Bifidobacterium animalis BD400 alleviates collagen-induced arthritis through branched-chain amino acids (BCAAs) and ubiquinone biosynthesis

Bifidobacterium animalis BD400 alleviates collagen-induced arthritis through branched-chain amino acids (BCAAs) and ubiquinone biosynthesis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Bifidobacterium animalis BD400 alleviates collagen-induced arthritis through branched-chain amino acids (BCAAs) and ubiquinone biosynthesis Yang Yang, Qing Hong, Xuehong Zhang, Zhenmin Liu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4767166/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Rheumatoid arthritis (RA) is a common chronic and systemic autoimmune disease. Numerous clinical studies have indicated a correlation between alterations in gut microbiota and the onset and progression of RA. As a result, this research aims to restore intestinal microbiota to a healthy state through the oral administration of Bifidobacterium in the early stages with the goal of delaying the onset and progression of RA. Results The findings reveal that administering Bifidobacterium animalis BD400 orally led to a significant reduction in arthritis clinical scores and paw swelling thickness in CIA rats. Additionally, there was a decrease in osteo-facial fusion and calcified cartilage thickening in the knee joint. Furthermore, the oral administration of B. animalis BD400 resulted in the down-regulation of inflammatory factors TNF-α and collagenase MMP-13 in the knee joint. Levels of specific antibodies (anti-CII IgG, anti-CII IgG1, and anti-CII IgG2a) and cytokine IL-17A in serum, as well as cytokines (TNF-α and IL-1β) in the synovial fluid of B. animalis BD400-treated CIA rats, were significantly reduced ( p < 0.05). The gene expression levels of intestinal barrier proteins (occludin-1, MUC-2, and ZO-1) showed a significant increase ( p < 0.05) in B. animalis BD400-treated CIA rats. The oral administration of B. animalis BD400 altered the composition of intestinal microorganisms in CIA rats at the phylum and genus levels, particularly affecting the genus HT002. Conclusions B. animalis BD400 alleviates RA by down-regulating 2-ketobutyric acid and pyruvate in the biosynthesis of branched-chain amino acids, as well as down-regulating 4-hydroxyphenyl-pyruvate in the biosynthesis of ubiquinone and other terpenoid-quinone, laying a foundation for the RA clinical treatment of probiotics. Rheumatoid arthritis Bifidobacterium Gut microbiota Metabolomics Probiotics therapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 1. Introduction Rheumatoid arthritis (RA) is an autoimmune disease characterized by persistent synovial inflammation, cartilage and bone damage, and potential disability[ 1 ]. The global prevalence rates of RA range from 0.5–1.0%[ 1 ], with lower rates in China at 0.2–0.3%[ 2 ]. RA is more common in females than in males[ 3 ]. While the exact pathogenesis of RA remains unclear, certain risk factors such as family history, smoking, air pollution, periodontitis, and hormonal factors are associated with an increased likelihood of developing the disease[ 4 ]. Studies have shown that RA patients exhibit distinct alterations in gut microbiota compared to healthy individuals[ 5 , 6 ], which may contribute to systemic immune dysregulation[ 7 , 8 ]. Different strains of gut bacteria can have varying effects on immune system function, potentially influencing the development of RA[ 9 ]. Disease-modifying anti-rheumatic drugs (DMARDs) are commonly used in RA treatment and may indirectly impact gut microbiota composition to modulate systemic immunity[ 9 ]. Considering this therapeutic approach, there is interest in exploring whether early intervention targeting gut microbiota, such as probiotics, could potentially prevent the onset of RA. Probiotics are defined as “live microorganisms that, when administered in adequate amounts, confer a health benefit on the host”[ 10 ]. Probiotics can inhibit the growth of pathogenic bacteria by competing for nutrition and colonization sites. Meanwhile, metabolites of probiotics can strengthen the intestinal barrier and modulate the host immune responses[ 11 ]. Three strains of Lactobacillus acidophilus , Lactobacillus casei , Bifidobacterium bifidum were provided for RA patients in a randomized, double-blind, placebo-controlled trial[ 12 ]. After 8 weeks, RA patients receiving these probiotics showed improvement in Disease Activity Score of 28 joints (DAS-28) from − 0.3 ± 0.4 to -0.1 ± 0.4. Furthermore, insulin levels, homeostatic model assessment-B cell function (HOMA-B), and serum high-sensitivity C-reactive protein (hs-CRP) concentrations decreased significantly, along with improvements in total and low-density lipoprotein-cholesterol levels[ 12 ]. Given that most studies involve mixed strains of probiotics, the specific effects of a single strain, such as Bifidobacterium , remain unclear. While Bifidobacterium is known for its health benefits, further research is needed to determine if a single strain can replicate the effects of mixed probiotics. This study aims to restore the altered gut microbiota in RA patients to a healthy state through oral administration of Bifidobacterium , effectively slowing the onset and progression of RA. Clinical scores for arthritis and paw swelling thickness were used to assess arthritis symptoms, while bone damage severity was determined through knee joint pathology and staining in rats. Immune response was evaluated by measuring specific antibodies and cytokines in serum and synovial fluid. The expression of intestinal barrier proteins was analyzed using qPCR to assess intestinal barrier damage. Changes in gut microbiota composition and diversity were assessed through 16S high-throughput sequencing, and metabolomics was used to analyze metabolite production and associated pathways in rat feces. The findings of this study offer valuable insights for the potential use of probiotics in the clinical management of RA. 2. Materials and methods 2.1. Materials Bovine type II collagen solution, complete Freund`s adjuvant and incomplete Freund`s adjuvant were purchased from Chondrex (Redmon, WA, USA). Methotrexate (MTX) was purchased from Shanghai Yuanye Bio-Technology Co. (Ltd, Shanghai, China). Anti-TNF-α antibody and anti-MMP-13 antibody were purchased from Abcam (Cambridge, United Kingdom). Total CⅡ-IgG ELISA assay kit, CⅡ-IgG1 ELISA assay kit, CⅡ-IgG2a ELISA assay kit and CⅡ-IgG2b ELISA assay kit were purchased from Shanghai MuLuan Biological Technology Co. (Ltd, Shanghai, China). Rat TNF-α ELISA assay kit, rat IL-1β ELISA assay kit and rat IL-17A ELISA assay kit were purchased from Hangzhou Lianke Biotechnology Co. (LTD, Hangzhou, China). 2.2. Bacterial strain All the probiotics, listed in Table 1 , were deposited at State Key Laboratory of Dairy Biotechnology. The twenty strains were cultured in DeManRogosa-Sharpe (MRS) medium at 37°C overnight, and were harvested by centrifugation at 5000g for 10 min at 4°C. The bacterial precipitate was washed twice with saline. The concentration of each strain was re-suspended at 5 × 10 8 CFU/mL in saline, and stored at − 80°C prior to use. The viability of all the probiotics suspensions was measured by colony counting before daily oral administration. Table 1 Probiotics used in this study Group Strains Origin Bifidobacterium B. longum BD3150 Tibet feces B. animalis BD400 Granted B. longum BD6256 (PP4) Long-lived people feces B. bifidum BD5348 Healthy human (1–3 years old) B. breve BB12 Granted 2.3. Animals and the experiment design Female Wistar rats (7–8 week-old) (Shanghai SLAC Laboratory Animal Ltd, Shanghai, China) were allowed to acclimatize for seven days before experimentation. The rats were given free access to food and water specific pathogen-free (SPF) standard laboratory conditions at 25 ± 2 ℃ and humidity of 50% ± 5%, with a 12 h light-dark cycle. This study was carried out in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals in China. Ethical approval for this study was obtained from Animal Ethics Committee of Shanghai Zhanyuan Biological Technology Co., LTD (approval No. 202306261). 2.4. Collagen-induced arthritis and treatment The collagen-induced arthritis (CIA) animal model is the most commonly studied autoimmune model of rheumatoid arthritis. CIA was induced and assessed according to the previous method[ 13 ]. Briefly, bovine type II collagen solution (CII, Chondrex, Redmon, WA, USA) were emulsified with complete Freund’s adjuvant (CFA, Chondrex, Redmon, WA, USA) at a ratio of 1:1, and 150 ml emulsion were injected subcutaneously into the tail root of each rat for multi-point immunization at day 1. After seven days, bovine type II collagen solution (CII, Chondrex, Redmon, WA, USA) were emulsified with incomplete Freund’s adjuvant (IFA, Chondrex, Redmon, WA, USA) at a ratio of 1:1, and 150 ml emulsion were injected into the tail root of each rat for a booster immunization. The control rats were subcutaneously injected with 150 ml sterile saline. The experimental rats were subcutaneously injected with same volume of probiotic liquid. The experimental schedule is as Fig. 1 . 2.5. Assessment of CIA-associated symptoms During the experiment, the weight of the rats was measured weekly. Since the arthritic symptoms developed at paw and joint, the paws thickness was measured using calipers and the severity of symptoms was assessed by an arthritis clinical score following the method described previously[ 13 ]. The quantitative clinical score is as follows: 0, no signs of erythema and swelling; 1, erythema and mild swelling limited to the tarsal bone or ankle joint; 2, erythema and mild swelling extending from the ankle joint to the tarsal bone; 3, Erythema and moderate swelling extending from the ankle joint to the metatarsal joint; 4, erythema and severe swelling of the ankles, feet, and fingers, or stiffness of the limbs. 2.6. Histopathology analysis Clinical condition and symptoms of each rat were evaluated by histological analysis with haematoxylin and eosin (H&E) and safranin O-fast green staining. Briefly, the joints were fixed in 10% formalin for 48 h, decalcified in 10% EDTA for 30 days, and embedded in paraffin. Tissue sections (5 µm thick) in the sagittal direction along the long axis of the knee were stained using H&E and safranin O-fast green staining. 2.7. Immunofluorescent staining Formalin-fixed paraffin-embedded samples (5 µm thick) were deparaffinized and retrieved with bone tissue antigen retrieval solution was in a wet box at 37 ℃ for 2 h. After sealed at room temperature for 1 h, samples were then incubated with the primary antibody (anti TNF-α and anti MMP-13, respectively) (Abcam, Cambridge, UK) at 4 ℃ overnight, followed by reaction with goat anti-rabbit secondary antibody (FITC) (Abcam, Cambridge, UK) at room temperature for 1 h in the dark. After washing, 4`,6-diamidino-2-phenylindole (DAPI) was applied for re-dyeing and incubated at room temperature for 5 min in the dark, and then the sample was sealed and observed under fluorescence microscope. 2.8. Measurement of collagen-specific IgG and inflammatory factors by ELISA in serum and joint fluid Total Ⅱ collagen-specific IgG (CⅡ-IgG), and its subclasses CⅡ-IgG1, CⅡ-IgG2a and CⅡ-IgG2b were detected by ELISA kits according to the manufacturer`s instructions. Inflammatory factors interleukin-1β (IL-1β), interleukin-17A (IL-17A) and tumor necrosis factor-α (TNF-α) in serum and synovial fluid were detected using an ELISA kit according to the manufacturer’s instructions (Hangzhou LianKe Biological Technology Co., Ltd, Hangzhou, China). OD values were measured by ELIASA. 2.9. Quantitative real-time PCR The transcription levels of ZO-1 and Occludin in rat ileum were measured via qPCR. Total RNA from rat ileum tissue was extracted using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA). Then, total RNA was analyzed as described previously[ 14 ]. The primers used are shown in Table 1 . Analysis of each sample was repeated three times. β-actin RNA was used as the endogenous control. Table 1 Primers used in quantitative real-time PCR Genes Primer Sequence (5`-3`) β-actin Forward primer: TCAGGTCATCACTATCGGCAAT Reverse primer: AAAGAAAGGGTGTAAAACGCA ZO-1 Forward primer: TTTTTGACAGGGGGAGTGG Reverse primer: TGCTGCAGAGGTCAAAGTTCAAG Occludin-1 Forward primer: GTCTTGGGAGCCTTGACATCTT Reverse primer: GCATTGTCGAACGTGCATC Claudin-1 Forward primer: GGGACAACATCGTGACTGCT Reverse primer: CCACTAATGTCGCCAGACCTG MUC-2 Forward primer: AGATCCCGAAACCATGTC Reverse primer: GTTCCACATGAGGGAGAGG 2.10. Analysis of the microbial community Fecal samples were collected at the end of the experiment and stored at − 80°C. Total fecal DNA was extracted using the TIANamp Bacteria DNA Kit (TIANGEN Biotech, Beijing, China) according to the manufacturer’s instructions. The V3-V4 region of 16S rDNA was amplified using primer set 341F/806R and sequenced using a MiSeq sequencer (Illumina, San Diego, CA, USA). The microbial communities were further predicted by PICRUSt. 2.11. Fecal metabolomics 2.11.1. Metabolites Extraction The fecal samples (25 mg ± 1 mg) were taken, mixed with beads and 500 µL of extraction solution (MeOH : CAN : H 2 O, 2:2:1 (v/v)). The extraction solution contains deuterated internal standards. The mixed solution was vortexed for 30 s. These soil samples (100 mg ± 1 mg) were taken, mixed with beads and 500 µL of extraction solution (MeOH : CAN : H 2 O, 2:2:1 (v/v)). The extraction solution contains deuterated internal standards. The mixed solution was vortexed for 30 s. Then the mixed samples were homogenized (35 Hz, 4 min) and sonicated for 5 min in 4 ℃ water bath, the step repeat for three times. The samples were incubated for 1 h at -40 ℃ to precipitate proteins. Then the samples ware centrifuged at 12000 rpm (RCF = 13800(×g), R = 8.6cm) for 15 min at 4 ℃. The supernatant was transferred to a fresh glass vial for analysis. The quality control (QC) sample was prepared by mixing an equal aliquot of the supernatant of samples. 2.11.2. LC-MS Analysis For polar metabolites, LC-MS/MS analyses were performed using an UHPLC system (Vanquish, Thermo Fisher Scientific) with a Waters ACQUITY UPLC BEH Amide (2.1 mm × 50 mm, 1.7 µm) coupled to Orbitrap Exploris 120 mass spectrometer (Orbitrap MS, Thermo). The mobile phase consisted of 25 mmol/L ammonium acetate and 25 ammonia hydroxide in water(pH = 9.75)(A) and acetonitrile (B). The auto-sampler temperature was 4 ℃, and the injection volume was 2 µL. The Orbitrap Exploris 120 mass spectrometer was used for its ability to acquire MS/MS spectra on information-dependent acquisition (IDA) mode in the control of the acquisition software (Xcalibur, Thermo). In this mode, the acquisition software continuously evaluates the full scan MS spectrum. The ESI source conditions were set as following: sheath gas flow rate as 50 Arb, Aux gas flow rate as 15 Arb, capillary temperature 320 ℃, full MS resolution as 60000, MS/MS resolution as 15000, collision energy: SNCE 20/30/40, spray voltage as 3.8 kV (positive) or -3.4 kV (negative), respectively. 2.11.3 Data preprocessing and annotation The raw data were converted to the mzXML format using ProteoWizard and processed with an in-house program. which was developed using R and based on XCMS, for peak detection, extraction, alignment, and integration. The R package and the BiotreeDB(V3.0) were applied in metabolite identification[ 15 ]. 2.12. Statistical analysis All statistical analyses were performed using SPSS 19.0 statistical software (SPSS Inc., Chicago, IL, USA). The results were expressed as mean ± standard deviation. Statistical differences among the groups were assessed by one-way ANOVA, and multiple comparisons were performed using Tukey HSD test. Values of p < 0.05 were considered statistically significant. 3. Results 3.1 Bifidobacterium significantly alleviates experimental arthritis After a seven-day acclimatization period, Wistar rats were administered either a Bifidobacterium solution or sterile saline orally on day 0. The CIA model group, MTX group, and Bifidobacterium solution group were induced as CIA models with primary immunization on day 14 and booster immunization on day 21. The Bifidobacterium solution group received oral gavage of Bifidobacterium solution (2 × 10 8 CFU) from day 0 to day 63. The CIA model and control groups were orally gavaged with sterile saline from day 0 to day 63. The MTX group received sterile saline orally from day 0 to day 63 and was treated with MTX twice a week from day 14 to day 63 (Fig. 1 ). Paw photos of each group of rats on day 63 are shown in Fig. 2 . A comparison between Fig. 2 G and 2 H reveals significant redness and swelling in the feet and fingers of the CIA rats. The Bifidobacterium intervention demonstrated a reduction in this redness and swelling (Fig. 2 A- 2 E). The study recorded the body weight, clinical scores, and paw thickness of rats to evaluate the severity of arthritis. Prominent symptoms of CIA rats, such as swelling and reddening, appeared on day 21. As depicted in Fig. 2 I, the weight of CIA rats began to decrease, but by day 35, it had returned to an upward trend as RA stabilized. In contrast, the control group's rat weight steadily increased. The MTX group's rat weight hit its lowest point on day 49. Between days 42 and 63, the MTX group's rat weight was consistently lower than that of the CIA model group, likely due to MTX's hepatotoxic nature causing gastrointestinal discomfort like vomiting and diarrhea. This resulted in lower body weight compared to the model group. Similarly, the weight of rats in the Bifidobacterium groups (BD3150, BD400, BD6256, BD5348, BB12) exhibited a pattern of initial increase, subsequent decrease, and final rise. There were minimal differences in rat weight among the Bifidobacterium groups. Arthritis onset was observed in rats one week after booster immunization, with arthritis clinical scores and paw thickness recorded (Fig. 2 J and 2 K). Paw swelling in CIA rats continued to increase from day 28 to day 42, peaking on day 42 before entering a stable phase with gradual reduction in swelling. While MTX intervention did not show immediate effects in early arthritis stages, it did reduce paw swelling in later stages. Disease activity persisted after MTX treatment, a common scenario in RA management[ 16 ]. Bifidobacterium administration reduced paw swelling in CIA rats, with the most significant difference seen in the B. animalis BD400 group. 3.2 Histopathological analysis of CIA rats` joint improved by Bifidobacterium The knee joints of rats were collected for histopathological analysis. Bone erosion in the knee joints was observed through HE staining, while cartilage damage was assessed using safranin O-fast green staining. In Fig. 3 H, joint staining in normal rats appeared uniform, with round chondrocytes evenly arranged and abundant extracellular collagen fibers. Conversely, the knee bones of CIA rats showed severe damage, with less stained cartilage matrix indicating significant collagen loss, along with damage to the synovial membrane and cartilage (Fig. 3 G). Rats in the Bifidobacterium and MTX groups exhibited uniformly colored joints and cartilage, suggesting restoration of inflammatory damage and collagen loss in the joints (Fig. 3 A- 3 F). Safranin O-fast green staining can reveal cartilage damage by coloring normal cartilage layers, hyaline cartilage (HC) and calcified cartilage (CC), in red, while coloring cancellous bone layers in green. HC contains active chondrocytes responsible for repairing the cartilage matrix, whereas CC represents mineralized HC. Thicker CC layers can impede the flow of liquid and small organic molecules into HC, hindering chondrocyte growth [ 17 ]. In the study, normal rats exhibited thick and intact HC layers with a clearly visible tidal line, along with moderately thick CC layers (Fig. 3 H). Conversely, rats in the CIA model group showed reduced HC thickness, intensified cartilage matrix degradation, and thickened mineralized CC layers (Fig. 3 G). Treatment with Bifidobacterium increased HC thickness and decreased CC thickness in CIA rats, indicating a reduction in inflammation levels that promoted chondrocyte biological activity and alleviated RA development (Fig. 3 A- 3 E). Specifically, the Bifidobacterium group showed knee bone and cartilage conditions similar to those of the normal group, with both B. longum BD3150 and B. animalis BD400 groups exhibiting comparable results 3.3 Expression of inflammatory markers in rat joint tissues Immunofluorescence staining was conducted on histopathologic sections of rat knee joints to examine TNF-α and MMP-13 distribution (Fig. 4 ). In the control group, articular cartilage appeared normal with no positive fluorescence. However, in the CIA model group, increased TNF-α and MMP-13 proteins were observed. Treatment with Bifidobacterium led to reduced protein expression, particularly in the B. animalis BD400 group. Quantitative analysis using Image J software showed significantly higher fluorescence in the CIA model group compared to controls ( p < 0.05). Bifidobacterium intervention decreased fluorescence significantly ( p 0.05). 3.4 Effect of Bifidobacterium on specific antibody of CIA rats Anti-CII IgG is a specific antibody that targets type II collagen and plays a crucial role in the development of arthritis in CIA rats. It is known to induce or worsen arthritis and can be used to evaluate the severity of the disease. Lowering the production of these autoantibodies can effectively halt the progression of arthritis[ 18 ]. In this study, the impact of Bifidobacterium on the humoral immunity of CIA rats was assessed by measuring the levels of CII-specific antibodies. The study measured the levels of total anti-CII IgG as well as its subtypes (anti-CII IgG1, IgG2a, IgG2b) in the serum. Results showed that the levels of these antibodies were significantly higher in the CIA model group compared to the control group (Fig. 5 A- 5 D). Treatment with MTX reduced these antibody levels to a level comparable to that of normal rats. Oral administration of Bifidobacterium in CIA rats also led to a notable decrease in these antibody levels. Specifically, the B. longum BD3150 and B. animalis BD400 groups showed significantly lower levels of total anti-CII IgG and its subtypes compared to the CIA model group. These findings suggest that B. longum BD3150 and B. animalis BD400 may help alleviate inflammatory damage induced by autoantibodies by reducing the levels of anti-CII IgG, IgG1, and IgG2a 3.5 Effect of Bifidobacterium on immune responses of CIA rats Cytokine levels in serum serve as indicators of systemic inflammatory immune response, reflecting the overall inflammatory status of the body. Notably, IL-1 and TNF-α are key inflammatory mediators in RA, with IL-17 playing a significant role in promoting the secretion of IL-1 and TNF-α by inflammatory cells. In the study (Fig. 5 E), levels of IL-17A in the serum of the CIA model group were markedly higher compared to other groups ( p < 0.01). Treatment with MTX led to a significant reduction in IL-17A levels in the serum of CIA rats ( p < 0.01). Furthermore, administration of B. longum BD3150 and B. animalis BD400 to CIA rats resulted in a significant decrease in IL-17A levels in serum ( p < 0.05) (Fig. 5 F and 5 G). Additionally, analysis of synovial fluid from rats revealed elevated levels of TNF-α and IL-1β in the CIA model group compared to control groups ( p < 0.01). Treatment with B. longum BD3150 and B. animalis BD400 significantly lowered TNF-α and IL-1β levels in the synovial fluid of CIA rats ( p < 0.05). These findings suggest that B. longum BD3150 and B. animalis BD400 effectively reduce inflammation in both the blood and joint fluid of CIA rats. 3.6 Effects of Bifidobacterium on intestinal barrier related protein genes in CIA rats Intestinal barrier proteins, such as claudin-1, occludin-1, mucin-2 (MUC-2), and zonula occluden-1 (ZO-1), play a crucial role in maintaining normal intestinal barrier function. Gene expression analysis in a CIA model group revealed a significant decrease in occludin-1 and MUC-2 levels, an increase in claudin-1 expression, and no notable change in ZO-1 levels compared to the control group (Fig. 6 ). Treatment with Bifidobacterium led to a significant increase in occludin-1 and MUC-2 expression, while claudin-1 levels decreased. In the B. animalis BD400 group, there was a significant increase in occludin-1, MUC-2, and ZO-1 expression, with a decrease in claudin-1 levels. Occludin-1 regulates intercellular ion transport, while MUC-2 is a mucin produced by goblet cells in the intestinal wall. The modulation of occludin-1 and MUC-2 by B. animalis BD400 can enhance intestinal selective permeability, reduce the influx of harmful substances into the internal environment, and maintain internal homeostasis. 3.7 Effects of Bifidobacterium on the composition and diversity of gut microbiota Faecal samples were collected to evaluate the impact of Bifidobacterium on the gut microbiota of CIA rats through 16S rDNA V3-V4 sequencing. A total of 3,276,658 valid sequences were obtained after double-end splicing, quality control, and chimera filtering. Through amplicon sequence variants (ASVs) cluster analysis and species annotation, 50,065 ASVs were identified, with an average of 1,043 ASVs per sample. The species accumulation curve in Fig. 7 A shows a plateau as sample size increases, indicating sufficient sampling. Additionally, the dilution curve in Fig. 7 B flattens with the increase in sample sequences, suggesting an appropriate amount of sequencing data. Significant differences in Chao1 index, Shannon index, and Simpson index were observed between the CIA model group and the control group ( p < 0.05) in Figs. 7 C- 7 E. Following the intervention of certain Bifidobacterium strains, there was a notable increase in species richness within the gut microbiota of CIA rats ( p < 0.05). Specifically, the Chao1 index, Shannon index, and Simpson index significantly increased in the B. longum BD3150 group ( p < 0.01), while the Shannon index and Simpson index notably increased in the B. bifidum BD5348 group ( p < 0.05). These findings indicate substantial disparities in species diversity within the gut microbiota of CIA rats compared to normal rats, and highlight the potential of B. longum BD3150 and B. bifidum BD5348 interventions in mitigating the reduction in intestinal species diversity induced by arthritis. Principal component analysis (PCA), principal coordinate analysis (PCoA), and nonmetric multidimensional scaling (NMDS) were utilized to compare the distribution profiles of fecal microorganisms in eight groups. Figure 7 F- 7 H demonstrates a significant difference in PCA, PCoA, and NMDS between the CIA model group (purple circle) and the control group (pink circle). Upon administration of Bifidobacterium , there were significant alterations in the distribution profiles, particularly in the B. longum BD3150 group and the B. animalis BD400 group in PCoA. Adonis analysis revealed a significant difference in the species composition of gut microbiota among the eight groups ( p = 0.001) (Table 2 ). Table 2 Adonis Multivariate Analysis based on Bray-Curtis Distance Df Sum of sqs R 2 F p Group 7 2.57 0.28 2.25 0.00 Residual 40 6.52 0.72 Total 47 9.09 1 Df, Degree of freedom; Sum of sqs, sum of squares of deviations; R 2 , R 2 represents the interpretation of sample differences by different groups, that is, the ratio of group variance to total variance; F, F test value; p , p value , p < 0.05 indicates a high degree of reliability. Based on ASV annotation results and the ASV abundance table for each sample, we generated a species abundance table at various taxonomic levels including kingdom, phylum, class, order, family, genus, and species. Utilizing this information along with species annotation data, we identified the top 30 species for constructing cluster stacked bar charts at the phylum and genus levels. In Fig. 8 A, Firmicutes and Bacteroidota emerge as the predominant phyla in rat gut bacteria, with a higher proportion observed in the CIA model group compared to the control group. Following intervention with specific strains of Bifidobacterium , the ratio of Firmicutes and Bacteroidota exhibited alterations. Notably, clustering based on Bray-Curtis distance revealed that the B. breve BB12 group closely resembled the control group in terms of Firmicutes and Bacteroidota percentages. Moving to the genus level (Fig. 8 B), the top 5 species included Clostridia_UCG-014 _unclassified, Lactobacillus , Ligilactobacillus , Lachnospiraceae _unclassified, and Firmicutes _unclassified. The proportion of these species differed significantly between the CIA model group (50.72%) and the control group (34.57%) ( p < 0.05). Upon Bifidobacterium administration, a decrease in the percentages of these top 5 species was observed, particularly in the B. bifidum BD5348 group. To further investigate the species contributing to the differences between groups, a differential abundance analysis was conducted. In Fig. 8 C, Desulfobacterota at the phylum level exhibited the most significant difference between the CIA model group and the control group. Following the administration of B. breve BB12, there was an increase in the relative abundance of Desulfobacterota (Fig. 8 D). At the genus level, Lactobacillus showed the most significant difference between the CIA model group and the control group (Fig. 8 E). Additionally, Ruminococcus and HT002 were also found to differ between the CIA model group and the control group. Notably, there was no observed increase in Ruminococcus with the administration of Bifidobacterium , while B. animalis BD400 reduced the relative abundance of HT002. The LEfSe tool was utilized to identify biomarkers between groups. In Fig. 9 , 26 types of bacteria showed significant differences across various classification levels including phylum, class, order, family, and genus in the control group. The top 5 bacteria with notable differences were Ruminococcus _unclassified, Ruminococcus , Ruminococcaceae , Turicibacter _unclassified, and Turicibacter . In the B. bifidum BD5348 group, 7 types of bacteria exhibited significant differences, namely Ruminococcus _bromii, Ruminococcus , Ruminococcaceae , Christensenellales , Christensenellaceae , Christensenellaceae _R_7_group, and Christensenellaceae _R_7_group_unclassified. These results indicate that both the B. bifidum BD5348 group and the control group share biomarkers such as Ruminococcus and Ruminococcaceae , suggesting that the intervention of B. bifidum BD5348 alters the gut microbiota of CIA rats to resemble that of normal rats. 3.8 Untargeted metabolomics of gut microbiota A total of 11632 peaks in positive ion mode and 9769 peaks in negative ion mode were retained after quality control. Differential metabolites between the control and treatment groups were identified based on the variable importance in the projection (VIP) of the OPLS-DA model. Subsequently, a T-test was conducted using SPSS 19.0 statistical software to perform statistical analysis. The criteria for screening differential metabolites included ∣Log2FOLD CHANGE∣>1, p 1. The ratio of each differential metabolite was calculated and transformed logarithmically with a base of 2. The comparison of differential metabolites between the CIA model group and the control group was presented in Figs. 10 A and 10 B. Each Bifidobacterium group was compared individually with the control group. Notably, the changes in differential metabolites between the B. animalis BD400 group and the control group were found to be opposite to those between the CIA model group and the control group (Fig. 10 B). For instance, purine nucleosides like crotonoside guanosine, 2'-deoxyuridine, and xanthosine were significantly up-regulated in the CIA model group but down-regulated in the B. animalis BD400 group. Similarly, the fatty acid metabolite 2-ketobutyric acid showed significant up-regulation in the CIA model group but down-regulation in the B. animalis BD400 group. On the other hand, glycerin phospholipids such as 2-O-(4,7,10,13,16,19-docosahexaenoyl)-1-O-hexadecylglycero-3-phosphocholine, momordicinin, and botulin were significantly down-regulated in the CIA model group but up-regulated in the B. animalis BD400 group. These contrasting results between the CIA model group and B. animalis BD400 group suggest that B. animalis BD400 may possess the ability to mitigate the abnormal differential metabolite profiles associated with RA. A radar chart (Fig. 10 C and 10 D) was utilized to illustrate the variation trend in the content of differential metabolites. The red font represents the difference multiple for each grid line, while the purple shadow consists of the difference multiple lines for each metabolite. Overall, Fig. 10 C predominantly shows positive difference multiples, indicating an increasing trend, whereas Fig. 10 D mostly displays negative difference multiples, suggesting a decreasing trend. Figure 10 C compares the content of the same differential metabolite in the CIA model group and the control group, revealing higher levels of certain metabolites in the CIA model group such as orotic acid, 3-hydroxyisovaleric acid, terephthalic acid, uric acid, N-acetylmuramic acid, 5-hydroxyhexanoic acid, Ile-Leu, Leu-Leu, and 4-hydroxybenzoic acid compared to the control group. Conversely, trigonelline was lower in the CIA model group than in the control group. In Fig. 10 D, prolylhydroxyproline in the B. animalis BD400 group exhibited higher levels compared to the control group, while 3,3-dimethylglutaric acid, dimethylmalonic acid, 3-amino-4-methylpentanic acid, 2-ketobutyric acid, tetradecyl sulfate, 3-hydroxybenzaldehyde, isoleucine, pyruvate, and LacCer(d18:1/16:0) in the B. animalis BD400 group were lower than in the control group. The contrasting trends in difference multiples between the CIA model group and the B. animalis BD400 group demonstrate the potential of B. animalis BD400 to restore intestinal metabolite disturbance. The role of these differential metabolites was investigated by annotating the metabolic and regulatory pathways they are associated with. Enrichment results (Fig. 10 E and 10 F) revealed that the differential metabolites primarily belonged to metabolic pathways, suggesting that the CIA model construction significantly impacted the metabolic pathways of rats, and B. animalis BD400 also influenced the metabolic pathways of CIA rats. The differential abundance score (DA score) calculations indicated a positive trend for all metabolites in these pathways (Fig. 10 G), whereas in the B. animalis BD400 group, metabolites in each pathway exhibited a decreasing trend (Fig. 10 H). To pinpoint key metabolic pathways highly correlated with metabolite differences, enrichment analysis and topological analysis were conducted. Notably, in CIA rats, pyrimidine metabolism, valine, leucine, and isoleucine biosynthesis, starch and sucrose metabolism, beta-alanine metabolism, riboflavin metabolism, and pyruvate metabolism were significantly altered (Fig. 10 I). Conversely, B. animalis BD400 primarily influenced valine, leucine, and isoleucine biosynthesis, ubiquinone and other terpenoid-quinone biosynthesis, citrate cycle, pyruvate metabolism, glycolysis or gluconeogenesis, and tyrosine metabolism (Fig. 10 J). The study delved deeper into the expression of metabolites and enzymes involved in valine, leucine, and isoleucine biosynthesis, as well as ubiquinone and other terpenoid-quinone biosynthesis, in the presence or absence of oral B. animalis BD400. Figure S1 illustrates that in the absence of oral B. animalis BD400, 2-oxobutanoate, pyruvate, 2-oxoisovalerate, and 4-methyl-2-oxopentanoate showed high expression levels in the biosynthesis of valine, leucine, and isoleucine. Conversely, when oral B. animalis BD400 was present, the expression of these metabolites was down-regulated in the biosynthesis pathways of these amino acids. Valine, leucine, and isoleucine are classified as branched-chain amino acids (BCAAs), which are crucial amino acids that cannot be synthesized in animals but can be produced in plants and microorganisms. The findings suggest that B. animalis BD400 influences the biosynthesis of BCAAs in the gut microbiota. Furthermore, in the process of ubiquinone and other terpenoid-quinone biosynthesis (Figure S2), 4-hydroxybenzoate exhibited high expression levels in the absence of oral B. animalis BD400, which was not observed when the probiotic was administered. Additionally, 4-hydroxyphenylpyruvate, with low expression in the B. animalis BD400 group, did not show significant changes in the CIA model group. These results indicate that B. animalis BD400 may alleviate symptoms of RA by modulating the metabolic pathways involved in valine, leucine, and isoleucine biosynthesis, as well as ubiquinone and other terpenoid-quinone biosynthesis. 4. Discussion RA is a chronic, symmetrical, systemic, inflammatory autoimmune disease with complex etiology and unclear pathogenesis[ 19 ]. While there are drugs available to treat RA, there is still no effective treatment. In the early stages, RA presents with joint swelling, pain, and dysfunction. As RA progresses, it is marked by different levels of joint stiffness, bone and skeletal muscle atrophy, and can be highly disabling if not treated regularly[ 1 ]. Numerous studies conducted worldwide have demonstrated a strong correlation between RA and gut microbiota. For instance, a study in the United States utilized 16S sequencing of stool samples taken from 114 RA patients and healthy individuals, revealing an increase in Prevotella copri abundance in RA patients, which was linked to a reduction in Bacteroides levels and a decline in beneficial microbes[ 20 ]. Similarly, a Japanese study involving 17 early RA patients observed a similar trend with an increase in Prevotella copri abundance and a decrease in Bacteroides [ 21 ]. Furthermore, researchers Vaahtovuo et al. from Finland employed 16S rRNA hybridization and DNA staining techniques to analyze the fecal microbiota of 51 early RA patients. A comparison with fibromyalgia patients showed a significant decrease in the levels of bacteria within the Bifidobacteria and Bacteroides - Porphyromonas - Prevotella group, Bacteroides fragilis subgroup, and Eubacterium rectale - Clostridium coccoides group among early RA patients[ 22 ]. Zhang et al. conducted a study in China where they analyzed the oral and gut microbiota of 212 fecal samples from both RA patients and healthy controls using metagenomic shotgun sequencing. Their findings revealed a decrease in Haemophilus spp. in the gut, dental, or saliva microbiome of RA patients, while an increase in Lactobacillus salivarius was observed in these same microbiomes of RA patients[ 6 ]. Maeda et al. further explored the connection between gut microbiota and RA by transplanting feces from RA patients into germ-free mice. The mice gradually developed ankle swelling two weeks post-transplant and eventually developed RA[ 21 ]. Additionally, Zeng et al. successfully treated a 20-year-old woman with refractory RA using fecal microbiota transplantation (FMT). By administering fecal suspensions from healthy eight-year-old donors via colonoscopy, they observed no adverse reactions during or after FMT. Notably, the patient's rheumatic factors significantly decreased ( p < 0.05) at 42 days post-FMT, with RA symptoms showing improvement 78 days post-FMT[ 23 ]. These findings underscore the crucial role of gut microbiota in the pathogenesis and progression of RA. Bifidobacterium , the predominant microbe in the gastrointestinal tract, plays a crucial role in maintaining the balance of gut microbiota and overall host health. Numerous clinical, in vivo, and in vitro studies have demonstrated the beneficial effects of Bifidobacterium on conditions such as inflammatory bowel disease, irritable bowel syndrome, cancer, diarrhea, and lactose intolerance. Bifidobacterium exerts its effects by inhibiting the growth of pathogens, preserving gut microbiota balance, and safeguarding intestinal barrier integrity through the reduction of intestinal pH[ 24 ]. Moreover, Bifidobacterium produces a variety of metabolites that are advantageous to the host, including vitamins, polyphenols, conjugated linoleic acid, and short-chain fatty acids. These metabolites also have harmful effects on pathogenic microorganisms, such as organic acids, bacteriocins, and bio-surfactants, thereby impeding the proliferation of harmful microorganisms[ 25 ]. Additionally, Bifidobacterium aids in the breakdown of carbohydrate compounds in the host and from dietary sources through sugar degradation pathways, promoting healthy host metabolism. This feature not only ensures the survival of Bifidobacterium in the mammalian intestine but also provides essential nutrients for the host and other intestinal microorganisms through cross-feeding[ 26 ]. Jeong et al. identified a novel Bifidobacterium longum RAPO with therapeutic potential from microbiome analysis of RA patients with varying rheumatoid factor (RF) levels. Oral administration of B. longum RAPO significantly reduced RA incidence, arthritis score, inflammation, bone injury, cartilage injury, Th17 cells, and inflammatory cytokine secretion in CIA mice[ 27 ]. Furthermore, patents suggest that certain Bifidobacterium strains may have preventive or therapeutic effects on RA[ 28 – 31 ]. This study demonstrated that oral administration of B. animalis BD400 for nine weeks notably decreased arthritis clinical scores and paw thickness in CIA rats (Fig. 2 I- 2 K). Histological analysis of knee joint sections and staining of rats revealed that B. animalis BD400 improved the interface between synovium and bone tissue, reduced cell infiltration and synovial hyperplasia, restored the thickness and integrity of the hyaline cartilage layer, ultimately alleviating RA symptoms (Figs. 3 and 4 ). The impact of B. animalis BD400 on RA symptoms prompted further investigation into its effects on specific antibodies and pro-inflammatory factors in the serum and joint fluid of CIA rats. Collagen-induced arthritis, a well-established model for RA, shares key characteristics with human RA, notably immune tolerance breakdown and autoantibody production[ 13 ]. Autoantibodies, particularly anti-CII IgG antibodies specific to type II collagen, play a crucial role in RA diagnosis and disease progression. High levels of these autoantibodies can be detected in serum well before clinical symptoms manifest[ 18 ]. In this study, anti-CII IgG and its subtypes (IgG1, IgG2a, and IgG2b) were measured in the serum of CIA rats. Levels of these antibodies were significantly elevated in CIA rats compared to the control group. Treatment with B. longum BD3150 and B. animalis BD400 led to a significant decrease in anti-CII IgG, IgG1, and IgG2a levels ( p < 0.05) (Fig. 5 ). Meanwhile, we assessed the production of pro-inflammatory factors, including IL-17A, TNF-α, and IL-1β, in both serum and synovial fluid. The levels of IL-17A in serum, as well as TNF-α and IL-1β in synovial fluid, were significantly reduced with the administration of B. longum BD3150 and B. animalis BD400. These inflammatory factors play a crucial role in cellular communication. Notably, TNF-α, IL-6, and IL-1β are commonly studied in the context of RA. TNF-α, a member of the tumor necrosis factor family, triggers the production of various cytokines and proteases by target cells in RA, primarily through the NF-κB and MAPK signaling pathways[ 32 ]. This cascade of inflammatory responses leads to a continuous cycle of inflammation, contributing to bone and joint erosion[ 33 ]. As a result, the components of the articular cavity, such as synovial cells, synovial tissue fluid, and serum in CIA rats, exhibited an increasing trend compared to healthy controls. The intervention of B. longum BD3150 and B. animalis BD400 reduced the levels of TNF-α in the synovial fluid of CIA rats, suggesting the disruption of this persistent inflammatory cycle. In RA, antigen-presenting cells carrying HLA-DR antigen increase and stimulate CD4 + T lymphocytes to secrete numerous cytokines, activating synovial macrophages to release IL-1β and TNF⁃α[ 34 ]. These cytokines target joint cells, leading to the production of collagen and neutral protease, ultimately causing synovial proliferation and erosion of joint cartilage, worsening the disease[ 34 ]. While IL⁃1β levels are typically low in the knee fluid of healthy individuals, our study found elevated levels of IL-1β in the joint fluid of collagen-induced arthritis (CIA) rats. Treatment with B. longum BD3150 and B. animalis BD400 reduced IL-1β levels in the knee fluid of CIA rats. IL-17A, a key inflammatory mediator in RA, is primarily produced by CD4 + Th17 cells, as well as CD8 + T cells, NK T cells, γδT cells, neutrophils, and lymphoid tissue inductor-like cells [ 35 ]. IL-17A works in conjunction with TNF-α to promote osteogenesis, induce PEG production in chondrocytes, stimulate fibroblast-like synoviocytes (FLS) to secrete various inflammatory factors, and activate pathways like PI3K/Akt and NF⁃κB, leading to synovial inflammation and cartilage damage[ 36 ]. Consequently, IL⁃17A levels are higher in the synovial fluid and surrounding tissues of RA patients compared to healthy individuals. Our study demonstrated a significant decrease in serum IL-17A levels in CIA rats following the oral administration of probiotics, highlighting the potential of B. longum BD3150 and B. animalis BD400 in mitigating RA-related inflammation. The occurrence and development of RA is closely linked to disruptions in both local and systemic immune responses, stemming from immune sites beyond the joints, known as the "mucosal origin hypothesis"[ 37 – 39 ]. The gut, recognized as the largest immune organ, harbors a diverse population of microorganisms that not only provide essential nutrients and energy to the body but also play a role in shaping and regulating the intestinal mucosal immune system[ 40 ]. These intestinal microorganisms interact with, respond to, and regulate the intestinal mucosa through the intestinal mucosal barrier[ 41 ]. The tight connection between the mucus barrier and intestinal epithelial cells serves as the primary defense against pathogens[ 42 ]. Key proteins involved in maintaining the integrity of the intestinal barrier include claudin-1, occludin-1, mucin-2 (MUC-2), and zonula occludens-1 (ZO-1). In a study involving collagen-induced arthritis (CIA) rats, it was found that the expression of occludin-1 and MUC-2 in the gut was significantly reduced compared to control rats ( p < 0.001), while the expression of claudin-1 was significantly increased ( p < 0.001). Treatment with 5 strains of Bifidobacterium (BD3150, BD400, BD6256, BD5348, BB12) restored the expression of these three proteins (claudin-1, occludin-1, and MUC-2) to normal levels (Fig. 6 ). The relationship between gut microbiota and human health is integral, as gut microbiota are present throughout the human life cycle. Changes in gut microbiota composition result from specific interactions between microorganisms and the gut environment. The evolution and selection process of the gut microbiota remains unclear, but there is growing interest in the co-evolution and mutual interaction between the gut microbiota and the host intestinal immune system. The intestinal microbiota plays a crucial role in supporting the development of the immune system through various mechanisms and helps maintain a balanced intestinal micro-ecology[ 43 , 44 ]. Imbalances in the intestinal micro-ecology have been linked to various diseases, including intestinal and immune disorders[ 45 , 46 ]. This imbalance can lead to the disruption of the intestinal micro-ecology, an increase in pathogenic bacteria, a decrease in beneficial bacteria, triggering local inflammatory responses and cascading effects that impact the immune response of extra-intestinal organs, ultimately posing a threat to the host's health[ 47 ]. In our study (Figs. 7 , 8 and 9 ), significant differences were observed in the gut microbiota composition between CIA rats and normal rats ( p < 0.05). Desulfobacterota was identified as the phylum with the most significant difference between the CIA model group and the control group ( p < 0.05). Treatment with B. breve BB12 led to a restoration in the relative abundance of Desulfobacterota . At the genus level, notable differences were observed in Clostridia_UCG-014 _unclassified, Lactobacillus , Ligilactobacillus , Lachnospiraceae _unclassified, and Firmicutes _unclassified (top 5 species). The combined proportion of these top 5 species in the CIA model group was 50.72%, significantly different from the control group's 34.57%. The percentages of these top 5 species decreased under the administration of B. bifidum BD5348. Through differential abundance analysis, we observed that B. animalis BD400 decreased the relative abundance of HT002. Desulfobacterota , a sulfate-reducing anaerobic bacteria, thrives in the gut and releases hydrogen sulfide. The role of hydrogen sulfide is intricate and at times contradictory. Clinical data suggests an association between hydrogen sulfide and chronic colon disease as well as inflammation of the large intestine[ 48 ]. However, research has also demonstrated that hydrogen sulfide can directly stimulate angiogenesis, crucial for mending gastrointestinal ulcers[ 49 , 50 ]. Despite the challenging task of elucidating the precise role of Desulfobacterota in the gut, our findings revealed contrasting results in the abundance of Desulfobacterota between the CIA model group and the B. animalis BD400 group, providing insight into the ability of B. animalis BD400 to restore gut microbiota. Furthermore, a separate study on Bifidobacterium adolescentis yielded similar biological outcomes, highlighting Lactobacillus , Ligilactobacillus , and Lachnospiraceae as prominent genera[ 51 ]. This finding strongly corroborates our own results. The metabolites of gut microbiota can directly or indirectly impact host health. These metabolites can be categorized based on their synthesis pathway: 1. Metabolites produced by gut microbiota that break down dietary components like short-chain fatty acids, tryptophan, and trimethylamine oxide; 2. Metabolites produced by the host and altered by gut microbiota, such as bile acids; 3. Metabolites synthesized by gut microbiota from scratch, including branched-chain amino acids, polyamines, and vitamins[ 52 ]. These gut microbiota metabolites play a crucial role in maintaining host intestinal balance and regulating immune function through various mechanisms. They can enter cells through passive diffusion or carrier-mediated transport to regulate processes like protein synthesis, glucose and lipid metabolism, insulin resistance, hepatocyte proliferation, and immunity. Moreover, these metabolites can travel to distant tissues and organs via the bloodstream, influencing the functions of multiple organs[ 53 – 56 ]. In this study (Fig. 10 ), metabolites such as crotonoside, guanosine, 2`-ketobutyric acid, momordicinin, botulin, trigonelline, among others, exhibited significant differences in CIA rats. Following oral administration of B. animalis BD400, these variances were restored, particularly 2`-deoxyuridine, 2`-ketobutyric acid, crotonoside, and guanosine. By conducting enrichment and topological analyses on the pathways associated with the altered metabolites, the study identified key pathways with the highest correlation to these metabolites. Pyrimidine metabolism, valine, leucine, and isoleucine biosynthesis, starch and sucrose metabolism, beta-alanine metabolism, riboflavin metabolism, and pyruvate metabolism were significantly impacted by the CIA model. Conversely, the mechanism of action of B. animalis BD400 primarily involved valine, leucine, and isoleucine biosynthesis, as well as ubiquinone and other terpenoid-quinone biosynthesis. Valine, leucine, and isoleucine are all branched-chain amino acids (BCAAs) and constitute three of the nine essential amino acids. BCAAs not only provide nutritional benefits but also exert various biological effects, such as modulating the balance between pro-inflammatory and anti-inflammatory cytokines[ 57 ], reducing oxidative stress [ 58 ], enhancing immunity [ 59 ], and regulating glucose metabolism[ 60 , 61 ]. According to the valine, leucine and isoleucine biosynthesis pathway plot obtained in this study (Figure S1 ), B. animalis BD400 regulates the biosynthesis of these amino acids by up-regulating differential metabolites such as 2-oxobutanoate, pyruvate, 2-oxoisovalerate, and 4-methyl-2-oxopentanoate. Conversely, in the ubiquinone and other terpenoid-quinone biosynthesis pathway plot obtained in this study (Figure S2), B. animalis BD400 regulates the biosynthesis of these compounds by down-regulating the differential metabolite 4-hydroxyphenyl-pyruvate. Within the valine, leucine, and isoleucine biosynthesis process, threonine is converted by threonine dehydrase into ketobutyric acid. Acetylhydroxybutyric acid synthase then catalyzes the conversion of ketobutyric acid and pyruvate into acetylhydroxybutyric acid, a precursor for isoleucine synthesis. Additionally, some pyruvates lead to the production of acetyllactic acid, which is essential for valine and leucine synthesis. The pivotal roles of ketobutyric acid and pyruvate in valine, leucine, and isoleucine biosynthesis are highlighted. In our study, ketobutyric acid and pyruvate were identified as among the top 10 differentiated metabolites (Fig. 10 A and 10 B). The differential metabolite of 4-hydroxyphenylpyruvate in ubiquinone and other terpenoid-quinone biosynthesis is a pyruvate derivative closely linked to pyruvate. Pyrimidine metabolism, while significant in CIA development, does not impact the regulation of B. animalis BD400. Increased pyrimidine metabolism results in elevated uric acid levels, promoting the conversion of arachidonic acid to prostaglandin E2[ 62 ], an inflammatory mediator that enhances synovial inflammation[ 63 ]. Reduction in inflammatory response leads to decreased levels of 2`-deoxyuridine, guanosine, xanthosine, and other metabolites in pyrimidine metabolism, highlighting its role in B. animalis BD400 regulation. Overall, these findings indicate that B. animalis BD400 mitigates RA symptoms through the regulation of ketobutyric acid and pyruvate in valine, leucine, and isoleucine biosynthesis, as well as the regulation of 4-hydroxyphenylpyruvate in ubiquinone and other terpenoid-quinone biosynthesis. 5. Conclusion The clinical treatment of RA focuses on reducing inflammation and alleviating symptoms, as RA is challenging to cure. Our study investigated the oral administration of B. animalis BD400 to restore the intestinal microbiota to a normal state. B. animalis BD400 primarily achieves this by down-regulating 2-ketobutyric acid and pyruvate in branched-chain amino acids biosynthesis, as well as 4-hydroxyphenyl-pyruvate in ubiquinone and other terpenoid-quinone biosynthesis. This research is expected to offer insights for the potential future clinical use of probiotics therapy. Declarations Acknowledgments The authors are thankful to the State Key Laboratory of Dairy Biotechnology, Shanghai Engineering Research Center of Dairy Biotechnology, Bright Dairy & Food Co., Ltd., Shanghai, China for providing the various resources for the completion of the current article. Authors’ contributions Y.Y., X.Z. and Z.L. conceived the project and designed the experiments. Y.Y., Q.H., and Z.L. performed all the experiments and analyzed the data. Y.Y. and Q.H. wrote the manuscript with inputs from all authors. Funding This work was supported by grants from the Shanghai State-owned Assets Supervision and Administration Commission Enterprise Innovation Development and Capacity Enhancement Program (No. 2022013) and the National Key R&D Program of China (2022YFD2100704). Availability of data and materials The raw sequence data of 16S rDNA gene sequencing were deposited in the Sequence Read Archive (SRA) at NCBI under Bioproject PRJNA1139339 (SUB14619059, https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1139339). The data matrix for non-targeted metabolite analysis was supplied in Supplementary material Table S1. All the other data in this work are available from the corresponding author upon reasonable request. Ethics approval and consent to participate Ethical approval for this study was obtained from Animal Ethics Committee of Shanghai Zhanyuan Biological Technology Co., LTD (approval No. 202306261). All procedures treated with mice were carried out in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals in China. Consent for publication Not applicable. Competing interests The authors declare no competing interests. References Smolen, J.S., D. Aletaha, and I.B. McInnes, Rheumatoid arthritis[J]. The Lancet, 2016. 388(10055): 2023-2038. DOI: 10.1016/S0140-6736(16)30173-8 Felson, D.T.J.A.R. and Therapy, Comparing the prevalence of rheumatic diseases in China with the rest of the world[J]. Arthritis Research & Therapy, 2008. 10(1): 106-106. DOI: 10.1186/ar2369 Crowson, C. S., Matteson, E. L., Myasoedova, E., Michet, C. J., Ernste, F. C., Warrington, K. J., et al., The lifetime risk of adult-onset rheumatoid arthritis and other inflammatory autoimmune rheumatic diseases[J]. Arthritis & Rheumatism, 2011. 63(3): 633-639. DOI: 10.1002/art.30155 Aletaha, D. and J.S. Smolen, Diagnosis and Management of Rheumatoid Arthritis: A Review[J]. The Journal of the American Medical Association, 2018. 320(13): 1360-1372. DOI: 10.1001/jama.2018.13103 Liu, X., Zou, Q., Zeng, B., Fang, Y., Wei, H., Analysis of Fecal Lactobacillus Community Structure in Patients with Early Rheumatoid Arthritis[J]. Current Microbiology, 2013. 67(2): 170-176. DOI: 10.1007/s00284-013-0338-1 Zhang, X., Zhang, D., Jia, H., Feng, Q., Wang, D., Liang, D. , et al. The oral and gut microbiomes are perturbed in rheumatoid arthritis and partly normalized after treatment[J]. Nature Medicine, 2015. 21(8): 895-905. DOI: 10.1038/nm.3914 Kinashi, Y. and K. Hase, PPartners in leaky gut syndrome: intestinal dysbiosis and autoimmunity[J]. Frontiers in Immunology, 2021, 12, 673708. DOI: 10.3389/fimmu.2021.673708 Chen, B., L. Sun, and X. Zhang, Integration of microbiome and epigenome to decipher the pathogenesis of autoimmune diseases[J]. Journal of Autoimmunity, 2017. 83: 31-42. DOI: 10.1016/j.jaut.2017.03.009. Zhao, T., Wei Y., Xie Z, Hai Q., Li Z., Qin D., et al., Gut microbiota and rheumatoid arthritis: From pathogenesis to novel therapeutic opportunities[J]. Frontiers in Immunology, 2022, 13, 1007165. DOI: 10.3389/fimmu.2022.1007165 Hill, C., Guarner, F., Reid, G., Gibson, G. R., Merenstein, D. J., Pot, B. , et al., The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic[J]. Nature Reviews Gastroenterology & Hepatology, 2014. 11(8): 506-514. DOI: 10.1038/nrgastro.2014.66 Ferro, M., Charneca, S., Dourado, E., Guerreiro, C. S., Fonseca, J. E., Probiotic Supplementation for Rheumatoid Arthritis: A Promising Adjuvant Therapy in the Gut Microbiome Era[J]. Frontiers in Pharmacology, 2021. 12: 711788. DOI: 10.3389/FPHAR.2021.711788 Zamani, B., Golkar, H. R., Farshbaf, S., Modjtaba Emadi‐Baygi, Maryam Tajabadi‐Ebrahimi, Jafari, P., et al., Clinical and metabolic response to probiotic supplementation in patients with rheumatoid arthritis: a randomized, double-blind, placebo-controlled trial[J].International Journal of Rheumatic Diseases, 2016. 19(9): 869-879. DOI: 10.1111/1756-185X.12888 Brand, D.D., K.A. Latham, and E.F. Rosloniec, Collagen-induced arthritis[J]. Nature Protocols, 2007. 2(5): 1269-1275. DOI: 10.1038/nprot.2007.173 Marietta E V, Murray J A, Luckey D H, Jeraldo P R, Lamba A, Patel R, et al., Suppression of Inflammatory Arthritis by Human Gut-Derived Prevotella histicola in Humanized Mice[J]. Arthritis Rheumatol, 2016. 68(12): 2878-2888. DOI: 10.1002/art.39785 Zhou, Z., Luo, M., Zhang, H., Yin, Y., Cai, Y., Zhu, Z. J., Metabolite annotation from knowns to unknowns through knowledge-guided multi-layer metabolic networking[J]. Nature Communications, 2022. 13(1): 6656. DOI: 10.1038/s41467-022-34537-6. O'Dell, J. R., Mikuls, T. R., Taylor, T. H., Ahluwalia, V., Keystone, E., Therapies for active rheumatoid arthritis after methotrexate failure[J]. New England Journal of Medicine, 2013. 369(4): 307-318. DOI: 10.1056/NEJMoa1303006 Ao Y., Li Z., Zhang C., Duan X., Research progress on calcified cartilage zone[J]. Orthopedic Journal of China, 2019. 27(8): 722-725. Nandakumar, K. S., Johansson, B. P., BjoRck, L., Holmdahl, R., Blocking of experimental arthritis by cleavage of IgG antibodies in vivo[J]. Arthritis & Rheumatism, 2007. 56(10): 3253-3260. DOI: 10.1002/art.22930 Smolen, J., Aletaha, D., Barton, A., Burmeste G., Emery P., Firestein G S., et al., Rheumatoid arthritis[J]. Nature Reviews Disease Primers, 2018. 4(1): 18001. DOI: 10.1038/nrdp.2018.1 Scher, J.U., Sczesnak, A., Longman, R.S., Segata, N., Ubeda, C.; Bielski, C., et al. Expansion of intestinal Prevotella copri correlates with enhanced susceptibility to arthritis[J]. eLIFE 2013, 2, e01202. DOI: 10.7554/eLife.01202 Maeda, Y., Kurakawa, T., Umemoto, E., Motooka, D., Ito, Y., Gotoh, K., et al. Dysbiosis Contributes to Arthritis Development via Activation of Autoreactive T Cells in the Intestine[J]. Arthritis & Rheumatology, 2016. 68(11): p. 2646-2661. DOI: 10.1002/art.39783 Vaahtovuo J, Munukka E, Korkeamäki M, Luukkainen R, Toivanen P. Fecal microbiota in early rheumatoid arthritis[J]. Journal Rheumatol. 2008. 35(8): 1500-1505. Zeng J, Peng L, Zheng W, Huang F, Zhang N, Wu D, et al., Fecal microbiota transplantation for rheumatoid arthritis: A case report[J]. Clinical Case Report, 2021. 9(2): 906-909. DOI: /10.1002/ccr3.3677 Tang Y, Chen C, Jiang B, Wang L, Jiang F, Wang D, et al, Bifidobacterium bifidum-Mediated Specific Delivery of Nanoparticles for Tumor Therapy[J]. International journal of nanomedicine, 2021. DOI:10.2147/IJN.S315650 Miri S T, Sotoodehnejadnematalahi F, Amiri M M, Pourshafie M R, Rohani M. The impact of Lactobacillus and Bifidobacterium probiotic cocktail on modulation of gene expression of gap junctions dysregulated by intestinal pathogens[J]. Archives of Microbiology, 2022, 204(7): 417. DOI: 10.1007/s00203-022-03026-1 Levit, R., Cortes-Perez, N. G., Leblanc, A. D. M. D., Loiseau, J., Aucouturier, A., Langella, P., et al. Use of genetically modified lactic acid bacteria and bifidobacteria as live delivery vectors for human and animal health[J]. Gut microbes, 14(1): 2110821. DOI: 10.1080/19490976.2022.2110821 Jeong Y, Jhun J, Lee S-Y, Na H S, Choi J, Cho K H, et al Therapeutic Potential of a Novel Bifidobacterium Identified Through Microbiome Profiling of RA Patients With Different RF Levels[J]. Frontier in Immunology,2021, 12:736196. DOI: 10.3389/fimmu.2021.736196 Dong, Y., et al. Use of Bifidobacterium animalis subsp. lactis BLa19 used as probiotic agent and composite probiotic for alleviating rheumatoid arthritis in preparation of medicines for preventing, and improving or treating rheumatoid arthritis, Wecare Probiotics Suzhou Co Ltd. Li, T., N. Qin, and Z. Zheng, Kit is used for diagnosing rheumatoid arthritis, comprises reagent suitable for detecting at least one strain of first microorganism set and second microorganism set, where first microorganism set comprises Bacteroides strain, and second microorganism set comprises Bifidobacterium strain. Qingdao Ruiyi Precision Medical Testing. Zhang, H., et al., New strain of Bifidobacterium longum subsp.infantis used for preparing medicine for e.g. preventing and/or treating rheumatoid arthritis, increasing contents of osteoprotegerin and osteocalcin, regulating intestinal flora by increasing relative abundance of Lactobacillus and/or Ruminococcus 1. Univ Jiangnan. Zhang, X., J. Zhu, and Z. Zheng, Kit useful for diagnosing rheumatoid arthritis or detecting therapeutic effect of rheumatoid arthritis, comprises reagent for detecting e.g. Acinetobacter johnsonii, Bifidobacterium adolescentis, B.animalis and Brevundimonas diminuta. Shanghai Real Biotechnology Co Ltd. Dostert, C., Grusdat, M., Letellier, E., Brenner, D..The TNF Family of Ligands and Receptors: Communication Modules in the Immune System and Beyond[J]. Physiological Reviews, 2019, 99(1):115-160. DOI:10.1152/physrev.00045.2017 Choy E H, Panayi G S.Cytokine pathways and joint inflammation in rheumatoid arthritis.[J].The New England Journal of Medicine, 2001, 344(12):907-916. DOI: 10.1056/NEJM200103223441207 Joosten L A B, Helsen M M A, Loo F A J V D, Berg W B. Anticytokine treatment of established type II collagen-induced arthritis in DBA/1 mice. A comparative study using anti-TNF alpha, anti-IL-1 alpha/beta, and IL-1Ra[J]. Arthritis & Rheumatology, 2010, 39(5):797-809. DOI: 10.1002/art.1780390513 Gallego A, Vargas J A, Castejón R, Citores M. J., Romero Y., Millán A I.. Durántez. Production of intracellular IL-2, TNF-alpha, and IFN-gamma by T cells in B-CLL[J]. Cytometry Part B Clinical Cytometry, 2010, 56(1):23-29. DOI: 10.1002/cyto.b.10052 Sato K, Suematsu A, Okamoto K, Yamaguchi A, Morishita Y, Kadono Y, et al. Th17 functions as an osteoclastogenic helper T cell subset that links T cell activation and bone destruction[J]. Journal of Experimental Medicine, 2006, 203(12): 2673-2682. DOI: 10.1084/jem.20061775 Zaiss M M, Wu H J J, Mauro D, Schett G, Ciccia F. The gut-joint axis in rheumatoid arthritis[J].Nature Reviews Rheumatology, 2021, 17: 224-237. DOI: 10.1038/s41584-021-00585-3 Michael H V, Kristen D M, Kuhn K A, Buckner J H, Robinson W H, Okamoto Y, et al. Rheumatoid arthritis and the mucosal origins hypothesis: protection turns todestruction[J]. Nature Reviews Rheumatology, 2018, 14, 542-557. DOI: 10.1038/s41584-018-0070-0 Brusca S B, Abramson S B, Scher J U. Microbiome and mucosal inflammation as extra-articular triggers for rheumatoid arthritis and autoimmunity[J]. Current Opinion In Rheumatology. 2014, 26(1): 101-107. DOI: 10.1097/BOR.0000000000000008 Lin, L., Zhang K, Xiong Q, Zhang J, Cai B, et al., Gut microbiota in pre-clinical rheumatoid arthritis: From pathogenesis to preventing progression[J]. Journal of Autoimmunity, 2023. 141: 103001. DOI: 10.1016/j.jaut.2023.103001 Chelakkot, C., J. Ghim, and S.H. Ryu, Mechanisms regulating intestinal barrier integrity and its pathological implications[J]. Experimental & Molecular Medicine, 2018. 50(8): 1-9. DOI: 10.1038/s12276-018-0126-x Hansson G C, Johansson M E. The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria[J]. Gut Microbes, 2008, 105(1):51-54. DOI: 10.1073/pnas.0803124105 Honda K, Littman D R. The microbiota in adaptive immune homeostasis and disease[J]. Nature, 2016, 535(7610):75. DOI: 10.1038/nature18848 Hooper L V, Macpherson A J . Immune adaptations that maintain homeostasis with the intestinal microbiota[J]. Nature Reviews Immunology, 2010, 10(3): 159-169. DOI: 10.1038nri2710 Sekirov I, Russell S L, Antunes L C M, Finlay B B. Gut Microbiota in Health and Disease[J]. Physiological Reviews, 2010, 90(3): 859-904. DOI: 10.1152/physrev.00045.2009 Jie Z, Xia H, Zhong S L, Feng Q, Li S, Liang S, et al. The gut microbiome in atherosclerotic cardiovascular disease[J]. Nature Communications, 2017, 8(1): 845 . DOI: 10.1038/s41467-017-00900-1 Opoku Y K, Asare K K, Ghartey-Quansah G, Afrifa J, Bentsi-Enchill F, Ofori E G, et al. Intestinal microbiome-rheumatoid arthritis crosstalk: The therapeutic role of probiotics[J]. Frontiers in microbiology, 2022, 13: 996031. DOI: 10.3389/fmicb.2022.996031 Brenda Maldonado‐Arriaga, Sergio Sandoval‐Jiménez, Juan Rodríguez‐Silverio, Sofía Lizeth Alcaráz‐Estrada, Tomás Cortés‐Espinosa, & Rebeca Pérez‐Cabeza de Vaca, et al., Gut dysbiosis and clinical phases of pancolitis in patients with ulcerative colitis[J]. Microbiology Open,2021, 10: e1181. DOI: 10.1002/mbo3.1181 Morbidelli, L., M. Monti, and E. Terzuoli, Pharmacological Tools for the Study of H2S Contribution to Angiogenesis[J]. Methods in Molecular Biology, 2019,2007: 151-166. DOI: 10.1007/978-1-4939-9528-8_11 Köhn C, Dubrovska G, Huang Y, Gollasch M. Hydrogen sulfide: potent regulator of vascular tone and stimulator of angiogenesis[J]. Journal of Biomedical Science, 2012, 8(2):81-86. PMID: 23675260; PMCID: PMC3614859. Fan, Z., Yang, B., Ross, R. P., Stanton, C., Shi, G., Zhao, J., et al. Protective effects of Bifidobacterium adolescentis on collagen-induced arthritis in rats depend on timing of administration[J]. Food & Function, 2020, 11(5): 4499-4511. DOI: 10.1039/D0FO00077A Yang, W. and Y.J.Cong, Gut microbiota-derived metabolites in the regulation of host immune responses and immune-related inflammatory diseases[J]. Cellular & Molecular Immunology, 2021. 18(4): 1-12. DOI: 10.1038/s41423-021-00661-4 Fusco, W., Lorenzo, M.B., Cintoni, M., Porcari, S., Rinninella, E., Kaitsas, F., et al. Short-Chain Fatty-Acid-Producing Bacteria: Key Components of the Human Gut Microbiota[J]. Nutrients, 2023, 15: 2211. DOI: 10.3390/nu15092211 Perez-Castro L, Garcia R, Venkateswaran N, Barnes S, Conacci-Sorrell M. Tryptophan and its metabolites in normal physiology and cancer etiology[J]. European Journal of Biochemistry Journal, 2023, 290(1):7-27. DOI: 10.1111/febs.16245 Collins, S. L., Stine, J. G., Bisanz, J. E., Okafor, C. D., Patterson, A. D.. Bile acids and the gut microbiota: metabolic interactions and impacts on disease[J]. Nature Reviews Microbiology, 2023. 21(4): 236-247. DOI: 10.1038/s41579-022-00805 Couteur, D. G. L., Solon-Biet, S. M., Cogger, V. C., Ribeiro, R., Cabo, R. D., Raubenheimer, D., et al. Branched chain amino acids, aging and age-related health[J]. Ageing Research Revviews, 2020, 64: 101198. DOI: 10.1016/j.arr.2020.101198 Rosa L, Scaini G, Furlanetto C B, Galant L S, Vuolo F, Dall'Igna D M, et al. Administration of branched-chain amino acids alters the balance between pro-inflammatory and anti-inflammatory cytokines[J]. International Journal of Developmental Neuroscience, 2016, 48(1): 24-30. DOI: 10.1016/j.ijdevneu.2015.11.002 De Simone R, Vissicchio F, Mingarelli C, De Nuccio C, Visentin S, Ajmone-Cat M A, et al. Branched-chain amino acids influence the immune properties of microglial cells and their responsiveness to pro-inflammatory signals[J]. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease, 2013, 1832(5): 650-659. DOI: 10.1016/j.bbadis.2013.02.001 Cunxi, N., Ting, H., Wenju, Z., Guolong, Z., Xi, M.. Branched Chain Amino Acids: Beyond Nutrition Metabolism[J]. International Journal of Molecular ences, 2018, 19(4): 954. DOI: 10.3390/ijms19040954 Gannon N P, Schnuck J K, Vaughan R A. BCAA Metabolism and Insulin Sensitivity-Dysregulated by Metabolic Status?[J]. Molecular Nutrition & Food Research, 2018, 62(6): 1700756. DOI: 10.1002/mnfr.201700756 Horiuchi, M., Takeda, T., Takanashi, H., Ozaki-Masuzawa, Y., Taguchi, Y., Toyoshima, Y., et al. Branched-chain amino acid supplementation restores reduced insulinotropic activity of a low-protein diet through the vagus nerve in rats[J]. Nutrition & Metabolism, 2017, 14(1): 59. DOI: 10.1186/s12986-017-0215-1 Deby C, Deby-Dupont G, Noël FX, Lavergne L. In vitro and in vivo arachidonic acid conversions into biologically active derivatives are enhanced by uric acid[J]. Biochemical Pharmacology, 1981, 30(16): 2243-2249. DOI: 10.1016/0006-2952(81)90094-0 Wang H, Dong B W, Zheng Z H, Wu Z B, Li W, Ding J. Metastasis-associated protein 1 (MTA1) signaling in rheumatoid synovium: Regulation of inflammatory response and cytokine-mediated production of prostaglandin E2 (PGE2)[J]. Biochemical and Biophysical Research Communications. 2016, 473(2):442-448. DOI: 10.1016/j.bbrc.2016.03.027 Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.zip Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4767166","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":339630035,"identity":"eed789f0-88a9-47a0-aa86-43a3fb15ce9a","order_by":0,"name":"Yang Yang","email":"","orcid":"","institution":"State Key Laboratory of Dairy Biotechnology","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Yang","suffix":""},{"id":339630039,"identity":"1b3c41f9-ecee-4686-a86b-688f8cf3d218","order_by":1,"name":"Qing Hong","email":"","orcid":"","institution":"State Key Laboratory of Dairy Biotechnology","correspondingAuthor":false,"prefix":"","firstName":"Qing","middleName":"","lastName":"Hong","suffix":""},{"id":339630041,"identity":"99c9d7c4-2b29-400f-9388-40d3961578c0","order_by":2,"name":"Xuehong Zhang","email":"","orcid":"","institution":"Shanghai Jiao Tong University","correspondingAuthor":false,"prefix":"","firstName":"Xuehong","middleName":"","lastName":"Zhang","suffix":""},{"id":339630042,"identity":"547bc0bd-843b-48b3-aaaa-68bd2893e892","order_by":3,"name":"Zhenmin Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDElEQVRIiWNgGAWjYBACPmYGBmYQg42B+RgDgwFDAgMQHcCnhQ2hhS0NrIWHoBYGqBYGBh4zEAnWghewsfMYfy6ouBPNJ93z7XFFQW2ePXvyw8OVbQzy/GLYLWNj5jEwnnHmWW6bzNnthmcMjhfz8DwzOHi2jcFw5mzs1oG0JPO2Hc5tk8jdJtlgcCyxRyLB4GBjG0OCwW3cWg7z/gNpyXkG1ZL+gZAWw2beBrAWNqCWGqCWHEK2sBUz8xwDaUkzN2wwOJDYc+ZNwcGGcxI4/cLPf3jzZ56aw7nzZyQ/e9jwpy6xvT1988eGMht5fmnsWtDBYQjFyCZBlHIQqIPSf4jWMQpGwSgYBcMfAAD3l14JDT/6fQAAAABJRU5ErkJggg==","orcid":"","institution":"State Key Laboratory of Dairy Biotechnology","correspondingAuthor":true,"prefix":"","firstName":"Zhenmin","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-07-19 09:06:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4767166/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4767166/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":63035619,"identity":"2f662793-c031-4300-84b3-8ac729a0a25e","added_by":"auto","created_at":"2024-08-22 10:22:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":150017,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExperimental schedule.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4767166/v1/3686bdaadacd4ffce64149f0.png"},{"id":63036166,"identity":"5c632d5f-ce15-45b7-af1f-52ed03c002e9","added_by":"auto","created_at":"2024-08-22 10:30:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1786681,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of oral\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e Bifidobacterium\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e on the symptoms of paw arthritis in CIA rats. (A) \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. longum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e BD3150, (B) \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. animalis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eBD400, (C) \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. longum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e BD6256, (D) \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. bifidum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e BD5348, (E) \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. breve\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e BB12, (F) MTX, (G) CIA model, (H) Control, (I) Body weight, (J) Arthritis clinical score, (K) Thickness of paw.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4767166/v1/67b5f753a2dbf080dfdf6a7a.png"},{"id":63035623,"identity":"955f98a3-2d9e-4b08-baa5-68a276390d7c","added_by":"auto","created_at":"2024-08-22 10:22:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":15079219,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistopathological analysis of oral treatment with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBifidobacterium\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein CIA rats. From the top down are the HE staining picture, the safranin O-fast green staining picture, and the enlarged picture at the box of the safranin O-fast green staining picture. (A) \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. longum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e BD3150, (B) \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. animalis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eBD400, (C) \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. longum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e BD6256, (D) \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. bifidum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e BD5348, (E) \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. breve\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e BB12, (F) MTX, (G) CIA model, (H) Control.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4767166/v1/b78d8cc752ce54650e083920.png"},{"id":63035042,"identity":"c04d07f3-5f52-4b72-bad4-e90a6ab66439","added_by":"auto","created_at":"2024-08-22 10:14:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4003780,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression of TNF-αand MMP13 in rat joint tissues. (***\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e\u0026lt; 0.01，**\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.01，* \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.05\u003c/strong\u003e \u003cstrong\u003eagainst the control group.)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4767166/v1/ad6bd2b653ec435b5a78d4a1.png"},{"id":63035046,"identity":"c9e58366-836d-4599-88cb-7288f9cab1fc","added_by":"auto","created_at":"2024-08-22 10:14:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2909631,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBifidobacterium\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e on inflammatory responses in rats. The levels of anti-CⅡ IgG (A), anti-CⅡ IgG1 (B), anti-CⅡ IgG2a (C), anti-CⅡ IgG2b (D) and IL-17A (E) in serum were examined. The levels of TNF-α (F) and IL-1β (G) in the synovial fluid were examined.\u003c/strong\u003e \u003cstrong\u003e(\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e##\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.01，\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e# \u003c/strong\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.05 against the control group; **\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.01，* \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.05\u003c/strong\u003e \u003cstrong\u003eagainst the CIA group as determined by a two-way ANOVA with Tukey`s multiple comparisons.)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4767166/v1/90e6c796008339c64bf04731.png"},{"id":63035621,"identity":"1f1d3e34-745e-40a3-a5da-7f36ac119fd9","added_by":"auto","created_at":"2024-08-22 10:22:09","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":471778,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntestinal barrier protein gene expression in rats. (A) occludin-1, (B) claudin-1, (C) MUC-2, (D) ZO-1.\u003c/strong\u003e \u003cstrong\u003e(* \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e\u0026lt; 0.05, **\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.01, ***\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.001\u003c/strong\u003e \u003cstrong\u003eagainst the CIA model group as determined by a two-way ANOVA with Tukey`s multiple comparisons.)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4767166/v1/b4e094b5dc6cb19ffe535d09.png"},{"id":63035620,"identity":"7ed99b4d-bc8a-4b2e-8545-ece18d9d30de","added_by":"auto","created_at":"2024-08-22 10:22:09","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1498003,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBifidobacterium\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e on the relative abundance and diversity of gut microbiota. (A) Specaccum curve, (B) Rank-abundance curve, (C) Chao1, (D) Shannon, (E) Simpson, (F) PCA, (G) PCoA, (H) NMDS. Group: A: \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. longum \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eBD3150, B: \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. animalis \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eBD400, C: \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. longum \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eBD6256, D: \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. bifidum \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eBD5348, E: \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. breve \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eBB12, F: MTX, G: CIA Model, H: Control. (* \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e\u0026lt; 0.05, **\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.01, determined by a two-way ANOVA.)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4767166/v1/0135632610fb79a7ea786b16.png"},{"id":63035048,"identity":"c76ea1a1-0c8d-499d-9105-4c317f75a659","added_by":"auto","created_at":"2024-08-22 10:14:09","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1231062,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBifidobacterium\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e on the species composition of gut microbiota.\u003c/strong\u003e \u003cstrong\u003eSpecies abundance at the phylum level(A), genus level (B), and a relative abundance difference between group G and group H at the phylum level (C), between group E and group G at the phylum level (D), between group G and group H at the genus level (E), between group D and group G at the genus level (F), between group B and group G at the genus level (G). Group: A: \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. longum \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eBD3150, B: \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. animalis \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eBD400, C: \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. longum \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eBD6256, D: \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. bifidum \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eBD5348, E: \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. breve \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eBB12, F: MTX, G: CIA Model, H: Control. (* \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e\u0026lt; 0.05, **\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026lt; 0.01, determined by a two-way ANOVA.)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-4767166/v1/a02c8d1320ad5896c894e93b.png"},{"id":63035049,"identity":"f8010bfc-ed3b-47d5-bbea-79b980b9b5bf","added_by":"auto","created_at":"2024-08-22 10:14:09","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":2331749,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLEfSe analysis.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-4767166/v1/bcff6f74ed0c109f3bc13b20.png"},{"id":63036167,"identity":"37a93e8a-a8bf-4c37-bffe-4102a0431330","added_by":"auto","created_at":"2024-08-22 10:30:09","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":4197622,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of differential metabolites and metabolic pathways via non-targeted metabolomics. (A), (C) and (E): CIA model vs control; (B), (D) and (F): \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB. animalis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e BD400 vs control. Rich factor, it refers to the ratio of the number of differential metabolites annotated in a pathway to the number of all metabolites in that pathway; DA score, it refers to the ratio of difference between the number of up-regulated and down-regulated differential metabolites annotated on a pathway to the number of all metabolites on that pathway.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure10.png","url":"https://assets-eu.researchsquare.com/files/rs-4767166/v1/74954f65ee7ac489faba1281.png"},{"id":65644798,"identity":"c3d207d1-9aae-4f49-b9cf-de7140d63cbe","added_by":"auto","created_at":"2024-09-30 21:46:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":39961331,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4767166/v1/62291381-29e7-4c79-bf94-46afc84d8ffd.pdf"},{"id":63035053,"identity":"1b4e4a60-5210-4985-aaf0-b7e3c82170df","added_by":"auto","created_at":"2024-08-22 10:14:11","extension":"zip","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":131176398,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial.zip","url":"https://assets-eu.researchsquare.com/files/rs-4767166/v1/9e6a9dc636b8988602e83ae5.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"Bifidobacterium animalis BD400 alleviates collagen-induced arthritis through branched-chain amino acids (BCAAs) and ubiquinone biosynthesis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eRheumatoid arthritis (RA) is an autoimmune disease characterized by persistent synovial inflammation, cartilage and bone damage, and potential disability[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The global prevalence rates of RA range from 0.5\u0026ndash;1.0%[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], with lower rates in China at 0.2\u0026ndash;0.3%[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. RA is more common in females than in males[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. While the exact pathogenesis of RA remains unclear, certain risk factors such as family history, smoking, air pollution, periodontitis, and hormonal factors are associated with an increased likelihood of developing the disease[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Studies have shown that RA patients exhibit distinct alterations in gut microbiota compared to healthy individuals[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], which may contribute to systemic immune dysregulation[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Different strains of gut bacteria can have varying effects on immune system function, potentially influencing the development of RA[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Disease-modifying anti-rheumatic drugs (DMARDs) are commonly used in RA treatment and may indirectly impact gut microbiota composition to modulate systemic immunity[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Considering this therapeutic approach, there is interest in exploring whether early intervention targeting gut microbiota, such as probiotics, could potentially prevent the onset of RA.\u003c/p\u003e \u003cp\u003eProbiotics are defined as \u0026ldquo;live microorganisms that, when administered in adequate amounts, confer a health benefit on the host\u0026rdquo;[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Probiotics can inhibit the growth of pathogenic bacteria by competing for nutrition and colonization sites. Meanwhile, metabolites of probiotics can strengthen the intestinal barrier and modulate the host immune responses[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Three strains of \u003cem\u003eLactobacillus acidophilus\u003c/em\u003e, \u003cem\u003eLactobacillus casei\u003c/em\u003e, \u003cem\u003eBifidobacterium bifidum\u003c/em\u003e were provided for RA patients in a randomized, double-blind, placebo-controlled trial[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. After 8 weeks, RA patients receiving these probiotics showed improvement in Disease Activity Score of 28 joints (DAS-28) from \u0026minus;\u0026thinsp;0.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4 to -0.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4. Furthermore, insulin levels, homeostatic model assessment-B cell function (HOMA-B), and serum high-sensitivity C-reactive protein (hs-CRP) concentrations decreased significantly, along with improvements in total and low-density lipoprotein-cholesterol levels[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Given that most studies involve mixed strains of probiotics, the specific effects of a single strain, such as \u003cem\u003eBifidobacterium\u003c/em\u003e, remain unclear. While \u003cem\u003eBifidobacterium\u003c/em\u003e is known for its health benefits, further research is needed to determine if a single strain can replicate the effects of mixed probiotics.\u003c/p\u003e \u003cp\u003eThis study aims to restore the altered gut microbiota in RA patients to a healthy state through oral administration of \u003cem\u003eBifidobacterium\u003c/em\u003e, effectively slowing the onset and progression of RA. Clinical scores for arthritis and paw swelling thickness were used to assess arthritis symptoms, while bone damage severity was determined through knee joint pathology and staining in rats. Immune response was evaluated by measuring specific antibodies and cytokines in serum and synovial fluid. The expression of intestinal barrier proteins was analyzed using qPCR to assess intestinal barrier damage. Changes in gut microbiota composition and diversity were assessed through 16S high-throughput sequencing, and metabolomics was used to analyze metabolite production and associated pathways in rat feces. The findings of this study offer valuable insights for the potential use of probiotics in the clinical management of RA.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Materials\u003c/h2\u003e \u003cp\u003eBovine type II collagen solution, complete Freund`s adjuvant and incomplete Freund`s adjuvant were purchased from Chondrex (Redmon, WA, USA). Methotrexate (MTX) was purchased from Shanghai Yuanye Bio-Technology Co. (Ltd, Shanghai, China). Anti-TNF-α antibody and anti-MMP-13 antibody were purchased from Abcam (Cambridge, United Kingdom). Total CⅡ-IgG ELISA assay kit, CⅡ-IgG1 ELISA assay kit, CⅡ-IgG2a ELISA assay kit and CⅡ-IgG2b ELISA assay kit were purchased from Shanghai MuLuan Biological Technology Co. (Ltd, Shanghai, China). Rat TNF-α ELISA assay kit, rat IL-1β ELISA assay kit and rat IL-17A ELISA assay kit were purchased from Hangzhou Lianke Biotechnology Co. (LTD, Hangzhou, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Bacterial strain\u003c/h2\u003e \u003cp\u003eAll the probiotics, listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e, were deposited at State Key Laboratory of Dairy Biotechnology. The twenty strains were cultured in DeManRogosa-Sharpe (MRS) medium at 37\u0026deg;C overnight, and were harvested by centrifugation at 5000g for 10 min at 4\u0026deg;C. The bacterial precipitate was washed twice with saline. The concentration of each strain was re-suspended at 5 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e CFU/mL in saline, and stored at \u0026minus;\u0026thinsp;80\u0026deg;C prior to use. The viability of all the probiotics suspensions was measured by colony counting before daily oral administration.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eProbiotics used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStrains\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOrigin\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"4\" rowspan=\"5\"\u003e \u003cp\u003e\u003cem\u003eBifidobacterium\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB. longum\u003c/em\u003e BD3150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTibet feces\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB. animalis\u003c/em\u003e BD400\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGranted\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB. longum\u003c/em\u003e BD6256 (PP4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLong-lived people feces\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB. bifidum\u003c/em\u003e BD5348\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHealthy human (1\u0026ndash;3 years old)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB. breve\u003c/em\u003e BB12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGranted\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Animals and the experiment design\u003c/h2\u003e \u003cp\u003eFemale Wistar rats (7\u0026ndash;8 week-old) (Shanghai SLAC Laboratory Animal Ltd, Shanghai, China) were allowed to acclimatize for seven days before experimentation. The rats were given free access to food and water specific pathogen-free (SPF) standard laboratory conditions at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2 ℃ and humidity of 50% \u0026plusmn; 5%, with a 12 h light-dark cycle. This study was carried out in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals in China. Ethical approval for this study was obtained from Animal Ethics Committee of Shanghai Zhanyuan Biological Technology Co., LTD (approval No. 202306261).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Collagen-induced arthritis and treatment\u003c/h2\u003e \u003cp\u003eThe collagen-induced arthritis (CIA) animal model is the most commonly studied autoimmune model of rheumatoid arthritis. CIA was induced and assessed according to the previous method[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Briefly, bovine type II collagen solution (CII, Chondrex, Redmon, WA, USA) were emulsified with complete Freund\u0026rsquo;s adjuvant (CFA, Chondrex, Redmon, WA, USA) at a ratio of 1:1, and 150 ml emulsion were injected subcutaneously into the tail root of each rat for multi-point immunization at day 1. After seven days, bovine type II collagen solution (CII, Chondrex, Redmon, WA, USA) were emulsified with incomplete Freund\u0026rsquo;s adjuvant (IFA, Chondrex, Redmon, WA, USA) at a ratio of 1:1, and 150 ml emulsion were injected into the tail root of each rat for a booster immunization. The control rats were subcutaneously injected with 150 ml sterile saline. The experimental rats were subcutaneously injected with same volume of probiotic liquid. The experimental schedule is as Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Assessment of CIA-associated symptoms\u003c/h2\u003e \u003cp\u003eDuring the experiment, the weight of the rats was measured weekly. Since the arthritic symptoms developed at paw and joint, the paws thickness was measured using calipers and the severity of symptoms was assessed by an arthritis clinical score following the method described previously[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The quantitative clinical score is as follows: 0, no signs of erythema and swelling; 1, erythema and mild swelling limited to the tarsal bone or ankle joint; 2, erythema and mild swelling extending from the ankle joint to the tarsal bone; 3, Erythema and moderate swelling extending from the ankle joint to the metatarsal joint; 4, erythema and severe swelling of the ankles, feet, and fingers, or stiffness of the limbs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Histopathology analysis\u003c/h2\u003e \u003cp\u003eClinical condition and symptoms of each rat were evaluated by histological analysis with haematoxylin and eosin (H\u0026amp;E) and safranin O-fast green staining. Briefly, the joints were fixed in 10% formalin for 48 h, decalcified in 10% EDTA for 30 days, and embedded in paraffin. Tissue sections (5 \u0026micro;m thick) in the sagittal direction along the long axis of the knee were stained using H\u0026amp;E and safranin O-fast green staining.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Immunofluorescent staining\u003c/h2\u003e \u003cp\u003eFormalin-fixed paraffin-embedded samples (5 \u0026micro;m thick) were deparaffinized and retrieved with bone tissue antigen retrieval solution was in a wet box at 37 ℃ for 2 h. After sealed at room temperature for 1 h, samples were then incubated with the primary antibody (anti TNF-α and anti MMP-13, respectively) (Abcam, Cambridge, UK) at 4 ℃ overnight, followed by reaction with goat anti-rabbit secondary antibody (FITC) (Abcam, Cambridge, UK) at room temperature for 1 h in the dark. After washing, 4`,6-diamidino-2-phenylindole (DAPI) was applied for re-dyeing and incubated at room temperature for 5 min in the dark, and then the sample was sealed and observed under fluorescence microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Measurement of collagen-specific IgG and inflammatory factors by ELISA in serum and joint fluid\u003c/h2\u003e \u003cp\u003eTotal Ⅱ collagen-specific IgG (CⅡ-IgG), and its subclasses CⅡ-IgG1, CⅡ-IgG2a and CⅡ-IgG2b were detected by ELISA kits according to the manufacturer`s instructions. Inflammatory factors interleukin-1β (IL-1β), interleukin-17A (IL-17A) and tumor necrosis factor-α (TNF-α) in serum and synovial fluid were detected using an ELISA kit according to the manufacturer\u0026rsquo;s instructions (Hangzhou LianKe Biological Technology Co., Ltd, Hangzhou, China). OD values were measured by ELIASA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Quantitative real-time PCR\u003c/h2\u003e \u003cp\u003eThe transcription levels of ZO-1 and Occludin in rat ileum were measured via qPCR. Total RNA from rat ileum tissue was extracted using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA). Then, total RNA was analyzed as described previously[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The primers used are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Analysis of each sample was repeated three times. β-actin RNA was used as the endogenous control.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in quantitative real-time PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5`-3`)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer: TCAGGTCATCACTATCGGCAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse primer: AAAGAAAGGGTGTAAAACGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eZO-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer: TTTTTGACAGGGGGAGTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse primer: TGCTGCAGAGGTCAAAGTTCAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eOccludin-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer: GTCTTGGGAGCCTTGACATCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse primer: GCATTGTCGAACGTGCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eClaudin-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer: GGGACAACATCGTGACTGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse primer: CCACTAATGTCGCCAGACCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMUC-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer: AGATCCCGAAACCATGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse primer: GTTCCACATGAGGGAGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Analysis of the microbial community\u003c/h2\u003e \u003cp\u003eFecal samples were collected at the end of the experiment and stored at \u0026minus;\u0026thinsp;80\u0026deg;C. Total fecal DNA was extracted using the TIANamp Bacteria DNA Kit (TIANGEN Biotech, Beijing, China) according to the manufacturer\u0026rsquo;s instructions. The V3-V4 region of 16S rDNA was amplified using primer set 341F/806R and sequenced using a MiSeq sequencer (Illumina, San Diego, CA, USA). The microbial communities were further predicted by PICRUSt.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11. Fecal metabolomics\u003c/h2\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.11.1. Metabolites Extraction\u003c/h2\u003e \u003cp\u003eThe fecal samples (25 mg\u0026thinsp;\u0026plusmn;\u0026thinsp;1 mg) were taken, mixed with beads and 500 \u0026micro;L of extraction solution (MeOH : CAN : H\u003csub\u003e2\u003c/sub\u003eO, 2:2:1 (v/v)). The extraction solution contains deuterated internal standards. The mixed solution was vortexed for 30 s. These soil samples (100 mg\u0026thinsp;\u0026plusmn;\u0026thinsp;1 mg) were taken, mixed with beads and 500 \u0026micro;L of extraction solution (MeOH : CAN : H\u003csub\u003e2\u003c/sub\u003eO, 2:2:1 (v/v)). The extraction solution contains deuterated internal standards. The mixed solution was vortexed for 30 s.\u003c/p\u003e \u003cp\u003eThen the mixed samples were homogenized (35 Hz, 4 min) and sonicated for 5 min in 4 ℃ water bath, the step repeat for three times. The samples were incubated for 1 h at -40 ℃ to precipitate proteins. Then the samples ware centrifuged at 12000 rpm (RCF\u0026thinsp;=\u0026thinsp;13800(\u0026times;g), R\u0026thinsp;=\u0026thinsp;8.6cm) for 15 min at 4 ℃. The supernatant was transferred to a fresh glass vial for analysis. The quality control (QC) sample was prepared by mixing an equal aliquot of the supernatant of samples.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.11.2. LC-MS Analysis\u003c/h2\u003e \u003cp\u003eFor polar metabolites, LC-MS/MS analyses were performed using an UHPLC system (Vanquish, Thermo Fisher Scientific) with a Waters ACQUITY UPLC BEH Amide (2.1 mm \u0026times; 50 mm, 1.7 \u0026micro;m) coupled to Orbitrap Exploris 120 mass spectrometer (Orbitrap MS, Thermo). The mobile phase consisted of 25 mmol/L ammonium acetate and 25 ammonia hydroxide in water(pH\u0026thinsp;=\u0026thinsp;9.75)(A) and acetonitrile (B). The auto-sampler temperature was 4 ℃, and the injection volume was 2 \u0026micro;L. The Orbitrap Exploris 120 mass spectrometer was used for its ability to acquire MS/MS spectra on information-dependent acquisition (IDA) mode in the control of the acquisition software (Xcalibur, Thermo). In this mode, the acquisition software continuously evaluates the full scan MS spectrum. The ESI source conditions were set as following: sheath gas flow rate as 50 Arb, Aux gas flow rate as 15 Arb, capillary temperature 320 ℃, full MS resolution as 60000, MS/MS resolution as 15000, collision energy: SNCE 20/30/40, spray voltage as 3.8 kV (positive) or -3.4 kV (negative), respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.11.3 Data preprocessing and annotation\u003c/h2\u003e \u003cp\u003eThe raw data were converted to the mzXML format using ProteoWizard and processed with an in-house program. which was developed using R and based on XCMS, for peak detection, extraction, alignment, and integration. The R package and the BiotreeDB(V3.0) were applied in metabolite identification[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.12. Statistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were performed using SPSS 19.0 statistical software (SPSS Inc., Chicago, IL, USA). The results were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Statistical differences among the groups were assessed by one-way ANOVA, and multiple comparisons were performed using Tukey HSD test. Values of \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.1 \u003cem\u003eBifidobacterium\u003c/em\u003e significantly alleviates experimental arthritis\u003c/h2\u003e \u003cp\u003eAfter a seven-day acclimatization period, Wistar rats were administered either a \u003cem\u003eBifidobacterium\u003c/em\u003e solution or sterile saline orally on day 0. The CIA model group, MTX group, and \u003cem\u003eBifidobacterium\u003c/em\u003e solution group were induced as CIA models with primary immunization on day 14 and booster immunization on day 21. The \u003cem\u003eBifidobacterium\u003c/em\u003e solution group received oral gavage of \u003cem\u003eBifidobacterium\u003c/em\u003e solution (2 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e CFU) from day 0 to day 63. The CIA model and control groups were orally gavaged with sterile saline from day 0 to day 63. The MTX group received sterile saline orally from day 0 to day 63 and was treated with MTX twice a week from day 14 to day 63 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Paw photos of each group of rats on day 63 are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. A comparison between Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH reveals significant redness and swelling in the feet and fingers of the CIA rats. The \u003cem\u003eBifidobacterium\u003c/em\u003e intervention demonstrated a reduction in this redness and swelling (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe study recorded the body weight, clinical scores, and paw thickness of rats to evaluate the severity of arthritis. Prominent symptoms of CIA rats, such as swelling and reddening, appeared on day 21. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI, the weight of CIA rats began to decrease, but by day 35, it had returned to an upward trend as RA stabilized. In contrast, the control group's rat weight steadily increased. The MTX group's rat weight hit its lowest point on day 49. Between days 42 and 63, the MTX group's rat weight was consistently lower than that of the CIA model group, likely due to MTX's hepatotoxic nature causing gastrointestinal discomfort like vomiting and diarrhea. This resulted in lower body weight compared to the model group. Similarly, the weight of rats in the \u003cem\u003eBifidobacterium\u003c/em\u003e groups (BD3150, BD400, BD6256, BD5348, BB12) exhibited a pattern of initial increase, subsequent decrease, and final rise. There were minimal differences in rat weight among the \u003cem\u003eBifidobacterium\u003c/em\u003e groups.\u003c/p\u003e \u003cp\u003eArthritis onset was observed in rats one week after booster immunization, with arthritis clinical scores and paw thickness recorded (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eK). Paw swelling in CIA rats continued to increase from day 28 to day 42, peaking on day 42 before entering a stable phase with gradual reduction in swelling. While MTX intervention did not show immediate effects in early arthritis stages, it did reduce paw swelling in later stages. Disease activity persisted after MTX treatment, a common scenario in RA management[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. \u003cem\u003eBifidobacterium\u003c/em\u003e administration reduced paw swelling in CIA rats, with the most significant difference seen in the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Histopathological analysis of CIA rats` joint improved by \u003cem\u003eBifidobacterium\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eThe knee joints of rats were collected for histopathological analysis. Bone erosion in the knee joints was observed through HE staining, while cartilage damage was assessed using safranin O-fast green staining. In Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH, joint staining in normal rats appeared uniform, with round chondrocytes evenly arranged and abundant extracellular collagen fibers. Conversely, the knee bones of CIA rats showed severe damage, with less stained cartilage matrix indicating significant collagen loss, along with damage to the synovial membrane and cartilage (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Rats in the \u003cem\u003eBifidobacterium\u003c/em\u003e and MTX groups exhibited uniformly colored joints and cartilage, suggesting restoration of inflammatory damage and collagen loss in the joints (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003eSafranin O-fast green staining can reveal cartilage damage by coloring normal cartilage layers, hyaline cartilage (HC) and calcified cartilage (CC), in red, while coloring cancellous bone layers in green. HC contains active chondrocytes responsible for repairing the cartilage matrix, whereas CC represents mineralized HC. Thicker CC layers can impede the flow of liquid and small organic molecules into HC, hindering chondrocyte growth [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In the study, normal rats exhibited thick and intact HC layers with a clearly visible tidal line, along with moderately thick CC layers (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). Conversely, rats in the CIA model group showed reduced HC thickness, intensified cartilage matrix degradation, and thickened mineralized CC layers (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Treatment with \u003cem\u003eBifidobacterium\u003c/em\u003e increased HC thickness and decreased CC thickness in CIA rats, indicating a reduction in inflammation levels that promoted chondrocyte biological activity and alleviated RA development (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Specifically, the \u003cem\u003eBifidobacterium\u003c/em\u003e group showed knee bone and cartilage conditions similar to those of the normal group, with both \u003cem\u003eB. longum\u003c/em\u003e BD3150 and \u003cem\u003eB. animalis\u003c/em\u003e BD400 groups exhibiting comparable results\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Expression of inflammatory markers in rat joint tissues\u003c/h2\u003e \u003cp\u003eImmunofluorescence staining was conducted on histopathologic sections of rat knee joints to examine TNF-α and MMP-13 distribution (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In the control group, articular cartilage appeared normal with no positive fluorescence. However, in the CIA model group, increased TNF-α and MMP-13 proteins were observed. Treatment with \u003cem\u003eBifidobacterium\u003c/em\u003e led to reduced protein expression, particularly in the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group. Quantitative analysis using Image J software showed significantly higher fluorescence in the CIA model group compared to controls (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). \u003cem\u003eBifidobacterium\u003c/em\u003e intervention decreased fluorescence significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), with no difference between the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group and control (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Effect of \u003cem\u003eBifidobacterium\u003c/em\u003e on specific antibody of CIA rats\u003c/h2\u003e \u003cp\u003eAnti-CII IgG is a specific antibody that targets type II collagen and plays a crucial role in the development of arthritis in CIA rats. It is known to induce or worsen arthritis and can be used to evaluate the severity of the disease. Lowering the production of these autoantibodies can effectively halt the progression of arthritis[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In this study, the impact of \u003cem\u003eBifidobacterium\u003c/em\u003e on the humoral immunity of CIA rats was assessed by measuring the levels of CII-specific antibodies. The study measured the levels of total anti-CII IgG as well as its subtypes (anti-CII IgG1, IgG2a, IgG2b) in the serum. Results showed that the levels of these antibodies were significantly higher in the CIA model group compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Treatment with MTX reduced these antibody levels to a level comparable to that of normal rats. Oral administration of \u003cem\u003eBifidobacterium\u003c/em\u003e in CIA rats also led to a notable decrease in these antibody levels. Specifically, the \u003cem\u003eB. longum\u003c/em\u003e BD3150 and \u003cem\u003eB. animalis\u003c/em\u003e BD400 groups showed significantly lower levels of total anti-CII IgG and its subtypes compared to the CIA model group. These findings suggest that \u003cem\u003eB. longum\u003c/em\u003e BD3150 and \u003cem\u003eB. animalis\u003c/em\u003e BD400 may help alleviate inflammatory damage induced by autoantibodies by reducing the levels of anti-CII IgG, IgG1, and IgG2a\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Effect of \u003cem\u003eBifidobacterium\u003c/em\u003e on immune responses of CIA rats\u003c/h2\u003e \u003cp\u003eCytokine levels in serum serve as indicators of systemic inflammatory immune response, reflecting the overall inflammatory status of the body. Notably, IL-1 and TNF-α are key inflammatory mediators in RA, with IL-17 playing a significant role in promoting the secretion of IL-1 and TNF-α by inflammatory cells. In the study (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE), levels of IL-17A in the serum of the CIA model group were markedly higher compared to other groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Treatment with MTX led to a significant reduction in IL-17A levels in the serum of CIA rats (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Furthermore, administration of \u003cem\u003eB. longum\u003c/em\u003e BD3150 and \u003cem\u003eB. animalis\u003c/em\u003e BD400 to CIA rats resulted in a significant decrease in IL-17A levels in serum (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). Additionally, analysis of synovial fluid from rats revealed elevated levels of TNF-α and IL-1β in the CIA model group compared to control groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Treatment with \u003cem\u003eB. longum\u003c/em\u003e BD3150 and \u003cem\u003eB. animalis\u003c/em\u003e BD400 significantly lowered TNF-α and IL-1β levels in the synovial fluid of CIA rats (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These findings suggest that \u003cem\u003eB. longum\u003c/em\u003e BD3150 and \u003cem\u003eB. animalis\u003c/em\u003e BD400 effectively reduce inflammation in both the blood and joint fluid of CIA rats.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Effects of \u003cem\u003eBifidobacterium\u003c/em\u003e on intestinal barrier related protein genes in CIA rats\u003c/h2\u003e \u003cp\u003eIntestinal barrier proteins, such as claudin-1, occludin-1, mucin-2 (MUC-2), and zonula occluden-1 (ZO-1), play a crucial role in maintaining normal intestinal barrier function. Gene expression analysis in a CIA model group revealed a significant decrease in occludin-1 and MUC-2 levels, an increase in claudin-1 expression, and no notable change in ZO-1 levels compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Treatment with \u003cem\u003eBifidobacterium\u003c/em\u003e led to a significant increase in occludin-1 and MUC-2 expression, while claudin-1 levels decreased. In the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group, there was a significant increase in occludin-1, MUC-2, and ZO-1 expression, with a decrease in claudin-1 levels. Occludin-1 regulates intercellular ion transport, while MUC-2 is a mucin produced by goblet cells in the intestinal wall. The modulation of occludin-1 and MUC-2 by \u003cem\u003eB. animalis\u003c/em\u003e BD400 can enhance intestinal selective permeability, reduce the influx of harmful substances into the internal environment, and maintain internal homeostasis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e3.7 Effects of \u003cem\u003eBifidobacterium\u003c/em\u003e on the composition and diversity of gut microbiota\u003c/h2\u003e \u003cp\u003eFaecal samples were collected to evaluate the impact of \u003cem\u003eBifidobacterium\u003c/em\u003e on the gut microbiota of CIA rats through 16S rDNA V3-V4 sequencing. A total of 3,276,658 valid sequences were obtained after double-end splicing, quality control, and chimera filtering. Through amplicon sequence variants (ASVs) cluster analysis and species annotation, 50,065 ASVs were identified, with an average of 1,043 ASVs per sample. The species accumulation curve in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA shows a plateau as sample size increases, indicating sufficient sampling. Additionally, the dilution curve in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB flattens with the increase in sample sequences, suggesting an appropriate amount of sequencing data. Significant differences in Chao1 index, Shannon index, and Simpson index were observed between the CIA model group and the control group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC-\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE. Following the intervention of certain \u003cem\u003eBifidobacterium\u003c/em\u003e strains, there was a notable increase in species richness within the gut microbiota of CIA rats (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Specifically, the Chao1 index, Shannon index, and Simpson index significantly increased in the \u003cem\u003eB. longum\u003c/em\u003e BD3150 group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), while the Shannon index and Simpson index notably increased in the \u003cem\u003eB. bifidum\u003c/em\u003e BD5348 group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These findings indicate substantial disparities in species diversity within the gut microbiota of CIA rats compared to normal rats, and highlight the potential of \u003cem\u003eB. longum\u003c/em\u003e BD3150 and \u003cem\u003eB. bifidum\u003c/em\u003e BD5348 interventions in mitigating the reduction in intestinal species diversity induced by arthritis.\u003c/p\u003e \u003cp\u003ePrincipal component analysis (PCA), principal coordinate analysis (PCoA), and nonmetric multidimensional scaling (NMDS) were utilized to compare the distribution profiles of fecal microorganisms in eight groups. Figure\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF-\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eH demonstrates a significant difference in PCA, PCoA, and NMDS between the CIA model group (purple circle) and the control group (pink circle). Upon administration of \u003cem\u003eBifidobacterium\u003c/em\u003e, there were significant alterations in the distribution profiles, particularly in the \u003cem\u003eB. longum\u003c/em\u003e BD3150 group and the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group in PCoA. Adonis analysis revealed a significant difference in the species composition of gut microbiota among the eight groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.001) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAdonis Multivariate Analysis based on Bray-Curtis Distance\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSum of sqs\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eResidual\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDf, Degree of freedom; Sum of sqs, sum of squares of deviations; R\u003c/b\u003e \u003csup\u003e \u003cb\u003e2\u003c/b\u003e \u003c/sup\u003e, \u003cb\u003eR\u003c/b\u003e\u003csup\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sup\u003e \u003cb\u003erepresents the interpretation of sample differences by different groups, that is, the ratio of group variance to total variance; F, F test value;\u003c/b\u003e \u003cb\u003ep\u003c/b\u003e, \u003cb\u003ep\u003c/b\u003e \u003cb\u003evalue\u003c/b\u003e, \u003cb\u003ep\u003c/b\u003e\u0026thinsp;\u003cb\u003e\u0026lt;\u0026thinsp;0.05 indicates a high degree of reliability.\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBased on ASV annotation results and the ASV abundance table for each sample, we generated a species abundance table at various taxonomic levels including kingdom, phylum, class, order, family, genus, and species. Utilizing this information along with species annotation data, we identified the top 30 species for constructing cluster stacked bar charts at the phylum and genus levels. In Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA, \u003cem\u003eFirmicutes\u003c/em\u003e and \u003cem\u003eBacteroidota\u003c/em\u003e emerge as the predominant phyla in rat gut bacteria, with a higher proportion observed in the CIA model group compared to the control group. Following intervention with specific strains of \u003cem\u003eBifidobacterium\u003c/em\u003e, the ratio of \u003cem\u003eFirmicutes\u003c/em\u003e and \u003cem\u003eBacteroidota\u003c/em\u003e exhibited alterations. Notably, clustering based on Bray-Curtis distance revealed that the \u003cem\u003eB. breve\u003c/em\u003e BB12 group closely resembled the control group in terms of \u003cem\u003eFirmicutes\u003c/em\u003e and \u003cem\u003eBacteroidota\u003c/em\u003e percentages. Moving to the genus level (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB), the top 5 species included \u003cem\u003eClostridia_UCG-014\u003c/em\u003e_unclassified, \u003cem\u003eLactobacillus\u003c/em\u003e, \u003cem\u003eLigilactobacillus\u003c/em\u003e, \u003cem\u003eLachnospiraceae\u003c/em\u003e_unclassified, and \u003cem\u003eFirmicutes\u003c/em\u003e_unclassified. The proportion of these species differed significantly between the CIA model group (50.72%) and the control group (34.57%) (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Upon \u003cem\u003eBifidobacterium\u003c/em\u003e administration, a decrease in the percentages of these top 5 species was observed, particularly in the \u003cem\u003eB. bifidum\u003c/em\u003e BD5348 group.\u003c/p\u003e \u003cp\u003eTo further investigate the species contributing to the differences between groups, a differential abundance analysis was conducted. In Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC, \u003cem\u003eDesulfobacterota\u003c/em\u003e at the phylum level exhibited the most significant difference between the CIA model group and the control group. Following the administration of \u003cem\u003eB. breve\u003c/em\u003e BB12, there was an increase in the relative abundance of \u003cem\u003eDesulfobacterota\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). At the genus level, \u003cem\u003eLactobacillus\u003c/em\u003e showed the most significant difference between the CIA model group and the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). Additionally, \u003cem\u003eRuminococcus\u003c/em\u003e and HT002 were also found to differ between the CIA model group and the control group. Notably, there was no observed increase in \u003cem\u003eRuminococcus\u003c/em\u003e with the administration of \u003cem\u003eBifidobacterium\u003c/em\u003e, while \u003cem\u003eB. animalis\u003c/em\u003e BD400 reduced the relative abundance of HT002.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe LEfSe tool was utilized to identify biomarkers between groups. In Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e, 26 types of bacteria showed significant differences across various classification levels including phylum, class, order, family, and genus in the control group. The top 5 bacteria with notable differences were \u003cem\u003eRuminococcus\u003c/em\u003e_unclassified, \u003cem\u003eRuminococcus\u003c/em\u003e, \u003cem\u003eRuminococcaceae\u003c/em\u003e, \u003cem\u003eTuricibacter\u003c/em\u003e_unclassified, and \u003cem\u003eTuricibacter\u003c/em\u003e. In the \u003cem\u003eB. bifidum\u003c/em\u003e BD5348 group, 7 types of bacteria exhibited significant differences, namely \u003cem\u003eRuminococcus\u003c/em\u003e_bromii, \u003cem\u003eRuminococcus\u003c/em\u003e, \u003cem\u003eRuminococcaceae\u003c/em\u003e, \u003cem\u003eChristensenellales\u003c/em\u003e, \u003cem\u003eChristensenellaceae\u003c/em\u003e, \u003cem\u003eChristensenellaceae\u003c/em\u003e_R_7_group, and \u003cem\u003eChristensenellaceae\u003c/em\u003e_R_7_group_unclassified. These results indicate that both the \u003cem\u003eB. bifidum\u003c/em\u003e BD5348 group and the control group share biomarkers such as \u003cem\u003eRuminococcus\u003c/em\u003e and \u003cem\u003eRuminococcaceae\u003c/em\u003e, suggesting that the intervention of \u003cem\u003eB. bifidum\u003c/em\u003e BD5348 alters the gut microbiota of CIA rats to resemble that of normal rats.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e3.8 Untargeted metabolomics of gut microbiota\u003c/h2\u003e \u003cp\u003eA total of 11632 peaks in positive ion mode and 9769 peaks in negative ion mode were retained after quality control. Differential metabolites between the control and treatment groups were identified based on the variable importance in the projection (VIP) of the OPLS-DA model. Subsequently, a T-test was conducted using SPSS 19.0 statistical software to perform statistical analysis. The criteria for screening differential metabolites included ∣Log2FOLD CHANGE∣\u0026gt;1, p 1. The ratio of each differential metabolite was calculated and transformed logarithmically with a base of 2.\u003c/p\u003e \u003cp\u003eThe comparison of differential metabolites between the CIA model group and the control group was presented in Figs.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA and \u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eB. Each \u003cem\u003eBifidobacterium\u003c/em\u003e group was compared individually with the control group. Notably, the changes in differential metabolites between the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group and the control group were found to be opposite to those between the CIA model group and the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eB). For instance, purine nucleosides like crotonoside guanosine, 2'-deoxyuridine, and xanthosine were significantly up-regulated in the CIA model group but down-regulated in the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group. Similarly, the fatty acid metabolite 2-ketobutyric acid showed significant up-regulation in the CIA model group but down-regulation in the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group. On the other hand, glycerin phospholipids such as 2-O-(4,7,10,13,16,19-docosahexaenoyl)-1-O-hexadecylglycero-3-phosphocholine, momordicinin, and botulin were significantly down-regulated in the CIA model group but up-regulated in the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group. These contrasting results between the CIA model group and \u003cem\u003eB. animalis\u003c/em\u003e BD400 group suggest that \u003cem\u003eB. animalis\u003c/em\u003e BD400 may possess the ability to mitigate the abnormal differential metabolite profiles associated with RA.\u003c/p\u003e \u003cp\u003eA radar chart (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eC and \u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eD) was utilized to illustrate the variation trend in the content of differential metabolites. The red font represents the difference multiple for each grid line, while the purple shadow consists of the difference multiple lines for each metabolite. Overall, Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eC predominantly shows positive difference multiples, indicating an increasing trend, whereas Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eD mostly displays negative difference multiples, suggesting a decreasing trend. Figure\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eC compares the content of the same differential metabolite in the CIA model group and the control group, revealing higher levels of certain metabolites in the CIA model group such as orotic acid, 3-hydroxyisovaleric acid, terephthalic acid, uric acid, N-acetylmuramic acid, 5-hydroxyhexanoic acid, Ile-Leu, Leu-Leu, and 4-hydroxybenzoic acid compared to the control group. Conversely, trigonelline was lower in the CIA model group than in the control group. In Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eD, prolylhydroxyproline in the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group exhibited higher levels compared to the control group, while 3,3-dimethylglutaric acid, dimethylmalonic acid, 3-amino-4-methylpentanic acid, 2-ketobutyric acid, tetradecyl sulfate, 3-hydroxybenzaldehyde, isoleucine, pyruvate, and LacCer(d18:1/16:0) in the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group were lower than in the control group. The contrasting trends in difference multiples between the CIA model group and the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group demonstrate the potential of \u003cem\u003eB. animalis\u003c/em\u003e BD400 to restore intestinal metabolite disturbance.\u003c/p\u003e \u003cp\u003eThe role of these differential metabolites was investigated by annotating the metabolic and regulatory pathways they are associated with. Enrichment results (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eE and \u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eF) revealed that the differential metabolites primarily belonged to metabolic pathways, suggesting that the CIA model construction significantly impacted the metabolic pathways of rats, and \u003cem\u003eB. animalis\u003c/em\u003e BD400 also influenced the metabolic pathways of CIA rats. The differential abundance score (DA score) calculations indicated a positive trend for all metabolites in these pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eG), whereas in the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group, metabolites in each pathway exhibited a decreasing trend (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003eTo pinpoint key metabolic pathways highly correlated with metabolite differences, enrichment analysis and topological analysis were conducted. Notably, in CIA rats, pyrimidine metabolism, valine, leucine, and isoleucine biosynthesis, starch and sucrose metabolism, beta-alanine metabolism, riboflavin metabolism, and pyruvate metabolism were significantly altered (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eI). Conversely, \u003cem\u003eB. animalis\u003c/em\u003e BD400 primarily influenced valine, leucine, and isoleucine biosynthesis, ubiquinone and other terpenoid-quinone biosynthesis, citrate cycle, pyruvate metabolism, glycolysis or gluconeogenesis, and tyrosine metabolism (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eJ).\u003c/p\u003e \u003cp\u003eThe study delved deeper into the expression of metabolites and enzymes involved in valine, leucine, and isoleucine biosynthesis, as well as ubiquinone and other terpenoid-quinone biosynthesis, in the presence or absence of oral \u003cem\u003eB. animalis\u003c/em\u003e BD400. Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e illustrates that in the absence of oral \u003cem\u003eB. animalis\u003c/em\u003e BD400, 2-oxobutanoate, pyruvate, 2-oxoisovalerate, and 4-methyl-2-oxopentanoate showed high expression levels in the biosynthesis of valine, leucine, and isoleucine. Conversely, when oral \u003cem\u003eB. animalis BD400\u003c/em\u003e was present, the expression of these metabolites was down-regulated in the biosynthesis pathways of these amino acids. Valine, leucine, and isoleucine are classified as branched-chain amino acids (BCAAs), which are crucial amino acids that cannot be synthesized in animals but can be produced in plants and microorganisms. The findings suggest that \u003cem\u003eB. animalis\u003c/em\u003e BD400 influences the biosynthesis of BCAAs in the gut microbiota. Furthermore, in the process of ubiquinone and other terpenoid-quinone biosynthesis (Figure S2), 4-hydroxybenzoate exhibited high expression levels in the absence of oral \u003cem\u003eB. animalis\u003c/em\u003e BD400, which was not observed when the probiotic was administered. Additionally, 4-hydroxyphenylpyruvate, with low expression in the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group, did not show significant changes in the CIA model group. These results indicate that \u003cem\u003eB. animalis\u003c/em\u003e BD400 may alleviate symptoms of RA by modulating the metabolic pathways involved in valine, leucine, and isoleucine biosynthesis, as well as ubiquinone and other terpenoid-quinone biosynthesis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eRA is a chronic, symmetrical, systemic, inflammatory autoimmune disease with complex etiology and unclear pathogenesis[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. While there are drugs available to treat RA, there is still no effective treatment. In the early stages, RA presents with joint swelling, pain, and dysfunction. As RA progresses, it is marked by different levels of joint stiffness, bone and skeletal muscle atrophy, and can be highly disabling if not treated regularly[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNumerous studies conducted worldwide have demonstrated a strong correlation between RA and gut microbiota. For instance, a study in the United States utilized 16S sequencing of stool samples taken from 114 RA patients and healthy individuals, revealing an increase in \u003cem\u003ePrevotella copri\u003c/em\u003e abundance in RA patients, which was linked to a reduction in \u003cem\u003eBacteroides\u003c/em\u003e levels and a decline in beneficial microbes[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Similarly, a Japanese study involving 17 early RA patients observed a similar trend with an increase in \u003cem\u003ePrevotella copri\u003c/em\u003e abundance and a decrease in \u003cem\u003eBacteroides\u003c/em\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Furthermore, researchers Vaahtovuo et al. from Finland employed 16S rRNA hybridization and DNA staining techniques to analyze the fecal microbiota of 51 early RA patients. A comparison with fibromyalgia patients showed a significant decrease in the levels of bacteria within the \u003cem\u003eBifidobacteria\u003c/em\u003e and \u003cem\u003eBacteroides\u003c/em\u003e-\u003cem\u003ePorphyromonas\u003c/em\u003e-\u003cem\u003ePrevotella\u003c/em\u003e group, \u003cem\u003eBacteroides fragilis\u003c/em\u003e subgroup, and \u003cem\u003eEubacterium rectale\u003c/em\u003e-\u003cem\u003eClostridium coccoides\u003c/em\u003e group among early RA patients[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Zhang et al. conducted a study in China where they analyzed the oral and gut microbiota of 212 fecal samples from both RA patients and healthy controls using metagenomic shotgun sequencing. Their findings revealed a decrease in \u003cem\u003eHaemophilus spp.\u003c/em\u003e in the gut, dental, or saliva microbiome of RA patients, while an increase in \u003cem\u003eLactobacillus salivarius\u003c/em\u003e was observed in these same microbiomes of RA patients[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Maeda et al. further explored the connection between gut microbiota and RA by transplanting feces from RA patients into germ-free mice. The mice gradually developed ankle swelling two weeks post-transplant and eventually developed RA[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Additionally, Zeng et al. successfully treated a 20-year-old woman with refractory RA using fecal microbiota transplantation (FMT). By administering fecal suspensions from healthy eight-year-old donors via colonoscopy, they observed no adverse reactions during or after FMT. Notably, the patient's rheumatic factors significantly decreased (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05) at 42 days post-FMT, with RA symptoms showing improvement 78 days post-FMT[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. These findings underscore the crucial role of gut microbiota in the pathogenesis and progression of RA.\u003c/p\u003e \u003cp\u003e \u003cem\u003eBifidobacterium\u003c/em\u003e, the predominant microbe in the gastrointestinal tract, plays a crucial role in maintaining the balance of gut microbiota and overall host health. Numerous clinical, in vivo, and in vitro studies have demonstrated the beneficial effects of \u003cem\u003eBifidobacterium\u003c/em\u003e on conditions such as inflammatory bowel disease, irritable bowel syndrome, cancer, diarrhea, and lactose intolerance. \u003cem\u003eBifidobacterium\u003c/em\u003e exerts its effects by inhibiting the growth of pathogens, preserving gut microbiota balance, and safeguarding intestinal barrier integrity through the reduction of intestinal pH[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Moreover, \u003cem\u003eBifidobacterium\u003c/em\u003e produces a variety of metabolites that are advantageous to the host, including vitamins, polyphenols, conjugated linoleic acid, and short-chain fatty acids. These metabolites also have harmful effects on pathogenic microorganisms, such as organic acids, bacteriocins, and bio-surfactants, thereby impeding the proliferation of harmful microorganisms[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Additionally, \u003cem\u003eBifidobacterium\u003c/em\u003e aids in the breakdown of carbohydrate compounds in the host and from dietary sources through sugar degradation pathways, promoting healthy host metabolism. This feature not only ensures the survival of \u003cem\u003eBifidobacterium\u003c/em\u003e in the mammalian intestine but also provides essential nutrients for the host and other intestinal microorganisms through cross-feeding[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Jeong et al. identified a novel \u003cem\u003eBifidobacterium longum\u003c/em\u003e RAPO with therapeutic potential from microbiome analysis of RA patients with varying rheumatoid factor (RF) levels. Oral administration of \u003cem\u003eB. longum\u003c/em\u003e RAPO significantly reduced RA incidence, arthritis score, inflammation, bone injury, cartilage injury, Th17 cells, and inflammatory cytokine secretion in CIA mice[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Furthermore, patents suggest that certain \u003cem\u003eBifidobacterium\u003c/em\u003e strains may have preventive or therapeutic effects on RA[\u003cspan additionalcitationids=\"CR29 CR30\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. This study demonstrated that oral administration of \u003cem\u003eB. animalis\u003c/em\u003e BD400 for nine weeks notably decreased arthritis clinical scores and paw thickness in CIA rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eK). Histological analysis of knee joint sections and staining of rats revealed that \u003cem\u003eB. animalis\u003c/em\u003e BD400 improved the interface between synovium and bone tissue, reduced cell infiltration and synovial hyperplasia, restored the thickness and integrity of the hyaline cartilage layer, ultimately alleviating RA symptoms (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe impact of \u003cem\u003eB. animalis\u003c/em\u003e BD400 on RA symptoms prompted further investigation into its effects on specific antibodies and pro-inflammatory factors in the serum and joint fluid of CIA rats. Collagen-induced arthritis, a well-established model for RA, shares key characteristics with human RA, notably immune tolerance breakdown and autoantibody production[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Autoantibodies, particularly anti-CII IgG antibodies specific to type II collagen, play a crucial role in RA diagnosis and disease progression. High levels of these autoantibodies can be detected in serum well before clinical symptoms manifest[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In this study, anti-CII IgG and its subtypes (IgG1, IgG2a, and IgG2b) were measured in the serum of CIA rats. Levels of these antibodies were significantly elevated in CIA rats compared to the control group. Treatment with \u003cem\u003eB. longum\u003c/em\u003e BD3150 and \u003cem\u003eB. animalis\u003c/em\u003e BD400 led to a significant decrease in anti-CII IgG, IgG1, and IgG2a levels (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Meanwhile, we assessed the production of pro-inflammatory factors, including IL-17A, TNF-α, and IL-1β, in both serum and synovial fluid. The levels of IL-17A in serum, as well as TNF-α and IL-1β in synovial fluid, were significantly reduced with the administration of \u003cem\u003eB. longum\u003c/em\u003e BD3150 and \u003cem\u003eB. animalis\u003c/em\u003e BD400. These inflammatory factors play a crucial role in cellular communication. Notably, TNF-α, IL-6, and IL-1β are commonly studied in the context of RA. TNF-α, a member of the tumor necrosis factor family, triggers the production of various cytokines and proteases by target cells in RA, primarily through the NF-κB and MAPK signaling pathways[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. This cascade of inflammatory responses leads to a continuous cycle of inflammation, contributing to bone and joint erosion[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. As a result, the components of the articular cavity, such as synovial cells, synovial tissue fluid, and serum in CIA rats, exhibited an increasing trend compared to healthy controls. The intervention of \u003cem\u003eB. longum\u003c/em\u003e BD3150 and \u003cem\u003eB. animalis\u003c/em\u003e BD400 reduced the levels of TNF-α in the synovial fluid of CIA rats, suggesting the disruption of this persistent inflammatory cycle. In RA, antigen-presenting cells carrying HLA-DR antigen increase and stimulate CD4\u0026thinsp;+\u0026thinsp;T lymphocytes to secrete numerous cytokines, activating synovial macrophages to release IL-1β and TNF⁃α[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. These cytokines target joint cells, leading to the production of collagen and neutral protease, ultimately causing synovial proliferation and erosion of joint cartilage, worsening the disease[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. While IL⁃1β levels are typically low in the knee fluid of healthy individuals, our study found elevated levels of IL-1β in the joint fluid of collagen-induced arthritis (CIA) rats. Treatment with B. longum BD3150 and B. animalis BD400 reduced IL-1β levels in the knee fluid of CIA rats. IL-17A, a key inflammatory mediator in RA, is primarily produced by CD4\u0026thinsp;+\u0026thinsp;Th17 cells, as well as CD8\u0026thinsp;+\u0026thinsp;T cells, NK T cells, γδT cells, neutrophils, and lymphoid tissue inductor-like cells [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. IL-17A works in conjunction with TNF-α to promote osteogenesis, induce PEG production in chondrocytes, stimulate fibroblast-like synoviocytes (FLS) to secrete various inflammatory factors, and activate pathways like PI3K/Akt and NF⁃κB, leading to synovial inflammation and cartilage damage[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Consequently, IL⁃17A levels are higher in the synovial fluid and surrounding tissues of RA patients compared to healthy individuals. Our study demonstrated a significant decrease in serum IL-17A levels in CIA rats following the oral administration of probiotics, highlighting the potential of \u003cem\u003eB. longum\u003c/em\u003e BD3150 and \u003cem\u003eB. animalis\u003c/em\u003e BD400 in mitigating RA-related inflammation.\u003c/p\u003e \u003cp\u003eThe occurrence and development of RA is closely linked to disruptions in both local and systemic immune responses, stemming from immune sites beyond the joints, known as the \"mucosal origin hypothesis\"[\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The gut, recognized as the largest immune organ, harbors a diverse population of microorganisms that not only provide essential nutrients and energy to the body but also play a role in shaping and regulating the intestinal mucosal immune system[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. These intestinal microorganisms interact with, respond to, and regulate the intestinal mucosa through the intestinal mucosal barrier[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The tight connection between the mucus barrier and intestinal epithelial cells serves as the primary defense against pathogens[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Key proteins involved in maintaining the integrity of the intestinal barrier include claudin-1, occludin-1, mucin-2 (MUC-2), and zonula occludens-1 (ZO-1). In a study involving collagen-induced arthritis (CIA) rats, it was found that the expression of occludin-1 and MUC-2 in the gut was significantly reduced compared to control rats (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), while the expression of claudin-1 was significantly increased (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Treatment with 5 strains of \u003cem\u003eBifidobacterium\u003c/em\u003e (BD3150, BD400, BD6256, BD5348, BB12) restored the expression of these three proteins (claudin-1, occludin-1, and MUC-2) to normal levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). The relationship between gut microbiota and human health is integral, as gut microbiota are present throughout the human life cycle. Changes in gut microbiota composition result from specific interactions between microorganisms and the gut environment. The evolution and selection process of the gut microbiota remains unclear, but there is growing interest in the co-evolution and mutual interaction between the gut microbiota and the host intestinal immune system. The intestinal microbiota plays a crucial role in supporting the development of the immune system through various mechanisms and helps maintain a balanced intestinal micro-ecology[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Imbalances in the intestinal micro-ecology have been linked to various diseases, including intestinal and immune disorders[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. This imbalance can lead to the disruption of the intestinal micro-ecology, an increase in pathogenic bacteria, a decrease in beneficial bacteria, triggering local inflammatory responses and cascading effects that impact the immune response of extra-intestinal organs, ultimately posing a threat to the host's health[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. In our study (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e and \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e), significant differences were observed in the gut microbiota composition between CIA rats and normal rats (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). \u003cem\u003eDesulfobacterota\u003c/em\u003e was identified as the phylum with the most significant difference between the CIA model group and the control group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Treatment with \u003cem\u003eB. breve\u003c/em\u003e BB12 led to a restoration in the relative abundance of \u003cem\u003eDesulfobacterota\u003c/em\u003e. At the genus level, notable differences were observed in \u003cem\u003eClostridia_UCG-014\u003c/em\u003e_unclassified, \u003cem\u003eLactobacillus\u003c/em\u003e, \u003cem\u003eLigilactobacillus\u003c/em\u003e, \u003cem\u003eLachnospiraceae\u003c/em\u003e_unclassified, and \u003cem\u003eFirmicutes\u003c/em\u003e_unclassified (top 5 species). The combined proportion of these top 5 species in the CIA model group was 50.72%, significantly different from the control group's 34.57%. The percentages of these top 5 species decreased under the administration of \u003cem\u003eB. bifidum\u003c/em\u003e BD5348. Through differential abundance analysis, we observed that \u003cem\u003eB. animalis\u003c/em\u003e BD400 decreased the relative abundance of HT002. \u003cem\u003eDesulfobacterota\u003c/em\u003e, a sulfate-reducing anaerobic bacteria, thrives in the gut and releases hydrogen sulfide. The role of hydrogen sulfide is intricate and at times contradictory. Clinical data suggests an association between hydrogen sulfide and chronic colon disease as well as inflammation of the large intestine[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. However, research has also demonstrated that hydrogen sulfide can directly stimulate angiogenesis, crucial for mending gastrointestinal ulcers[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Despite the challenging task of elucidating the precise role of \u003cem\u003eDesulfobacterota\u003c/em\u003e in the gut, our findings revealed contrasting results in the abundance of \u003cem\u003eDesulfobacterota\u003c/em\u003e between the CIA model group and the \u003cem\u003eB. animalis\u003c/em\u003e BD400 group, providing insight into the ability of \u003cem\u003eB. animalis\u003c/em\u003e BD400 to restore gut microbiota. Furthermore, a separate study on \u003cem\u003eBifidobacterium adolescentis\u003c/em\u003e yielded similar biological outcomes, highlighting \u003cem\u003eLactobacillus\u003c/em\u003e, \u003cem\u003eLigilactobacillus\u003c/em\u003e, and \u003cem\u003eLachnospiraceae\u003c/em\u003e as prominent genera[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. This finding strongly corroborates our own results.\u003c/p\u003e \u003cp\u003eThe metabolites of gut microbiota can directly or indirectly impact host health. These metabolites can be categorized based on their synthesis pathway: 1. Metabolites produced by gut microbiota that break down dietary components like short-chain fatty acids, tryptophan, and trimethylamine oxide; 2. Metabolites produced by the host and altered by gut microbiota, such as bile acids; 3. Metabolites synthesized by gut microbiota from scratch, including branched-chain amino acids, polyamines, and vitamins[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. These gut microbiota metabolites play a crucial role in maintaining host intestinal balance and regulating immune function through various mechanisms. They can enter cells through passive diffusion or carrier-mediated transport to regulate processes like protein synthesis, glucose and lipid metabolism, insulin resistance, hepatocyte proliferation, and immunity. Moreover, these metabolites can travel to distant tissues and organs via the bloodstream, influencing the functions of multiple organs[\u003cspan additionalcitationids=\"CR54 CR55\" citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. In this study (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e), metabolites such as crotonoside, guanosine, 2`-ketobutyric acid, momordicinin, botulin, trigonelline, among others, exhibited significant differences in CIA rats. Following oral administration of B. animalis BD400, these variances were restored, particularly 2`-deoxyuridine, 2`-ketobutyric acid, crotonoside, and guanosine. By conducting enrichment and topological analyses on the pathways associated with the altered metabolites, the study identified key pathways with the highest correlation to these metabolites. Pyrimidine metabolism, valine, leucine, and isoleucine biosynthesis, starch and sucrose metabolism, beta-alanine metabolism, riboflavin metabolism, and pyruvate metabolism were significantly impacted by the CIA model. Conversely, the mechanism of action of B. animalis BD400 primarily involved valine, leucine, and isoleucine biosynthesis, as well as ubiquinone and other terpenoid-quinone biosynthesis. Valine, leucine, and isoleucine are all branched-chain amino acids (BCAAs) and constitute three of the nine essential amino acids. BCAAs not only provide nutritional benefits but also exert various biological effects, such as modulating the balance between pro-inflammatory and anti-inflammatory cytokines[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e], reducing oxidative stress [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e], enhancing immunity [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], and regulating glucose metabolism[\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. According to the valine, leucine and isoleucine biosynthesis pathway plot obtained in this study (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e), \u003cem\u003eB. animalis\u003c/em\u003e BD400 regulates the biosynthesis of these amino acids by up-regulating differential metabolites such as 2-oxobutanoate, pyruvate, 2-oxoisovalerate, and 4-methyl-2-oxopentanoate. Conversely, in the ubiquinone and other terpenoid-quinone biosynthesis pathway plot obtained in this study (Figure S2), \u003cem\u003eB. animalis\u003c/em\u003e BD400 regulates the biosynthesis of these compounds by down-regulating the differential metabolite 4-hydroxyphenyl-pyruvate. Within the valine, leucine, and isoleucine biosynthesis process, threonine is converted by threonine dehydrase into ketobutyric acid. Acetylhydroxybutyric acid synthase then catalyzes the conversion of ketobutyric acid and pyruvate into acetylhydroxybutyric acid, a precursor for isoleucine synthesis. Additionally, some pyruvates lead to the production of acetyllactic acid, which is essential for valine and leucine synthesis. The pivotal roles of ketobutyric acid and pyruvate in valine, leucine, and isoleucine biosynthesis are highlighted. In our study, ketobutyric acid and pyruvate were identified as among the top 10 differentiated metabolites (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA and \u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eB). The differential metabolite of 4-hydroxyphenylpyruvate in ubiquinone and other terpenoid-quinone biosynthesis is a pyruvate derivative closely linked to pyruvate. Pyrimidine metabolism, while significant in CIA development, does not impact the regulation of \u003cem\u003eB. animalis\u003c/em\u003e BD400. Increased pyrimidine metabolism results in elevated uric acid levels, promoting the conversion of arachidonic acid to prostaglandin E2[\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e], an inflammatory mediator that enhances synovial inflammation[\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. Reduction in inflammatory response leads to decreased levels of 2`-deoxyuridine, guanosine, xanthosine, and other metabolites in pyrimidine metabolism, highlighting its role in \u003cem\u003eB. animalis\u003c/em\u003e BD400 regulation. Overall, these findings indicate that \u003cem\u003eB. animalis\u003c/em\u003e BD400 mitigates RA symptoms through the regulation of ketobutyric acid and pyruvate in valine, leucine, and isoleucine biosynthesis, as well as the regulation of 4-hydroxyphenylpyruvate in ubiquinone and other terpenoid-quinone biosynthesis.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThe clinical treatment of RA focuses on reducing inflammation and alleviating symptoms, as RA is challenging to cure. Our study investigated the oral administration of \u003cem\u003eB. animalis\u003c/em\u003e BD400 to restore the intestinal microbiota to a normal state. \u003cem\u003eB. animalis\u003c/em\u003e BD400 primarily achieves this by down-regulating 2-ketobutyric acid and pyruvate in branched-chain amino acids biosynthesis, as well as 4-hydroxyphenyl-pyruvate in ubiquinone and other terpenoid-quinone biosynthesis. This research is expected to offer insights for the potential future clinical use of probiotics therapy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors are thankful to the State Key Laboratory of Dairy Biotechnology, Shanghai Engineering Research Center of Dairy Biotechnology, Bright Dairy \u0026amp; Food Co., Ltd., Shanghai, China for providing the various resources for the completion of the current article.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eY.Y., X.Z. and Z.L. conceived the project and designed the experiments. Y.Y., Q.H., and Z.L. performed all the experiments and analyzed the data. Y.Y. and Q.H. wrote the manuscript with inputs from all authors.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from the Shanghai State-owned Assets Supervision and Administration Commission Enterprise Innovation Development and Capacity Enhancement Program (No. 2022013) and the National Key R\u0026amp;D Program of China (2022YFD2100704).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw sequence data of 16S rDNA gene sequencing were deposited in the Sequence Read Archive (SRA) at NCBI under Bioproject PRJNA1139339 (SUB14619059, https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1139339). The data matrix for non-targeted metabolite analysis was supplied in Supplementary material Table S1. All the other data in this work are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthical approval for this study was obtained from Animal Ethics Committee of Shanghai Zhanyuan Biological Technology Co., LTD (approval No. 202306261). All procedures treated with mice were carried out in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals in China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSmolen, J.S., D. Aletaha, and I.B. McInnes, Rheumatoid arthritis[J]. The Lancet, 2016. 388(10055): 2023-2038. DOI: 10.1016/S0140-6736(16)30173-8\u003c/li\u003e\n\u003cli\u003eFelson, D.T.J.A.R. and Therapy, Comparing the prevalence of rheumatic diseases in China with the rest of the world[J]. Arthritis Research \u0026amp; Therapy, 2008. 10(1): 106-106. DOI: 10.1186/ar2369\u003c/li\u003e\n\u003cli\u003eCrowson, C. S., Matteson, E. L., Myasoedova, E., Michet, C. J., Ernste, F. C., Warrington, K. J., et al., The lifetime risk of adult-onset rheumatoid arthritis and other inflammatory autoimmune rheumatic diseases[J]. Arthritis \u0026amp; Rheumatism, 2011. 63(3): 633-639. DOI: 10.1002/art.30155\u003c/li\u003e\n\u003cli\u003eAletaha, D. and J.S. Smolen, Diagnosis and Management of Rheumatoid Arthritis: A Review[J]. The Journal of the American Medical Association, 2018. 320(13): 1360-1372. DOI: 10.1001/jama.2018.13103\u003c/li\u003e\n\u003cli\u003eLiu, X., Zou, Q., Zeng, B., Fang, Y., Wei, H., Analysis of Fecal Lactobacillus Community Structure in Patients with Early Rheumatoid Arthritis[J]. Current Microbiology, 2013. 67(2): 170-176. DOI: 10.1007/s00284-013-0338-1\u003c/li\u003e\n\u003cli\u003eZhang, X., Zhang, D., Jia, H., Feng, Q., Wang, D., Liang, D. , et al. The oral and gut microbiomes are perturbed in rheumatoid arthritis and partly normalized after treatment[J]. Nature Medicine, 2015. 21(8): 895-905. DOI: 10.1038/nm.3914\u003c/li\u003e\n\u003cli\u003eKinashi, Y. and K. Hase, PPartners in leaky gut syndrome: intestinal dysbiosis and autoimmunity[J]. Frontiers in Immunology, 2021, 12, 673708. DOI: 10.3389/fimmu.2021.673708\u003c/li\u003e\n\u003cli\u003eChen, B., L. Sun, and X. Zhang, Integration of microbiome and epigenome to decipher the pathogenesis of autoimmune diseases[J]. Journal of Autoimmunity, 2017. 83: 31-42. DOI: 10.1016/j.jaut.2017.03.009.\u003c/li\u003e\n\u003cli\u003eZhao, T., Wei Y., Xie Z, Hai Q., Li Z., Qin D., et al., Gut microbiota and rheumatoid arthritis: From pathogenesis to novel therapeutic opportunities[J]. Frontiers in Immunology, 2022, 13, 1007165. DOI: 10.3389/fimmu.2022.1007165\u003c/li\u003e\n\u003cli\u003eHill, C., Guarner, F., Reid, G., Gibson, G. R., Merenstein, D. J., Pot, B. , et al., The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic[J]. Nature Reviews Gastroenterology \u0026amp; Hepatology, 2014. 11(8): 506-514. DOI: 10.1038/nrgastro.2014.66\u003c/li\u003e\n\u003cli\u003eFerro, M., Charneca, S., Dourado, E., Guerreiro, C. S., Fonseca, J. E., Probiotic Supplementation for Rheumatoid Arthritis: A Promising Adjuvant Therapy in the Gut Microbiome Era[J]. Frontiers in Pharmacology, 2021. 12: 711788. DOI: 10.3389/FPHAR.2021.711788\u003c/li\u003e\n\u003cli\u003eZamani, B., Golkar, H. R., Farshbaf, S., Modjtaba Emadi‐Baygi, Maryam Tajabadi‐Ebrahimi, Jafari, P., et al., Clinical and metabolic response to probiotic supplementation in patients with rheumatoid arthritis: a randomized, double-blind, placebo-controlled trial[J].International Journal of Rheumatic Diseases, 2016. 19(9): 869-879. DOI: 10.1111/1756-185X.12888\u003c/li\u003e\n\u003cli\u003eBrand, D.D., K.A. Latham, and E.F. Rosloniec, Collagen-induced arthritis[J]. Nature Protocols, 2007. 2(5): 1269-1275. DOI: 10.1038/nprot.2007.173\u003c/li\u003e\n\u003cli\u003eMarietta E V, Murray J A, Luckey D H, Jeraldo P R, Lamba A, Patel R, et al., Suppression of Inflammatory Arthritis by Human Gut-Derived Prevotella histicola in Humanized Mice[J]. Arthritis Rheumatol, 2016. 68(12): 2878-2888. DOI: 10.1002/art.39785\u003c/li\u003e\n\u003cli\u003eZhou, Z., Luo, M., Zhang, H., Yin, Y., Cai, Y., Zhu, Z. J., Metabolite annotation from knowns to unknowns through knowledge-guided multi-layer metabolic networking[J]. Nature Communications, 2022. 13(1): 6656. DOI: 10.1038/s41467-022-34537-6.\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Dell, J. R., Mikuls, T. R., Taylor, T. H., Ahluwalia, V., Keystone, E., Therapies for active rheumatoid arthritis after methotrexate failure[J]. New England Journal of Medicine, 2013. 369(4): 307-318. DOI: 10.1056/NEJMoa1303006\u003c/li\u003e\n\u003cli\u003eAo Y., Li Z., Zhang C., Duan X., Research progress on calcified cartilage zone[J]. Orthopedic Journal of China, 2019. 27(8): 722-725.\u003c/li\u003e\n\u003cli\u003eNandakumar, K. S., Johansson, B. P., BjoRck, L., Holmdahl, R., Blocking of experimental arthritis by cleavage of IgG antibodies in vivo[J]. Arthritis \u0026amp; Rheumatism, 2007. 56(10): 3253-3260. DOI: 10.1002/art.22930\u003c/li\u003e\n\u003cli\u003eSmolen, J., Aletaha, D., Barton, A., Burmeste G., Emery P., Firestein G S., et al., Rheumatoid arthritis[J]. Nature Reviews Disease Primers, 2018. 4(1): 18001. DOI: 10.1038/nrdp.2018.1\u003c/li\u003e\n\u003cli\u003eScher, J.U., Sczesnak, A., Longman, R.S., Segata, N., Ubeda, C.; Bielski, C., et al. Expansion of intestinal Prevotella copri correlates with enhanced susceptibility to arthritis[J]. eLIFE 2013, 2, e01202. DOI: 10.7554/eLife.01202\u003c/li\u003e\n\u003cli\u003eMaeda, Y., Kurakawa, T., Umemoto, E., Motooka, D., Ito, Y., Gotoh, K., et al. Dysbiosis Contributes to Arthritis Development via Activation of Autoreactive T Cells in the Intestine[J]. Arthritis \u0026amp; Rheumatology, 2016. 68(11): p. 2646-2661. DOI: 10.1002/art.39783\u003c/li\u003e\n\u003cli\u003eVaahtovuo J, Munukka E, Korkeam\u0026auml;ki M, Luukkainen R, Toivanen P. Fecal microbiota in early rheumatoid arthritis[J]. Journal Rheumatol. 2008. 35(8): 1500-1505.\u003c/li\u003e\n\u003cli\u003eZeng J, Peng L, Zheng W, Huang F, Zhang N, Wu D, et al., Fecal microbiota transplantation for rheumatoid arthritis: A case report[J]. Clinical Case Report, 2021. 9(2): 906-909. DOI: /10.1002/ccr3.3677\u003c/li\u003e\n\u003cli\u003eTang Y, Chen C, Jiang B, Wang L, Jiang F, Wang D, et al, Bifidobacterium bifidum-Mediated Specific Delivery of Nanoparticles for Tumor Therapy[J]. International journal of nanomedicine, 2021. DOI:10.2147/IJN.S315650\u003c/li\u003e\n\u003cli\u003eMiri S T, Sotoodehnejadnematalahi F, Amiri M M, Pourshafie M R, Rohani M. The impact of Lactobacillus and Bifidobacterium probiotic cocktail on modulation of gene expression of gap junctions dysregulated by intestinal pathogens[J]. Archives of Microbiology, 2022, 204(7): 417. DOI: 10.1007/s00203-022-03026-1\u003c/li\u003e\n\u003cli\u003eLevit, R., Cortes-Perez, N. G., Leblanc, A. D. M. D., Loiseau, J., Aucouturier, A., Langella, P., et al. Use of genetically modified lactic acid bacteria and bifidobacteria as live delivery vectors for human and animal health[J]. Gut microbes, 14(1): 2110821. DOI: 10.1080/19490976.2022.2110821\u003c/li\u003e\n\u003cli\u003eJeong Y, Jhun J, Lee S-Y, Na H S, Choi J, Cho K H, et al Therapeutic Potential of a Novel Bifidobacterium Identified Through Microbiome Profiling of RA Patients With Different RF Levels[J]. Frontier in Immunology,2021, 12:736196. DOI: 10.3389/fimmu.2021.736196\u003c/li\u003e\n\u003cli\u003eDong, Y., et al. Use of Bifidobacterium animalis subsp. lactis BLa19 used as probiotic agent and composite probiotic for alleviating rheumatoid arthritis in preparation of medicines for preventing, and improving or treating rheumatoid arthritis, Wecare Probiotics Suzhou Co Ltd.\u003c/li\u003e\n\u003cli\u003eLi, T., N. Qin, and Z. Zheng, Kit is used for diagnosing rheumatoid arthritis, comprises reagent suitable for detecting at least one strain of first microorganism set and second microorganism set, where first microorganism set comprises Bacteroides strain, and second microorganism set comprises Bifidobacterium strain. Qingdao Ruiyi Precision Medical Testing.\u003c/li\u003e\n\u003cli\u003eZhang, H., et al., New strain of Bifidobacterium longum subsp.infantis used for preparing medicine for e.g. preventing and/or treating rheumatoid arthritis, increasing contents of osteoprotegerin and osteocalcin, regulating intestinal flora by increasing relative abundance of Lactobacillus and/or Ruminococcus 1. Univ Jiangnan.\u003c/li\u003e\n\u003cli\u003eZhang, X., J. Zhu, and Z. Zheng, Kit useful for diagnosing rheumatoid arthritis or detecting therapeutic effect of rheumatoid arthritis, comprises reagent for detecting e.g. Acinetobacter johnsonii, Bifidobacterium adolescentis, B.animalis and Brevundimonas diminuta. Shanghai Real Biotechnology Co Ltd.\u003c/li\u003e\n\u003cli\u003eDostert, C., Grusdat, M., Letellier, E., Brenner, D..The TNF Family of Ligands and Receptors: Communication Modules in the Immune System and Beyond[J]. Physiological Reviews, 2019, 99(1):115-160. DOI:10.1152/physrev.00045.2017\u003c/li\u003e\n\u003cli\u003eChoy E H, Panayi G S.Cytokine pathways and joint inflammation in rheumatoid arthritis.[J].The New England Journal of Medicine, 2001, 344(12):907-916. DOI: 10.1056/NEJM200103223441207\u003c/li\u003e\n\u003cli\u003eJoosten L A B, Helsen M M A, Loo F A J V D, Berg W B. Anticytokine treatment of established type II collagen-induced arthritis in DBA/1 mice. A comparative study using anti-TNF alpha, anti-IL-1 alpha/beta, and IL-1Ra[J]. Arthritis \u0026amp; Rheumatology, 2010, 39(5):797-809. DOI: 10.1002/art.1780390513\u003c/li\u003e\n\u003cli\u003eGallego A, Vargas J A, Castej\u0026oacute;n R, Citores M. J., Romero Y., Mill\u0026aacute;n A I.. Dur\u0026aacute;ntez. Production of intracellular IL-2, TNF-alpha, and IFN-gamma by T cells in B-CLL[J]. Cytometry Part B Clinical Cytometry, 2010, 56(1):23-29. DOI: 10.1002/cyto.b.10052\u003c/li\u003e\n\u003cli\u003eSato K, Suematsu A, Okamoto K, Yamaguchi A, Morishita Y, Kadono Y, et al. Th17 functions as an osteoclastogenic helper T cell subset that links T cell activation and bone destruction[J]. Journal of Experimental Medicine, 2006, 203(12): 2673-2682. DOI: 10.1084/jem.20061775\u003c/li\u003e\n\u003cli\u003eZaiss M M, Wu H J J, Mauro D, Schett G, Ciccia F. The gut-joint axis in rheumatoid arthritis[J].Nature Reviews Rheumatology, 2021, 17: 224-237. DOI: 10.1038/s41584-021-00585-3\u003c/li\u003e\n\u003cli\u003eMichael H V, Kristen D M, Kuhn K A, Buckner J H, Robinson W H, Okamoto Y, et al. Rheumatoid arthritis and the mucosal origins hypothesis: protection turns todestruction[J]. Nature Reviews Rheumatology, 2018, 14, 542-557. DOI: 10.1038/s41584-018-0070-0\u003c/li\u003e\n\u003cli\u003eBrusca S B, Abramson S B, Scher J U. Microbiome and mucosal inflammation as extra-articular triggers for rheumatoid arthritis and autoimmunity[J]. Current Opinion In Rheumatology. 2014, 26(1): 101-107. DOI: 10.1097/BOR.0000000000000008\u003c/li\u003e\n\u003cli\u003eLin, L., Zhang K, Xiong Q, Zhang J, Cai B, et al., Gut microbiota in pre-clinical rheumatoid arthritis: From pathogenesis to preventing progression[J]. Journal of Autoimmunity, 2023. 141: 103001. DOI: 10.1016/j.jaut.2023.103001\u003c/li\u003e\n\u003cli\u003eChelakkot, C., J. Ghim, and S.H. Ryu, Mechanisms regulating intestinal barrier integrity and its pathological implications[J]. Experimental \u0026amp; Molecular Medicine, 2018. 50(8): 1-9. DOI: 10.1038/s12276-018-0126-x\u003c/li\u003e\n\u003cli\u003eHansson G C, Johansson M E. The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria[J]. Gut Microbes, 2008, 105(1):51-54. DOI: 10.1073/pnas.0803124105\u003c/li\u003e\n\u003cli\u003eHonda K, Littman D R. The microbiota in adaptive immune homeostasis and disease[J]. Nature, 2016, 535(7610):75. DOI: 10.1038/nature18848\u003c/li\u003e\n\u003cli\u003eHooper L V, Macpherson A J . Immune adaptations that maintain homeostasis with the intestinal microbiota[J]. Nature Reviews Immunology, 2010, 10(3): 159-169. DOI: 10.1038nri2710\u003c/li\u003e\n\u003cli\u003eSekirov I, Russell S L, Antunes L C M, Finlay B B. Gut Microbiota in Health and Disease[J]. Physiological Reviews, 2010, 90(3): 859-904. DOI: 10.1152/physrev.00045.2009\u003c/li\u003e\n\u003cli\u003eJie Z, Xia H, Zhong S L, Feng Q, Li S, Liang S, et al. The gut microbiome in atherosclerotic cardiovascular disease[J]. Nature Communications, 2017, 8(1): 845 . DOI: 10.1038/s41467-017-00900-1\u003c/li\u003e\n\u003cli\u003eOpoku Y K, Asare K K, Ghartey-Quansah G, Afrifa J, Bentsi-Enchill F, Ofori E G, et al. Intestinal microbiome-rheumatoid arthritis crosstalk: The therapeutic role of probiotics[J]. Frontiers in microbiology, 2022, 13: 996031. DOI: 10.3389/fmicb.2022.996031\u003c/li\u003e\n\u003cli\u003eBrenda Maldonado‐Arriaga, Sergio Sandoval‐Jim\u0026eacute;nez, Juan Rodr\u0026iacute;guez‐Silverio, Sof\u0026iacute;a Lizeth Alcar\u0026aacute;z‐Estrada, Tom\u0026aacute;s Cort\u0026eacute;s‐Espinosa, \u0026amp; Rebeca P\u0026eacute;rez‐Cabeza de Vaca, et al., Gut dysbiosis and clinical phases of pancolitis in patients with ulcerative colitis[J]. Microbiology Open,2021, 10: e1181. DOI: 10.1002/mbo3.1181\u003c/li\u003e\n\u003cli\u003eMorbidelli, L., M. Monti, and E. Terzuoli, Pharmacological Tools for the Study of H2S Contribution to Angiogenesis[J]. Methods in Molecular Biology, 2019,2007: 151-166. DOI: 10.1007/978-1-4939-9528-8_11\u003c/li\u003e\n\u003cli\u003eK\u0026ouml;hn C, Dubrovska G, Huang Y, Gollasch M. Hydrogen sulfide: potent regulator of vascular tone and stimulator of angiogenesis[J]. Journal of Biomedical Science, 2012, 8(2):81-86. PMID: 23675260; PMCID: PMC3614859.\u003c/li\u003e\n\u003cli\u003eFan, Z., Yang, B., Ross, R. P., Stanton, C., Shi, G., Zhao, J., et al. Protective effects of Bifidobacterium adolescentis on collagen-induced arthritis in rats depend on timing of administration[J]. Food \u0026amp; Function, 2020, 11(5): 4499-4511. DOI: 10.1039/D0FO00077A\u003c/li\u003e\n\u003cli\u003eYang, W. and Y.J.Cong, Gut microbiota-derived metabolites in the regulation of host immune responses and immune-related inflammatory diseases[J]. Cellular \u0026amp; Molecular Immunology, 2021. 18(4): 1-12. DOI: 10.1038/s41423-021-00661-4\u003c/li\u003e\n\u003cli\u003eFusco, W., Lorenzo, M.B., Cintoni, M., Porcari, S., Rinninella, E., Kaitsas, F., et al. Short-Chain Fatty-Acid-Producing Bacteria: Key Components of the Human Gut Microbiota[J]. Nutrients, 2023, 15: 2211. DOI: 10.3390/nu15092211\u003c/li\u003e\n\u003cli\u003ePerez-Castro L, Garcia R, Venkateswaran N, Barnes S, Conacci-Sorrell M. Tryptophan and its metabolites in normal physiology and cancer etiology[J]. European Journal of Biochemistry Journal, 2023, 290(1):7-27. DOI: 10.1111/febs.16245\u003c/li\u003e\n\u003cli\u003eCollins, S. L., Stine, J. G., Bisanz, J. E., Okafor, C. D., Patterson, A. D.. Bile acids and the gut microbiota: metabolic interactions and impacts on disease[J]. Nature Reviews Microbiology, 2023. 21(4): 236-247. DOI: 10.1038/s41579-022-00805\u003c/li\u003e\n\u003cli\u003eCouteur, D. G. L., Solon-Biet, S. M., Cogger, V. C., Ribeiro, R., Cabo, R. D., Raubenheimer, D., et al. Branched chain amino acids, aging and age-related health[J]. Ageing Research Revviews, 2020, 64: 101198. DOI: 10.1016/j.arr.2020.101198\u003c/li\u003e\n\u003cli\u003eRosa L, Scaini G, Furlanetto C B, Galant L S, Vuolo F, Dall\u0026apos;Igna D M, et al. Administration of branched-chain amino acids alters the balance between pro-inflammatory and anti-inflammatory cytokines[J]. International Journal of Developmental Neuroscience, 2016, 48(1): 24-30. DOI: 10.1016/j.ijdevneu.2015.11.002\u003c/li\u003e\n\u003cli\u003eDe Simone R, Vissicchio F, Mingarelli C, De Nuccio C, Visentin S, Ajmone-Cat M A, et al. Branched-chain amino acids influence the immune properties of microglial cells and their responsiveness to pro-inflammatory signals[J]. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease, 2013, 1832(5): 650-659. DOI: 10.1016/j.bbadis.2013.02.001\u003c/li\u003e\n\u003cli\u003eCunxi, N., Ting, H., Wenju, Z., Guolong, Z., Xi, M.. Branched Chain Amino Acids: Beyond Nutrition Metabolism[J]. International Journal of Molecular ences, 2018, 19(4): 954. DOI: 10.3390/ijms19040954\u003c/li\u003e\n\u003cli\u003eGannon N P, Schnuck J K, Vaughan R A. BCAA Metabolism and Insulin Sensitivity-Dysregulated by Metabolic Status?[J]. Molecular Nutrition \u0026amp; Food Research, 2018, 62(6): 1700756. DOI: 10.1002/mnfr.201700756\u003c/li\u003e\n\u003cli\u003eHoriuchi, M., Takeda, T., Takanashi, H., Ozaki-Masuzawa, Y., Taguchi, Y., Toyoshima, Y., et al. Branched-chain amino acid supplementation restores reduced insulinotropic activity of a low-protein diet through the vagus nerve in rats[J]. Nutrition \u0026amp; Metabolism, 2017, 14(1): 59. DOI: 10.1186/s12986-017-0215-1\u003c/li\u003e\n\u003cli\u003eDeby C, Deby-Dupont G, No\u0026euml;l FX, Lavergne L. In vitro and in vivo arachidonic acid conversions into biologically active derivatives are enhanced by uric acid[J]. Biochemical Pharmacology, 1981, 30(16): 2243-2249. DOI: 10.1016/0006-2952(81)90094-0\u003c/li\u003e\n\u003cli\u003eWang H, Dong B W, Zheng Z H, Wu Z B, Li W, Ding J. Metastasis-associated protein 1 (MTA1) signaling in rheumatoid synovium: Regulation of inflammatory response and cytokine-mediated production of prostaglandin E2 (PGE2)[J]. Biochemical and Biophysical Research Communications. 2016, 473(2):442-448. DOI: 10.1016/j.bbrc.2016.03.027\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Rheumatoid arthritis, Bifidobacterium, Gut microbiota, Metabolomics, Probiotics therapy","lastPublishedDoi":"10.21203/rs.3.rs-4767166/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4767166/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eRheumatoid arthritis (RA) is a common chronic and systemic autoimmune disease. Numerous clinical studies have indicated a correlation between alterations in gut microbiota and the onset and progression of RA. As a result, this research aims to restore intestinal microbiota to a healthy state through the oral administration of \u003cem\u003eBifidobacterium\u003c/em\u003e in the early stages with the goal of delaying the onset and progression of RA.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe findings reveal that administering \u003cem\u003eBifidobacterium animalis\u003c/em\u003e BD400 orally led to a significant reduction in arthritis clinical scores and paw swelling thickness in CIA rats. Additionally, there was a decrease in osteo-facial fusion and calcified cartilage thickening in the knee joint. Furthermore, the oral administration of \u003cem\u003eB. animalis\u003c/em\u003e BD400 resulted in the down-regulation of inflammatory factors TNF-α and collagenase MMP-13 in the knee joint. Levels of specific antibodies (anti-CII IgG, anti-CII IgG1, and anti-CII IgG2a) and cytokine IL-17A in serum, as well as cytokines (TNF-α and IL-1β) in the synovial fluid of \u003cem\u003eB. animalis\u003c/em\u003e BD400-treated CIA rats, were significantly reduced (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The gene expression levels of intestinal barrier proteins (occludin-1, MUC-2, and ZO-1) showed a significant increase (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in \u003cem\u003eB. animalis\u003c/em\u003e BD400-treated CIA rats. The oral administration of \u003cem\u003eB. animalis\u003c/em\u003e BD400 altered the composition of intestinal microorganisms in CIA rats at the phylum and genus levels, particularly affecting the genus HT002.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003e \u003cem\u003eB. animalis\u003c/em\u003e BD400 alleviates RA by down-regulating 2-ketobutyric acid and pyruvate in the biosynthesis of branched-chain amino acids, as well as down-regulating 4-hydroxyphenyl-pyruvate in the biosynthesis of ubiquinone and other terpenoid-quinone, laying a foundation for the RA clinical treatment of probiotics.\u003c/p\u003e","manuscriptTitle":"Bifidobacterium animalis BD400 alleviates collagen-induced arthritis through branched-chain amino acids (BCAAs) and ubiquinone biosynthesis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-22 10:14:04","doi":"10.21203/rs.3.rs-4767166/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6c660ea7-f5d7-4391-9a72-98eb074753b0","owner":[],"postedDate":"August 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-09-30T21:38:21+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-22 10:14:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4767166","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4767166","identity":"rs-4767166","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}