Clinical and Genetic Analysis of a Compound Heterozygous Mutation in the BBS10 Gene in Chinese People With Bardet Biedl syndrome

Clinical and Genetic Analysis of a Compound Heterozygous Mutation in the BBS10 Gene in Chinese People With Bardet Biedl syndrome | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Clinical and Genetic Analysis of a Compound Heterozygous Mutation in the BBS10 Gene in Chinese People With Bardet Biedl syndrome Pai Zhang, Yanan Wang, Yuqiong Chai, Weiwei Zang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6824032/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Bardet-Biedl syndrome (BBS) is a heterogeneous autosomal recessive disorder characterized by retinitis pigmentosa, obesity, and polydactyly as cardinal features. This study aimed to characterize the clinical manifestations and genetic basis in a Chinese patient with BBS. Methods The study subject was a 23-year-old Han Chinese male who presented to the Maternal and Child Health Hospital of Luoyang City, Henan Province, seeking pre-pregnancy counseling. The patient had a history of obesity since childhood, progressive bilateral vision loss, and polydactyly affecting both hands and feet. A detailed medical history was obtained, and physical examination, laboratory tests, and radiological imaging were performed. Peripheral venous blood was collected for whole-exome sequencing (WES) to screen for candidate pathogenic mutations. Results Whole-exome sequencing (WES) identified two novel mutations in the BBS10 gene: c.83_84delinsAG (p.Cys28Ter) in exon 1 and c.1063C > T (p.Gln355Ter) in exon 2. Both are nonsense mutations predicted to result in a truncated protein and loss of function. Sanger sequencing confirmed both variants. Conclusions In this study, we successfully identified two novel mutations in the BBS10 gene in a Chinese patient with BBS, expanding the mutational spectrum of the disorder and providing new genetic variants for BBS research and clinical diagnosis. This finding underscores the utility of whole-exome sequencing (WES) in pinpointing disease-causing mutations in rare genetic disorders and offers novel insights into the pathogenesis of BBS. Bardet-Biedl syndrome (BBS) Rare disease Whole exome sequencing Nonsense mutation BBS10 gene Figures Figure 1 Figure 2 Figure 3 BACKGROUND Bardet-Biedl syndrome (BBS) is a rare autosomal recessive disorder, first reported by Bardet and Biedl in 1920 [ 1 ] . The main clinical symptoms of BBS are extremely complex and varied, covering lesions in multiple systems and organs. Among them, retinitis pigmentosa is one of the most characteristic clinical manifestations of BBS, and patients usually develop night blindness in early childhood, followed by a gradual decline in visual acuity, which may eventually lead to blindness [ 2 ] . In addition, obesity, polydactyly, gonadal hypoplasia, mental retardation, and renal abnormalities are also common symptoms of BBS. Obesity often begins in infancy and worsens with age, which may lead to a series of metabolic diseases [ 3 ] ; polydactyly increases physical dysfunction and psychological burden; gonadal hypoplasia leads to impaired reproductive ability, affecting the fertility and quality of life of patients [ 2 , 4 ] ; and intellectual disability and renal abnormality further aggravate the challenges of patients' social adaptability and ability to take care of themselves [ 2 ] . The prevalence of BBS varies in different regions, ranging from 1/140,000 to 1/160,000 in developed countries such as North America and Europe, and increasing significantly in regions with a high proportion of consanguineous marriages such as the Middle East and North Africa, such as Kuwait, where the prevalence rate is as high as 1/13,500 [ 5 – 7 ] ; large-scale epidemiological surveys have not yet been conducted in China. Genetic studies have revealed the complex genetic background of BBS. To date, at least 26 genes are associated with BBS, which are mainly localized on primary cilia and involved in the functional regulation of non-motor cilia [ 8 ] . Among them, BBS1, BBS2, and BBS10 are the most common causative genotypes. With the rapid development of molecular biology technology, the study of BBS pathogenic genes has been deepening. The identified BBS genes are all localized on primary cilia, and their products play important roles in cilia assembly and signaling.BBS proteins can be divided into two groups, BBSome and molecular chaperones, where BBSome consists of BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, and BBS9, which are responsible for the assembly and maintenance of the cilia; while molecular chaperones include BBS6, BBS10, and BBS12, which regulate the assembly of BBSome [ 9 – 11 ] . The abnormal function of these genes and their products underlie the occurrence and development of BBS. In this paper, we report a male patient with Bardet-Biedl syndrome (BBS) harboring two novel mutations in the BBS10 gene (c.83_84delinsAG, p.Cys28Ter and c.1063C > T, p.Gln355Ter). The detailed clinical characterization of this case not only expands the genetic spectrum of BBS but also facilitates early diagnosis and deepens the clinical understanding of this disorder. METHODS 1. Research Objective The patient is a 23-year-old, married Han Chinese male. On August 25, 2023, he presented to the Department of Medical Genetics at Luoyang Maternal and Child Health Hospital, Henan Province, seeking pre-pregnancy genetic counseling due to intellectual disability in both partners within one year of marriage. A detailed clinical evaluation was performed, including assessment of family history, personal history, and consanguinity. Clinical data encompassing medical history, physical examination, laboratory investigations, and imaging studies were collected. Genetic testing was initiated by collecting 2 mL of peripheral venous blood from the patient for genomic DNA extraction and subsequent screening for candidate pathogenic variants. The study protocol received approval from the Medical Ethics Committee of Luoyang Maternal and Child Health Hospital, and the patient provided written informed consent. 2. Genomic DNA extraction and whole exome sequencing The xGen™ ExomeResearchPanelv1 (Exomev1) capture kit developed by IDT was designed to cover the DNA sequences of the coding regions of 19,396 genes, with a target region range of 39M. It is designed to detect point mutations and insertion-deletion mutations within 20 bp in small fragments. The method mainly targets the exon region of the gene, and is mainly applicable to point mutations and insertion-deletion mutations (MicroIn/Dels) within 20bp, and does not target the analysis of specific pathogenic mechanisms such as methylation modification, RNA transcription, or protein expression. The specific steps were as follows: (1) DNA extraction was performed using the Tengen Magnetic Bead Method Blood Genomic DNA Extraction Kit and the Tengen Automatic Nucleic Acid Extractor. (2) Genomic DNA was interrupted using fragmentation enzymes from Enzymatic, with fragment lengths of 250–300 bp. (3) Amplification of the libraries was performed using the enzyme KAPAHiFiReadyMix (KAPA Corporation). (4) Whole exon capture was performed using the IDTxGenExomeResearchPanelv1.0 capture kit. (5) Library concentration (concentration ≥ 10ng/ul) was detected using Qubit4.0 and Qubit™dsDNAHSAssayKit, and library fragment length (300bp ~ 550bp) was detected using QSeq400 fragment analyser. (6) Online sequencing of the library. Sequencing was performed using NovaSeq6000 equipment from Illumnia, PE150 (read length 150bp) mode sequencing, the output data was about 10G, the average sequencing depth of the target region of whole exome sequencing was greater than 100X, and 95% of the target sequences were sequenced up to a depth of 20X. 3. Bioinformatics analysis and data screening The sequencing data analysis process mainly includes sequencing data quality control, data pre-processing, sequence comparison, format conversion and sequencing de-duplication, local re-comparison, base correction, variant analysis, variant interpretation, etc., to be able to explain the variability of the patient's abnormal phenotype. The specific operation steps are as follows: the downstream data are FSATQ files. Into the raw letter analysis process, using fastp software (version number: 0.21.0) data filtering, bwa software (version number: 0.7.17-r1198-dirty) data comparison, using the public dbsnp159 for data correction, using samtoolsdepth (version number: 1.3.1 (usinghtslib1.3. 1)) to count the sequencing depth of the data, and gatkDepthOfCoverage to count the bed file region coverage, 20X sequencing depth, and so on. Variants were called using gatk3.8. mosdepth0.2.5 software was used for GC content statistics. Point mutations were annotated using Annovar software (version number: 2020-06-0800:46:07-0400), and further annotation parsing was done in conjunction with local databases such as HGMD databases, HPOs, and internal carryover. The detected variants were classified according to the American College of Medical Genetics (ACMG) genetic variant classification criteria as "pathogenic", "probably pathogenic" and "of uncertain significance". 4. Sanger sequencing validation and protein secondary structure prediction Based on the variant sites obtained from the whole exome detection of the patients, PCR primers for sequencing were designed and synthesized, DNA was amplified, the products were purified, and Sanger sequencing was carried out using an ABI sequencer. The sequence of BBS10 amplification primers is as follows, forward sequence 1:CAGGAAACAGCTATGACCTACGCATCGCCTCAGGATGGG, reverse sequence 1:TGTAAAACGACGGCCAGTTCTGCCTTCGCGTACAACGG, and forward sequence 2:CAGGAAACAGCTATGACCTTGGTCATTGGTTTGTGTCATGTAA, reverse sequence 2: TGTAAAACGACGGCCAGTTTTCCACTTCTGGATCAGAGTTTATTC. PCR amplification conditions: 95°C for 3min; 95°C for 30s, 30 cycles; 58°C for 30s; 72°C for 30s; 72°C for 3min. based on the results to find the reference sequences by" MutationSurveyor" analysis software was used to compare the sequencing results with the reference sequences. The secondary structure of the BBS10 protein was predicted using the SWISSMODEL protein structure modeling tool ( www.swissmodel.expasy.org ). RESULTS 1. Clinical symptoms The patient was born at term, with birth weight (unknown), obese since childhood, and with rapid postnatal weight gain. He was unresponsive compared to his peers was unable to complete his schooling, and did not attend school after primary school. At the age of 9 years, he began to experience a gradual loss of vision in both eyes, and at the time of presentation, his vision in both eyes was < 0.1. He reported that he had a polydactyly (six toes) on the lateral aspect of the fifth toes of both hands and feet, which was surgically excised at the age of 16 years. There was no history of similar disease in the family, a family history of hereditary disease was denied, and the parents were not consanguineous. On examination, he was 167 cm tall, weighed 83 kg, had a blood pressure of 138 mmHg/87 mmHg, was obese, had a full-moon face, had no polycythemia, no purple lines, no cranial deformities, no abnormalities of the ears, nose, or mouth, and no abnormal signs of the heart, lungs, or abdomen. The fingers and toes of both hands were stubby, and a polydactyl ectomy scar was seen on both hands and the lateral side of the fifth toe of both feet (Fig. 1 ). The patient had no other clinical manifestations such as abnormal gonadal development, neurological abnormalities, or cardiovascular abnormalities. 2. Analysis of sequencing results We performed whole exome sequencing on the patient. The results showed that the causative gene as well as the mutation locus in this patient was BBS10 c.83_84delinsAG and c.1063C > T mutations; mutation c.83_84delinsAG, p.C28X, located at position + 83_+84 of Exon1, with GC deletion of base c.83_84 and insertion of base AG, and mutation of the amino acid cysteine at amino acid position 28 from C to termination codon (X). The mutation c.1063C > T,p.Q355X, located within Exon2, mutates the base at c.1063 from C to T, and the amino acid glutamine (Q) at amino acid position 355 is mutated to the termination codon (X). We hypothesized that a truncated expressed protein would be produced and the normal function of the BBS10 protein would be lost. No mutations were found in the other genes in the test results. We then sequenced exon 1\2 of the BBS10 gene in 30 local normal populations, the c.83_84delinsAG and c.1063C > T mutations were not found in any of them. The chromosomal location of c.83_84delinsAG mutation is chr12:76742056 (genome version: hg19), transcript NM_024685, in exon 1. It is a nonsense mutation. It is not included in the HGMD Professional database and there are 2 cases included in the Clinvar database (1 pathogenic,1 likelypathogenic). The population frequency of this locus is not available. It is not included in the East Asian population in the gnomAD database. Referring to the ACMG Mutation Interpretation Guidelines, this locus meets 2 lines of evidence (PVS, PM2_Supporting) and is graded as Likely pathogenic. The chromosomal location of c.1063C > T mutation is chr12:76740702 (genome version: hg19), and the transcript NM_024685, is located in exon 2. It is a nonsense mutation. It is listed as DM in the HGMD Professional database [ 12 ] and not listed in the Clinvar database. The population frequency of this locus is not included. It is not included in the East Asian population in the gnomAD database. Referring to the ACMG Mutation Interpretation Guidelines, this locus meets 2 pieces of evidence (PVS_Strong, PM2_Supporting) and is graded as Uncertainsignificance. Sanger sequencing validation showed that the patient had a c.83_84delinsAG, c.1063C > T compound heterozygous mutation in the gene BBS10, which was consistent with the whole exome assay (Fig. 2 ). Sequence conservation was predicted by GERP and other software, and the sequence was compared with several species, which showed that the sequence sequence consistency was high and highly conserved, with potential functional impacts. MutationTaster predicted that both mutations were "deleterious", suggesting that the amino acid sequence might be altered and the structure of the protein might be affected, which might lead to "NMD". After bioinformatics prediction, both mutations could change the secondary structure of the BBS10 protein, and it was found that the structure of the mutated BBS10 protein was different from that of the wild-type protein (Fig. 3 A and B). (The two-dimensional structure could not be predicted because the c.83_84delinsAG mutation resulted in only 28 amino acids). The protein encoded by the BBS10 gene contains the apical structural domain, the intermediate structural domain, and the equatorial structural domain, which are conserved in BBS proteins, and the analyses by Prosite showed that both mutations were able to lead to the deletion of the intermediate structural domain, the equatorial structural domain and the partial apical structural domain deletion, predicting that this mutation affects the protein function. The mutation is an important cause of the patient's morbidity. DISCUSSION Bardet-Biedl syndrome is a primary ciliary dysfunction disorder due to genetic mutations [ 13 ] . The BBS proteins encoded by the relevant genes (BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9, and BBS18) can form the BBSome complex, which is involved in the formation of cilia or the transciliary transport of some specific proteins, such as the G protein-coupled receptor and growth inhibitory hormone receptor, whereas the complexes consisting of BBS6, BBS10, and BBS12 are BBSome complex is a necessary chaperone protein complex during the formation of the BBSome complex [ 14 – 16 ] . Mutations in BBS-related genes can cause non-motor cilia dysfunction, which often involves multiple organ systems, and can exhibit a variety of clinical symptoms, which may vary greatly between patients. Currently, the prevalence of BBS in China is unclear, with fewer cases reported [ 17 ] , and the age at diagnosis is significantly older than that reported abroad, which may be related to the lack of awareness of the disease, etc. Clinical diagnosis of BBS requires compliance with either four main symptoms or three main symptoms and two secondary symptoms. The main features include retinal degeneration, obesity, polydactyly, abnormal gonadal development, mental retardation and renal abnormalities. The incidence, age of onset, and progression of symptoms vary. The most common symptom is retinal degeneration, seen in 80–100% of cases [ 18 ] . The clinical presentation is a gradual onset of night blindness followed by photophobia and loss of central vision and color vision [ 19 ] . The mean age of patients reporting night blindness is 8.5 years [ 20 ] . Cataracts and refractive errors are also common. Obesity is another major clinical manifestation with a prevalence of 72 to 86 percent. Although adult obesity tends to favor the trunk, it appears to be generalized and diffuse in childhood. In this case study, the patient exhibited obesity, polydactyly/polydactyly, eye abnormalities, and mental retardation, etc. We identified a specific mutation in the BBS10 gene (c.83_84delinsAG, c.1063C > T) as a key factor contributing to the patient's development of Bardet-Biedl syndrome (BBS). This finding not only validates the mode of inheritance of BBS as an autosomal recessive disorder but also highlights the central role of BBS-related genes in cilia structure and function. Mutations in the BBS10 gene, one of the many BBS-causing genes, reveal the complexity of the genetic heterogeneity of the disease. Mutations in different genes may affect cilia function through similar or different pathways, leading to similar clinical symptoms, which provides a rich perspective for understanding the full picture of the disease. BBS10 protein, as an important component of the cilium base, its functional integrity is critical for cilia formation, maintenance, and signaling. BBS10 protein has a chaperonin_likedomain functional structural domain, which is 723aa in length, and the mutations we identified, c.83_84delinsAGp.C28X and mutation c.1063C > Tp.Q355X are both located in the retrieved chaperonin_likedomain. It suggests that mutations in the BBS10 gene lead to abnormal function of the BBS10 protein, which in turn affects the normal function of cilia. This effect may involve multiple levels, including protein stability, localization, and interaction with other cilia-associated proteins. These abnormalities ultimately lead to dysfunction of cells in multiple systems, including retinal cells, adipocytes, renal cells, and gonadal cells, which triggers the complex clinical manifestations of BBS. Despite a more in-depth understanding of the genetic basis and clinical manifestations of BBS in recent years, treatments for the disease are still very limited.BBS is mainly treated symptomatically. Rational diet and exercise are recommended for early intervention as retinopathy in BBS starts early and progresses rapidly, with a significant risk of blindness. Management of renal function is particularly important as abnormal renal structure or function is the leading cause of death in this disease. Rehabilitation is recommended for patients with mental retardation and developmental delays. Some gonadal dysgenesis and polydactyly problems can be corrected surgically. However, these methods only relieve symptoms and do not cure the disease at its root. New interventions for BBS gene therapy such as exon skipping therapy, nonsense suppression therapy, gene editing, and other non-genetic therapies are also being studied [ 21 ] . For consanguineous families, both renal polycystic lesions and polydactyly may be detected by prenatal ultrasound, and genetic screening of routine prenatal ultrasound items and special abnormalities detected may provide a reference for prenatal diagnosis of BBS and genetic counseling of the family line. Despite the remarkable progress made in recent years in the study of the genetics and pathogenesis of BBS, there are still many questions that need to be further explored. For example, how do mutations in different BBS genes lead to similar clinical manifestations? How does ciliary dysfunction trigger such complex multi-system symptoms? Answers to these questions will help us understand the pathogenesis of BBS more comprehensively and provide new ideas and approaches for the diagnosis and treatment of the disease. Future research should continue to focus on the following aspects: first, to strengthen gene-phenotype association studies and establish more accurate genotype and phenotype prediction models; second, to make use of advanced molecular and cellular biology techniques to explore in depth how mutations in BBS-related genes affect the processes of cilia function, signaling, and cellular metabolism; and third, to carry out large-scale clinical studies and international collaborations to accumulate more Thirdly, to carry out large-scale clinical research and international cooperation to accumulate more case data and experience, and to promote precision medicine and individualized treatment of BBS. In summary, Bardet-Biedl syndrome, as a rare autosomal recessive hereditary disease, poses a serious challenge to the medical community with its complex clinical manifestations and genetic mechanisms. However, with the continuous progress of science and technology and in-depth research, we have reason to believe that more effective treatments can be found and the quality of life of patients can be improved in the future. In this paper, we report the discovery of two novel mutations in the BBS10 gene (c.83_84delinsAG,p.C28X, and c.1063C > Tp.Q355X ) in a BBS patient. Enriching the mutation spectrum of the BBS10 gene. It suggests that whole exome sequencing is of great importance in confirming the diagnosis of BBS patients with atypical symptoms. CONCLUSION In this study, we successfully identified two novel mutations in the BBS10 gene of Chinese BBS patient, providing new genetic resources for genetic studies and clinical diagnosis of BBS. This finding highlights the importance of whole exome sequencing in identifying the causative genes of rare genetic diseases and provides new clues for an in-depth understanding of the pathogenesis of BBS. Abbreviations BBS Bardet-Biedl syndrome PCR Polymerase chain reaction HGMD Human Gene Mutation Database ACMG American College of Medical Genetics Declarations Ethics approval and consent to participate I confirm that all methods were performed in accordance with the relevant guidelines and regulations. The patient signed an informed consent form. And the study was approved by the Ethics Committee of Medical Genetics and Prenatal Diagnosis of Luoyang Maternal and Child Health Hospital. The ethic number is LYFY-YCCZ-2024006. Consent for publication Informed consent was obtained from the patient to publish the information and image in an online open-access publication. Availability of data and material Not applicable Competing interests The authors declare no competing financial interests. Funding This work was supported by the Department of Genetics and Prenatal Diagnosis of the Luoyang Maternal and Child Health Hospital. The funding agency did not participate in the design or implementation of this study. Authors' contributions ZP designed this work, WYN and CYQ performed sequencing and analysis, ZWW prepared figures, and ZP wrote the manuscript. Acknowledgements We would like to thank all the participants and the staff for their valuable contribution to this research. References Hrynchak PK. Bardet-Biedl syndrome. Optom Vis Sci. 2000;77(5):236 – 43. 10.1097/00006324-200005000-00010 . PMID: 10831213. Beales PL, Elcioglu N, Woolf AS, Parker D, Flinter FA. New criteria for improved diagnosis of Bardet-Biedl syndrome: results of a population survey. J Med Genet. 1999;36(6):437–46. PMID: 10874630; PMCID: PMC1734378. Iannello S, Bosco P, Cavaleri A, Camuto M, Milazzo P, Belfiore F. A review of the literature of Bardet-Biedl disease and report of three cases associated with metabolic syndrome and diagnosed after the age of fifty. Obes Rev. 2002;3(2):123 – 35. 10.1046/j.1467-789x.2002.00055.x . PMID: 12120419. M'hamdi O, Ouertani I, Chaabouni-Bouhamed H. Update on the genetics of bardet-biedl syndrome. Mol Syndromol. 2014;5(2):51 – 6. doi: 10.1159/000357054. Epub 2013 Dec 20. PMID: 24715851; PMCID: PMC3977223. Suspitsin EN, Imyanitov EN, Bardet-Biedl S. Mol Syndromol. 2016;7(2):62–71. 10.1159/000445491 . Epub 2016 Apr 15. PMID: 27385962; PMCID: PMC4906432. Janssen S, Ramaswami G, Davis EE, Hurd T, Airik R, Kasanuki JM, Van Der Kraak L, Allen SJ, Beales PL, Katsanis N, Otto EA, Hildebrandt F. Mutation analysis in Bardet-Biedl syndrome by DNA pooling and massively parallel resequencing in 105 individuals. Hum Genet. 2011;129(1):79–90. Epub 2010 Oct 30. PMID: 21052717; PMCID: PMC3646619. Farag TI, Teebi AS. High incidence of Bardet Biedl syndrome among the Bedouin. Clin Genet. 1989;36(6):463-4. 10.1111/j.1399-0004.1989.tb03378.x . PMID: 2591073. Heon E, Kim G, Qin S, Garrison JE, Tavares E, Vincent A, Nuangchamnong N, Scott CA, Slusarski DC, Sheffield VC. Mutations in C8ORF37 cause Bardet Biedl syndrome (BBS21). Hum Mol Genet. 2016;25(11):2283–94. 10.1093/hmg/ddw096 . Epub 2016 Mar 22. PMID: 27008867; PMCID: PMC5081059. Beales PL, Badano JL, Ross AJ, Ansley SJ, Hoskins BE, Kirsten B, Mein CA, Froguel P, Scambler PJ, Lewis RA, Lupski JR, Katsanis N. Genetic interaction of BBS1 mutations with alleles at other BBS loci can result in non-Mendelian Bardet-Biedl syndrome. Am J Hum Genet. 2003;72(5):1187–99. 10.1086/375178 . Epub 2003 Apr 3. PMID: 12677556; PMCID: PMC1180271. Seo S, Zhang Q, Bugge K, Breslow DK, Searby CC, Nachury MV, Sheffield VC. A novel protein LZTFL1 regulates ciliary trafficking of the BBSome and Smoothened. PLoS Genet. 2011;7(11):e1002358. 10.1371/journal.pgen.1002358 . Epub 2011 Nov 3. PMID: 22072986; PMCID: PMC3207910. Seo S, Baye LM, Schulz NP, Beck JS, Zhang Q, Slusarski DC, Sheffield VC. BBS6, BBS10, and BBS12 form a complex with CCT/TRiC family chaperonins and mediate BBSome assembly. Proc Natl Acad Sci U S A. 2010;107(4):1488–93. 10.1073/pnas.0910268107 . Epub 2010 Jan 4. PMID: 20080638; PMCID: PMC2824390. Liu X, Tao T, Zhao L, Li G, Yang L. Molecular diagnosis based on comprehensive genetic testing in 800 Chinese families with non-syndromic inherited retinal dystrophies. Clin Exp Ophthalmol. 2021;49(1):46–59. 10.1111/ceo.13875 . Epub 2020 Nov 2. PMID: 33090715. Hildebrandt F, Benzing T, Katsanis N, Ciliopathies. N Engl J Med. 2011;364(16):1533–43. 10.1056/NEJMra1010172 . PMID: 21506742; PMCID: PMC3640822. Loktev AV, Zhang Q, Beck JS, Searby CC, Scheetz TE, Bazan JF, Slusarski DC, Sheffield VC, Jackson PK, Nachury MV. A BBSome subunit links ciliogenesis, microtubule stability, and acetylation. Dev Cell. 2008;15(6):854 – 65. doi: 10.1016/j.devcel.2008.11.001. PMID: 19081074. Wei Q, Zhang Y, Li Y, Zhang Q, Ling K, Hu J. The BBSome controls IFT assembly and turnaround in cilia. Nat Cell Biol. 2012;14(9):950–7. 10.1038/ncb2560 . Epub 2012 Aug 26. PMID: 22922713; PMCID: PMC3434251. Nachury MV, Loktev AV, Zhang Q, Westlake CJ, Peränen J, Merdes A, Slusarski DC, Scheller RH, Bazan JF, Sheffield VC, Jackson PK. A core complex of BBS proteins cooperates with the GTPase Rab8 to promote ciliary membrane biogenesis. Cell. 2007;129(6):1201-13. 10.1016/j.cell.2007.03.053 . PMID: 17574030. Tao T, Wang L, Chong W, Yang L, Li G. Characteristics of genotype and phenotype in Chinese patients with Bardet-Biedl syndrome. Int Ophthalmol. 2020;40(9):2325–43. 10.1007/s10792-020-01415-3 . Epub 2020 May 24. PMID: 32448990. Chakrabarty S, Savantre SB, Ramachandra Bhat C, Satyamoorthy K. Multiple genetic mutations implicate spectrum of phenotypes in Bardet-Biedl syndrome. Gene. 2020;725:144164. 10.1016/j.gene.2019.144164 . Epub 2019 Oct 19. PMID: 31639430. Mahmood SH, Khan M, Qadar LT, Yousuf F, Hasan M. A Unique Manifestation of Bardet-Biedl Syndrome with Otolaryngologic Symptoms and Bronchopneumonia in a One-year-old Girl. Cureus. 2019;11(9):e5717. 10.7759/cureus.5717 . PMID: 31720185; PMCID: PMC6823080. Shrestha S, Chaudhary N. A rare case of obesity. Can it be Bardet-Biedl Syndrome? Clin Case Rep. 2019;7(9):1725–8. 10.1002/ccr3.2356 . PMID: 31534736; PMCID: PMC6745398. Forsythe E, Kenny J, Bacchelli C, Beales PL. Managing Bardet-Biedl Syndrome-Now and in the Future. Front Pediatr. 2018;6:23. 10.3389/fped.2018.00023 . PMID: 29487844; PMCID: PMC5816783. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6824032","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":484223420,"identity":"a886a990-55f8-4230-91f9-2e0674f0d8c2","order_by":0,"name":"Pai Zhang","email":"","orcid":"","institution":"Luoyang Maternal and Child Health Hospital","correspondingAuthor":false,"prefix":"","firstName":"Pai","middleName":"","lastName":"Zhang","suffix":""},{"id":484223421,"identity":"e84098a6-d03a-4ecf-8eb8-04ce158ac0b6","order_by":1,"name":"Yanan Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYPACCTk29uYDBz78IF6LjTE/z7HEgzN7iNeSljhzRo7xYQ42ItQa3Eh+9uDnjsOMGw7kfDjMwMMgzy92gJCWNHPD3jOHmQ0OnN1wuMCCwXDm7AT8WsxuJJhJ8LYdZjM42Lvh8AwehgSD2wS1pH+T/Nt2mMfgMM+DwzxsRGnJMZPmbUuTkGzjYSBOi/2ZN2XSsm02Bvw8QLfN7JEg7BfJ9vRtkm/bJOrb5B8//vDhh408vzQBLQwCqAokCCgHAf4DRCgaBaNgFIyCkQ0AO2tKA8okf0IAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-8754-3221","institution":"Luoyang Maternal and Child Health Hospital","correspondingAuthor":true,"prefix":"","firstName":"Yanan","middleName":"","lastName":"Wang","suffix":""},{"id":484223422,"identity":"1f01d92d-1596-4ceb-8f76-5a5a603df5c6","order_by":2,"name":"Yuqiong Chai","email":"","orcid":"","institution":"Luoyang Maternal and Child Health Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yuqiong","middleName":"","lastName":"Chai","suffix":""},{"id":484223423,"identity":"24763bdc-29f7-4dba-8aeb-62140f1e5e94","order_by":3,"name":"Weiwei Zang","email":"","orcid":"","institution":"Luoyang Maternal and Child Health Hospital","correspondingAuthor":false,"prefix":"","firstName":"Weiwei","middleName":"","lastName":"Zang","suffix":""}],"badges":[],"createdAt":"2025-06-05 00:55:53","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6824032/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6824032/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":86897748,"identity":"003ccd64-5899-4fc6-989b-8850e747e4b9","added_by":"auto","created_at":"2025-07-17 00:31:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":349551,"visible":true,"origin":"","legend":"\u003cp\u003eAnomalies shown on the patient’s extremities. A is photography of the patient. B and C:Surgical scars on bilateral hands (arrows). D and E: Surgical scars on the foot (arrows).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6824032/v1/329f59358b207d47dd7afbf6.png"},{"id":86897754,"identity":"32d47879-e84d-48e1-97e0-bede52dea430","added_by":"auto","created_at":"2025-07-17 00:31:03","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":81606,"visible":true,"origin":"","legend":"\u003cp\u003eBy Sanger sequencing of exon of the BBS10 gene, a heterozygous (NM_024685:c.83_84delinsAG,p.C28X) variant (A) and a heterozygous (NM_024685:c.1063C\u0026gt;T, p.Q355X) variant (B) was detected in the patient. The variant sites are indicated by arrows.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6824032/v1/41bc2d686058286cdf6eb183.jpeg"},{"id":86897755,"identity":"bb82cea6-b398-42c6-bcd4-0acdeec66227","added_by":"auto","created_at":"2025-07-17 00:31:03","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":42711,"visible":true,"origin":"","legend":"\u003cp\u003ePrediction of secondary structure of BBS10 protein. A is the wild-type secondary structure of BBS10 protein, B is the secondary structure of BBS10 c.1063C\u0026gt;T, p.Q355X mutation.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6824032/v1/c5788c0016ab1c5baa5afe62.jpeg"},{"id":92782495,"identity":"01e9c4fe-05ff-4f31-aab7-51b21522cc7d","added_by":"auto","created_at":"2025-10-04 18:43:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1012130,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6824032/v1/790b1eb1-1dd0-4d2d-ab8a-655bea8b7aae.pdf"}],"financialInterests":"","formattedTitle":"Clinical and Genetic Analysis of a Compound Heterozygous Mutation in the BBS10 Gene in Chinese People With Bardet Biedl syndrome","fulltext":[{"header":"BACKGROUND","content":"\u003cp\u003eBardet-Biedl syndrome (BBS) is a rare autosomal recessive disorder, first reported by Bardet and Biedl in 1920 \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. The main clinical symptoms of BBS are extremely complex and varied, covering lesions in multiple systems and organs. Among them, retinitis pigmentosa is one of the most characteristic clinical manifestations of BBS, and patients usually develop night blindness in early childhood, followed by a gradual decline in visual acuity, which may eventually lead to blindness \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. In addition, obesity, polydactyly, gonadal hypoplasia, mental retardation, and renal abnormalities are also common symptoms of BBS. Obesity often begins in infancy and worsens with age, which may lead to a series of metabolic diseases \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e; polydactyly increases physical dysfunction and psychological burden; gonadal hypoplasia leads to impaired reproductive ability, affecting the fertility and quality of life of patients \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e; and intellectual disability and renal abnormality further aggravate the challenges of patients' social adaptability and ability to take care of themselves \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. The prevalence of BBS varies in different regions, ranging from 1/140,000 to 1/160,000 in developed countries such as North America and Europe, and increasing significantly in regions with a high proportion of consanguineous marriages such as the Middle East and North Africa, such as Kuwait, where the prevalence rate is as high as 1/13,500 \u003csup\u003e[\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e–\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e; large-scale epidemiological surveys have not yet been conducted in China.\u003c/p\u003e\u003cp\u003eGenetic studies have revealed the complex genetic background of BBS. To date, at least 26 genes are associated with BBS, which are mainly localized on primary cilia and involved in the functional regulation of non-motor cilia \u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Among them, BBS1, BBS2, and BBS10 are the most common causative genotypes. With the rapid development of molecular biology technology, the study of BBS pathogenic genes has been deepening. The identified BBS genes are all localized on primary cilia, and their products play important roles in cilia assembly and signaling.BBS proteins can be divided into two groups, BBSome and molecular chaperones, where BBSome consists of BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, and BBS9, which are responsible for the assembly and maintenance of the cilia; while molecular chaperones include BBS6, BBS10, and BBS12, which regulate the assembly of BBSome \u003csup\u003e[\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e–\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. The abnormal function of these genes and their products underlie the occurrence and development of BBS.\u003c/p\u003e\u003cp\u003eIn this paper, we report a male patient with Bardet-Biedl syndrome (BBS) harboring two novel mutations in the BBS10 gene (c.83_84delinsAG, p.Cys28Ter and c.1063C \u0026gt; T, p.Gln355Ter). The detailed clinical characterization of this case not only expands the genetic spectrum of BBS but also facilitates early diagnosis and deepens the clinical understanding of this disorder.\u003c/p\u003e"},{"header":"METHODS","content":"\u003cp\u003e1. Research Objective\u003c/p\u003e\u003cp\u003eThe patient is a 23-year-old, married Han Chinese male. On August 25, 2023, he presented to the Department of Medical Genetics at Luoyang Maternal and Child Health Hospital, Henan Province, seeking pre-pregnancy genetic counseling due to intellectual disability in both partners within one year of marriage. A detailed clinical evaluation was performed, including assessment of family history, personal history, and consanguinity. Clinical data encompassing medical history, physical examination, laboratory investigations, and imaging studies were collected. Genetic testing was initiated by collecting 2 mL of peripheral venous blood from the patient for genomic DNA extraction and subsequent screening for candidate pathogenic variants. The study protocol received approval from the Medical Ethics Committee of Luoyang Maternal and Child Health Hospital, and the patient provided written informed consent.\u003c/p\u003e\u003cp\u003e2. Genomic DNA extraction and whole exome sequencing\u003c/p\u003e\u003cp\u003eThe xGen™ ExomeResearchPanelv1 (Exomev1) capture kit developed by IDT was designed to cover the DNA sequences of the coding regions of 19,396 genes, with a target region range of 39M. It is designed to detect point mutations and insertion-deletion mutations within 20 bp in small fragments. The method mainly targets the exon region of the gene, and is mainly applicable to point mutations and insertion-deletion mutations (MicroIn/Dels) within 20bp, and does not target the analysis of specific pathogenic mechanisms such as methylation modification, RNA transcription, or protein expression. The specific steps were as follows: (1) DNA extraction was performed using the Tengen Magnetic Bead Method Blood Genomic DNA Extraction Kit and the Tengen Automatic Nucleic Acid Extractor. (2) Genomic DNA was interrupted using fragmentation enzymes from Enzymatic, with fragment lengths of 250–300 bp. (3) Amplification of the libraries was performed using the enzyme KAPAHiFiReadyMix (KAPA Corporation). (4) Whole exon capture was performed using the IDTxGenExomeResearchPanelv1.0 capture kit. (5) Library concentration (concentration ≥ 10ng/ul) was detected using Qubit4.0 and Qubit™dsDNAHSAssayKit, and library fragment length (300bp ~ 550bp) was detected using QSeq400 fragment analyser. (6) Online sequencing of the library. Sequencing was performed using NovaSeq6000 equipment from Illumnia, PE150 (read length 150bp) mode sequencing, the output data was about 10G, the average sequencing depth of the target region of whole exome sequencing was greater than 100X, and 95% of the target sequences were sequenced up to a depth of 20X.\u003c/p\u003e\u003cp\u003e3. Bioinformatics analysis and data screening\u003c/p\u003e\u003cp\u003eThe sequencing data analysis process mainly includes sequencing data quality control, data pre-processing, sequence comparison, format conversion and sequencing de-duplication, local re-comparison, base correction, variant analysis, variant interpretation, etc., to be able to explain the variability of the patient's abnormal phenotype. The specific operation steps are as follows: the downstream data are FSATQ files. Into the raw letter analysis process, using fastp software (version number: 0.21.0) data filtering, bwa software (version number: 0.7.17-r1198-dirty) data comparison, using the public dbsnp159 for data correction, using samtoolsdepth (version number: 1.3.1 (usinghtslib1.3. 1)) to count the sequencing depth of the data, and gatkDepthOfCoverage to count the bed file region coverage, 20X sequencing depth, and so on. Variants were called using gatk3.8. mosdepth0.2.5 software was used for GC content statistics. Point mutations were annotated using Annovar software (version number: 2020-06-0800:46:07-0400), and further annotation parsing was done in conjunction with local databases such as HGMD databases, HPOs, and internal carryover. The detected variants were classified according to the American College of Medical Genetics (ACMG) genetic variant classification criteria as \"pathogenic\", \"probably pathogenic\" and \"of uncertain significance\".\u003c/p\u003e\u003cp\u003e4. Sanger sequencing validation and protein secondary structure prediction\u003c/p\u003e\u003cp\u003eBased on the variant sites obtained from the whole exome detection of the patients, PCR primers for sequencing were designed and synthesized, DNA was amplified, the products were purified, and Sanger sequencing was carried out using an ABI sequencer. The sequence of BBS10 amplification primers is as follows, forward sequence 1:CAGGAAACAGCTATGACCTACGCATCGCCTCAGGATGGG, reverse sequence 1:TGTAAAACGACGGCCAGTTCTGCCTTCGCGTACAACGG, and forward sequence 2:CAGGAAACAGCTATGACCTTGGTCATTGGTTTGTGTCATGTAA, reverse sequence 2: TGTAAAACGACGGCCAGTTTTCCACTTCTGGATCAGAGTTTATTC. PCR amplification conditions: 95°C for 3min; 95°C for 30s, 30 cycles; 58°C for 30s; 72°C for 30s; 72°C for 3min. based on the results to find the reference sequences by\" MutationSurveyor\" analysis software was used to compare the sequencing results with the reference sequences. The secondary structure of the BBS10 protein was predicted using the SWISSMODEL protein structure modeling tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.swissmodel.expasy.org\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.swissmodel.expasy.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e1. Clinical symptoms\u003c/p\u003e\u003cp\u003eThe patient was born at term, with birth weight (unknown), obese since childhood, and with rapid postnatal weight gain. He was unresponsive compared to his peers was unable to complete his schooling, and did not attend school after primary school. At the age of 9 years, he began to experience a gradual loss of vision in both eyes, and at the time of presentation, his vision in both eyes was \u0026lt;\u0026thinsp;0.1. He reported that he had a polydactyly (six toes) on the lateral aspect of the fifth toes of both hands and feet, which was surgically excised at the age of 16 years. There was no history of similar disease in the family, a family history of hereditary disease was denied, and the parents were not consanguineous. On examination, he was 167 cm tall, weighed 83 kg, had a blood pressure of 138 mmHg/87 mmHg, was obese, had a full-moon face, had no polycythemia, no purple lines, no cranial deformities, no abnormalities of the ears, nose, or mouth, and no abnormal signs of the heart, lungs, or abdomen. The fingers and toes of both hands were stubby, and a polydactyl ectomy scar was seen on both hands and the lateral side of the fifth toe of both feet (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The patient had no other clinical manifestations such as abnormal gonadal development, neurological abnormalities, or cardiovascular abnormalities.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e2. Analysis of sequencing results\u003c/p\u003e\u003cp\u003eWe performed whole exome sequencing on the patient. The results showed that the causative gene as well as the mutation locus in this patient was BBS10\u003c/p\u003e\u003cp\u003ec.83_84delinsAG and c.1063C\u0026thinsp;\u0026gt;\u0026thinsp;T mutations; mutation c.83_84delinsAG, p.C28X, located at position\u0026thinsp;+\u0026thinsp;83_+84 of Exon1, with GC deletion of base c.83_84 and insertion of base AG, and mutation of the amino acid cysteine at amino acid position 28 from C to termination codon (X). The mutation c.1063C\u0026thinsp;\u0026gt;\u0026thinsp;T,p.Q355X, located within Exon2, mutates the base at c.1063 from C to T, and the amino acid glutamine (Q) at amino acid position 355 is mutated to the termination codon (X). We hypothesized that a truncated expressed protein would be produced and the normal function of the BBS10 protein would be lost. No mutations were found in the other genes in the test results. We then sequenced exon 1\\2 of the BBS10 gene in 30 local normal populations, the c.83_84delinsAG and c.1063C\u0026thinsp;\u0026gt;\u0026thinsp;T mutations were not found in any of them. The chromosomal location of c.83_84delinsAG mutation is chr12:76742056 (genome version: hg19), transcript NM_024685, in exon 1. It is a nonsense mutation. It is not included in the HGMD Professional database and there are 2 cases included in the Clinvar database (1 pathogenic,1 likelypathogenic). The population frequency of this locus is not available. It is not included in the East Asian population in the gnomAD database. Referring to the ACMG Mutation Interpretation Guidelines, this locus meets 2 lines of evidence (PVS, PM2_Supporting) and is graded as Likely pathogenic. The chromosomal location of c.1063C\u0026thinsp;\u0026gt;\u0026thinsp;T mutation is chr12:76740702 (genome version: hg19), and the transcript NM_024685, is located in exon 2. It is a nonsense mutation. It is listed as DM in the HGMD Professional database \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e and not listed in the Clinvar database. The population frequency of this locus is not included. It is not included in the East Asian population in the gnomAD database. Referring to the ACMG Mutation Interpretation Guidelines, this locus meets 2 pieces of evidence (PVS_Strong, PM2_Supporting) and is graded as Uncertainsignificance.\u003c/p\u003e\u003cp\u003eSanger sequencing validation showed that the patient had a c.83_84delinsAG, c.1063C\u0026thinsp;\u0026gt;\u0026thinsp;T compound heterozygous mutation in the gene BBS10, which was consistent with the whole exome assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Sequence conservation was predicted by GERP and other software, and the sequence was compared with several species, which showed that the sequence sequence consistency was high and highly conserved, with potential functional impacts. MutationTaster predicted that both mutations were \"deleterious\", suggesting that the amino acid sequence might be altered and the structure of the protein might be affected, which might lead to \"NMD\". After bioinformatics prediction, both mutations could change the secondary structure of the BBS10 protein, and it was found that the structure of the mutated BBS10 protein was different from that of the wild-type protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and B). (The two-dimensional structure could not be predicted because the c.83_84delinsAG mutation resulted in only 28 amino acids). The protein encoded by the BBS10 gene contains the apical structural domain, the intermediate structural domain, and the equatorial structural domain, which are conserved in BBS proteins, and the analyses by Prosite showed that both mutations were able to lead to the deletion of the intermediate structural domain, the equatorial structural domain and the partial apical structural domain deletion, predicting that this mutation affects the protein function. The mutation is an important cause of the patient's morbidity.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eBardet-Biedl syndrome is a primary ciliary dysfunction disorder due to genetic mutations \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. The BBS proteins encoded by the relevant genes (BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9, and BBS18) can form the BBSome complex, which is involved in the formation of cilia or the transciliary transport of some specific proteins, such as the G protein-coupled receptor and growth inhibitory hormone receptor, whereas the complexes consisting of BBS6, BBS10, and BBS12 are BBSome complex is a necessary chaperone protein complex during the formation of the BBSome complex \u003csup\u003e[\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Mutations in BBS-related genes can cause non-motor cilia dysfunction, which often involves multiple organ systems, and can exhibit a variety of clinical symptoms, which may vary greatly between patients. Currently, the prevalence of BBS in China is unclear, with fewer cases reported \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e, and the age at diagnosis is significantly older than that reported abroad, which may be related to the lack of awareness of the disease, etc. Clinical diagnosis of BBS requires compliance with either four main symptoms or three main symptoms and two secondary symptoms. The main features include retinal degeneration, obesity, polydactyly, abnormal gonadal development, mental retardation and renal abnormalities. The incidence, age of onset, and progression of symptoms vary. The most common symptom is retinal degeneration, seen in 80\u0026ndash;100% of cases \u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. The clinical presentation is a gradual onset of night blindness followed by photophobia and loss of central vision and color vision \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. The mean age of patients reporting night blindness is 8.5 years \u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Cataracts and refractive errors are also common. Obesity is another major clinical manifestation with a prevalence of 72 to 86 percent. Although adult obesity tends to favor the trunk, it appears to be generalized and diffuse in childhood.\u003c/p\u003e\u003cp\u003eIn this case study, the patient exhibited obesity, polydactyly/polydactyly, eye abnormalities, and mental retardation, etc. We identified a specific mutation in the BBS10 gene (c.83_84delinsAG, c.1063C\u0026thinsp;\u0026gt;\u0026thinsp;T) as a key factor contributing to the patient's development of Bardet-Biedl syndrome (BBS). This finding not only validates the mode of inheritance of BBS as an autosomal recessive disorder but also highlights the central role of BBS-related genes in cilia structure and function. Mutations in the BBS10 gene, one of the many BBS-causing genes, reveal the complexity of the genetic heterogeneity of the disease. Mutations in different genes may affect cilia function through similar or different pathways, leading to similar clinical symptoms, which provides a rich perspective for understanding the full picture of the disease.\u003c/p\u003e\u003cp\u003eBBS10 protein, as an important component of the cilium base, its functional integrity is critical for cilia formation, maintenance, and signaling. BBS10 protein has a chaperonin_likedomain functional structural domain, which is 723aa in length, and the mutations we identified, c.83_84delinsAGp.C28X and mutation c.1063C\u0026thinsp;\u0026gt;\u0026thinsp;Tp.Q355X are both located in the retrieved chaperonin_likedomain. It suggests that mutations in the BBS10 gene lead to abnormal function of the BBS10 protein, which in turn affects the normal function of cilia. This effect may involve multiple levels, including protein stability, localization, and interaction with other cilia-associated proteins. These abnormalities ultimately lead to dysfunction of cells in multiple systems, including retinal cells, adipocytes, renal cells, and gonadal cells, which triggers the complex clinical manifestations of BBS.\u003c/p\u003e\u003cp\u003eDespite a more in-depth understanding of the genetic basis and clinical manifestations of BBS in recent years, treatments for the disease are still very limited.BBS is mainly treated symptomatically. Rational diet and exercise are recommended for early intervention as retinopathy in BBS starts early and progresses rapidly, with a significant risk of blindness. Management of renal function is particularly important as abnormal renal structure or function is the leading cause of death in this disease. Rehabilitation is recommended for patients with mental retardation and developmental delays. Some gonadal dysgenesis and polydactyly problems can be corrected surgically. However, these methods only relieve symptoms and do not cure the disease at its root. New interventions for BBS gene therapy such as exon skipping therapy, nonsense suppression therapy, gene editing, and other non-genetic therapies are also being studied \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. For consanguineous families, both renal polycystic lesions and polydactyly may be detected by prenatal ultrasound, and genetic screening of routine prenatal ultrasound items and special abnormalities detected may provide a reference for prenatal diagnosis of BBS and genetic counseling of the family line.\u003c/p\u003e\u003cp\u003eDespite the remarkable progress made in recent years in the study of the genetics and pathogenesis of BBS, there are still many questions that need to be further explored. For example, how do mutations in different BBS genes lead to similar clinical manifestations? How does ciliary dysfunction trigger such complex multi-system symptoms? Answers to these questions will help us understand the pathogenesis of BBS more comprehensively and provide new ideas and approaches for the diagnosis and treatment of the disease. Future research should continue to focus on the following aspects: first, to strengthen gene-phenotype association studies and establish more accurate genotype and phenotype prediction models; second, to make use of advanced molecular and cellular biology techniques to explore in depth how mutations in BBS-related genes affect the processes of cilia function, signaling, and cellular metabolism; and third, to carry out large-scale clinical studies and international collaborations to accumulate more Thirdly, to carry out large-scale clinical research and international cooperation to accumulate more case data and experience, and to promote precision medicine and individualized treatment of BBS. In summary, Bardet-Biedl syndrome, as a rare autosomal recessive hereditary disease, poses a serious challenge to the medical community with its complex clinical manifestations and genetic mechanisms. However, with the continuous progress of science and technology and in-depth research, we have reason to believe that more effective treatments can be found and the quality of life of patients can be improved in the future. In this paper, we report the discovery of two novel mutations in the BBS10 gene (c.83_84delinsAG,p.C28X, and c.1063C\u0026thinsp;\u0026gt;\u0026thinsp;Tp.Q355X ) in a BBS patient. Enriching the mutation spectrum of the BBS10 gene. It suggests that whole exome sequencing is of great importance in confirming the diagnosis of BBS patients with atypical symptoms.\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eIn this study, we successfully identified two novel mutations in the BBS10 gene of Chinese BBS patient, providing new genetic resources for genetic studies and clinical diagnosis of BBS. This finding highlights the importance of whole exome sequencing in identifying the causative genes of rare genetic diseases and provides new clues for an in-depth understanding of the pathogenesis of BBS.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eBBS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eBardet-Biedl syndrome\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePCR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePolymerase chain reaction\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eHGMD\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eHuman Gene Mutation Database\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eACMG\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eAmerican College of Medical Genetics\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eI confirm that all methods were performed in accordance with the relevant guidelines and regulations. The patient signed an informed consent form. And the study was approved by the Ethics Committee of Medical Genetics and Prenatal Diagnosis of Luoyang Maternal and Child Health Hospital. The ethic number is LYFY-YCCZ-2024006.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInformed consent was obtained from the patient to publish the information and image in an online open-access publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing financial interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Department of Genetics and Prenatal Diagnosis of the Luoyang Maternal and Child Health Hospital. The funding agency did not participate in the design or implementation of this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZP designed this work, WYN and CYQ performed sequencing and analysis, ZWW prepared figures, and ZP wrote the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank all the participants and the staff for their valuable contribution to this research.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHrynchak PK. Bardet-Biedl syndrome. Optom Vis Sci. 2000;77(5):236\u0026thinsp;\u0026ndash;\u0026thinsp;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/00006324-200005000-00010\u003c/span\u003e\u003cspan address=\"10.1097/00006324-200005000-00010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 10831213.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBeales PL, Elcioglu N, Woolf AS, Parker D, Flinter FA. New criteria for improved diagnosis of Bardet-Biedl syndrome: results of a population survey. J Med Genet. 1999;36(6):437\u0026ndash;46. PMID: 10874630; PMCID: PMC1734378.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIannello S, Bosco P, Cavaleri A, Camuto M, Milazzo P, Belfiore F. A review of the literature of Bardet-Biedl disease and report of three cases associated with metabolic syndrome and diagnosed after the age of fifty. Obes Rev. 2002;3(2):123\u0026thinsp;\u0026ndash;\u0026thinsp;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1046/j.1467-789x.2002.00055.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1467-789x.2002.00055.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 12120419.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM'hamdi O, Ouertani I, Chaabouni-Bouhamed H. Update on the genetics of bardet-biedl syndrome. Mol Syndromol. 2014;5(2):51\u0026thinsp;\u0026ndash;\u0026thinsp;6. doi: 10.1159/000357054. Epub 2013 Dec 20. PMID: 24715851; PMCID: PMC3977223.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSuspitsin EN, Imyanitov EN, Bardet-Biedl S. Mol Syndromol. 2016;7(2):62\u0026ndash;71. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1159/000445491\u003c/span\u003e\u003cspan address=\"10.1159/000445491\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2016 Apr 15. PMID: 27385962; PMCID: PMC4906432.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJanssen S, Ramaswami G, Davis EE, Hurd T, Airik R, Kasanuki JM, Van Der Kraak L, Allen SJ, Beales PL, Katsanis N, Otto EA, Hildebrandt F. Mutation analysis in Bardet-Biedl syndrome by DNA pooling and massively parallel resequencing in 105 individuals. Hum Genet. 2011;129(1):79\u0026ndash;90. Epub 2010 Oct 30. PMID: 21052717; PMCID: PMC3646619.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFarag TI, Teebi AS. High incidence of Bardet Biedl syndrome among the Bedouin. Clin Genet. 1989;36(6):463-4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1399-0004.1989.tb03378.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1399-0004.1989.tb03378.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 2591073.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHeon E, Kim G, Qin S, Garrison JE, Tavares E, Vincent A, Nuangchamnong N, Scott CA, Slusarski DC, Sheffield VC. Mutations in C8ORF37 cause Bardet Biedl syndrome (BBS21). Hum Mol Genet. 2016;25(11):2283\u0026ndash;94. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/hmg/ddw096\u003c/span\u003e\u003cspan address=\"10.1093/hmg/ddw096\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2016 Mar 22. PMID: 27008867; PMCID: PMC5081059.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBeales PL, Badano JL, Ross AJ, Ansley SJ, Hoskins BE, Kirsten B, Mein CA, Froguel P, Scambler PJ, Lewis RA, Lupski JR, Katsanis N. Genetic interaction of BBS1 mutations with alleles at other BBS loci can result in non-Mendelian Bardet-Biedl syndrome. Am J Hum Genet. 2003;72(5):1187\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1086/375178\u003c/span\u003e\u003cspan address=\"10.1086/375178\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2003 Apr 3. PMID: 12677556; PMCID: PMC1180271.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSeo S, Zhang Q, Bugge K, Breslow DK, Searby CC, Nachury MV, Sheffield VC. A novel protein LZTFL1 regulates ciliary trafficking of the BBSome and Smoothened. PLoS Genet. 2011;7(11):e1002358. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pgen.1002358\u003c/span\u003e\u003cspan address=\"10.1371/journal.pgen.1002358\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2011 Nov 3. PMID: 22072986; PMCID: PMC3207910.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSeo S, Baye LM, Schulz NP, Beck JS, Zhang Q, Slusarski DC, Sheffield VC. BBS6, BBS10, and BBS12 form a complex with CCT/TRiC family chaperonins and mediate BBSome assembly. Proc Natl Acad Sci U S A. 2010;107(4):1488\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.0910268107\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0910268107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2010 Jan 4. PMID: 20080638; PMCID: PMC2824390.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu X, Tao T, Zhao L, Li G, Yang L. Molecular diagnosis based on comprehensive genetic testing in 800 Chinese families with non-syndromic inherited retinal dystrophies. Clin Exp Ophthalmol. 2021;49(1):46\u0026ndash;59. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/ceo.13875\u003c/span\u003e\u003cspan address=\"10.1111/ceo.13875\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020 Nov 2. PMID: 33090715.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHildebrandt F, Benzing T, Katsanis N, Ciliopathies. N Engl J Med. 2011;364(16):1533\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1056/NEJMra1010172\u003c/span\u003e\u003cspan address=\"10.1056/NEJMra1010172\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 21506742; PMCID: PMC3640822.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLoktev AV, Zhang Q, Beck JS, Searby CC, Scheetz TE, Bazan JF, Slusarski DC, Sheffield VC, Jackson PK, Nachury MV. A BBSome subunit links ciliogenesis, microtubule stability, and acetylation. Dev Cell. 2008;15(6):854\u0026thinsp;\u0026ndash;\u0026thinsp;65. doi: 10.1016/j.devcel.2008.11.001. PMID: 19081074.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWei Q, Zhang Y, Li Y, Zhang Q, Ling K, Hu J. The BBSome controls IFT assembly and turnaround in cilia. Nat Cell Biol. 2012;14(9):950\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ncb2560\u003c/span\u003e\u003cspan address=\"10.1038/ncb2560\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2012 Aug 26. PMID: 22922713; PMCID: PMC3434251.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNachury MV, Loktev AV, Zhang Q, Westlake CJ, Per\u0026auml;nen J, Merdes A, Slusarski DC, Scheller RH, Bazan JF, Sheffield VC, Jackson PK. A core complex of BBS proteins cooperates with the GTPase Rab8 to promote ciliary membrane biogenesis. Cell. 2007;129(6):1201-13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2007.03.053\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2007.03.053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 17574030.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTao T, Wang L, Chong W, Yang L, Li G. Characteristics of genotype and phenotype in Chinese patients with Bardet-Biedl syndrome. Int Ophthalmol. 2020;40(9):2325\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10792-020-01415-3\u003c/span\u003e\u003cspan address=\"10.1007/s10792-020-01415-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020 May 24. PMID: 32448990.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChakrabarty S, Savantre SB, Ramachandra Bhat C, Satyamoorthy K. Multiple genetic mutations implicate spectrum of phenotypes in Bardet-Biedl syndrome. Gene. 2020;725:144164. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.gene.2019.144164\u003c/span\u003e\u003cspan address=\"10.1016/j.gene.2019.144164\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2019 Oct 19. PMID: 31639430.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMahmood SH, Khan M, Qadar LT, Yousuf F, Hasan M. A Unique Manifestation of Bardet-Biedl Syndrome with Otolaryngologic Symptoms and Bronchopneumonia in a One-year-old Girl. Cureus. 2019;11(9):e5717. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7759/cureus.5717\u003c/span\u003e\u003cspan address=\"10.7759/cureus.5717\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 31720185; PMCID: PMC6823080.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShrestha S, Chaudhary N. A rare case of obesity. Can it be Bardet-Biedl Syndrome? Clin Case Rep. 2019;7(9):1725\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ccr3.2356\u003c/span\u003e\u003cspan address=\"10.1002/ccr3.2356\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 31534736; PMCID: PMC6745398.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eForsythe E, Kenny J, Bacchelli C, Beales PL. Managing Bardet-Biedl Syndrome-Now and in the Future. Front Pediatr. 2018;6:23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fped.2018.00023\u003c/span\u003e\u003cspan address=\"10.3389/fped.2018.00023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 29487844; PMCID: PMC5816783.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Bardet-Biedl syndrome (BBS), Rare disease, Whole exome sequencing, Nonsense mutation, BBS10 gene","lastPublishedDoi":"10.21203/rs.3.rs-6824032/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6824032/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eBardet-Biedl syndrome (BBS) is a heterogeneous autosomal recessive disorder characterized by retinitis pigmentosa, obesity, and polydactyly as cardinal features. This study aimed to characterize the clinical manifestations and genetic basis in a Chinese patient with BBS.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eThe study subject was a 23-year-old Han Chinese male who presented to the Maternal and Child Health Hospital of Luoyang City, Henan Province, seeking pre-pregnancy counseling. The patient had a history of obesity since childhood, progressive bilateral vision loss, and polydactyly affecting both hands and feet. A detailed medical history was obtained, and physical examination, laboratory tests, and radiological imaging were performed. Peripheral venous blood was collected for whole-exome sequencing (WES) to screen for candidate pathogenic mutations.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eWhole-exome sequencing (WES) identified two novel mutations in the BBS10 gene: c.83_84delinsAG (p.Cys28Ter) in exon 1 and c.1063C\u0026thinsp;\u0026gt;\u0026thinsp;T (p.Gln355Ter) in exon 2. Both are nonsense mutations predicted to result in a truncated protein and loss of function. Sanger sequencing confirmed both variants.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eIn this study, we successfully identified two novel mutations in the BBS10 gene in a Chinese patient with BBS, expanding the mutational spectrum of the disorder and providing new genetic variants for BBS research and clinical diagnosis. This finding underscores the utility of whole-exome sequencing (WES) in pinpointing disease-causing mutations in rare genetic disorders and offers novel insights into the pathogenesis of BBS.\u003c/p\u003e","manuscriptTitle":"Clinical and Genetic Analysis of a Compound Heterozygous Mutation in the BBS10 Gene in Chinese People With Bardet Biedl syndrome","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-17 00:30:59","doi":"10.21203/rs.3.rs-6824032/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"47dacee5-9c0c-4e90-b78a-ed2849b328ac","owner":[],"postedDate":"July 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-04T18:35:45+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-17 00:30:59","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6824032","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6824032","identity":"rs-6824032","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}