Fig. 4 ). Hence, rs1071644-T increases D65-PLCG2 and is a functional SNP. Since D65-PLCG2 introduces a premature stop codon within exon 28, well before the usual termination codon in exon 33, we hypothesized that D65-PLCG2 was susceptible to NMD because this process commonly occurs when a ribosome encounters a termination codon upstream of an exon junction complex (Silva & Romao, 2009 ). Consistent with this hypothesis, CHX treated U937 cells showed an increase in the proportion of PLCG2 expressed as D65-PLCG2 . We interpret the finding that D65-PLCG2 is less stable than PLCG2 to mean that our measurements of D65-PLCG2 at steady state in brain and buffy coat likely reflect an underestimate of the proportion of PLCG2 transcripts that become D65-PLCG2 during RNA splicing. Hence, the rs1071644-T allele may have a larger effect on overall PLCG2 transcripts than suggested by our qPCR findings. Our overall findings support a model wherein the rs1071644-T allele increases AD risk by increasing D65-PLCG2 at the expense of canonical PLCG2 . Since D65-PLCG2 lacks a portion of the PLCG2 catalytic domain, and the entire Ca + 2 binding domain, this protein is likely non-functional, as reported previously for a PLCG2 synthetic construct lacking the Ca + 2 binding domain (Nishida et al., 2003 ). Because pharmacologic agents have been developed to rectify aberrant splicing and have achieved FDA approval (El Marabti & Abdel-Wahab, 2021 ; Matsuo, 2021 ; Neil & Bisaccia, 2019 ), we tested whether ectopic expression of several splicing factors would reduce D65-PLCG2. This effort found that SRSF1, SRSF6 and SRSF7 were all capable of ameliorating the effects of rs1071644-T on splicing. Hence, the actions of rs1071644-T in promoting AD risk may be countered by responsive to agents that improve canonical exon 28 splicing. In summary, we report the actions of an AD GWAS SNP, rs12446759, and identify a novel AD risk factor, rs1071644, and its underlying mechanism. Rs12446759 resides just after the first exon of an LNC adjacent to PLCG2 and is associated with this LNC being used as the PLCG2 5’UTR instead of the canonical PLCG2 exon 1. Rs1071644 resides in exon 28 and is functional in causing a skipping of the first 65 nucleotides of exon 28. While the effects of the altered 5’UTR require further study to elucidate, the changes in exon 28 splicing produce an apparently stable protein which lacks a portion of the PLCG2 catalytic domain as well as the PLCG2 Ca + 2 binding domain. The effects of rs1071644 appear amenable to agents that target splicing, suggesting that this AD risk factor may be amenable to therapeutic intervention. Abbreviations AD: Alzheimer’s disease, MCI: mild cognitive impairment, bp: basepair, LNC: long noncoding, SNP: single nucleotide polymorphism, PIP2: 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate, IP3: 1D-myo-inositol 1,4,5-trisphosphate, DAG: diacylglycerol, ADGC: Alzheimer’s Disease Genetics Consortium, NACC: National Alzheimer’s Coordinating Center, CHX: cycloheximide, OR: Odds ratio, CI: 95% Confidence Interval Declarations -Ethics approval and consent to participate: This study was approved by the University of Kentucky Institutional Review Board (application #48095). The authors express their gratitude for each of the individuals that donated tissue or blood for this study, each of whom signed an informed consent. -Consent for publication: Each author approved of the final version of this paper and agreed to be included as an author. -Availability of data and material: All relevant data are included within the manuscript. -Competing interests: The authors declare no competing interests. -Funding: National Institute on Aging at NIH, including R21AG083820 and R01AG082730. -Authors' contributions: A.T. wrote the manuscript text and prepared Figure 4, 6 and 7. K.D. prepared Figures 2, 3 and 5. K.C. prepared Figure 1. Q.Q. prepared Table 1. J.S. contributed to Figures 1, 2, 3, 4, 5, and 7. D.F. and S.E. directed the study. All authors edited and reviewed the manuscript. -Acknowledgements: The authors thank the dedicated research participants at the University of Kentucky. This manuscript is dedicated to the memory of Mr. Simpson who contributed to many scientific findings from the Estus lab and recently died of prostate cancer. DATA ACKNOWLEDGEMENTS Alzheimer’s Disease Genetics Consortium (ADGC) . The National Institutes of Health, National Institute on Aging (NIH-NIA) supported this work through the following grants: ADGC, U01 AG032984, RC2 AG036528; Samples from the National Cell Repository for Alzheimer’s Disease (NCRAD), which receives government support under a cooperative agreement grant (U24 AG21886) awarded by the National Institute on Aging (NIA), were used in this study. We thank contributors who collected samples used in this study, as well as patients and their families, whose help and participation made this work possible; Data for this study were prepared, archived, and distributed by the National Institute on Aging Alzheimer’s Disease Data Storage Site (NIAGADS) at the University of Pennsylvania (U24-AG041689); GCAD, U54 AG052427; NACC, U01 AG016976; NIA LOAD (Columbia University), U24 AG026395, U24 AG026390, R01AG041797; Banner Sun Health Research Institute P30 AG019610; Boston University, P30 AG013846, U01 AG10483, R01 CA129769, R01 MH080295, R01 AG017173, R01 AG025259, R01 AG048927, R01AG33193, R01 AG009029; Columbia University, P50 AG008702, R37 AG015473, R01 AG037212, R01 AG028786; Duke University, P30 AG028377, AG05128; Emory University, AG025688; Group Health Research Institute, UO1 AG006781, UO1 HG004610, UO1 HG006375, U01 HG008657; Indiana University, P30 AG10133, R01 AG009956, RC2 AG036650; Johns Hopkins University, P50 AG005146, R01 AG020688; Massachusetts General Hospital, P50 AG005134; Mayo Clinic, P50 AG016574, R01 AG032990, KL2 RR024151; Mount Sinai School of Medicine, P50 AG005138, P01 AG002219; New York University, P30 AG08051, UL1 RR029893, 5R01AG012101, 5R01AG022374, 5R01AG013616, 1RC2AG036502, 1R01AG035137; North Carolina A&T University, P20 MD000546, R01 AG28786-01A1; Northwestern University, P30 AG013854; Oregon Health & Science University, P30 AG008017, R01 AG026916; Rush University, P30 AG010161, R01 AG019085, R01 AG15819, R01 AG17917, R01 AG030146, R01 AG01101, RC2 AG036650, R01 AG22018; TGen, R01 NS059873; REAADI study is supported by NIA grant AG052410; University of Alabama at Birmingham, P50 AG016582; University of Arizona, R01 AG031581; University of California, Davis, P30 AG010129; University of California, Irvine, P50 AG016573; University of California, Los Angeles, P50 AG016570; University of California, San Diego, P50 AG005131; University of California, San Francisco, P50 AG023501, P01 AG019724; University of Kentucky, P30 AG028383, AG05144; University of Michigan, P50 AG008671; University of Pennsylvania, P30 AG010124; University of Pittsburgh, P50 AG005133, AG030653, AG041718, AG07562, AG02365; University of Southern California, P50 AG005142; University of Texas Southwestern, P30 AG012300; University of Miami, R01 AG027944, AG010491, AG027944, AG021547, AG019757; University of Washington, P50 AG005136, R01 AG042437; University of Wisconsin, P50 AG033514; Vanderbilt University, R01 AG019085; and Washington University, P50 AG005681, P01 AG03991, P01 AG026276. The Kathleen Price Bryan Brain Bank at Duke University Medical Center is funded by NINDS grant # NS39764, NIMH MH60451 and by Glaxo Smith Kline. Support was also from the Alzheimer’s Association (LAF, IIRG-08-89720; MP-V, IIRG-05-14147), the US Department of Veterans Affairs Administration, Office of Research and Development, Biomedical Laboratory Research Program, and BrightFocus Foundation (MP-V, A2111048). P.S.G.-H. is supported by Wellcome Trust, Howard Hughes Medical Institute, and the Canadian Institute of Health Research. Genotyping of the TGEN2 cohort was supported by Kronos Science. The TGen series was also funded by NIA grant AG041232 to AJM and MJH, The Banner Alzheimer’s Foundation, The Johnnie B. Byrd Sr. Alzheimer’s Institute, the Medical Research Council, and the state of Arizona and also includes samples from the following sites: Newcastle Brain Tissue Resource (funding via the Medical Research Council, local NHS trusts and Newcastle University), MRC London Brain Bank for Neurodegenerative Diseases (funding via the Medical Research Council),South West Dementia Brain Bank (funding via numerous sources including the Higher Education Funding Council for England (HEFCE), Alzheimer’s Research Trust (ART), BRACE as well as North Bristol NHS Trust Research and Innovation Department and DeNDRoN), The Netherlands Brain Bank (funding via numerous sources including Stichting MS Research, Brain Net Europe, Hersenstichting Nederland Breinbrekend Werk, International Parkinson Fonds, Internationale Stiching Alzheimer Onderzoek), Institut de Neuropatologia, Servei Anatomia Patologica, Universitat de Barcelona. ADNI data collection and sharing was funded by the National Institutes of Health Grant U01 AG024904 and Department of Defense award number W81XWH-12-2-0012. ADNI is funded by the National Institute on Aging, the National Institute of Biomedical Imaging and Bioengineering, and through generous contributions from the following: AbbVie, Alzheimer’s Association; Alzheimer’s Drug Discovery Foundation; Araclon Biotech; BioClinica, Inc.; Biogen; Bristol-Myers Squibb Company; CereSpir, Inc.; Eisai Inc.; Elan Pharmaceuticals, Inc.; Eli Lilly and Company; EuroImmun; F. Hoffmann-La Roche Ltd and its affiliated company Genentech, Inc.; Fujirebio; GE Healthcare; IXICO Ltd.; Janssen Alzheimer Immunotherapy Research & Development, LLC.; Johnson & Johnson Pharmaceutical Research & Development LLC.; Lumosity; Lundbeck; Merck & Co., Inc.; Meso Scale Diagnostics, LLC.; NeuroRx Research; Neurotrack Technologies; Novartis Pharmaceuticals Corporation; Pfizer Inc.; Piramal Imaging; Servier; Takeda Pharmaceutical Company; and Transition Therapeutics. The Canadian Institutes of Health Research is providing funds to support ADNI clinical sites in Canada. Private sector contributions are facilitated by the Foundation for the National Institutes of Health (www.fnih.org). The grantee organization is the Northern California Institute for Research and Education, and the study is coordinated by the Alzheimer's Disease Cooperative Study at the University of California, San Diego. ADNI data are disseminated by the Laboratory for Neuro Imaging at the University of Southern California. National Alzheimer’s Coordinating Center (NACC). The NACC database is funded by NIA/NIH Grant U24 AG072122. NACC data are contributed by the NIA-funded ADRCs: P30 AG062429 (PI James Brewer, MD, PhD), P30 AG066468 (PI Oscar Lopez, MD), P30 AG062421 (PI Bradley Hyman, MD, PhD), P30 AG066509 (PI Thomas Grabowski, MD), P30 AG066514 (PI Mary Sano, PhD), P30 AG066530 (PI Helena Chui, MD), P30 AG066507 (PI Marilyn Albert, PhD), P30 AG066444 (PI John Morris, MD), P30 AG066518 (PI Jeffrey Kaye, MD), P30 AG066512 (PI Thomas Wisniewski, MD), P30 AG066462 (PI Scott Small, MD), P30 AG072979 (PI David Wolk, MD), P30 AG072972 (PI Charles DeCarli, MD), P30 AG072976 (PI Andrew Saykin, PsyD), P30 AG072975 (PI David Bennett, MD), P30 AG072978 (PI Neil Kowall, MD), P30 AG072977 (PI Robert Vassar, PhD), P30 AG066519 (PI Frank LaFerla, PhD), P30 AG062677 (PI Ronald Petersen, MD, PhD), P30 AG079280 (PI Eric Reiman, MD), P30 AG062422 (PI Gil Rabinovici, MD), P30 AG066511 (PI Allan Levey, MD, PhD), P30 AG072946 (PI Linda Van Eldik, PhD), P30 AG062715 (PI Sanjay Asthana, MD, FRCP), P30 AG072973 (PI Russell Swerdlow, MD), P30 AG066506 (PI Todd Golde, MD, PhD), P30 AG066508 (PI Stephen Strittmatter, MD, PhD), P30 AG066515 (PI Victor Henderson, MD, MS), P30 AG072947 (PI Suzanne Craft, PhD), P30 AG072931 (PI Henry Paulson, MD, PhD), P30 AG066546 (PI Sudha Seshadri, MD), P20 AG068024 (PI Erik Roberson, MD, PhD), P20 AG068053 (PI Justin Miller, PhD), P20 AG068077 (PI Gary Rosenberg, MD), P20 AG068082 (PI Angela Jefferson, PhD), P30 AG072958 (PI Heather Whitson, MD), P30 AG072959 (PI James Leverenz, MD). References Bellenguez, C., Kucukali, F., Jansen, I. E., Kleineidam, L., Moreno-Grau, S., Amin, N., Naj, A. C., Campos-Martin, R., Grenier-Boley, B., Andrade, V., Holmans, P. A., Boland, A., Damotte, V., van der Lee, S. J., Costa, M. R., Kuulasmaa, T., Yang, Q., de Rojas, I., Bis, J. C., . . . Lambert, J. C. (2022). New insights into the genetic etiology of Alzheimer's disease and related dementias. Nat Genet , 54 (4), 412-436. https://doi.org/10.1038/s41588-022-01024-z Busi, F., & Cresteil, T. (2005). CYP3A5 mRNA degradation by nonsense-mediated mRNA decay. Mol Pharmacol , 68 (3), 808-815. https://doi.org/mol.105.014225 [pii] 10.1124/mol.105.014225 Chang, C. C., Chow, C. C., Tellier, L. C., Vattikuti, S., Purcell, S. M., & Lee, J. J. (2015). Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience , 4 , 7. https://doi.org/10.1186/s13742-015-0047-8 Cunningham, F., Allen, J. E., Allen, J., Alvarez-Jarreta, J., Amode, M. R., Armean, I. M., Austine-Orimoloye, O., Azov, A. G., Barnes, I., Bennett, R., Berry, A., Bhai, J., Bignell, A., Billis, K., Boddu, S., Brooks, L., Charkhchi, M., Cummins, C., Da Rin Fioretto, L., . . . Flicek, P. (2022). Ensembl 2022. Nucleic Acids Res , 50 (D1), D988-D995. https://doi.org/10.1093/nar/gkab1049 Dalmasso, M. C., Brusco, L. I., Olivar, N., Muchnik, C., Hanses, C., Milz, E., Becker, J., Heilmann-Heimbach, S., Hoffmann, P., Prestia, F. A., Galeano, P., Avalos, M. S. S., Martinez, L. E., Carulla, M. E., Azurmendi, P. J., Liberczuk, C., Fezza, C., Sampano, M., Fierens, M., . . . Ramirez, A. (2019). Transethnic meta-analysis of rare coding variants in PLCG2, ABI3, and TREM2 supports their general contribution to Alzheimer's disease. Transl Psychiatry , 9 (1), 55. https://doi.org/10.1038/s41398-019-0394-9 El Marabti, E., & Abdel-Wahab, O. (2021). Therapeutic Modulation of RNA Splicing in Malignant and Non-Malignant Disease. Trends Mol Med , 27 (7), 643-659. https://doi.org/10.1016/j.molmed.2021.04.005 Gatz, M., Reynolds, C. A., Fratiglioni, L., Johansson, B., Mortimer, J. A., Berg, S., Fiske, A., & Pedersen, N. L. (2006). Role of genes and environments for explaining Alzheimer disease. Arch Gen Psychiatry , 63 (2), 168-174. https://doi.org/10.1001/archpsyc.63.2.168 Gronning, A. G. B., Doktor, T. K., Larsen, S. J., Petersen, U. S. S., Holm, L. L., Bruun, G. H., Hansen, M. B., Hartung, A. M., Baumbach, J., & Andresen, B. S. (2020). DeepCLIP: predicting the effect of mutations on protein-RNA binding with deep learning. Nucleic Acids Res , 48 (13), 7099-7118. https://doi.org/10.1093/nar/gkaa530 Haynes, K. (2015, 2015). TRIzol RNeasy . OpenWetWare. Retrieved May 18 from Jansen, I. E., Savage, J. E., Watanabe, K., Bryois, J., Williams, D. M., Steinberg, S., Sealock, J., Karlsson, I. K., Hagg, S., Athanasiu, L., Voyle, N., Proitsi, P., Witoelar, A., Stringer, S., Aarsland, D., Almdahl, I. S., Andersen, F., Bergh, S., Bettella, F., . . . Posthuma, D. (2019). Genome-wide meta-analysis identifies new loci and functional pathways influencing Alzheimer's disease risk. Nat Genet , 51 , 404–413. https://doi.org/10.1038/s41588-018-0311-9 Jay, T. R., von Saucken, V. E., & Landreth, G. E. (2017). TREM2 in Neurodegenerative Diseases. Mol Neurodegener , 12 (1), 56. https://doi.org/10.1186/s13024-017-0197-5 Katsumata, Y., Shade, L. M., Hohman, T. J., Schneider, J. A., Bennett, D. A., Farfel, J. M., Alzheimer's Disease Genetics, C., Kukull, W. A., Fardo, D. W., & Nelson, P. T. (2022). Multiple gene variants linked to Alzheimer's-type clinical dementia via GWAS are also associated with non-Alzheimer's neuropathologic entities. Neurobiol Dis , 174 , 105880. https://doi.org/10.1016/j.nbd.2022.105880 Kleineidam, L., Chouraki, V., Prochnicki, T., van der Lee, S. J., Madrid-Marquez, L., Wagner-Thelen, H., Karaca, I., Weinhold, L., Wolfsgruber, S., Boland, A., Martino Adami, P. V., Lewczuk, P., Popp, J., Brosseron, F., Jansen, I. E., Hulsman, M., Kornhuber, J., Peters, O., Berr, C., . . . Ramirez, A. (2020). PLCG2 protective variant p.P522R modulates tau pathology and disease progression in patients with mild cognitive impairment. Acta Neuropathol , 139 (6), 1025-1044. https://doi.org/10.1007/s00401-020-02138-6 Leng, F., & Edison, P. (2021). Neuroinflammation and microglial activation in Alzheimer disease: where do we go from here? Nat Rev Neurol , 17 (3), 157-172. https://doi.org/10.1038/s41582-020-00435-y Ling, I. F., & Estus, S. (2010). Role of SFRS13A in low-density lipoprotein receptor splicing. Hum Mutat , 31 (6), 702-709. https://doi.org/10.1002/humu.21244 Machiela, M. J., & Chanock, S. J. (2015). LDlink: a web-based application for exploring population-specific haplotype structure and linking correlated alleles of possible functional variants. Bioinformatics , 31 (21), 3555-3557. https://doi.org/10.1093/bioinformatics/btv402 Magno, L., Lessard, C. B., Martins, M., Lang, V., Cruz, P., Asi, Y., Katan, M., Bilsland, J., Lashley, T., Chakrabarty, P., Golde, T. E., & Whiting, P. J. (2019). Alzheimer's disease phospholipase C-gamma-2 (PLCG2) protective variant is a functional hypermorph. Alzheimers Res Ther , 11 (1), 16. https://doi.org/10.1186/s13195-019-0469-0 Malik, M., Chiles, J., 3rd, Xi, H. S., Medway, C., Simpson, J., Potluri, S., Howard, D., Liang, Y., Paumi, C. M., Mukherjee, S., Crane, P., Younkin, S., Fardo, D. W., & Estus, S. (2015). Genetics of CD33 in Alzheimer's disease and acute myeloid leukemia. Hum Mol Genet . https://doi.org/10.1093/hmg/ddv092 Manning, K. S., & Cooper, T. A. (2017). The roles of RNA processing in translating genotype to phenotype. Nat Rev Mol Cell Biol , 18 (2), 102-114. https://doi.org/10.1038/nrm.2016.139 Matsuo, M. (2021). Antisense Oligonucleotide-Mediated Exon-skipping Therapies: Precision Medicine Spreading from Duchenne Muscular Dystrophy. JMA J , 4 (3), 232-240. https://doi.org/10.31662/jmaj.2021-0019 Neil, E. E., & Bisaccia, E. K. (2019). Nusinersen: A Novel Antisense Oligonucleotide for the Treatment of Spinal Muscular Atrophy. J Pediatr Pharmacol Ther , 24 (3), 194-203. https://doi.org/10.5863/1551-6776-24.3.194 Nelson, P. T., Braak, H., & Markesbery, W. R. (2009). Neuropathology and cognitive impairment in Alzheimer disease: a complex but coherent relationship. J Neuropathol Exp Neurol , 68 (1), 1-14. https://doi.org/10.1097/NEN.0b013e3181919a48 Nishida, M., Sugimoto, K., Hara, Y., Mori, E., Morii, T., Kurosaki, T., & Mori, Y. (2003). Amplification of receptor signalling by Ca2+ entry-mediated translocation and activation of PLCgamma2 in B lymphocytes. EMBO J , 22 (18), 4677-4688. https://doi.org/10.1093/emboj/cdg457 Olive, C., Ibanez, L., Farias, F. H. G., Wang, F., Budde, J. P., Norton, J. B., Gentsch, J., Morris, J. C., Li, Z., Dube, U., Del-Aguila, J., Bergmann, K., Bradley, J., Benitez, B. A., Harari, O., Fagan, A., Ances, B., Cruchaga, C., & Fernandez, M. V. (2020). Examination of the Effect of Rare Variants in TREM2, ABI3, and PLCG2 in LOAD Through Multiple Phenotypes. J Alzheimers Dis , 77 (4), 1469-1482. https://doi.org/10.3233/JAD-200019 Purcell, S., & Chang, C. (2015). PLINK 2.0 . In www.cog-genomics.org/plink/2.0/. Shaw, B. C., Katsumata, Y., Simpson, J. F., Fardo, D. W., & Estus, S. (2021). Analysis of Genetic Variants Associated with Levels of Immune Modulating Proteins for Impact on Alzheimer's Disease Risk Reveal a Potential Role for SIGLEC14. Genes (Basel) , 12 (7). https://doi.org/10.3390/genes12071008 Shaw, B. C., Snider, H. C., Turner, A. K., Zajac, D. J., Simpson, J. F., & Estus, S. (2022). An Alternatively Spliced TREM2 Isoform Lacking the Ligand Binding Domain is Expressed in Human Brain. J Alzheimers Dis . https://doi.org/10.3233/JAD-215602 Shi, Y., & Holtzman, D. M. (2018). Interplay between innate immunity and Alzheimer disease: APOE and TREM2 in the spotlight. Nat Rev Immunol , 18 (12), 759-772. https://doi.org/10.1038/s41577-018-0051-1 Silva, A. L., & Romao, L. (2009). The mammalian nonsense-mediated mRNA decay pathway: to decay or not to decay! Which players make the decision? FEBS Lett , 583 (3), 499-505. https://doi.org/10.1016/j.febslet.2008.12.058 Sims, R., van der Lee, S. J., Naj, A. C., Bellenguez, C., Badarinarayan, N., Jakobsdottir, J., Kunkle, B. W., Boland, A., Raybould, R., Bis, J. C., Martin, E. R., Grenier-Boley, B., Heilmann-Heimbach, S., Chouraki, V., Kuzma, A. B., Sleegers, K., Vronskaya, M., Ruiz, A., Graham, R. R., . . . Schellenberg, G. D. (2017). Rare coding variants in PLCG2, ABI3, and TREM2 implicate microglial-mediated innate immunity in Alzheimer's disease. Nat Genet , 49 (9), 1373-1384. https://doi.org/10.1038/ng.3916 Solomon, S., Sampathkumar, N. K., Carre, I., Mondal, M., Chennell, G., Vernon, A. C., Ruepp, M. D., & Mitchell, J. C. (2022). Heterozygous expression of the Alzheimer's disease-protective PLCgamma2 P522R variant enhances Abeta clearance while preserving synapses. Cell Mol Life Sci , 79 (8), 453. https://doi.org/10.1007/s00018-022-04473-1 Strickland, S. L., Morel, H., Prusinski, C., Allen, M., Patel, T. A., Carrasquillo, M. M., Conway, O. J., Lincoln, S. J., Reddy, J. S., Nguyen, T., Malphrus, K. G., Soto, A. I., Walton, R. L., Crook, J. E., Murray, M. E., Boeve, B. F., Petersen, R. C., Lucas, J. A., Ferman, T. J., . . . Ertekin-Taner, N. (2020). Association of ABI3 and PLCG2 missense variants with disease risk and neuropathology in Lewy body disease and progressive supranuclear palsy. Acta Neuropathol Commun , 8 (1), 172. https://doi.org/10.1186/s40478-020-01050-0 Sudwarts, A., & Thinakaran, G. (2023). Alzheimer's genes in microglia: a risk worth investigating. Mol Neurodegener , 18 (1), 90. https://doi.org/10.1186/s13024-023-00679-4 Takalo, M., Wittrahm, R., Wefers, B., Parhizkar, S., Jokivarsi, K., Kuulasmaa, T., Makinen, P., Martiskainen, H., Wurst, W., Xiang, X., Marttinen, M., Poutiainen, P., Haapasalo, A., Hiltunen, M., & Haass, C. (2020). The Alzheimer's disease-associated protective Plcgamma2-P522R variant promotes immune functions. Mol Neurodegener , 15 (1), 52. https://doi.org/10.1186/s13024-020-00402-7 Urano, E., Miyauchi, K., Ichikawa, R., Futahashi, Y., & Komano, J. (2012). Regulation of cyclin T1 expression and function by an alternative splice variant that skips exon 7 and contains a premature termination codon. Gene , 505 (1), 1-8. https://doi.org/10.1016/j.gene.2012.06.006 van Bergeijk, P., Seneviratne, U., Aparicio-Prat, E., Stanton, R., & Hasson, S. A. (2019). SRSF1 and PTBP1 Are trans-Acting Factors That Suppress the Formation of a CD33 Splicing Isoform Linked to Alzheimer's Disease Risk. Mol Cell Biol , 39 (18). https://doi.org/10.1128/MCB.00568-18 van der Lee, S. J., Conway, O. J., Jansen, I., Carrasquillo, M. M., Kleineidam, L., van den Akker, E., Hernandez, I., van Eijk, K. R., Stringa, N., Chen, J. A., Zettergren, A., Andlauer, T. F. M., Diez-Fairen, M., Simon-Sanchez, J., Lleo, A., Zetterberg, H., Nygaard, M., Blauwendraat, C., Savage, J. E., . . . Holstege, H. (2019). A nonsynonymous mutation in PLCG2 reduces the risk of Alzheimer's disease, dementia with Lewy bodies and frontotemporal dementia, and increases the likelihood of longevity. Acta Neuropathol , 138 (2), 237-250. https://doi.org/10.1007/s00401-019-02026-8 Wang, M., & Marin, A. (2006). Characterization and prediction of alternative splice sites. Gene , 366 (2), 219-227. https://doi.org/10.1016/j.gene.2005.07.015 Zajac, D. J., Simpson, J., Zhang, E., Parikh, I., & Estus, S. (2023). Expression of INPP5D isoforms in human brain: Impact of Alzheimer's Disease neuropathology and genetics. Genes (Basel) , 14 (3). https://doi.org/10.3390/genes14030763 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 10 Sep, 2025 Reviews received at journal 04 Sep, 2025 Reviewers agreed at journal 05 Aug, 2025 Reviews received at journal 02 Jul, 2025 Reviewers agreed at journal 02 Jul, 2025 Reviewers invited by journal 17 Jun, 2025 Editor assigned by journal 12 Jun, 2025 Submission checks completed at journal 28 May, 2025 First submitted to journal 23 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6735123","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":472727989,"identity":"8f722958-477b-404e-beea-b031b538201b","order_by":0,"name":"Andrew K. Turner","email":"","orcid":"","institution":"University of Kentucky","correspondingAuthor":false,"prefix":"","firstName":"Andrew","middleName":"K.","lastName":"Turner","suffix":""},{"id":472727990,"identity":"5ac419e4-ef02-4faa-a6b7-b9056b00a62f","order_by":1,"name":"Kennedy Dotson","email":"","orcid":"","institution":"University of Kentucky","correspondingAuthor":false,"prefix":"","firstName":"Kennedy","middleName":"","lastName":"Dotson","suffix":""},{"id":472727991,"identity":"eec993bb-1c63-4326-99e2-a0b516c63659","order_by":2,"name":"Qi Qiao","email":"","orcid":"","institution":"University of Kentucky","correspondingAuthor":false,"prefix":"","firstName":"Qi","middleName":"","lastName":"Qiao","suffix":""},{"id":472727992,"identity":"6469cd1d-1c42-4e9d-93e4-da16a9932588","order_by":3,"name":"Kailey Cain","email":"","orcid":"","institution":"University of Kentucky","correspondingAuthor":false,"prefix":"","firstName":"Kailey","middleName":"","lastName":"Cain","suffix":""},{"id":472727993,"identity":"6582f724-69b6-4a21-8c7f-110d79eccf4c","order_by":4,"name":"James F. Simpson","email":"","orcid":"","institution":"University of Kentucky","correspondingAuthor":false,"prefix":"","firstName":"James","middleName":"F.","lastName":"Simpson","suffix":""},{"id":472727994,"identity":"5a199909-774e-44a8-9a74-2d937a431cd6","order_by":5,"name":"David W. Fardo","email":"","orcid":"","institution":"University of Kentucky","correspondingAuthor":false,"prefix":"","firstName":"David","middleName":"W.","lastName":"Fardo","suffix":""},{"id":472727995,"identity":"d699594a-33ca-4369-a937-d6731a52726e","order_by":6,"name":"Steven Estus","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYJADxgcMB0B0AgF1bFCah4GB2YBkLWwSRGmRn998TOIDg429vUT6s2qeM4cZ+NlzDPBqMTjGliY5gyEtsUcix+w2z43DDJI9bwhoYeMxNuZhOJzAI5HDdpvnw2EGgxsEbJFv4/9s/Ifhvz0P0GHFIC32hLQwHONhfMzAcICxRyLBjBnkMAMJgn5JM3zYY5Cc2HPmjbHknDPpPBJnnhXgd1jz4QcHflTY2bO3pz/88OaYtRx/e/IG/A6D2AVnNfMQoRwV1JGsYxSMglEwCoY/AAAJvUKgQ3GwcgAAAABJRU5ErkJggg==","orcid":"","institution":"University of Kentucky","correspondingAuthor":true,"prefix":"","firstName":"Steven","middleName":"","lastName":"Estus","suffix":""}],"badges":[],"createdAt":"2025-05-23 18:38:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6735123/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6735123/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":84973991,"identity":"bc723976-59fc-4953-ab11-110bf9654c9d","added_by":"auto","created_at":"2025-06-19 11:50:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":460977,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of \u003cem\u003eLNC-PLCG2 \u003c/em\u003erelative to canonical \u003cem\u003ePLCG2\u003c/em\u003e is associated with rs12446759. Several \u003cem\u003ePLCG2\u003c/em\u003e isoforms originated with the \u003cem\u003eLNC\u003c/em\u003e (A). The top row of the graphic shows each of the \u003cem\u003eLNC\u003c/em\u003e exons and the first two exons of \u003cem\u003ePLCG2\u003c/em\u003e. The subsequent rows depict each of the variant isoforms that were detected by subjecting human brain cDNA to PCR from \u003cem\u003eLNC\u003c/em\u003eexon 1 to \u003cem\u003ePLCG2\u003c/em\u003e exon 2. In addition to the isoform that included \u003cem\u003eLNC\u003c/em\u003e exons 1 and 2, isoforms were detected that lack \u003cem\u003eLNC\u003c/em\u003e exon 2, retained 51bp of \u003cem\u003eLNC\u003c/em\u003e intron 1 (denoted as light green) and each combination of these possibilities. \u003cem\u003eLNC-PLCG2\u003c/em\u003e and canonical \u003cem\u003ePLCG2\u003c/em\u003e were quantified by qPCR in brain (B-C) and buffy coat (D-E) samples. In the brain samples, Kruskal-Wallis analysis found an overall significant association with rs12446759 (p=0.018). Post-hoc analyses found that the homozygous G/G samples were significantly different from the A/G (p=0.022 (Bonferroni-adjusted)) and AA samples (p=0.020). In the buffy coat samples, rs12446759 was also associated with the \u003cem\u003eLNC-PLCG2: PLCG2\u003c/em\u003e ratio (p=0.008, Kruskal-Wallis). Post-hoc analyses found that the homozygous G/G samples were significantly different from the A/A samples (p=0.009). The G/G samples showed a trend for separation from the A/G samples (p=0.076).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6735123/v1/726fa7d64636683acebfd796.png"},{"id":84973745,"identity":"551cfe33-3389-4b3b-a51b-3e95d3f4fda6","added_by":"auto","created_at":"2025-06-19 11:42:36","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":210525,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCR amplification from exons 25 and 29 reveals a novel \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePLCG2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e variant isoform.\u003c/strong\u003e PCR was performed on a pool of brain cDNA by using primers corresponding to sequence within the indicated exons (A).\u0026nbsp; The primary novel PCR product, produced by primers against sequences in exon 25 and 29, was found to lack 65bp from the beginning of exon 28.\u0026nbsp; Loss of this 65 bp results in a frameshift with single amino acid followed by premature stop codon (B).\u0026nbsp; This changes PLCG2 by truncating the second portion of its catalytic domain and deleting the Ca\u003csup\u003e+2 \u003c/sup\u003ebinding domain.\u0026nbsp;\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6735123/v1/3f2fefbf3f5d1b60ae5b9ca8.png"},{"id":84973992,"identity":"a815937d-298d-4434-bd53-6c3b9ae05f85","added_by":"auto","created_at":"2025-06-19 11:50:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":235165,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eD65-PLCG2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e is strongly associated with rs1071644\u003c/strong\u003e. This SNP in the skipped portion of exon 28 is a splicing QTL.\u0026nbsp; In the brain samples, Kruskal-Wallis analysis found an overall significant association between the percentage of PLCG2 expressed as D65-PLCG2 and rs1071644 (p=2.4x10\u003csup\u003e-4\u003c/sup\u003e).\u0026nbsp; Post-hoc analyses found that the homozygous T/T samples were significantly different from the C/T (p=0.001 (Bonferroni-adjusted)) and C/C samples (p=0.001).\u0026nbsp; In the buffy coat samples, rs1071644 was also associated with the percentage of PLCG2 expressed as D65-PLCG2 (p=9.0x10\u003csup\u003e-7\u003c/sup\u003e, Kruskal-Wallis).\u0026nbsp; Post-hoc analyses found that the homozygous T/T samples were significantly different from the C/T samples (p=0.005) and the C/C samples (p=1.4x10\u003csup\u003e-7\u003c/sup\u003e) and that C/T were significantly different from C/C samples (p=0.006).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6735123/v1/b0bf6c2157ffc6dbaa60e4c0.png"},{"id":84974000,"identity":"a06cc6d6-a574-4596-ab11-9a80aa9b4a98","added_by":"auto","created_at":"2025-06-19 11:50:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":64720,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe proportion of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePLCG2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e minigene spliced as \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eD65-PLCG2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e is increased with the T allele of rs1071644 \u003c/strong\u003e(p\u0026lt;0.001, ANOVA)\u003cstrong\u003e. \u003c/strong\u003eThe two T clones were not significantly different (p\u0026gt;0.05) but were significantly different from the C allele (p\u0026lt;0.00001). Similar results were observed in a separate experiment in BV-2 cells as well as in HEK293 cells.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6735123/v1/b7356f0ca543ef23bb8a428e.png"},{"id":84973750,"identity":"8f02048e-c668-48da-b782-041f750323ce","added_by":"auto","created_at":"2025-06-19 11:42:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":217824,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eD65-PLCG2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e is subject to NMD. \u003c/strong\u003eThe proportion of \u003cem\u003ePLCG2\u003c/em\u003e expressed as D\u003cem\u003e65-PLCG2\u003c/em\u003e is increased in U937 cells treated with CHX, as revealed by visual inspection of PCR products separated by PAGE (A) and by qPCR \u003cstrong\u003e(\u003c/strong\u003eB, F\u003csub\u003e1,3 \u003c/sub\u003e= 44.9, p=1.2x10\u003csup\u003e-6\u003c/sup\u003e).\u0026nbsp; CHX treated samples were significantly different from solvent control samples at the 3, 5 and 8 hour time points (P\u0026lt;0.005, LSD).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6735123/v1/2fdfd178a7428bafedc8f9d4.png"},{"id":84973994,"identity":"e94d5a99-3c23-4374-8f2a-db349cb26479","added_by":"auto","created_at":"2025-06-19 11:50:36","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":435346,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eD65-PLCG2 and PLCG2 show cytosolic localization in untreated cells but only PLCG2 becomes condensed after A23187 treatment. \u003c/strong\u003eSimilar results were observed in a separate set of cells.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6735123/v1/87abb5c117ef5c29b183c2b7.png"},{"id":84973748,"identity":"ec949da2-ad7c-427c-acee-511dd5732feb","added_by":"auto","created_at":"2025-06-19 11:42:36","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":106648,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSeveral splicing factors, including SRSF7, reduce the proportion of aberrant \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePLCG2 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eexon 28 splicing\u003c/strong\u003e(general linear model, p\u0026lt;0.001, results for SRSF1, SRSF6 and SRSF7 significantly different from empty vector control (p\u0026lt;0.01, LSD).\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-6735123/v1/7e50f2c3b6a2dbeea94b18ba.png"},{"id":84975159,"identity":"af96d94e-9721-47a1-ba50-f3abe1373703","added_by":"auto","created_at":"2025-06-19 12:06:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2900705,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6735123/v1/966e9214-7826-4010-91ac-51d0af665ac2.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genetics of PLCG2 expression and splicing relative to Alzheimer’s disease risk","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eTwin and family studies indicate that genetics underlies the majority of Alzheimer\u0026rsquo;s disease (AD) risk (Gatz et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Elucidating the mechanisms underlying these AD risk factors will provide insights into disease mechanisms and may facilitate the identification of novel therapeutics. Two primary single nucleotide polymorphisms (SNP)s implicate \u003cem\u003ePLCG2\u003c/em\u003e in AD. First, a rare missense SNP, rs72824905 (P522R), reduces AD risk (Dalmasso et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Kleineidam et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Magno et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Olive et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Sims et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Strickland et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; van der Lee et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and appears a mild hypermorph in PLCG2 function (Magno et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Solomon et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Takalo et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Second, a common SNP upstream of \u003cem\u003ePLCG2\u003c/em\u003e, rs12446759, within the LNC adjacent to \u003cem\u003ePLCG2\u003c/em\u003e, also reduces AD risk and has unclear actions on \u003cem\u003ePLCG2\u003c/em\u003e (Bellenguez et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Dalmasso et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Jansen et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Kleineidam et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Magno et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Olive et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Sims et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Strickland et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; van der Lee et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrototypic \u003cem\u003ePLCG2\u003c/em\u003e contains 33 exons with translation beginning from an ATG within exon 2. \u003cem\u003ePLCG2\u003c/em\u003e encodes a phospholipase and, within the brain, is primarily expressed by microglia (Sims et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). While our understanding of microglial function in AD is still evolving, microglia are currently thought to be protective early in the AD process as they contribute to amyloid-beta clearance and possibly deleterious late in AD as their activation and associated inflammation may promote neurofibrillary tangle formation and cognitive decline (reviewed in (Leng \u0026amp; Edison, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Sudwarts \u0026amp; Thinakaran, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023\u003c/span\u003e)). Within microglia, PLCG2 is activated by increased cytosolic Ca\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e to cleave 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate (PIP2) to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG), which are key secondary messengers. As such, PLCG2 transduces signals from cell surface receptors such as TREM2, which has itself been associated with AD risk (Jay et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Shi \u0026amp; Holtzman, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHere, to gain insight into the role of \u003cem\u003ePLCG2\u003c/em\u003e expression and splicing in AD, we report an isoform that begins in an LNC RNA adjacent to PLCG2 (\u003cem\u003eLNC-PLCG2\u003c/em\u003e) and an isoform that lacks the initial 65bp of exon 28 (\u003cem\u003eD65-PLCG2\u003c/em\u003e). The ratio of the \u003cem\u003eLNC-PLCG2\u003c/em\u003e to prototypic \u003cem\u003ePLCG2\u003c/em\u003e was associated with rs12446759. The proportion of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e was associated with rs1071644, a SNP within the skipped portion of exon 28. This SNP was found to be functional in modulating the proportion of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e in minigene assays. Moreover, this SNP was associated with AD risk independent of either P522R or rs12445675. This aberrant \u003cem\u003ePLCG2\u003c/em\u003e splicing was correctable by ectopic expression of select splicing factors by using a minigene model. The loss of 65bp from exon 28 results in a premature termination codon such that this isoform encodes a PLCG2 lacking its carboxyl sequence, which includes a Ca\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e binding domain. \u003cem\u003eD65-PLCG2\u003c/em\u003e was susceptible to nonsense mediated RNA decay and produced a protein lacking the Ca\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e response observed in PLCG2. Overall, we report that rs12445675 and rs1071644 affect AD risk by impacting the \u003cem\u003eLNC-PLCG2\u003c/em\u003e to \u003cem\u003ePLCG2\u003c/em\u003e ratio and \u003cem\u003ePLCG2\u003c/em\u003e exon 28 splicing, respectively.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eHuman Brain DNA and cDNA\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe genomic DNA and cDNA brain samples used have been described extensively (Shaw et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Shaw et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Zajac et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In short, anterior cingulate samples were provided by the University of Kentucky AD Research Center and purified for RNA and genomic DNA, with the RNA converted to cDNA as described (Shaw et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Shaw et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Zajac et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The National Institute on Aging-Reagan Institute criteria for neuropathological diagnosis of AD based on amyloid and tau deposits were used as a measure of AD neuropathology. Scores of \u0026ldquo;intermediate likelihood\u0026rdquo; or below were defined as low AD neuropathology and scores of \u0026ldquo;high likelihood\u0026rdquo; were defined as high AD neuropathology (reviewed in (Nelson et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2009\u003c/span\u003e)). The samples for this study were from 25 brains with low neuropathology and 24 brains with high AD neuropathology, with an average age at death of the brain donors of 82.0\u0026thinsp;\u0026plusmn;\u0026thinsp;9.1 (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD, n\u0026thinsp;=\u0026thinsp;25) and 82.0\u0026thinsp;\u0026plusmn;\u0026thinsp;6.5 (n\u0026thinsp;=\u0026thinsp;24) years, respectively. The post-mortem interval for the high neuropathology and low neuropathology samples was 3.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6 and 2.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9 hours, respectively. Buffy coat samples were obtained from cognitively intact individuals, including 28 men with an average age of 72.6\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1 years and 29 women, average age of 71.0\u0026thinsp;\u0026plusmn;\u0026thinsp;1.0 years. These samples were stored at -80C until RNA was purified by sequential TRIzol phase separation and RNeasy spin columns, as described (Haynes, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). RNA was converted to cDNA by using Superscript IV, as described by the manufacturer (Thermo). DNA was prepared from these samples by using Qiamp Blood DNA minikits, as directed by the manufacturer (Qiagen).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePCR\u003c/b\u003e \u003c/p\u003e \u003cp\u003eGenomic DNA samples were genotyped by using TaqMan Genotyping (Thermo) as directed by the manufacturer: initial denaturation at 95\u0026deg;C for 10 min, and PCR cycling at 95\u0026deg;C, 15s; 60\u0026deg;C, 1 min; 40 cycles. For the initial identification of \u003cem\u003eLNC-PLCG2\u003c/em\u003e isoforms, polymerase chain reaction (PCR) was performed with primers corresponding to sequences within the \u003cem\u003eLNC\u003c/em\u003e exon 1 (5\u0026rsquo; TGCAGTCACACAGCCAACTT) and \u003cem\u003ePLCG2\u003c/em\u003e exon 2 (GGGAGAAGGAAGGAATCGGG). To detect novel \u003cem\u003ePLCG2\u003c/em\u003e splice variants in human brain, PCRs were performed on cDNA samples corresponding to 30 ng of RNA with primers corresponding to sequences within: exon 1 (5\u0026rsquo;- CCGGAGCCCAAACCCG) and exon 6 (5\u0026rsquo;- GATCAGGGGCAAGATGGTCT), exon 5 (5\u0026rsquo;- CTGTGGATCAAACCAGAAGAAAC) and exon 10 (5\u0026rsquo;- ACTTTGTCATCCGCTCACGG), exon 9 (5\u0026rsquo;- ATGCCTCTGCTGTTTACCTG) and exon 14 (5\u0026rsquo;- TGTGACGCTGTTGCTCCA), exon 13 (5\u0026rsquo;- GCCATCAAAGACCACGCCTT) and exon 17 (5\u0026rsquo;- ACTTCTCGGCACTCGTCCT), exon 16 (5\u0026rsquo;- CACTACTGCGCCATTGCY) and exon 19 (5\u0026rsquo;- CAGCATGTCCTCTGCCTCTC), exon 18 (5\u0026rsquo;- CTATGCCCTCATCCAGCACT) and exon 22 (5\u0026rsquo;- ATCGCTTCGCTTGGCTTTGT), exon 20 (5\u0026rsquo;- AAGCATTGTCGCATCAACCG) and exon 26 (5\u0026rsquo;- TCCACATACATTCTGCTGACG), exon 25 (5\u0026rsquo;- TGAGTGGTTTCAGAGCATCCG) and exon 29 (5\u0026rsquo;- AGGGACAGGCAATACTTCGTC), exon 28 (5\u0026rsquo;- TATGACCCGATGCCACCCG) and exon 32 (5\u0026rsquo;- TTCAGTTCTTCTTGCCGCCT), and exon 31 (5\u0026rsquo;- TCCCTCCTGGTTTTCTGTGAG) and exon 33 (5\u0026rsquo;- ACTTGCTGTTGCTGACTCTCTT). After 30 cycles with Q5 DNA Polymerase (New England Biolabs), PCR products were separated by electrophoresis using a 10% polyacrylamide gel and visualized with SYBRgold staining. Isoforms were excised and eluted from the gel, reamplified with appropriate primers and sequenced (ACGT, Inc).\u003c/p\u003e \u003cp\u003e \u003cb\u003eqPCR\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo quantify \u003cem\u003ePLCG2\u003c/em\u003e isoforms, a series of qPCR assays were performed as described previously (Shaw et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Shaw et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Zajac et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). For each assay, copy numbers present in cDNA samples were determined relative to standard curves that were executed in parallel (Shaw et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Shaw et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Zajac et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The \u003cem\u003eLNC-PLCG2\u003c/em\u003e was quantified using a forward primer corresponding to the \u003cem\u003eLNC\u003c/em\u003e exon 2 (5\u0026rsquo;- CAGGCGTCAGGAAAAGAACA) and a reverse primer corresponding to \u003cem\u003ePLCG2\u003c/em\u003e exon 2 (5\u0026rsquo;- GGGAGAAGGAAGGAATCGGG). Results were compared with those for canonical \u003cem\u003ePLCG2\u003c/em\u003e which used a forward primer corresponding to \u003cem\u003ePLCG2\u003c/em\u003e exon 1 (5\u0026rsquo;- CGGAGGGCGTGAGCG) and an exon 2 reverse primer (5\u0026rsquo;-CGGGGGTGGACTTGCG). Total \u003cem\u003ePLCG2\u003c/em\u003e was quantified using a forward primer corresponding to constitutively present sequence in exon 28 (5\u0026rsquo;-GAATCACGCATTGTTTTCTCTCA) and in reverse primer corresponding to sequence in exon 29 (5\u0026rsquo;- AGGGACAGGCAATACTTCGTC). The \u003cem\u003eD65-PLCG2\u003c/em\u003e was quantified with the same reverse exon 29 primer and a forward primer corresponding to the novel junction between exons 27 and 28 created by the loss of the first 65 bp in exon 28 (5\u0026rsquo;- TTCCAGACGGCAGCCTG). The PCR cycling conditions for all qPCR were as follows: 95\u0026deg;C, 2 min; 95\u0026deg;C, 15 s, 60\u0026deg;C, 15 s, 72\u0026deg;C, 30 s, 40 cycles.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGenetic Association Analyses\u003c/b\u003e \u003c/p\u003e \u003cp\u003eGenetic data from the Alzheimer\u0026rsquo;s Disease Genetics Consortium (ADGC) were obtained and linked to participant data from the National Alzheimer\u0026rsquo;s Coordinating Center (NACC) as described previously (Katsumata et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The variable defining presumptive etiologic diagnosis of the cognitive disorder - Alzheimer's disease (NACCALZD) was used to define AD cases and controls. Participants with mild cognitive impairment (MCI) or with impairment and no Alzheimer's disease etiologic diagnosis as defined in NACCUDSD were excluded, resulting in 8230 controls and 8215 AD cases. Logistic regression assuming an additive mode of inheritance and adjusting for sex, age, and 10 PCs was conducted in PLINK 2.0 (Chang et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Purcell \u0026amp; Chang).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePLCG2 Minigene\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo generate \u003cem\u003ePLCG2\u003c/em\u003e minigenes consisting of exon 27, exon 28, exon 29, and their intervening introns, primers corresponding to sequence in exon 27 (5\u0026rsquo;- CATCATCAGACAGAAGCCCGT) and exon 29 (5\u0026rsquo;- GTCATACTCGGCTCCACAGA) were used to PCR-amplify (Q5, NEB) genomic DNA from individuals homozygous for each allele of rs1071644. PCR products were separated by electrophoresis on a 1% agarose gel, excised, eluted, and then TA-cloned into pcDNA3.1 (Thermo). Clone sequences were confirmed via sequencing (Plasmidsaurus). In addition to rs1071644, clones also differed for rs4611451, rs12596299, rs4888191, rs488192 and rs4369659. To determine whether rs1071644 was indeed the functional SNP, the clone with rs1071644-C was mutated to rs1071644-T with a Quikchange Site Directed Mutagenesis kit (Agilent) as directed by the manufacturer by using HPLC purified primers 5'-CTCAATTTCCAGACGGCAAAGGGCAATTCTGCAGAT-3\u0026rsquo; and 5'-ATCTGCAGAATTGCCCTTTGCCGTCTGGAAATTGAG-3. The resulting clone was then sequenced (Plasmidsaurus) to confirm mutagenesis at only the rs1071644 site. These three clones were then transfected in triplicate into murine microglial BV-2 cells using Lipofectamine 3000 reagent (Thermo), as directed by the manufacturer. Cells were incubated for 24 hours and RNA purified with RNeasy (Qiagen) following manufacturer\u0026rsquo;s directions. RNA was converted into cDNA via reverse transcription by using random primers and Superscript IV Reverse Transcriptase (Thermo). PLCG2 exon 28 splicing was then quantified by qPCR by using a reverse primer that corresponded to vector -derived transcript sequence (5\u0026rsquo; AGACCGAGGAGAGGGTTAGG) and forward primers corresponding to either exon 27 (5\u0026rsquo;\u003cb\u003e-\u003c/b\u003eCATCATCAGACAGAAGCCCGT) or to the unique sequence corresponding to the exon-27-exon 28 junction observed in \u003cem\u003eD65-PLCG2\u003c/em\u003e (5\u0026rsquo;-TTCCAGACGGCAGCCTG).\u003c/p\u003e \u003cp\u003e \u003cb\u003eNonsense Mediated Decay\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo determine if \u003cem\u003eD65-PLCG2\u003c/em\u003e undergoes NMD, the U937 human cell line, which constitutively expresses \u003cem\u003ePLCG2\u003c/em\u003e, was treated with cycloheximide (CHX) or a DMSO solvent control as described previously (Zajac et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Briefly, U937 cells maintained in RPMI 1640 with HEPES (Invitrogen 42401-018), 10% v/v fetal calf serum (characterized, low lipopolysaccharide), 50 U/mL penicillin and 50 \u0026micro;g/mL streptomycin were plated in 0.9 mL media in a 24-well plate. CHX was dissolved in ethanol at 50 mg/mL and cells were treated in triplicate with either CHX (final concentration of 50\u0026micro;g/ml) or ethanol (0.1%). After 1, 3, 5, or 8 hours, cells were centrifuged and RNA purified using RNeasy according to the manufacturer\u0026rsquo;s instructions (Qiagen). RNA was converted to cDNA by using random hexamers and SuperScript IV (Thermo, Waltham, MA USA). \u003cem\u003eD65-PLCG2\u003c/em\u003e and \u003cem\u003ePLCG2\u003c/em\u003e were visualized by PCR followed by gel electrophoresis and SYBR-gold staining and quantified by qPCR, as described above.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSplicing Factors\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo determine if the \u003cem\u003eD65-PLCG2\u003c/em\u003e isoform is a potential target for splicing modulators, we co-transfected the rs1071644-T allele minigene clone into HEK-293 cells in duplicate with splicing factors encoding SRSF1, SRSF2, SRSF5, SRSF6, SRSF7 or, as the negative control, empty pCDM8, as we previously described (Ling \u0026amp; Estus, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). After 24 hours, cellular RNA was purified, converted into cDNA, and \u003cem\u003eD65-PLCG2\u003c/em\u003e and total \u003cem\u003ePLCG2\u003c/em\u003e quantified as described above for minigene analyses.\u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression Cloning of PLCG2 isoforms and Calcium Influx\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFor expression cloning of \u003cem\u003ePLCG2\u003c/em\u003e and \u003cem\u003eD65-PLCG2\u003c/em\u003e, cDNA underwent PCR cycling with primers corresponding to sequences in the \u003cem\u003ePLCG2\u003c/em\u003e 5\u0026rsquo; UTR (5\u0026rsquo;- CCGATTCCTTCCTTCTCCCTG) and 3\u0026rsquo; UTR (5\u0026rsquo;- CCCAGAGTGTGAATAGGGCA). PCR products corresponding to canonical \u003cem\u003ePLCG2\u003c/em\u003e and \u003cem\u003eD65-PLCG2\u003c/em\u003e were separated on a 1% agarose gel, reamplified separately, gel purified and then cloned in-frame at the carboxyl terminus of GFP by using NT-GFP Fusion-TOPO, as directed by the manufacturer (Thermo). Clone identities were confirmed by sequencing (ACGT, Inc). Clones were then transfected into HEK-293 cells by using Lipofectamine 3000 Reagent (Thermo) as directed by the manufacturer. After 24 hours, media was replaced with HBSS with or without 20uM A23187 calcium ionophore (Sigma) for five minutes. Cells were then washed with HBSS, fixed with 10% formalin for 7 minutes, rinsed, and mounted with NucBlueT Fixed Cell Ready Reagent (ThermoFisher). Cells were visualized and representative images obtained by using confocal microscopy (Nikon A1R HD).\u003c/p\u003e \u003cp\u003e \u003cb\u003eAdditional Statistical Analyses\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAnalyses were performed by using SPSS (V.29). The ratio of different isoforms as a function of genotype was analyzed by Kruskal-Wallis tests. P values for post-hoc analyses were Bonferroni-adjusted for multiple testing.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003eAs an initial approach to identify \u003cem\u003ePLCG2\u003c/em\u003e isoforms in human brain, we noted that ENSEMBL (Cunningham et al., 2022) included an isoform wherein a LNC RNA (ENSG00000289733) that flanks \u003cem\u003ePLCG2\u003c/em\u003e is spliced onto \u003cem\u003ePLCG2\u003c/em\u003e exon 2, creating a fusion mRNA. Since the first ATG translation initiation site within this fusion mRNA is the canonical \u003cem\u003ePLCG2\u003c/em\u003e translation start site within exon 2, this fusion mRNA still encodes prototypic PLCG2. To check whether this isoform was expressed in human brain, we performed PCR from the novel LNC exon 1 to exon 2 of \u003cem\u003ePLCG2\u003c/em\u003e. When these products were visualized by PAGE, four isoforms were detected that were readily detectable in each sample examined (Fig. 1A). Subsequent sequencing of these PCR products found that the most abundant isoform consisted of canonical \u003cem\u003eLNC\u003c/em\u003e exon 1 and exon 2 that was spliced onto \u003cem\u003ePLCG2\u003c/em\u003e exon 2 (Fig. 1A). We also detected several less abundant isoforms which sequencing established as (i) \u003cem\u003eLNC\u003c/em\u003e exon 1 spliced directly onto \u003cem\u003ePLCG2\u003c/em\u003e exon 2, (ii) \u003cem\u003eLNC\u003c/em\u003e exon 1 that retained 51 bp intron 1 and then spliced onto \u003cem\u003eLNC\u003c/em\u003e exon 2 and \u003cem\u003ePLCG2\u003c/em\u003e exon 2, and (iii) \u003cem\u003eLNC\u003c/em\u003e exon 1 that retained 51 bp of intron 1 that was spliced directly onto \u003cem\u003ePLCG2\u003c/em\u003eexon 2 (Fig. 1A).\u003c/p\u003e\u003cp\u003eWe proceeded to compare \u003cem\u003ePLCG2\u003c/em\u003e that arose from the \u003cem\u003eLNC\u003c/em\u003e versus the canonical \u003cem\u003ePLCG2\u003c/em\u003e exon 1 by using qPCR on cDNA samples generated from AD and non-AD brains. For this effort, we used a reverse primer in \u003cem\u003ePLCG2\u003c/em\u003e exon 2 and forward primers in either \u003cem\u003ePLCG2\u003c/em\u003e exon 1 or \u003cem\u003eLNC\u003c/em\u003e exon 2 to capture the most abundant novel isoform. This effort revealed that levels of the canonical \u003cem\u003ePLCG2\u003c/em\u003e and \u003cem\u003eLNC-PLCG2\u003c/em\u003e isoforms were comparable and were associated with the AD GWAS SNP rs12446759 (Fig. 1B-C). The minor rs12446759-A allele was associated with an increase in \u003cem\u003eLNC-PLCG2\u003c/em\u003e, compared to the canonical \u003cem\u003ePLCG2\u003c/em\u003e isoform. To test whether this finding was specific to the brain or relevant to \u003cem\u003ePLCG2\u003c/em\u003e expression in the periphery, we extended these findings by examining RNA purified from human buffy coat samples. The minor rs12446759-A allele was again associated with an increase in the ratio of \u003cem\u003eLNC-PLCG2\u003c/em\u003e compared to canonical \u003cem\u003ePLCG2\u003c/em\u003e (Fig. 1D-E).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n \u003cp\u003eWe proceeded to evaluate human brain cDNA samples for atypical \u003cem\u003ePLCG2\u003c/em\u003e splicing. For this effort, we used PCR with primers that generated overlapping fragments of \u003cem\u003ePLCG2\u003c/em\u003e. Hence, we used primers that corresponded to sequences in exons 1 and 6, exons 5 and 10, exons 9 and 14, exons 13 and 17, exons 16 and 19, exons 18 and 22, exons 20 and 26, exons 25 and 29, exons 28 and 32, and exons 31 and 33. The resulting PCR products were the expected sizes except for a product that appeared relatively common and was produced by the primers amplifying from exon 25 to exon 29 (Fig.\u0026nbsp;2A). This band as well as the expected PCR product were excised from the gel. Sequencing confirmed the larger PCR product was canonical \u003cem\u003ePLCG2\u003c/em\u003e from exon 25 to 29 and found that the smaller PCR product lacked the initial 65 bp of exon 28 (referred to as \u003cem\u003eD65-PLCG2\u003c/em\u003e). The use of the atypical splice acceptor site within exon 28 is not unexpected because the underlying RNA sequence (GCACGGGCUACGUUCUGCAG) has a splice acceptor site score of 4.1 which is well above the threshold of 2.2 (Wang \u0026amp; Marin, 2006). That noted, this value of 4.1 is well below the score of 11.2 attained by the canonical splice acceptor site of intron 27 (gcguucacuuuccuucccag) (Wang \u0026amp; Marin, 2006). Regarding the impact of the 65 bp deletion on PLCG2 protein, this deletion causes a codon reading frameshift such that exon 28 encodes a single amino acid followed immediately by a termination codon. The resulting protein is predicted to lack the carboxyl-terminal 247 amino acids of PLCG2 (Fig.\u0026nbsp;2B) which includes the carboxyl portion of the enzymatic Y-box and the C-2 motif that mediates Ca\u003csup\u003e2+\u003c/sup\u003e binding (Fig.\u0026nbsp;2B).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n \u003cp\u003eDuring this process, we noted that rs1071644 is at position 41 in exon 28, within the skipped 65bp portion. Moreover, DeepCLIP \u003cem\u003ein-silico\u003c/em\u003e analyses (Gronning et al., 2020) predict that rs1071644 affects binding of splicing factors such as SRSF7; the C allele is predicted to be targeted by SRSF7 (binding score of 0.73) relative to the T allele (binding score of 0.26), and SRSF7 is well-expressed in microglia (Manning \u0026amp; Cooper, 2017). This suggested that rs1071644 may be a functional SNP that influences the proportion of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e. To evaluate this possibility, we quantified \u003cem\u003ePLCG2\u003c/em\u003e and \u003cem\u003eD65-PLCG2\u003c/em\u003e as a function of rs1071644. This qPCR study used a common reverse primer corresponding to sequence within exon 29 and forward primers corresponding to either a constitutively present portion of exon 28 or the unique exon junction generated by exon 27 splicing onto the middle of exon 28. We found that the percent of \u003cem\u003ePLCG2\u003c/em\u003e that was present as \u003cem\u003eD65-PLCG2\u003c/em\u003e strongly correlated with rs1071644 in both brain and buffy coat samples (Fig.\u0026nbsp;3A-D). The proportion of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e was not correlated with AD neuropathology or sex (p \u0026gt; 0.5).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n \u003cp\u003eTo determine whether rs1071644 is indeed a functional SNP that influences skipping of the first 65 bp of exon 28, we cloned minigenes for the rs1071644 major T and minor C alleles that contained \u003cem\u003ePLCG2\u003c/em\u003e exon 27 to 29, including their respective introns. To obviate the possibility that rs1071644 is a proxy for a different functional SNP that is co-inherited, we mutated the rs1071644 minor C allele clone to the major T allele by using site directed mutagenesis. These three clones were then transfected into murine BV-2 microglial cells. After 24 hours, RNA was prepared, converted into cDNA, and the percentage of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e was quantified by using a vector specific reverse primer and forward primers corresponding to either the constitutive portion of exon 28 or the novel splice junction formed in \u003cem\u003eD65-PLCG2\u003c/em\u003e. We found that the percentage of \u003cem\u003eD65-PLCG2\u003c/em\u003e arising from the C and T allele clones was 1.4% and 11.1%, respectively, while the samples wherein the minor C allele was mutated to T showed 10.0% \u003cem\u003eD65-PLCG2\u003c/em\u003e (p = 2x10\u003csup\u003e-5\u003c/sup\u003e, F\u003csub\u003e1,2\u003c/sub\u003e = 108.4, Fig.\u0026nbsp;4). Hence, rs1071644 is a functional SNP that affects splicing of \u003cem\u003ePLCG2\u003c/em\u003e exon 28.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n \u003cp\u003eSince rs1071644 is a functional SNP and \u003cem\u003ePLCG2\u003c/em\u003e has been previously implicated in AD by genetics (Bellenguez et al., 2022; Dalmasso et al., 2019; Jansen et al., 2019; Kleineidam et al., 2020; Magno et al., 2019; Olive et al., 2020; Sims et al., 2017; Strickland et al., 2020; van der Lee et al., 2019), we tested whether rs1071644 is associated with AD risk. Since SNPs are often co-inherited with other SNPs, we first checked whether rs1071644 was in linkage disequilibrium with either of the known AD-associated \u003cem\u003ePLCG2\u003c/em\u003e SNPs, the rare missense SNP, rs72824905 (P522R) and the GWAS SNP rs12446759. Within the European population that constitutes the samples used within this study, rs1071644 is not co-inherited with rs12446759 (r\u003csup\u003e2\u003c/sup\u003e = 0.0005, p = 0.758) and only modestly co-inherited with rs72824905 (r\u003csup\u003e2\u003c/sup\u003e = 0.0205, p = 0.044) (Machiela \u0026amp; Chanock, 2015). To examine the association of rs1071644 with AD further, we evaluated rs1071644 for association with AD by itself and in combination with P522R and rs12446759. We found that rs1071644-T was consistently associated with increased AD risk, independent of the other SNPs (Table 1).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eRs1071644 is associated with AD risk.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"6\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003cp\u003eAllele\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eEffect Allele*\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eModel**\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eOR (95% CI)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eZ Statistic\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eP value\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ers1071644\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.065 (1.017–1.114)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2.706\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.0068\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ers1071644\u003c/p\u003e\n \u003cp\u003e+P522R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.067 (1.020–1.117)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2.795\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.0052\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ers1071644\u003c/p\u003e\n \u003cp\u003e+P522R+\u003c/p\u003e\n \u003cp\u003eRs12446759\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.068 (1.021–1.118)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2.843\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.0045\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n \u003cp\u003e*Each regression models the count of T alleles of rs1071644, reflecting an additive mode of inheritance. **Sex, age, and the first 10 PCs are covariates in all the regression models. OR: Odds ratio, CI: 95% Confidence Interval\u003c/p\u003e\n \u003cp\u003eSince \u003cem\u003eD65-PLCG2\u003c/em\u003e introduces a premature stop codon within exon 28, well before the usual termination codon in exon 33, we hypothesized that \u003cem\u003eD65-PLCG2\u003c/em\u003e was susceptible to NMD because this process often occurs when a ribosome encounters a termination codon upstream of an exon junction complex (Silva \u0026amp; Romao, 2009). To test this hypothesis, U937 cells, which naturally express \u003cem\u003ePLCG2\u003c/em\u003e, were treated with CHX. We and others have previously used CHX to inhibit protein synthesis and, thereby, NMD (Busi \u0026amp; Cresteil, 2005; Malik et al., 2015; Urano et al., 2012; Zajac et al., 2023). RNA was then prepared and reverse transcribed into cDNA. The percentage of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e was visualized via staining on a polyacrylamide gel and quantified by using qPCR. We found that CHX increased the percentage of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e (Fig.\u0026nbsp;5), supporting the hypothesis that \u003cem\u003eD65-PLCG2\u003c/em\u003e undergoes NMD. Hence, \u003cem\u003eD65-PLCG2\u003c/em\u003e likely represents a larger proportion of \u003cem\u003ePLCG2\u003c/em\u003e transcription than suggested by the steady state mRNA measurements.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n \u003cp\u003eTo discern whether \u003cem\u003eD65-PLCG2\u003c/em\u003e may encode a stable protein, we generated plasmids encoding \u003cem\u003ePLCG2\u003c/em\u003e and \u003cem\u003eD65-PLCG2\u003c/em\u003e as GFP fusion proteins, similar to the approach of Nishida et al who evaluated the role of PLCG2 domains in PLCG2 function (Nishida et al., 2003). Clones were transiently transfected into HEK293 cells which typically express \u003cem\u003ePLCG2\u003c/em\u003e. In resting cells, the subcellular localization of canonical PLCG2 and PLCG2-GFP was similar as both manifested a diffuse cytosolic localization (Fig.\u0026nbsp;6), suggesting that D65-PLCG2 may be expressed as a stable protein. Since Nishida et al reported that the Ca\u003csup\u003e+ 2\u003c/sup\u003e binding domain is critical for PLCG2 response to Ca\u003csup\u003e+ 2\u003c/sup\u003e (Nishida et al., 2003), we tested the response in cells treated with the Ca\u003csup\u003e+ 2\u003c/sup\u003e ionophore A23187 for five minutes. While D65-PLCG2 remained diffusely localized in the cytosol in response to this treatment, PLCG2 showed a pattern of marked condensation, likely reflecting a conformation change (Fig.\u0026nbsp;6). Hence, PLCG2 but not D65-PLCG2 responds to increases in cytosolic Ca\u003csup\u003e+ 2\u003c/sup\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n \u003cp\u003eSince rs1071644-T is associated with increased AD risk and causes an increase in \u003cem\u003eD65-PLCG2\u003c/em\u003e, agents that promote canonical \u003cem\u003ePLCG2\u003c/em\u003e exon 28 splicing may reduce AD risk. Exon splicing is modulated by splicing enhancer and suppressor proteins that bind to sequence-specific elements within exons and introns and signal to other proteins involved in the splicing process (reviewed in (Manning \u0026amp; Cooper, 2017)). In recent years, pharmacologic agents targeting these splicing factors or the splice sites themselves have emerged as a viable therapeutic strategy (El Marabti \u0026amp; Abdel-Wahab, 2021). As a proof-of-concept study to investigate whether \u003cem\u003eD65-PLCG23\u003c/em\u003e could be reduced by modulators, the rs1071644-T allele minigene was co-transfected with plasmids encoding splicing modulators, as we and others have described previously (Ling \u0026amp; Estus, 2010; van Bergeijk et al., 2019). These splicing factors included SRSF7, which was noted above to target the rs1071644 sequence, as well as a negative control plasmid. We found that the proportion of \u003cem\u003eD65-PLCG2\u003c/em\u003e was reduced by ectopic expression of SRSF7, as well as SRSF1 and SRSF6 (Fig. 7), leading us to predict that SRSF1 and SRSF6 bind to other target elements within this minigene. Overall, these results support the concept that \u003cem\u003ePLCG2\u003c/em\u003e exon 28 splicing can be improved through splicing factor modulation.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThis primary findings of this study include (i) a \u003cem\u003ePLCG2\u003c/em\u003e GWAS SNP, rs12446759, is associated with the proportion of PLCG2 transcripts that begin within an adjacent LNC versus canonical PLCG2 exon 1, (ii) levels of a novel \u003cem\u003ePLCG2\u003c/em\u003e isoform, which lacks the first 65bp of exon 28, are modulated by a SNP within the skipped sequence, rs1071644, that is itself associated with AD risk independent of rs12446759 and P522R, (iii) D65-PLCG2 is subject to NMD, suggesting that the \u003cem\u003eD65-PLCG2\u003c/em\u003e mRNA measurements in brain and buffy coat samples likely underestimate the proportion of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e, (iv) ectopic expression of \u003cem\u003eD65-PLCG2\u003c/em\u003e as a GFP fusion protein found that D65-PLCG2 is localized to the cytosol but lacks a Ca\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e response observed in PLCG2-GFP, and (v) the proportion of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e is reduced by ectopic splicing factor expression, suggesting that this splicing event may be targetable by pharmacologic agents. In summary, we report mechanisms whereby two SNPs alter \u003cem\u003ePLCG2\u003c/em\u003e expression and AD risk, test whether a novel isoform is expressed as protein, and show that \u003cem\u003ePLCG2\u003c/em\u003esplicing can be modulated in a fashion that would reduce AD risk.\u003c/p\u003e\u003cp\u003eThe rs12446759-G allele, previously associated with reduced AD risk (Bellenguez et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), was associated here with a decrease in \u003cem\u003eLNC-PLCG2\u003c/em\u003e relative to canonical \u003cem\u003ePLCG2\u003c/em\u003e. Interestingly, rs12446759 is located within the first intron of LNC, 13bp after exon 1, and is therefore contained within the rare \u003cem\u003eLNC-PLCG2\u003c/em\u003e isoforms that retained 51 bp of \u003cem\u003eLNC\u003c/em\u003e intron 1. Iin considering how the association of rs12446759 with \u003cem\u003eLNC-PLCG2\u003c/em\u003e versus \u003cem\u003ePLCG2\u003c/em\u003e may impact PLCG2 function, we note that both \u003cem\u003eLNC-PLCG2\u003c/em\u003e and canonical \u003cem\u003ePLCG2\u003c/em\u003e encode the same PLCG2 protein because the first ATG translation start site for either \u003cem\u003eLNC-PLCG2\u003c/em\u003e or \u003cem\u003ePLCG2\u003c/em\u003e is within exon 2 of canonical \u003cem\u003ePLCG2\u003c/em\u003e. This was also true for each of the multiple \u003cem\u003eLNC-PLCG2\u003c/em\u003e isoforms that we identified; the first ATG translation start codon for each of isoform is in the canonical \u003cem\u003ePLCG2\u003c/em\u003e exon 2. We speculate that differences in the 5\u0026rsquo;UTR sequences of \u003cem\u003eLNC-PLCG2\u003c/em\u003e and canonical \u003cem\u003ePLCG2\u003c/em\u003e may influence protein translation. Further work is required to clarify this possibility.\u003c/p\u003e \u003cp\u003eThe rs1071644-T allele was associated with an increase in the proportion of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e in both brain and buffy coat samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e). To test whether rs1071644 may be functional, we compared splicing from minigenes that differed for the rs1071644 alleles. This effort found that rs1071644-T resulted in about 11% of the minigene being expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e compared to about 1% for the rs1071644-C allele. Since these minigenes also differed at other SNPs, including rs4611451, rs12596299, rs4888191, rs488192 and rs4369659, we tested whether rs1071644 was indeed functional by converting the rs1071644-C minigene to the T allele by using site-directed mutagenesis. This change was sufficient to change splicing from 1% \u003cem\u003eD65-PLCG2\u003c/em\u003e to 11% \u003cem\u003eD65-PLCG2\u003c/em\u003e, replicating the effect of the rs1071644-T allele minigene (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Hence, rs1071644-T increases \u003cem\u003eD65-PLCG2\u003c/em\u003e and is a functional SNP. Since \u003cem\u003eD65-PLCG2\u003c/em\u003e introduces a premature stop codon within exon 28, well before the usual termination codon in exon 33, we hypothesized that D65-PLCG2 was susceptible to NMD because this process commonly occurs when a ribosome encounters a termination codon upstream of an exon junction complex (Silva \u0026amp; Romao, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Consistent with this hypothesis, CHX treated U937 cells showed an increase in the proportion of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e. We interpret the finding that \u003cem\u003eD65-PLCG2\u003c/em\u003e is less stable than \u003cem\u003ePLCG2\u003c/em\u003e to mean that our measurements of \u003cem\u003eD65-PLCG2\u003c/em\u003e at steady state in brain and buffy coat likely reflect an underestimate of the proportion of \u003cem\u003ePLCG2\u003c/em\u003e transcripts that become \u003cem\u003eD65-PLCG2\u003c/em\u003e during RNA splicing. Hence, the rs1071644-T allele may have a larger effect on overall \u003cem\u003ePLCG2\u003c/em\u003e transcripts than suggested by our qPCR findings.\u003c/p\u003e \u003cp\u003eOur overall findings support a model wherein the rs1071644-T allele increases AD risk by increasing \u003cem\u003eD65-PLCG2\u003c/em\u003e at the expense of canonical \u003cem\u003ePLCG2\u003c/em\u003e. Since D65-PLCG2 lacks a portion of the PLCG2 catalytic domain, and the entire Ca\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e binding domain, this protein is likely non-functional, as reported previously for a \u003cem\u003ePLCG2\u003c/em\u003e synthetic construct lacking the Ca\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e binding domain (Nishida et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Because pharmacologic agents have been developed to rectify aberrant splicing and have achieved FDA approval (El Marabti \u0026amp; Abdel-Wahab, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Matsuo, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Neil \u0026amp; Bisaccia, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), we tested whether ectopic expression of several splicing factors would reduce D65-PLCG2. This effort found that SRSF1, SRSF6 and SRSF7 were all capable of ameliorating the effects of rs1071644-T on splicing. Hence, the actions of rs1071644-T in promoting AD risk may be countered by responsive to agents that improve canonical exon 28 splicing.\u003c/p\u003e \u003cp\u003eIn summary, we report the actions of an AD GWAS SNP, rs12446759, and identify a novel AD risk factor, rs1071644, and its underlying mechanism. Rs12446759 resides just after the first exon of an LNC adjacent to PLCG2 and is associated with this LNC being used as the PLCG2 5\u0026rsquo;UTR instead of the canonical PLCG2 exon 1. Rs1071644 resides in exon 28 and is functional in causing a skipping of the first 65 nucleotides of exon 28. While the effects of the altered 5\u0026rsquo;UTR require further study to elucidate, the changes in exon 28 splicing produce an apparently stable protein which lacks a portion of the PLCG2 catalytic domain as well as the PLCG2 Ca\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e binding domain. The effects of rs1071644 appear amenable to agents that target splicing, suggesting that this AD risk factor may be amenable to therapeutic intervention.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAD: Alzheimer\u0026rsquo;s disease, MCI: mild cognitive impairment, bp: basepair, LNC: \u0026nbsp; long noncoding, SNP: single nucleotide polymorphism, PIP2: 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate, IP3: \u0026nbsp;1D-myo-inositol 1,4,5-trisphosphate, DAG: diacylglycerol, ADGC: Alzheimer\u0026rsquo;s Disease Genetics Consortium, NACC: National Alzheimer\u0026rsquo;s Coordinating Center, CHX: cycloheximide, OR: Odds ratio, CI: 95% Confidence Interval\u003c/p\u003e\n"},{"header":"Declarations","content":"\u003cp\u003e-Ethics approval and consent to participate: This study was approved by the University of Kentucky Institutional Review Board (application #48095). The authors express their gratitude for each of the individuals that donated tissue or blood for this study, each of whom signed an informed consent.\u003c/p\u003e\n\u003cp\u003e-Consent for publication: Each author approved of the final version of this paper and agreed to be included as an author.\u003c/p\u003e\n\u003cp\u003e-Availability of data and material: All relevant data are included within the manuscript.\u003c/p\u003e\n\u003cp\u003e-Competing interests: \u0026nbsp;The authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e-Funding: \u0026nbsp;National Institute on Aging at NIH, including R21AG083820 and R01AG082730.\u003c/p\u003e\n\u003cp\u003e-Authors\u0026apos; contributions: A.T. wrote the manuscript text and prepared Figure 4, 6 and 7. \u0026nbsp;K.D. prepared Figures 2, 3 and 5. \u0026nbsp;K.C. prepared Figure 1. \u0026nbsp;Q.Q. prepared Table 1. \u0026nbsp;J.S. contributed to Figures 1, 2, 3, 4, 5, and 7. \u0026nbsp;D.F. and S.E. directed the study. \u0026nbsp;All authors edited and reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e-Acknowledgements: \u0026nbsp;The authors thank the dedicated research participants at the University of Kentucky. \u0026nbsp;This manuscript is dedicated to the memory of Mr. Simpson who contributed to many scientific findings from the Estus lab and recently died of prostate cancer.\u003c/p\u003e\n\u003cp\u003eDATA ACKNOWLEDGEMENTS\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAlzheimer\u0026rsquo;s Disease Genetics Consortium (ADGC)\u003c/strong\u003e. The National Institutes of Health, National Institute on Aging (NIH-NIA) supported this work through the following grants: ADGC, U01 AG032984, RC2 AG036528; Samples from the National Cell Repository for Alzheimer\u0026rsquo;s Disease (NCRAD), which receives government support under a cooperative agreement grant (U24 AG21886) awarded by the National Institute on Aging (NIA), were used in this study. We thank contributors who collected samples used in this study, as well as patients and their families, whose help and participation made this work possible; Data for this study were prepared, archived, and distributed by the National Institute on Aging Alzheimer\u0026rsquo;s Disease Data Storage Site (NIAGADS) at the University of Pennsylvania (U24-AG041689); GCAD, U54 AG052427; NACC, U01 AG016976; NIA LOAD (Columbia University), U24 AG026395, U24 AG026390, R01AG041797; Banner Sun Health Research Institute P30 AG019610; Boston University, P30 AG013846, U01 AG10483, R01 CA129769, R01 MH080295, R01 AG017173, R01 AG025259, R01 AG048927, R01AG33193, R01 AG009029; Columbia University, P50 AG008702, R37 AG015473, R01 AG037212, R01 AG028786; Duke University, P30 AG028377, AG05128; Emory University, AG025688; Group Health Research Institute, UO1 AG006781, UO1 HG004610, UO1 HG006375, U01 HG008657; Indiana University, P30 AG10133, R01 AG009956, RC2 AG036650; Johns Hopkins University, P50 AG005146, R01 AG020688; Massachusetts General Hospital, P50 AG005134; Mayo Clinic, P50 AG016574, R01 AG032990, KL2 RR024151; Mount Sinai School of Medicine, P50 AG005138, P01 AG002219; New York University, P30 AG08051, UL1 RR029893, 5R01AG012101, 5R01AG022374, 5R01AG013616, 1RC2AG036502, 1R01AG035137; North Carolina A\u0026amp;T University, P20 MD000546, R01 AG28786-01A1; Northwestern University, P30 AG013854; Oregon Health \u0026amp; Science University, P30 AG008017, R01 AG026916; Rush University, P30 AG010161, R01 AG019085, R01 AG15819, R01 AG17917, R01 AG030146, R01 AG01101, RC2 AG036650, R01 AG22018; TGen, R01 NS059873; REAADI study is supported by NIA grant AG052410; University of Alabama at Birmingham, P50 AG016582; University of Arizona, R01 AG031581; University of California, Davis, P30 AG010129; University of California, Irvine, P50 AG016573; University of California, Los Angeles, P50 AG016570; University of California, San Diego, P50 AG005131; University of California, San Francisco, P50 AG023501, P01 AG019724; University of Kentucky, P30 AG028383, AG05144; University of Michigan, P50 AG008671; University of Pennsylvania, P30 AG010124; University of Pittsburgh, P50 AG005133, AG030653, AG041718, AG07562, AG02365; University of Southern California, P50 AG005142; University of Texas Southwestern, P30 AG012300; University of Miami, R01 AG027944, AG010491, AG027944, AG021547, AG019757; University of Washington, P50 AG005136, R01 AG042437; University of Wisconsin, P50 AG033514; Vanderbilt University, R01 AG019085; and Washington University, P50 AG005681, P01 AG03991, P01 AG026276. The Kathleen Price Bryan Brain Bank at Duke University Medical Center is funded by NINDS grant # NS39764, NIMH MH60451 and by Glaxo Smith Kline. Support was also from the Alzheimer\u0026rsquo;s Association (LAF, IIRG-08-89720; MP-V, IIRG-05-14147), the US Department of Veterans Affairs Administration, Office of Research and Development, Biomedical Laboratory Research Program, and BrightFocus Foundation (MP-V, A2111048). P.S.G.-H. is supported by Wellcome Trust, Howard Hughes Medical Institute, and the Canadian Institute of Health Research. Genotyping of the TGEN2 cohort was supported by Kronos Science. The TGen series was also funded by NIA grant AG041232 to AJM and MJH, The Banner Alzheimer\u0026rsquo;s Foundation, The Johnnie B. Byrd Sr. Alzheimer\u0026rsquo;s Institute, the Medical Research Council, and the state of Arizona and also includes samples from the following sites: Newcastle Brain Tissue Resource (funding via the Medical Research Council, local NHS trusts and Newcastle University), MRC London Brain Bank for Neurodegenerative Diseases (funding via the Medical Research Council),South West Dementia Brain Bank (funding via numerous sources including the Higher Education Funding Council for England (HEFCE), Alzheimer\u0026rsquo;s Research Trust (ART), BRACE as well as North Bristol NHS Trust Research and Innovation Department and DeNDRoN), The Netherlands Brain Bank (funding via numerous sources including Stichting MS Research, Brain Net Europe, Hersenstichting Nederland Breinbrekend Werk, International Parkinson Fonds, Internationale Stiching Alzheimer Onderzoek), Institut de Neuropatologia, Servei Anatomia Patologica, Universitat de Barcelona. ADNI data collection and sharing was funded by the National Institutes of Health Grant U01 AG024904 and Department of Defense award number W81XWH-12-2-0012. ADNI is funded by the National Institute on Aging, the National Institute of Biomedical Imaging and Bioengineering, and through generous contributions from the following: AbbVie, Alzheimer\u0026rsquo;s Association; Alzheimer\u0026rsquo;s Drug Discovery Foundation; Araclon Biotech; BioClinica, Inc.; Biogen; Bristol-Myers Squibb Company; CereSpir, Inc.; Eisai Inc.; Elan Pharmaceuticals, Inc.; Eli Lilly and Company; EuroImmun; F. Hoffmann-La Roche Ltd and its affiliated company Genentech, Inc.; Fujirebio; GE Healthcare; IXICO Ltd.; Janssen Alzheimer Immunotherapy Research \u0026amp; Development, LLC.; Johnson \u0026amp; Johnson Pharmaceutical Research \u0026amp; Development LLC.; Lumosity; Lundbeck; Merck \u0026amp; Co., Inc.; Meso Scale Diagnostics, LLC.; NeuroRx Research; Neurotrack Technologies; Novartis Pharmaceuticals Corporation; Pfizer Inc.; Piramal Imaging; Servier; Takeda Pharmaceutical Company; and Transition Therapeutics. The Canadian Institutes of Health Research is providing funds to support ADNI clinical sites in Canada. Private sector contributions are facilitated by the Foundation for the National Institutes of Health (www.fnih.org). The grantee organization is the Northern California Institute for Research and Education, and the study is coordinated by the Alzheimer\u0026apos;s Disease Cooperative Study at the University of California, San Diego. ADNI data are disseminated by the Laboratory for Neuro Imaging at the University of Southern California. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNational Alzheimer\u0026rsquo;s Coordinating Center (NACC).\u003c/strong\u003e The NACC database is funded by NIA/NIH Grant U24 AG072122. NACC data are contributed by the NIA-funded ADRCs: P30 AG062429 (PI James Brewer, MD, PhD), P30 AG066468 (PI Oscar Lopez, MD), P30 AG062421 (PI Bradley Hyman, MD, PhD), P30 AG066509 (PI Thomas Grabowski, MD), P30 AG066514 (PI Mary Sano, PhD), P30 AG066530 (PI Helena Chui, MD), P30 AG066507 (PI Marilyn Albert, PhD), P30 AG066444 (PI John Morris, MD), P30 AG066518 (PI Jeffrey Kaye, MD), P30 AG066512 (PI Thomas Wisniewski, MD), P30 AG066462 (PI Scott Small, MD), P30 AG072979 (PI David Wolk, MD), P30 AG072972 (PI Charles DeCarli, MD), P30 AG072976 (PI Andrew Saykin, PsyD), P30 AG072975 (PI David Bennett, MD), P30 AG072978 (PI Neil Kowall, MD), P30 AG072977 (PI Robert Vassar, PhD), P30 AG066519 (PI Frank LaFerla, PhD), P30 AG062677 (PI Ronald Petersen, MD, PhD), P30 AG079280 (PI Eric Reiman, MD), P30 AG062422 (PI Gil Rabinovici, MD), P30 AG066511 (PI Allan Levey, MD, PhD), P30 AG072946 (PI Linda Van Eldik, PhD), P30 AG062715 (PI Sanjay Asthana, MD, FRCP), P30 AG072973 (PI Russell Swerdlow, MD), P30 AG066506 (PI Todd Golde, MD, PhD), P30 AG066508 (PI Stephen Strittmatter, MD, PhD), P30 AG066515 (PI Victor Henderson, MD, MS), P30 AG072947 (PI Suzanne Craft, PhD), P30 AG072931 (PI Henry Paulson, MD, PhD), P30 AG066546 (PI Sudha Seshadri, MD), P20 AG068024 (PI Erik Roberson, MD, PhD), P20 AG068053 (PI Justin Miller, PhD), P20 AG068077 (PI Gary Rosenberg, MD), P20 AG068082 (PI Angela Jefferson, PhD), P30 AG072958 (PI Heather Whitson, MD), P30 AG072959 (PI James Leverenz, MD).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBellenguez, C., Kucukali, F., Jansen, I. E., Kleineidam, L., Moreno-Grau, S., Amin, N., Naj, A. C., Campos-Martin, R., Grenier-Boley, B., Andrade, V., Holmans, P. A., Boland, A., Damotte, V., van der Lee, S. J., Costa, M. R., Kuulasmaa, T., Yang, Q., de Rojas, I., Bis, J. C., . . . Lambert, J. C. (2022). New insights into the genetic etiology of Alzheimer\u0026apos;s disease and related dementias. \u003cem\u003eNat Genet\u003c/em\u003e,\u003cem\u003e 54\u003c/em\u003e(4), 412-436. https://doi.org/10.1038/s41588-022-01024-z\u003c/li\u003e\n\u003cli\u003eBusi, F., \u0026amp; Cresteil, T. (2005). CYP3A5 mRNA degradation by nonsense-mediated mRNA decay. \u003cem\u003eMol Pharmacol\u003c/em\u003e,\u003cem\u003e 68\u003c/em\u003e(3), 808-815. https://doi.org/mol.105.014225 [pii] 10.1124/mol.105.014225\u003c/li\u003e\n\u003cli\u003eChang, C. C., Chow, C. C., Tellier, L. C., Vattikuti, S., Purcell, S. M., \u0026amp; Lee, J. J. (2015). Second-generation PLINK: rising to the challenge of larger and richer datasets. \u003cem\u003eGigascience\u003c/em\u003e,\u003cem\u003e 4\u003c/em\u003e, 7. https://doi.org/10.1186/s13742-015-0047-8\u003c/li\u003e\n\u003cli\u003eCunningham, F., Allen, J. E., Allen, J., Alvarez-Jarreta, J., Amode, M. R., Armean, I. M., Austine-Orimoloye, O., Azov, A. G., Barnes, I., Bennett, R., Berry, A., Bhai, J., Bignell, A., Billis, K., Boddu, S., Brooks, L., Charkhchi, M., Cummins, C., Da Rin Fioretto, L., . . . Flicek, P. (2022). Ensembl 2022. \u003cem\u003eNucleic Acids Res\u003c/em\u003e,\u003cem\u003e 50\u003c/em\u003e(D1), D988-D995. https://doi.org/10.1093/nar/gkab1049\u003c/li\u003e\n\u003cli\u003eDalmasso, M. C., Brusco, L. I., Olivar, N., Muchnik, C., Hanses, C., Milz, E., Becker, J., Heilmann-Heimbach, S., Hoffmann, P., Prestia, F. A., Galeano, P., Avalos, M. S. S., Martinez, L. E., Carulla, M. E., Azurmendi, P. J., Liberczuk, C., Fezza, C., Sampano, M., Fierens, M., . . . Ramirez, A. (2019). Transethnic meta-analysis of rare coding variants in PLCG2, ABI3, and TREM2 supports their general contribution to Alzheimer\u0026apos;s disease. \u003cem\u003eTransl Psychiatry\u003c/em\u003e,\u003cem\u003e 9\u003c/em\u003e(1), 55. https://doi.org/10.1038/s41398-019-0394-9\u003c/li\u003e\n\u003cli\u003eEl Marabti, E., \u0026amp; Abdel-Wahab, O. (2021). Therapeutic Modulation of RNA Splicing in Malignant and Non-Malignant Disease. \u003cem\u003eTrends Mol Med\u003c/em\u003e,\u003cem\u003e 27\u003c/em\u003e(7), 643-659. https://doi.org/10.1016/j.molmed.2021.04.005\u003c/li\u003e\n\u003cli\u003eGatz, M., Reynolds, C. A., Fratiglioni, L., Johansson, B., Mortimer, J. A., Berg, S., Fiske, A., \u0026amp; Pedersen, N. L. (2006). Role of genes and environments for explaining Alzheimer disease. \u003cem\u003eArch Gen Psychiatry\u003c/em\u003e,\u003cem\u003e 63\u003c/em\u003e(2), 168-174. https://doi.org/10.1001/archpsyc.63.2.168\u003c/li\u003e\n\u003cli\u003eGronning, A. G. B., Doktor, T. K., Larsen, S. J., Petersen, U. S. S., Holm, L. L., Bruun, G. H., Hansen, M. B., Hartung, A. M., Baumbach, J., \u0026amp; Andresen, B. S. (2020). DeepCLIP: predicting the effect of mutations on protein-RNA binding with deep learning. \u003cem\u003eNucleic Acids Res\u003c/em\u003e,\u003cem\u003e 48\u003c/em\u003e(13), 7099-7118. https://doi.org/10.1093/nar/gkaa530\u003c/li\u003e\n\u003cli\u003eHaynes, K. (2015, 2015). \u003cem\u003eTRIzol RNeasy\u003c/em\u003e. OpenWetWare. Retrieved May 18 from Jansen, I. E., Savage, J. E., Watanabe, K., Bryois, J., Williams, D. M., Steinberg, S., Sealock, J., Karlsson, I. K., Hagg, S., Athanasiu, L., Voyle, N., Proitsi, P., Witoelar, A., Stringer, S., Aarsland, D., Almdahl, I. S., Andersen, F., Bergh, S., Bettella, F., . . . Posthuma, D. (2019). Genome-wide meta-analysis identifies new loci and functional pathways influencing Alzheimer\u0026apos;s disease risk. \u003cem\u003eNat Genet\u003c/em\u003e,\u003cem\u003e 51\u003c/em\u003e, 404\u0026ndash;413. https://doi.org/10.1038/s41588-018-0311-9\u003c/li\u003e\n\u003cli\u003eJay, T. R., von Saucken, V. E., \u0026amp; Landreth, G. E. (2017). TREM2 in Neurodegenerative Diseases. \u003cem\u003eMol Neurodegener\u003c/em\u003e,\u003cem\u003e 12\u003c/em\u003e(1), 56. https://doi.org/10.1186/s13024-017-0197-5\u003c/li\u003e\n\u003cli\u003eKatsumata, Y., Shade, L. M., Hohman, T. J., Schneider, J. A., Bennett, D. A., Farfel, J. M., Alzheimer\u0026apos;s Disease Genetics, C., Kukull, W. A., Fardo, D. W., \u0026amp; Nelson, P. T. (2022). Multiple gene variants linked to Alzheimer\u0026apos;s-type clinical dementia via GWAS are also associated with non-Alzheimer\u0026apos;s neuropathologic entities. \u003cem\u003eNeurobiol Dis\u003c/em\u003e,\u003cem\u003e 174\u003c/em\u003e, 105880. https://doi.org/10.1016/j.nbd.2022.105880\u003c/li\u003e\n\u003cli\u003eKleineidam, L., Chouraki, V., Prochnicki, T., van der Lee, S. J., Madrid-Marquez, L., Wagner-Thelen, H., Karaca, I., Weinhold, L., Wolfsgruber, S., Boland, A., Martino Adami, P. V., Lewczuk, P., Popp, J., Brosseron, F., Jansen, I. E., Hulsman, M., Kornhuber, J., Peters, O., Berr, C., . . . Ramirez, A. (2020). PLCG2 protective variant p.P522R modulates tau pathology and disease progression in patients with mild cognitive impairment. \u003cem\u003eActa Neuropathol\u003c/em\u003e,\u003cem\u003e 139\u003c/em\u003e(6), 1025-1044. https://doi.org/10.1007/s00401-020-02138-6\u003c/li\u003e\n\u003cli\u003eLeng, F., \u0026amp; Edison, P. (2021). Neuroinflammation and microglial activation in Alzheimer disease: where do we go from here? \u003cem\u003eNat Rev Neurol\u003c/em\u003e,\u003cem\u003e 17\u003c/em\u003e(3), 157-172. https://doi.org/10.1038/s41582-020-00435-y\u003c/li\u003e\n\u003cli\u003eLing, I. F., \u0026amp; Estus, S. (2010). Role of SFRS13A in low-density lipoprotein receptor splicing. \u003cem\u003eHum Mutat\u003c/em\u003e,\u003cem\u003e 31\u003c/em\u003e(6), 702-709. https://doi.org/10.1002/humu.21244\u003c/li\u003e\n\u003cli\u003eMachiela, M. J., \u0026amp; Chanock, S. J. (2015). LDlink: a web-based application for exploring population-specific haplotype structure and linking correlated alleles of possible functional variants. \u003cem\u003eBioinformatics\u003c/em\u003e,\u003cem\u003e 31\u003c/em\u003e(21), 3555-3557. https://doi.org/10.1093/bioinformatics/btv402\u003c/li\u003e\n\u003cli\u003eMagno, L., Lessard, C. B., Martins, M., Lang, V., Cruz, P., Asi, Y., Katan, M., Bilsland, J., Lashley, T., Chakrabarty, P., Golde, T. E., \u0026amp; Whiting, P. J. (2019). Alzheimer\u0026apos;s disease phospholipase C-gamma-2 (PLCG2) protective variant is a functional hypermorph. \u003cem\u003eAlzheimers Res Ther\u003c/em\u003e,\u003cem\u003e 11\u003c/em\u003e(1), 16. https://doi.org/10.1186/s13195-019-0469-0\u003c/li\u003e\n\u003cli\u003eMalik, M., Chiles, J., 3rd, Xi, H. S., Medway, C., Simpson, J., Potluri, S., Howard, D., Liang, Y., Paumi, C. M., Mukherjee, S., Crane, P., Younkin, S., Fardo, D. W., \u0026amp; Estus, S. (2015). Genetics of CD33 in Alzheimer\u0026apos;s disease and acute myeloid leukemia. \u003cem\u003eHum Mol Genet\u003c/em\u003e. https://doi.org/10.1093/hmg/ddv092\u003c/li\u003e\n\u003cli\u003eManning, K. S., \u0026amp; Cooper, T. A. (2017). The roles of RNA processing in translating genotype to phenotype. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e,\u003cem\u003e 18\u003c/em\u003e(2), 102-114. https://doi.org/10.1038/nrm.2016.139\u003c/li\u003e\n\u003cli\u003eMatsuo, M. (2021). Antisense Oligonucleotide-Mediated Exon-skipping Therapies: Precision Medicine Spreading from Duchenne Muscular Dystrophy. \u003cem\u003eJMA J\u003c/em\u003e,\u003cem\u003e 4\u003c/em\u003e(3), 232-240. https://doi.org/10.31662/jmaj.2021-0019\u003c/li\u003e\n\u003cli\u003eNeil, E. E., \u0026amp; Bisaccia, E. K. (2019). Nusinersen: A Novel Antisense Oligonucleotide for the Treatment of Spinal Muscular Atrophy. \u003cem\u003eJ Pediatr Pharmacol Ther\u003c/em\u003e,\u003cem\u003e 24\u003c/em\u003e(3), 194-203. https://doi.org/10.5863/1551-6776-24.3.194\u003c/li\u003e\n\u003cli\u003eNelson, P. T., Braak, H., \u0026amp; Markesbery, W. R. (2009). Neuropathology and cognitive impairment in Alzheimer disease: a complex but coherent relationship. \u003cem\u003eJ Neuropathol Exp Neurol\u003c/em\u003e,\u003cem\u003e 68\u003c/em\u003e(1), 1-14. https://doi.org/10.1097/NEN.0b013e3181919a48\u003c/li\u003e\n\u003cli\u003eNishida, M., Sugimoto, K., Hara, Y., Mori, E., Morii, T., Kurosaki, T., \u0026amp; Mori, Y. (2003). Amplification of receptor signalling by Ca2+ entry-mediated translocation and activation of PLCgamma2 in B lymphocytes. \u003cem\u003eEMBO J\u003c/em\u003e,\u003cem\u003e 22\u003c/em\u003e(18), 4677-4688. https://doi.org/10.1093/emboj/cdg457\u003c/li\u003e\n\u003cli\u003eOlive, C., Ibanez, L., Farias, F. H. G., Wang, F., Budde, J. P., Norton, J. B., Gentsch, J., Morris, J. C., Li, Z., Dube, U., Del-Aguila, J., Bergmann, K., Bradley, J., Benitez, B. A., Harari, O., Fagan, A., Ances, B., Cruchaga, C., \u0026amp; Fernandez, M. V. (2020). Examination of the Effect of Rare Variants in TREM2, ABI3, and PLCG2 in LOAD Through Multiple Phenotypes. \u003cem\u003eJ Alzheimers Dis\u003c/em\u003e,\u003cem\u003e 77\u003c/em\u003e(4), 1469-1482. https://doi.org/10.3233/JAD-200019\u003c/li\u003e\n\u003cli\u003ePurcell, S., \u0026amp; Chang, C. (2015). \u003cem\u003ePLINK 2.0\u003c/em\u003e.\u003cem\u003e \u003c/em\u003eIn www.cog-genomics.org/plink/2.0/.\u003c/li\u003e\n\u003cli\u003eShaw, B. C., Katsumata, Y., Simpson, J. F., Fardo, D. W., \u0026amp; Estus, S. (2021). Analysis of Genetic Variants Associated with Levels of Immune Modulating Proteins for Impact on Alzheimer\u0026apos;s Disease Risk Reveal a Potential Role for SIGLEC14. \u003cem\u003eGenes (Basel)\u003c/em\u003e,\u003cem\u003e 12\u003c/em\u003e(7). https://doi.org/10.3390/genes12071008\u003c/li\u003e\n\u003cli\u003eShaw, B. C., Snider, H. C., Turner, A. K., Zajac, D. J., Simpson, J. F., \u0026amp; Estus, S. (2022). An Alternatively Spliced TREM2 Isoform Lacking the Ligand Binding Domain is Expressed in Human Brain. \u003cem\u003eJ Alzheimers Dis\u003c/em\u003e. https://doi.org/10.3233/JAD-215602\u003c/li\u003e\n\u003cli\u003eShi, Y., \u0026amp; Holtzman, D. M. (2018). Interplay between innate immunity and Alzheimer disease: APOE and TREM2 in the spotlight. \u003cem\u003eNat Rev Immunol\u003c/em\u003e,\u003cem\u003e 18\u003c/em\u003e(12), 759-772. https://doi.org/10.1038/s41577-018-0051-1\u003c/li\u003e\n\u003cli\u003eSilva, A. L., \u0026amp; Romao, L. (2009). The mammalian nonsense-mediated mRNA decay pathway: to decay or not to decay! Which players make the decision? \u003cem\u003eFEBS Lett\u003c/em\u003e,\u003cem\u003e 583\u003c/em\u003e(3), 499-505. https://doi.org/10.1016/j.febslet.2008.12.058\u003c/li\u003e\n\u003cli\u003eSims, R., van der Lee, S. J., Naj, A. C., Bellenguez, C., Badarinarayan, N., Jakobsdottir, J., Kunkle, B. W., Boland, A., Raybould, R., Bis, J. C., Martin, E. R., Grenier-Boley, B., Heilmann-Heimbach, S., Chouraki, V., Kuzma, A. B., Sleegers, K., Vronskaya, M., Ruiz, A., Graham, R. R., . . . Schellenberg, G. D. (2017). Rare coding variants in PLCG2, ABI3, and TREM2 implicate microglial-mediated innate immunity in Alzheimer\u0026apos;s disease. \u003cem\u003eNat Genet\u003c/em\u003e,\u003cem\u003e 49\u003c/em\u003e(9), 1373-1384. https://doi.org/10.1038/ng.3916\u003c/li\u003e\n\u003cli\u003eSolomon, S., Sampathkumar, N. K., Carre, I., Mondal, M., Chennell, G., Vernon, A. C., Ruepp, M. D., \u0026amp; Mitchell, J. C. (2022). Heterozygous expression of the Alzheimer\u0026apos;s disease-protective PLCgamma2 P522R variant enhances Abeta clearance while preserving synapses. \u003cem\u003eCell Mol Life Sci\u003c/em\u003e,\u003cem\u003e 79\u003c/em\u003e(8), 453. https://doi.org/10.1007/s00018-022-04473-1\u003c/li\u003e\n\u003cli\u003eStrickland, S. L., Morel, H., Prusinski, C., Allen, M., Patel, T. A., Carrasquillo, M. M., Conway, O. J., Lincoln, S. J., Reddy, J. S., Nguyen, T., Malphrus, K. G., Soto, A. I., Walton, R. L., Crook, J. E., Murray, M. E., Boeve, B. F., Petersen, R. C., Lucas, J. A., Ferman, T. J., . . . Ertekin-Taner, N. (2020). Association of ABI3 and PLCG2 missense variants with disease risk and neuropathology in Lewy body disease and progressive supranuclear palsy. \u003cem\u003eActa Neuropathol Commun\u003c/em\u003e,\u003cem\u003e 8\u003c/em\u003e(1), 172. https://doi.org/10.1186/s40478-020-01050-0\u003c/li\u003e\n\u003cli\u003eSudwarts, A., \u0026amp; Thinakaran, G. (2023). Alzheimer\u0026apos;s genes in microglia: a risk worth investigating. \u003cem\u003eMol Neurodegener\u003c/em\u003e,\u003cem\u003e 18\u003c/em\u003e(1), 90. https://doi.org/10.1186/s13024-023-00679-4\u003c/li\u003e\n\u003cli\u003eTakalo, M., Wittrahm, R., Wefers, B., Parhizkar, S., Jokivarsi, K., Kuulasmaa, T., Makinen, P., Martiskainen, H., Wurst, W., Xiang, X., Marttinen, M., Poutiainen, P., Haapasalo, A., Hiltunen, M., \u0026amp; Haass, C. (2020). The Alzheimer\u0026apos;s disease-associated protective Plcgamma2-P522R variant promotes immune functions. \u003cem\u003eMol Neurodegener\u003c/em\u003e,\u003cem\u003e 15\u003c/em\u003e(1), 52. https://doi.org/10.1186/s13024-020-00402-7\u003c/li\u003e\n\u003cli\u003eUrano, E., Miyauchi, K., Ichikawa, R., Futahashi, Y., \u0026amp; Komano, J. (2012). Regulation of cyclin T1 expression and function by an alternative splice variant that skips exon 7 and contains a premature termination codon. \u003cem\u003eGene\u003c/em\u003e,\u003cem\u003e 505\u003c/em\u003e(1), 1-8. https://doi.org/10.1016/j.gene.2012.06.006\u003c/li\u003e\n\u003cli\u003evan Bergeijk, P., Seneviratne, U., Aparicio-Prat, E., Stanton, R., \u0026amp; Hasson, S. A. (2019). SRSF1 and PTBP1 Are trans-Acting Factors That Suppress the Formation of a CD33 Splicing Isoform Linked to Alzheimer\u0026apos;s Disease Risk. \u003cem\u003eMol Cell Biol\u003c/em\u003e,\u003cem\u003e 39\u003c/em\u003e(18). https://doi.org/10.1128/MCB.00568-18\u003c/li\u003e\n\u003cli\u003evan der Lee, S. J., Conway, O. J., Jansen, I., Carrasquillo, M. M., Kleineidam, L., van den Akker, E., Hernandez, I., van Eijk, K. R., Stringa, N., Chen, J. A., Zettergren, A., Andlauer, T. F. M., Diez-Fairen, M., Simon-Sanchez, J., Lleo, A., Zetterberg, H., Nygaard, M., Blauwendraat, C., Savage, J. E., . . . Holstege, H. (2019). A nonsynonymous mutation in PLCG2 reduces the risk of Alzheimer\u0026apos;s disease, dementia with Lewy bodies and frontotemporal dementia, and increases the likelihood of longevity. \u003cem\u003eActa Neuropathol\u003c/em\u003e,\u003cem\u003e 138\u003c/em\u003e(2), 237-250. https://doi.org/10.1007/s00401-019-02026-8\u003c/li\u003e\n\u003cli\u003eWang, M., \u0026amp; Marin, A. (2006). Characterization and prediction of alternative splice sites. \u003cem\u003eGene\u003c/em\u003e,\u003cem\u003e 366\u003c/em\u003e(2), 219-227. https://doi.org/10.1016/j.gene.2005.07.015\u003c/li\u003e\n\u003cli\u003eZajac, D. J., Simpson, J., Zhang, E., Parikh, I., \u0026amp; Estus, S. (2023). Expression of INPP5D isoforms in human brain: Impact of Alzheimer\u0026apos;s Disease neuropathology and genetics. \u003cem\u003eGenes (Basel)\u003c/em\u003e,\u003cem\u003e 14\u003c/em\u003e(3). https://doi.org/10.3390/genes14030763\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-neurodegeneration-advances","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Molecular Neurodegeneration Advances](https://mnadvances.biomedcentral.com/)","snPcode":"44477","submissionUrl":"https://submission.springernature.com/new-submission/44477/3?","title":"Molecular Neurodegeneration Advances","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Alzheimer’s disease, RNA splicing, genetics, PLCG2","lastPublishedDoi":"10.21203/rs.3.rs-6735123/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6735123/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003ePLCG2 is associated with the risk of Alzheimer\u0026rsquo;s disease (AD) through a rare missense polymorphism, rs72824905 (P522R) as well as a common variant, rs12445675, within a long non-coding RNA adjacent to \u003cem\u003ePLCG2\u003c/em\u003e. Elucidating the impact of genetics on PLCG2 expression and splicing will provide insights into the role of PLCG2 in AD risk and, potentially, treatments that might reduce AD risk.\u003c/p\u003e\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eTo evaluate \u003cem\u003ePLCG2\u003c/em\u003e expression and splicing as a function of AD genetics.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003e \u003cem\u003ePLCG2\u003c/em\u003e isoform expression was detected by PCR and quantified by qPCR in AD and non-AD brain samples and in blood buffy coat samples. The function of a genetic variant, rs107164, was tested by using a minigene approach with both alleles in murine BV-2 microglial cells. The impact of ectopic splicing factor expression on PLCG2 minigene splicing was also tested in BV-2 cells. The extent that endogenous levels of a novel PLCG2 mRNA isoform lacking 65 bp within exon 28 (D65-PLCG2) were affected by nonsense mediated decay (NMD) was determined by using cycloheximide \u003cem\u003ein vitro\u003c/em\u003e. Lastly, whether D65-PLCG2 manifested a Ca\u0026thinsp;+\u0026thinsp;2 response similar to PLCG2 was tested by comparing D65-PLCG2-GFP and PLCG2-GFP fusion proteins in transfected HEK293 cells.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eWe report PLCG2 isoforms that include (i) a transcript that replaces \u003cem\u003ePLCG2\u003c/em\u003e exon 1 with sequence from an adjacent long noncoding (LNC) RNA (\u003cem\u003eLNC-PLCG2\u003c/em\u003e) and (ii) a transcript that lacks 65 bp from the beginning of exon 28 (\u003cem\u003eD65-PLCG2\u003c/em\u003e). The ratio of \u003cem\u003eLNC-PLCG2\u003c/em\u003e to canonical \u003cem\u003ePLCG2\u003c/em\u003e was associated with rs12445675 genotype in both human brain and buffy coat samples. The proportion of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e was increased by the T allele of rs1071644, a T/C SNP within the 65bp variably spliced portion of exon 28. This SNP was demonstrated to be functional in a minigene splicing assay. Moreover, the rs1071644-T allele was found to be associated with increased AD risk, independent of rs72824905 (P522R) and rs12445675. \u003cem\u003eD65-PLCG2\u003c/em\u003e was susceptible to nonsense mediated RNA decay. D65-PLCG2 was not responsive to Ca\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e in a fashion similar to that observed for PLCG2. Hence, the rs1071644-T allele appears to increase AD risk by increasing the proportion of \u003cem\u003ePLCG2\u003c/em\u003e expressed as \u003cem\u003eD65-PLCG2\u003c/em\u003e, representing a loss of PLCG2 function.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eWe report that two AD genetic risk factors, rs12445675 and rs1071644, affect AD risk by impacting the \u003cem\u003eLNC-PLCG2\u003c/em\u003e to \u003cem\u003ePLCG2\u003c/em\u003e ratio and \u003cem\u003ePLCG2\u003c/em\u003e exon 28 splicing, respectively.\u003c/p\u003e","manuscriptTitle":"Genetics of PLCG2 expression and splicing relative to Alzheimer’s disease risk","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-19 11:42:31","doi":"10.21203/rs.3.rs-6735123/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-10T13:55:56+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-04T22:09:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"88843762669394370720432076646913400918","date":"2025-08-05T18:16:52+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-02T18:48:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"14630234687400009539706948141969480666","date":"2025-07-02T18:00:32+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-17T19:44:50+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-12T13:57:59+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-05-28T04:23:23+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Neurodegeneration Advances","date":"2025-05-23T18:25:07+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-neurodegeneration-advances","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Molecular Neurodegeneration Advances](https://mnadvances.biomedcentral.com/)","snPcode":"44477","submissionUrl":"https://submission.springernature.com/new-submission/44477/3?","title":"Molecular Neurodegeneration Advances","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e80f14d3-a684-4a4b-9418-6dbd7a9c8e6f","owner":[],"postedDate":"June 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-11-13T15:08:40+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-19 11:42:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6735123","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6735123","identity":"rs-6735123","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}