First characterization of cultivable skin bacteria in the synanthropic anuran Scinax x-signatus (ANURA: HYLIDAE) in northeast Brazil | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article First characterization of cultivable skin bacteria in the synanthropic anuran Scinax x-signatus (ANURA: HYLIDAE) in northeast Brazil Lara Valesca Mendonça da Costa Santos, Alcina Gabriela Maria Medeiros da Fonsêca Santos, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4492166/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 3 You are reading this latest preprint version Abstract Some amphibians’ species adapted to the urban ecosystem – synanthropic - can have their cryptic interactions with microorganisms altered. In the case of anurans, the skin bacterial microbiota plays a fundamental role in host protection. However, it is not known how the composition and diversity of the skin microbiota of Scinax x-signatus , a synanthropic anuran, behaves in different fragments. In this study, we describe the culturable bacteria from the skin of individuals of the anthropic anuran Scinax x-signatus by sequencing the 16S rRNA gene obtained from the amplified product of polymerase chain reaction (PCR) technique. Skin swab samples were collected from 11 S. x-signatus , 4 in a natural area and 7 in an anthropized area. Bacteria were isolated using different rich and selective culture media. A total of 20 bacterial isolates were identified, being 7 in control area and 13 in anthropized area, represented by the families Enterobacteriaceae (54.6%; n = 7), Bacillaceae (18.2%; n = 2) and Moraxellaceae (18.2%; n = 2). Among their representatives, we report Enterobacter as the most frequent genus and highlight the first report of Escherichia coli . This first report of culturable skin bacteria of Scinax x-signatus , together with the first record of E. coli , improves our knowledge of the skin microbiome of amphibians, contributing to their conservation and the maintenance of environmental health. Scinax x-signatus skin microbiota Anura microbiota synanthropic fauna Figures Figure 1 Introduction The environmental changes induced by human activities lead to a reorganization of the community that can result not only in the loss of species (Chivian, 2002 ), but also in the adaptation of others to the urban environment, known as synanthropic species (Hansen et al., 2005 ). Some amphibian species are common in urban environments and are recognized for carrying a cutaneous microbiota that is crucial for the protection and homeostasis of the organism (Becker et al., 2015 ). Consequently, increased human contact with this group facilitates a bilateral and unnatural transmission route for microorganisms and lineages with pathogenic potential (Cunningham; Daszak; Wood, 2017 ). Anuran amphibians are interesting models to be investigated in this regard, as species in this group have thin and moist skin due to the secretion of mucous substances, conditions crucial for the colonization of a cutaneous microbiome (Li et al., 2023 ). Some species are known for their greater environmental plasticity and occupation of areas modified by humans, such as species from the genera Rhinella and Scinax (Knispel; Barros, 2006 ; Montezol et al., 2018 ). The anuran species Scinax x-signatus (Spix, 1824), for example, is commonly found in forests, forest edges, and anthropogenically modified environments, including residences, thus, in frequent contact with humans (Pereira et al., 2016 ). In general, several bacterial phyla are commonly found on the skin of amphibians, such as Acidobacteria, Actinobacteria, Bacteroidetes, and Proteobacteria (Ross; Hoffmann; Neufeld, 2019 ). Given the diversity of lifestyles within this group, the skin microbiota of anurans is subject to various modulators, whether intrinsic to the species, such as ontogenetic development (Khalifa; AlMalki; Bekhet, 2021 ), sex (Brunetti et al., 2019 ), or related to abiotic factors, such as temperature and microhabitat (Jiménez et al., 2020 ). The establishment of pathogenic agents on the skin of anurans, such as the bacterium Aeromonas hydrophila , and the fungus Batrachochytrium dendrobatidis , can cause fatal and highly transmissible infections (Khalifa; AlMalki; Bekhet, 2020; Jiménez et al., 2020 ; Ruthsatz et al., 2020 ). Given this context, microbiological approaches with the synanthropic genus Scinax spp. are scarce, and the identification of the culturable skin bacteria of anurans occurring in anthropic environments can provide implications for the health of hosts, humans, and for better ecosystem management (Bravo et al., 2022 ) .Therefore, the aim of this study was to describe the culturable bacterial diversity of Scinax x-signatus collected at two sites within a fragment of Atlantic Forest with different anthropogenic impacts. Material and Methods The study was conducted at the Jardim Botânico do Recife (JBR), located in Pernambuco, Brazil, at coordinates 08°04’ S; 34°59’ W. The JBR spans 11.23 hectares, with 60% consisting of fragments of the Atlantic Forest characterized as Ombrophilous Dense (De Oliveira et al., 2016 ). Thus, the Jardim Botânico do Recife (JBR) encompasses fragments of both native and secondary forest, with deactivated trails inaccessible to visitors and staff, designated as the "Control Area" (CA). In another sector, the JBR features facilities and areas designed for visitation, environmental education activities, and the reception of the general public, which we categorize as the "Anthropized Area" (AA), located 700 meters from the CA. This distance was adopted in this study in accordance with the documented reports on movement estimates by species of the genus and family (Bevier; Gomes; Navas, 2008 ), which have a movement range of less than 700 meters. On 19 December 2019, we collected 11 adult individuals of Scinax x-signatus (Fig. 1 ) at JBR, comprising four from CA and seven from the AA. The individuals (six males, five females) were captured using nitrile gloves disinfected with 70% alcohol. Each individual was rinsed with 100 ml of autoclaved distilled water to remove particles and microorganisms associated with the environment. Subsequently, the skin microbiota was sampled from the specimens using two sterile swabs passed precisely over the entire body of the animal - ventral side, dorsal side, head and limbs - for approximately 1 minute (Lauer et al., 2007 ). All materials were sanitized with 70% alcohol, and gloves were changed and disinfected between each individual to prevent cross-contamination. Following the described procedure, the specimens were released at their respective sampling points. The swabs were immediately inoculated in Luria Bertani broth (LB) and incubated overnight at 37º C in the laboratory. After this step, the samples were inoculated on Mueller-Hinton Agar, Luria Bertani Agar and Cromogenic Agar. Based on colony characterization and morphology, 20 distinct isolates were obtained and stored in Luria Bertani broth + 15% glycerol in a deep freezer (-80ºC) for subsequent molecular identification. Bacterial suspension of the isolates in 200 µl Milli-Q water was prepared for the amplification of the 16S rRNA gene through polymerase chain reaction (PCR). For each reaction, 5 µl of Buffer, 2.5 µl of MgCl2, 0.5 µl of dNTP, and 1 µl of each primer 27F (GAGTTTGATCCTGGCTCAG) and 1093R (GTTGCGCTCGTTGCGGAACT) were used (Lane, 1991 ). DNA samples were collected directly from the bacterial suspension and placed in the reaction solution (3 µL). The amplification program in the thermocycler consisted of 4 min at 94°C, followed by 30 cycles of 1 min at 94°C, 1 min at 61°C, 30 seconds at 72°C, and 10 min at 72°C for the final extension. We evaluated the results of the amplification stage. through agarose gel electrophoresis at 1%. The purification of the amplified samples was performed using phenol chloroform, and the quantification and sequencing of the purified DNA were carried out at the Genomic and Gene Expression Technological Platform of the Center for Biological Sciences (CCB/UFPE). The obtained sequences were edited in the BioEdit software to remove bases with low reading quality and were compared to sequences deposited in the National Center for Biotechnology Information database – NCBI (2010), using the Classifier and Sequence match options. The sequence length varied from 820 to 1738 base pairs. We presented the absolute and relative frequencies of taxa derived from the 20 isolates. Afterward, we employed Pearson's χ2 test to examine potential differences in the frequencies of bacterial families within our samples. Results and discussion The 20 bacterial isolates from the skin of S. x-signatus comprised 11 species belonging to three families (Table 1 ). Enterobacteriaceae and Bacillaceae occurred in both areas, with Enterobacteriaceae being the most representative overall (χ2 = 7.75, g.l.= 2, p = 0. 035, Table 1 ) as well as in specific comparisons with the families Bacillaceae (χ2 Entero - Bacilla = 9, g.l.= 1, p = 0.003) and Moraxellaceae (χ2 Entero - Moraxella = 9, g.l.= 1, p = 0.003), the only one that occurred only in the Anthropized Area (Table 1 ). Table 1 Absolute and relative frequencies by area of the families, genera and bacterial species collected from the skin of S. x-signatus individuals in the control and anthropised areas. Orc = Orchidarium; Bro = Bromeliads; Po = Pond; Ve = Vegetation; Lib = Library; Pa = Patio; Vbro = Visiting Bromeliad; Ba = Bathroom. Family Bacterial genera/species Collection point Absolute frequency Relative frequency per area (%) Control Area (n = 4 animals) Bacillaceae 1 14.29 Bacillus cereus Orc. 1 14.29 Enterobacteriaceae 6 85.71 Enterobacter cloacae Bro 1 16.70 Enterobacter hormaechei Orq, Po, Ve, Bro 5 84.30 Total in the area 7 100 Anthropized area (n = 7 animals) Bacillaceae 3 23.08 Bacillus cereus Lib 2 15.39 Exiguobacterium acetylicum Pa 1 7.71 Enterobacteriaceae 7 53.85 Enterobacter cloacae Vbro 2 15.39 Enterobacter hormaechei Lib, Ba 2 15.39 Enterobacter sp. Ba 1 7.71 Escherichia coli Ba 1 7.71 Klebsiella pneumoniae Pa 1 7.71 Pantoea dispersa Lib 1 7.71 Moraxellaceae 2 15.39 Acinetobacter junii Lib 1 7.71 Acinetobacter pittii Vbro 1 7.71 Total in the area 13 100 Three bacterial taxa were common to both sample areas in our study: Enterobacte hormechei , E. cloacae , and Bacillus cereus . The presence of these three families aligns with previous investigations into the cutaneous microbiota of anurans (Ienes-Lima et al., 2023 ; Assis et al., 2016 ; Martin et al., 2020 ; Proença et al., 2021 ; Ienes-Lima et al., 2023 ). In general, these families are represented by ubiquitous species distributed in soil, water, vegetation, and anthropic installations (Murray et al., 1998 ). The occurrence of the Bacillaceae family in our study also supports findings from the skin of anurans with ranids, bufonids, hylids and, besides our low number of isolates, strengthening the hypothesis that these microorganisms constitute the symbiotic microbiota of anurans (Bletz et al., 2017 ). On the other hand, the report of Moraxellaceae, exclusively in the Anthropized Area, was a distinct finding compared to the report by Lenes-Lima et al. (2023) on the skin of the anuran M. admirabilis . This family only had the acinetes A. junii and A. pitii (non-baumanii acinetes) as representatives, and although previously described as environmental microorganisms, their occurrence only in the anthropized area may be an indication that these microorganisms also being part of the human bacterial flora, eventually causing opportunistic infections in vertebrates (Malick et al., 2020 ). Similarly to our reports, Proença et al. ( 2021 ) also identified the prevalence of enterobacteria on the skin of anurans in areas with and without environmental impacts (e.g., metal pollution). Although we recognize the small number of isolates in our study, this may be an indication that enterobacteria not only exhibit higher adaptability to environmental challenges (Gonzales-Siles; Sjöling, 2016 ), but can also colonize the skin of anurans under similar conditions. This observation is crucial, considering the potential protective role of enterobacteria such as Pantoea dispersa and Serratia marcescens against the fungus responsible for chytridiomycosis in amphibians (Ienes-Lima et al., 2023 ). The sample points "Library" and "Bathroom" in the Anthropized Area recorded five and three taxa, respectively. Opportunistic taxa such as E. coli and K. pneumoniae were found in areas commonly used by humans, such as the "Bathroom" and "Courtyard" (Table 1 ). To date, this is the first report of E. coli present on the skin of anurans. E. coli was found on the skin of an individual captured in the bathroom. We did not observe signs of ulcerations or wounds that could indicate any cutaneous infection in the individuals. While it is possible that, like other enterobacteria, E. coli may be part of the commensal skin microbiota of S. x-signatus , it is known that this microorganism is common in the lower gastrointestinal flora of warm-blooded animals (Schierack et al., 2009 ). Therefore, we believe this is indicative that E. coli may be transmitted to S. x-signatus through direct or indirect contact with human feces in the area where it was captured, once this species is commonly found in urban vegetation and decorative bodies of water (Pereira et al., 2016 ). Therefore, it is important to note that S. x-signatus individuals may carried an occasional patogenic agent. Strains of E. coli have specific virulence and resistance characteristics known in humans, while Multiresistant E. coli and K. pneumoniae are associated with urinary and nosocomial infections (Rodríguez-Bano et al., 2010 ). In general, it is expected that environmental complexity in less fragmented environments provides greater microbial diversity. However, as also observed by Bié et al. (2019), the source of fragmentation observed in this study is humans, and they, in turn, contribute to the construction of complex microenvironments associated with the dispersion of microorganisms to synanthropic fauna (Ramey; Ahlstrom, 2020 ). Our findings underscore the influence of anthropization on the composition and diversity of the cutaneous microbiota of synanthropic vertebrates and emphasize the investigation of pathways for the transmission of potentially zoonotic pathogens in ecosystems. Conclusions The adaptation of S. x-signatus individuals to the modified environment and the spatial heterogeneity caused by anthropization may have favoured microenvironments susceptible to this first report of human-associated bacterial species in threefrog’s skin. This finding can be a first step towards encouraging more in-depth research into the skin bacterial diversity of synanthropic anurans, especially with regard to the virulence potential and resistance profile of skin bacteria. Declarations Conflict of interest statement The authors declare that they have no known competing interests or personal relationships that could have appeared to influence the study reported in this paper. ORCID Lara Valesca Mendonça da Costa Santos 0000-0002-4400-6637; Alcina Gabriela Maria Medeiros da Fonsêca Santos 0000-0002-6223-8044; Paula Mariana Salgueiro de Souza 0000-0001-7764-0573; Anna Carolina Soares Almeida 0000-0001-5536-7262; Geraldo Jorge Barbosa de Moura 0000-0001-7241-7524. Ethics Approval This study was approved and granted by the Sistema de Autorização e Informação em Biodiversidade (2019/ 80088). Funding Declaration The authors declare that no funds, grants, or other support were received during the preparation of this manuscript. Author Contribution All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by L. V. M. C. S., A. G. M. M. F. S. and P. M. S. S. The execution of experimental steps were performed by L. V. M. C. S. and P. M. S. S. The first draft of this manuscript were commented and wroted by L. V. M. C. S., G. J. B. M. and A. C. S. A. All authors readed, commented on previous versions and approved the final version of this manuscript. Acknowledgement The authors express their gratitude to the Jardim Botânico do Recife and the Sistema de Autorização e Informação em Biodiversidade (SisBio) for granting permission for collections in the fragment. Also extend thanks to the Universidade Federal Rural de Pernambuco (UFRPE) and the Plataforma Tecnológica de Genômica e Expressão Gênica do Centro de Ciências Biológicas-CCB/UFPE for their partnership in the proposed analyses. Special thanks to Ubiratã Ferreira Souza, Dr. Carla Rodrigues Ribas and Lucas Tavares for their insightful helps and considerations in the analysis and manuscript writing. Additionally, it is noted that this article was partially produced during the PPGBIO00047 - Tópicos Especiais em Biodiversidade IX course of the Biodiversity Postgraduate Program at the Universidade Federal Rural de Pernambuco. References Becker, M. H., Walke, J. B., Cikanek, S., Savage, A. E., Mattheus, N., Santiago, C. N., ... & Gratwicke, B. (2015). Composition of symbiotic bacteria predicts survival in Panamanian golden frogs infected with a lethal fungus. Proceedings of the Royal Society B: Biological Sciences, 282(1805), 20142881. Bevier, C. R., Gomes, F. R., & Navas, C. A. (2008). Variation in call structure and calling behavior in treefrogs of the genus Scinax . South American Journal of Herpetology , 3(3), 196-206. Bletz, M. C., Archer, H., Harris, R. N., McKenzie, V. J., Rabemananjara, F. C., Rakotoarison, A., & Vences, M. (2017). Host ecology rather than host phylogeny drives amphibian skin microbial community structure in the biodiversity hotspot of Madagascar. Frontiers in Microbiology , 8, 1530. Bravo, M., Combes, T., Martinez, F. O., Risco, D., Gonçalves, P., Garcia-Jimenez, W. L., ... & Gutierrez-Merino, J. (2022). Wildlife Symbiotic Bacteria Are Indicators of the Health Status of the Host and Its Ecosystem. Applied and Environmental Microbiology, 88(1), e01385-21. Assis, A. B., Dos Santos, C., Dutra, F. P., de Oliveira Motta, A., Costa, F. S., Navas, C. A., ... & Barreto, C. C. (2016). Assessing antibacterial potential of components of Phyllomedusa distinct a skin and its associated dermal microbiota. Journal of chemical ecology , 42, 139-148. Brunetti, A. E., Lyra, M. L., Melo, W. G., Andrade, L. E., Palacios-Rodríguez, P., Prado, B. M., ... & Lopes, N. P. (2019). Symbiotic skin bacteria as a source for sex-specific scents in frogs. Proceedings of the National Academy of Sciences , 116(6), 2124-2129. Chivian, E. (2002). Biodiversity: its importance to human health. Center for Health and the Global Environment, Harvard Medical School, Cambridge , MA, 23. Cunningham, A. A., Daszak, P., & Wood, J. L. (2017). One Health, emerging infectious diseases and wildlife: two decades of progress? Philosophical Transactions of the Royal Society B: Biological Sciences , 372(1725), 20160167. De Oliveira, B. T., Nascimento, L. M., Coimbra, R. R. F., & Souza, A. M. (2016). Experiências de conservação no fragmento de Mata Atlântica do Jardim Botânico do Recife. Revista Arrudea-A revista do Jardim Botânico do Recife , 1(1), 1-5. Gonzales‐Siles, L., & Sjöling, Å. (2016). The different ecological niches of enterotoxigenic E scherichia coli . Environmental microbiology , 18 (3), 741-751. Hansen, A. J., Knight, R. L., Marzluff, J. M., Powell, S., Brown, K., Gude, P. H., & Jones, K. (2005). Effects of exurban development on biodiversity: patterns, mechanisms, and research needs. Ecological applications , 15(6), 1893-1905. Ienes-Lima, J., Prichula, J., Abadie, M., Borges-Martins, M., & Frazzon, A. P. G. (2023). First report of culturable skin bacteria in Melanophryniscus admirabilis (admirable redbelly toad). Microbial Ecology , 86(1), 756-761. Ienes-Lima, J., Prichula, J., Abadie, M., Borges-Martins, M., & Frazzon, A. P. G. (2023). Anthropic Impact on the Critically Endangered Melanophryniscus admirabilis (Admirable Redbelly Toad): Evidence from the Presence of Multiresistant Enterobacteriaceae. Current Microbiology , 80(11), 339. Jiménez, R. R., Alvarado, G., Sandoval, J., & Sommer, S. (2020). Habitat disturbance influences the skin microbiome of a rediscovered neotropical-montane frog. BMC microbiology , 20, 1-14. Khalifa, A. Y., AlMalki, M. A., & Bekhet, G. M. (2021). Pathological and mortality findings associated with Aeromonas hydrophila from frog eggs in Al‐Ahsa region of Saudi Arabia. Aquaculture Research , 52(3), 1227-1236. Knispel, S.R & Barros, F.B. (2006). Anfíbios anuros da região urbana de Altamira (Amazônia Oriental), Pará, Brasil. Biotemas . (22), 191-194. Lane, D.J. (1991) 16S/23S rRNA sequencing. In Nucleic Acid Techniques in Bacterial Systematics . Chichester, Reino Unido. Lauer, A., Simon, M. A., Banning, J. L., André, E., Duncan, K., & Harris, R. N. (2007). Common cutaneous bacteria from the eastern red-backed salamander can inhibit pathogenic fungi. Copeia, 2007(3), 630-640. Li, X., Wang, H., Li, Y., Chen, R., Zhang, P., Wang, X., ... & Shen, Y. (2023). Adaptive shifts of the skin and gut microbiomes during metamorphosis of anuran amphibians. Malick, R. C., Bera, A. K., Chowdhury, H., Bhattacharya, M., Abdulla, T., Swain, H. S., ... & Das, B. K. (2020). Identification and pathogenicity study of emerging fish pathogens Acinetobacter junii and Acinetobacter pittii recovered from a disease outbreak in Labeo catla (Hamilton, 1822) and Hypophthalmichthys molitrix (Valenciennes, 1844) of freshwater wetland in West Bengal, India. Aquaculture Research , 51(6), 2410-2420. Martin H, C., Ibáñez, R., Nothias, L. F., Caraballo-Rodríguez, A. M., Dorrestein, P. C., & Gutiérrez, M. (2020). Metabolites from microbes isolated from the skin of the Panamanian rocket frog Colostethus panamansis (Anura: Dendrobatidae). Metabolites , 10(10), 406. Montezol, M., Cassel, M., Silva, D., Ferreira, A., & Mehanna, M. (2018). Gametogenesis and reproductive dynamics of Rhinella schneideri (Anura: Bufonidae): Influence of environmental and anthropogenic factors. Acta Zoologica , 99(1), 93-104. Murray, A. E., Preston, C. M., Massana, R., Taylor, L. T., Blakis, A., Wu, K., & DeLong, E. F. (1998). Seasonal and spatial variability of bacterial and archaeal assemblages in the coastal waters near Anvers Island, Antarctica. Applied and Environmental Microbiology , 64(7), 2585-2595. Pereira, E. N., Lira, C. S., & Santos, E. M. (2016). Ocupação, distribuição espacial e sazonal dos anfíbios anuros, em fragmento de mata atlântica. Revista Ibero-Americana de Ciências Ambientai s, 7(2), 70-83. Proença, D. N., Fasola, E., Lopes, I., & Morais, P. V. (2021). Characterization of the skin cultivable microbiota composition of the frog Pelophylax perezi inhabiting different environments. International Journal of Environmental Research and Public Health , 18(5), 2585. Ramey, AM e Ahlstrom, C.A (2020). Bactérias resistentes a antibióticos na vida selvagem: Perspectivas sobre tendências, aquisição e disseminação, lacunas de dados e direções futuras. Journal of Wildlife Diseases , 56 (1), 1-15. Rodríguez-Bano, J., Picón, E., Gijón, P., Hernández, J. R., Cisneros, J. M., Pena, C., ... & Pascual, A. (2010). Risk factors and prognosis of nosocomial bloodstream infections caused by extended-spectrum-β-lactamase-producing Escherichia coli . Journal of clinical microbiology , 48 (5), 1726-1731. Ross, A. A.; Hoffmann, A. R.; Neufeld, J D. The skin microbiome of vertebrates. Microbiome , v. 7, n. 1, p. 79, 2019. Ruthsatz, K., Lyra, M. L., Lambertini, C., Belasen, A. M., Jenkinson, T. S., da Silva Leite, D., ... & Vences, M.. Skin microbiome correlates with bioclimate and Batrachochytrium dendrobatidis infection intensity in Brazil’s Atlantic Forest treefrogs. Scientific reports , 10(1), 22311, 2020. Schierack P, Romer A, Jores J, Kaspar H, Guenther S, Filter M, Eichberg J, Wieler LH. Isolation and characterization of intestinal Escherichia coli clones from wild boars in Germany. Applied and Environmental Microbiology . 2009; 75:695-702 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editor assigned by journal 20 Jun, 2024 Submission checks completed at journal 19 Jun, 2024 First submitted to journal 28 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4492166","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":316931603,"identity":"8f031406-8f3d-41a4-8bd0-5429694c2bd1","order_by":0,"name":"Lara Valesca Mendonça da Costa Santos","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIiWNgGAWjYBACPiQ24wMGGxDNg18LG4wBVMdswJBGohY2CeK0sJ99+IHhj12ePXv7s2qehHt5/Ay8xz7g1cKTbizB2JZczMNzxuw2T0JxsWQDX/IM/A5LY5BgbGBO7JHIYbvN+yMhccMBHmP8DuN/xvyD4U89UEv6s2KehITE/QS1SKQBfc12GKglwYwZpGUDA0Etz9gsEtuOJ/acOWMsOSchoVjiMF8yXi38/GnMNz78qU5sb29/+OFNQkIef3vvYbxawCABhc1MWANu7aNgFIyCUTAKwAAA0KU+R3aQC+MAAAAASUVORK5CYII=","orcid":"","institution":"Universidade Federal Rural de Pernambuco","correspondingAuthor":true,"prefix":"","firstName":"Lara","middleName":"Valesca Mendonça da Costa","lastName":"Santos","suffix":""},{"id":316931604,"identity":"50fbfd4e-addd-45e7-ab81-940b1ea35c8e","order_by":1,"name":"Alcina Gabriela Maria Medeiros da Fonsêca Santos","email":"","orcid":"","institution":"Universidade Federal Rural de Pernambuco","correspondingAuthor":false,"prefix":"","firstName":"Alcina","middleName":"Gabriela Maria Medeiros da Fonsêca","lastName":"Santos","suffix":""},{"id":316931606,"identity":"012eef71-a3e3-4780-932b-ba7bc8a622dc","order_by":2,"name":"Paula Mariana Salgueiro de Souza","email":"","orcid":"","institution":"Universidade Federal Rural de Pernambuco","correspondingAuthor":false,"prefix":"","firstName":"Paula","middleName":"Mariana Salgueiro","lastName":"de Souza","suffix":""},{"id":316931608,"identity":"c0caa403-371d-45b3-ad75-1a93a6eaf710","order_by":3,"name":"Anna Carolina Soares Almeida","email":"","orcid":"","institution":"Universidade Federal Rural de Pernambuco","correspondingAuthor":false,"prefix":"","firstName":"Anna","middleName":"Carolina Soares","lastName":"Almeida","suffix":""},{"id":316931610,"identity":"9f55966b-a4a5-48be-aa8e-aceafa4796c6","order_by":4,"name":"Geraldo Jorge Barbosa de Moura","email":"","orcid":"","institution":"Universidade Federal Rural de Pernambuco","correspondingAuthor":false,"prefix":"","firstName":"Geraldo","middleName":"Jorge Barbosa","lastName":"de Moura","suffix":""}],"badges":[],"createdAt":"2024-05-28 16:10:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4492166/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4492166/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60429516,"identity":"39a2ed12-c8fb-4555-8694-7fd236926975","added_by":"auto","created_at":"2024-07-16 16:02:55","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":98595,"visible":true,"origin":"","legend":"\u003cp\u003eIndividual of \u003cem\u003eScinax x-signatus\u003c/em\u003e on a bromeliad leaf in JBR. Photo credits: Ubiratã Ferreira-Souza (2019).\u003c/p\u003e","description":"","filename":"Figure1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4492166/v1/c05eeafafdc00fc2cd7789c4.jpeg"},{"id":60429919,"identity":"7bb4ffe7-c087-4315-9ba6-71b60416669b","added_by":"auto","created_at":"2024-07-16 16:10:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":800514,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4492166/v1/81ba63f3-00f0-41dc-bca0-6748f00407f7.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"First characterization of cultivable skin bacteria in the synanthropic anuran Scinax x-signatus (ANURA: HYLIDAE) in northeast Brazil","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe environmental changes induced by human activities lead to a reorganization of the community that can result not only in the loss of species (Chivian, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2002\u003c/span\u003e), but also in the adaptation of others to the urban environment, known as synanthropic species (Hansen et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Some amphibian species are common in urban environments and are recognized for carrying a cutaneous microbiota that is crucial for the protection and homeostasis of the organism (Becker et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Consequently, increased human contact with this group facilitates a bilateral and unnatural transmission route for microorganisms and lineages with pathogenic potential (Cunningham; Daszak; Wood, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAnuran amphibians are interesting models to be investigated in this regard, as species in this group have thin and moist skin due to the secretion of mucous substances, conditions crucial for the colonization of a cutaneous microbiome (Li et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Some species are known for their greater environmental plasticity and occupation of areas modified by humans, such as species from the genera \u003cem\u003eRhinella\u003c/em\u003e and \u003cem\u003eScinax\u003c/em\u003e (Knispel; Barros, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Montezol et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The anuran species \u003cem\u003eScinax x-signatus\u003c/em\u003e (Spix, 1824), for example, is commonly found in forests, forest edges, and anthropogenically modified environments, including residences, thus, in frequent contact with humans (Pereira et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn general, several bacterial phyla are commonly found on the skin of amphibians, such as \u003cem\u003eAcidobacteria, Actinobacteria, Bacteroidetes, and Proteobacteria\u003c/em\u003e (Ross; Hoffmann; Neufeld, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Given the diversity of lifestyles within this group, the skin microbiota of anurans is subject to various modulators, whether intrinsic to the species, such as ontogenetic development (Khalifa; AlMalki; Bekhet, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), sex (Brunetti et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), or related to abiotic factors, such as temperature and microhabitat (Jim\u0026eacute;nez et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The establishment of pathogenic agents on the skin of anurans, such as the bacterium \u003cem\u003eAeromonas hydrophila\u003c/em\u003e, and the fungus \u003cem\u003eBatrachochytrium dendrobatidis\u003c/em\u003e, can cause fatal and highly transmissible infections (Khalifa; AlMalki; Bekhet, 2020; Jim\u0026eacute;nez et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Ruthsatz et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGiven this context, microbiological approaches with the synanthropic genus \u003cem\u003eScinax spp.\u003c/em\u003e are scarce, and the identification of the culturable skin bacteria of anurans occurring in anthropic environments can provide implications for the health of hosts, humans, and for better ecosystem management (Bravo et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) .Therefore, the aim of this study was to describe the culturable bacterial diversity of \u003cem\u003eScinax x-signatus\u003c/em\u003e collected at two sites within a fragment of Atlantic Forest with different anthropogenic impacts.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003eThe study was conducted at the Jardim Bot\u0026acirc;nico do Recife (JBR), located in Pernambuco, Brazil, at coordinates 08\u0026deg;04\u0026rsquo; S; 34\u0026deg;59\u0026rsquo; W. The JBR spans 11.23 hectares, with 60% consisting of fragments of the Atlantic Forest characterized as Ombrophilous Dense (De Oliveira et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Thus, the Jardim Bot\u0026acirc;nico do Recife (JBR) encompasses fragments of both native and secondary forest, with deactivated trails inaccessible to visitors and staff, designated as the \"Control Area\" (CA). In another sector, the JBR features facilities and areas designed for visitation, environmental education activities, and the reception of the general public, which we categorize as the \"Anthropized Area\" (AA), located 700 meters from the CA. This distance was adopted in this study in accordance with the documented reports on movement estimates by species of the genus and family (Bevier; Gomes; Navas, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), which have a movement range of less than 700 meters.\u003c/p\u003e \u003cp\u003eOn 19 December 2019, we collected 11 adult individuals of \u003cem\u003eScinax x-signatus\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) at JBR, comprising four from CA and seven from the AA. The individuals (six males, five females) were captured using nitrile gloves disinfected with 70% alcohol. Each individual was rinsed with 100 ml of autoclaved distilled water to remove particles and microorganisms associated with the environment. Subsequently, the skin microbiota was sampled from the specimens using two sterile swabs passed precisely over the entire body of the animal - ventral side, dorsal side, head and limbs - for approximately 1 minute (Lauer et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). All materials were sanitized with 70% alcohol, and gloves were changed and disinfected between each individual to prevent cross-contamination. Following the described procedure, the specimens were released at their respective sampling points.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe swabs were immediately inoculated in Luria Bertani broth (LB) and incubated overnight at 37\u0026ordm; C in the laboratory. After this step, the samples were inoculated on Mueller-Hinton Agar, Luria Bertani Agar and Cromogenic Agar. Based on colony characterization and morphology, 20 distinct isolates were obtained and stored in Luria Bertani broth\u0026thinsp;+\u0026thinsp;15% glycerol in a deep freezer (-80\u0026ordm;C) for subsequent molecular identification.\u003c/p\u003e \u003cp\u003eBacterial suspension of the isolates in 200 \u0026micro;l Milli-Q water was prepared for the amplification of the 16S rRNA gene through polymerase chain reaction (PCR). For each reaction, 5 \u0026micro;l of Buffer, 2.5 \u0026micro;l of MgCl2, 0.5 \u0026micro;l of dNTP, and 1 \u0026micro;l of each primer 27F (GAGTTTGATCCTGGCTCAG) and 1093R (GTTGCGCTCGTTGCGGAACT) were used (Lane, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1991\u003c/span\u003e). DNA samples were collected directly from the bacterial suspension and placed in the reaction solution (3 \u0026micro;L). The amplification program in the thermocycler consisted of 4 min at 94\u0026deg;C, followed by 30 cycles of 1 min at 94\u0026deg;C, 1 min at 61\u0026deg;C, 30 seconds at 72\u0026deg;C, and 10 min at 72\u0026deg;C for the final extension.\u003c/p\u003e \u003cp\u003eWe evaluated the results of the amplification stage. through agarose gel electrophoresis at 1%. The purification of the amplified samples was performed using phenol chloroform, and the quantification and sequencing of the purified DNA were carried out at the Genomic and Gene Expression Technological Platform of the Center for Biological Sciences (CCB/UFPE). The obtained sequences were edited in the BioEdit software to remove bases with low reading quality and were compared to sequences deposited in the National Center for Biotechnology Information database \u0026ndash; NCBI (2010), using the Classifier and Sequence match options. The sequence length varied from 820 to 1738 base pairs.\u003c/p\u003e \u003cp\u003eWe presented the absolute and relative frequencies of taxa derived from the 20 isolates. Afterward, we employed Pearson's χ2 test to examine potential differences in the frequencies of bacterial families within our samples.\u003c/p\u003e"},{"header":"Results and discussion","content":"\u003cp\u003eThe 20 bacterial isolates from the skin of \u003cem\u003eS. x-signatus\u003c/em\u003e comprised 11 species belonging to three families (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Enterobacteriaceae and Bacillaceae occurred in both areas, with Enterobacteriaceae being the most representative overall (χ2\u0026thinsp;=\u0026thinsp;7.75, g.l.= 2, p\u0026thinsp;=\u0026thinsp;0. 035, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) as well as in specific comparisons with the families Bacillaceae (χ2 Entero - Bacilla\u0026thinsp;=\u0026thinsp;9, g.l.= 1, p\u0026thinsp;=\u0026thinsp;0.003) and Moraxellaceae (χ2 Entero - Moraxella\u0026thinsp;=\u0026thinsp;9, g.l.= 1, p\u0026thinsp;=\u0026thinsp;0.003), the only one that occurred only in the Anthropized Area (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAbsolute and relative frequencies by area of the families, genera and bacterial species collected from the skin of \u003cem\u003eS. x-signatus\u003c/em\u003e individuals in the control and anthropised areas. Orc\u0026thinsp;=\u0026thinsp;Orchidarium; Bro\u0026thinsp;=\u0026thinsp;Bromeliads; Po\u0026thinsp;=\u0026thinsp;Pond; Ve\u0026thinsp;=\u0026thinsp;Vegetation; Lib\u0026thinsp;=\u0026thinsp;Library; Pa\u0026thinsp;=\u0026thinsp;Patio; Vbro\u0026thinsp;=\u0026thinsp;Visiting Bromeliad; Ba\u0026thinsp;=\u0026thinsp;Bathroom.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eFamily\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBacterial genera/species\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCollection point\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAbsolute frequency\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRelative frequency per area (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eControl Area (n\u0026thinsp;=\u0026thinsp;4 animals)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBacillaceae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e14.29\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eBacillus cereus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOrc.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e14.29\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEnterobacteriaceae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e6\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e85.71\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eEnterobacter cloacae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBro\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e16.70\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eEnterobacter hormaechei\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOrq, Po, Ve, Bro\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e84.30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eTotal in the area\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e7\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e100\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eAnthropized area (n\u0026thinsp;=\u0026thinsp;7 animals)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBacillaceae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e23.08\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eBacillus cereus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLib\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e15.39\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eExiguobacterium acetylicum\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEnterobacteriaceae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e7\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e53.85\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eEnterobacter cloacae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eVbro\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15.39\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eEnterobacter hormaechei\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLib, Ba\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15.39\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eEnterobacter\u003c/em\u003e sp.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eEscherichia coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003ePantoea dispersa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLib\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMoraxellaceae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e15.39\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eAcinetobacter junii\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLib\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eAcinetobacter pittii\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eVbro\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eTotal in the area\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e13\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e100\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThree bacterial taxa were common to both sample areas in our study: \u003cem\u003eEnterobacte hormechei\u003c/em\u003e, \u003cem\u003eE. cloacae\u003c/em\u003e, and \u003cem\u003eBacillus cereus\u003c/em\u003e. The presence of these three families aligns with previous investigations into the cutaneous microbiota of anurans (Ienes-Lima et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Assis et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Martin et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Proen\u0026ccedil;a et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Ienes-Lima et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In general, these families are represented by ubiquitous species distributed in soil, water, vegetation, and anthropic installations (Murray et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1998\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe occurrence of the Bacillaceae family in our study also supports findings from the skin of anurans with ranids, bufonids, hylids and, besides our low number of isolates, strengthening the hypothesis that these microorganisms constitute the symbiotic microbiota of anurans (Bletz et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). On the other hand, the report of Moraxellaceae, exclusively in the Anthropized Area, was a distinct finding compared to the report by Lenes-Lima et al. (2023) on the skin of the anuran \u003cem\u003eM. admirabilis\u003c/em\u003e. This family only had the acinetes \u003cem\u003eA. junii\u003c/em\u003e and \u003cem\u003eA. pitii\u003c/em\u003e (non-baumanii acinetes) as representatives, and although previously described as environmental microorganisms, their occurrence only in the anthropized area may be an indication that these microorganisms also being part of the human bacterial flora, eventually causing opportunistic infections in vertebrates (Malick et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSimilarly to our reports, Proen\u0026ccedil;a et al. (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) also identified the prevalence of enterobacteria on the skin of anurans in areas with and without environmental impacts (e.g., metal pollution). Although we recognize the small number of isolates in our study, this may be an indication that enterobacteria not only exhibit higher adaptability to environmental challenges (Gonzales-Siles; Sj\u0026ouml;ling, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), but can also colonize the skin of anurans under similar conditions. This observation is crucial, considering the potential protective role of enterobacteria such as \u003cem\u003ePantoea dispersa\u003c/em\u003e and \u003cem\u003eSerratia marcescens\u003c/em\u003e against the fungus responsible for chytridiomycosis in amphibians (Ienes-Lima et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe sample points \"Library\" and \"Bathroom\" in the Anthropized Area recorded five and three taxa, respectively. Opportunistic taxa such as \u003cem\u003eE. coli\u003c/em\u003e and \u003cem\u003eK. pneumoniae\u003c/em\u003e were found in areas commonly used by humans, such as the \"Bathroom\" and \"Courtyard\" (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). To date, this is the first report of \u003cem\u003eE. coli\u003c/em\u003e present on the skin of anurans. \u003cem\u003eE. coli\u003c/em\u003e was found on the skin of an individual captured in the bathroom. We did not observe signs of ulcerations or wounds that could indicate any cutaneous infection in the individuals. While it is possible that, like other enterobacteria, \u003cem\u003eE. coli\u003c/em\u003e may be part of the commensal skin microbiota of \u003cem\u003eS. x-signatus\u003c/em\u003e, it is known that this microorganism is common in the lower gastrointestinal flora of warm-blooded animals (Schierack et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Therefore, we believe this is indicative that \u003cem\u003eE. coli\u003c/em\u003e may be transmitted to \u003cem\u003eS. x-signatus\u003c/em\u003e through direct or indirect contact with human feces in the area where it was captured, once this species is commonly found in urban vegetation and decorative bodies of water (Pereira et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Therefore, it is important to note that \u003cem\u003eS. x-signatus\u003c/em\u003e individuals may carried an occasional patogenic agent. Strains of \u003cem\u003eE. coli\u003c/em\u003e have specific virulence and resistance characteristics known in humans, while Multiresistant \u003cem\u003eE. coli\u003c/em\u003e and \u003cem\u003eK. pneumoniae\u003c/em\u003e are associated with urinary and nosocomial infections (Rodr\u0026iacute;guez-Bano et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn general, it is expected that environmental complexity in less fragmented environments provides greater microbial diversity. However, as also observed by Bi\u0026eacute; et al. (2019), the source of fragmentation observed in this study is humans, and they, in turn, contribute to the construction of complex microenvironments associated with the dispersion of microorganisms to synanthropic fauna (Ramey; Ahlstrom, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Our findings underscore the influence of anthropization on the composition and diversity of the cutaneous microbiota of synanthropic vertebrates and emphasize the investigation of pathways for the transmission of potentially zoonotic pathogens in ecosystems.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe adaptation of \u003cem\u003eS. x-signatus\u003c/em\u003e individuals to the modified environment and the spatial heterogeneity caused by anthropization may have favoured microenvironments susceptible to this first report of human-associated bacterial species in threefrog\u0026rsquo;s skin. This finding can be a first step towards encouraging more in-depth research into the skin bacterial diversity of synanthropic anurans, especially with regard to the virulence potential and resistance profile of skin bacteria.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflict of interest statement\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no known competing interests or personal relationships that could have appeared to influence the study reported in this paper.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003e \u003cb\u003eORCID\u003c/b\u003e \u003c/h2\u003e \u003cp\u003e \u003cstrong\u003eLara Valesca Mendon\u0026ccedil;a da Costa Santos\u003c/strong\u003e \u003cp\u003e0000-0002-4400-6637;\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eAlcina Gabriela Maria Medeiros da Fons\u0026ecirc;ca Santos\u003c/strong\u003e \u003cp\u003e0000-0002-6223-8044;\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003ePaula Mariana Salgueiro de Souza\u003c/strong\u003e \u003cp\u003e0000-0001-7764-0573;\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eAnna Carolina Soares Almeida\u003c/strong\u003e \u003cp\u003e0000-0001-5536-7262;\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eGeraldo Jorge Barbosa de Moura\u003c/strong\u003e \u003cp\u003e0000-0001-7241-7524.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eEthics Approval\u003c/h2\u003e \u003cp\u003eThis study was approved and granted by the Sistema de Autoriza\u0026ccedil;\u0026atilde;o e Informa\u0026ccedil;\u0026atilde;o em Biodiversidade (2019/ 80088).\u003c/p\u003e \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eFunding Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that no funds, grants, or other support were received during the preparation of this manuscript.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAll authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by L. V. M. C. S., A. G. M. M. F. S. and P. M. S. S. The execution of experimental steps were performed by L. V. M. C. S. and P. M. S. S. The first draft of this manuscript were commented and wroted by L. V. M. C. S., G. J. B. M. and A. C. S. A. All authors readed, commented on previous versions and approved the final version of this manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors express their gratitude to the Jardim Bot\u0026acirc;nico do Recife and the Sistema de Autoriza\u0026ccedil;\u0026atilde;o e Informa\u0026ccedil;\u0026atilde;o em Biodiversidade (SisBio) for granting permission for collections in the fragment. Also extend thanks to the Universidade Federal Rural de Pernambuco (UFRPE) and the Plataforma Tecnol\u0026oacute;gica de Gen\u0026ocirc;mica e Express\u0026atilde;o G\u0026ecirc;nica do Centro de Ci\u0026ecirc;ncias Biol\u0026oacute;gicas-CCB/UFPE for their partnership in the proposed analyses. Special thanks to Ubirat\u0026atilde; Ferreira Souza, Dr. Carla Rodrigues Ribas and Lucas Tavares for their insightful helps and considerations in the analysis and manuscript writing. Additionally, it is noted that this article was partially produced during the PPGBIO00047 - T\u0026oacute;picos Especiais em Biodiversidade IX course of the Biodiversity Postgraduate Program at the Universidade Federal Rural de Pernambuco.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBecker, M. H., Walke, J. B., Cikanek, S., Savage, A. E., Mattheus, N., Santiago, C. N., ... \u0026amp; Gratwicke, B. (2015). Composition of symbiotic bacteria predicts survival in Panamanian golden frogs infected with a lethal fungus. \u003cstrong\u003eProceedings of the Royal Society\u003c/strong\u003e B: Biological Sciences, 282(1805), 20142881.\u003c/li\u003e\n\u003cli\u003eBevier, C. R., Gomes, F. R., \u0026amp; Navas, C. A. (2008). Variation in call structure and calling behavior in treefrogs of the genus \u003cem\u003eScinax\u003c/em\u003e\u003cstrong\u003e. South American Journal of Herpetology\u003c/strong\u003e, 3(3), 196-206.\u003c/li\u003e\n\u003cli\u003eBletz, M. C., Archer, H., Harris, R. N., McKenzie, V. J., Rabemananjara, F. C., Rakotoarison, A., \u0026amp; Vences, M. (2017). Host ecology rather than host phylogeny drives amphibian skin microbial community structure in the biodiversity hotspot of Madagascar. \u003cstrong\u003eFrontiers in Microbiology\u003c/strong\u003e, 8, 1530.\u003c/li\u003e\n\u003cli\u003eBravo, M., Combes, T., Martinez, F. O., Risco, D., Gon\u0026ccedil;alves, P., Garcia-Jimenez, W. L., ... \u0026amp; Gutierrez-Merino, J. (2022). Wildlife Symbiotic Bacteria Are Indicators of the Health Status of the Host and Its Ecosystem. \u003cstrong\u003eApplied and Environmental Microbiology,\u003c/strong\u003e 88(1), e01385-21.\u003c/li\u003e\n\u003cli\u003eAssis, A. B., Dos Santos, C., Dutra, F. P., de Oliveira Motta, A., Costa, F. S., Navas, C. A., ... \u0026amp; Barreto, C. C. (2016). Assessing antibacterial potential of components of \u003cem\u003ePhyllomedusa distinct\u003c/em\u003ea skin and its associated dermal microbiota. \u003cstrong\u003eJournal of chemical ecology\u003c/strong\u003e, 42, 139-148.\u003c/li\u003e\n\u003cli\u003eBrunetti, A. E., Lyra, M. L., Melo, W. G., Andrade, L. E., Palacios-Rodr\u0026iacute;guez, P., Prado, B. M., ... \u0026amp; Lopes, N. P. (2019). Symbiotic skin bacteria as a source for sex-specific scents in frogs. \u003cstrong\u003eProceedings of the National Academy of Sciences\u003c/strong\u003e, 116(6), 2124-2129.\u003c/li\u003e\n\u003cli\u003eChivian, E. (2002). Biodiversity: its importance to human health. Center for Health and the Global Environment, \u003cstrong\u003eHarvard Medical School, Cambridge\u003c/strong\u003e, MA, 23.\u003c/li\u003e\n\u003cli\u003eCunningham, A. A., Daszak, P., \u0026amp; Wood, J. L. (2017). One Health, emerging infectious diseases and wildlife: two decades of progress? Philosophical Transactions of the Royal Society \u003cstrong\u003eB: Biological Sciences\u003c/strong\u003e, 372(1725), 20160167.\u003c/li\u003e\n\u003cli\u003eDe Oliveira, B. T., Nascimento, L. M., Coimbra, R. R. F., \u0026amp; Souza, A. M. (2016). Experi\u0026ecirc;ncias de conserva\u0026ccedil;\u0026atilde;o no fragmento de Mata Atl\u0026acirc;ntica do Jardim Bot\u0026acirc;nico do Recife. \u003cstrong\u003eRevista Arrudea-A revista do Jardim Bot\u0026acirc;nico do Recife\u003c/strong\u003e, 1(1), 1-5.\u003c/li\u003e\n\u003cli\u003eGonzales‐Siles, L., \u0026amp; Sj\u0026ouml;ling, \u0026Aring;. (2016). The different ecological niches of enterotoxigenic \u003cem\u003eE scherichia coli\u003c/em\u003e. \u003cstrong\u003eEnvironmental microbiology\u003c/strong\u003e, \u003cem\u003e18\u003c/em\u003e(3), 741-751.\u003c/li\u003e\n\u003cli\u003eHansen, A. J., Knight, R. L., Marzluff, J. M., Powell, S., Brown, K., Gude, P. H., \u0026amp; Jones, K. (2005). Effects of exurban development on biodiversity: patterns, mechanisms, and research needs. \u003cstrong\u003eEcological applications\u003c/strong\u003e, 15(6), 1893-1905.\u003c/li\u003e\n\u003cli\u003eIenes-Lima, J., Prichula, J., Abadie, M., Borges-Martins, M., \u0026amp; Frazzon, A. P. G. (2023). First report of culturable skin bacteria in \u003cem\u003eMelanophryniscus admirabilis\u003c/em\u003e (admirable redbelly toad). \u003cstrong\u003eMicrobial Ecology\u003c/strong\u003e, 86(1), 756-761.\u003c/li\u003e\n\u003cli\u003eIenes-Lima, J., Prichula, J., Abadie, M., Borges-Martins, M., \u0026amp; Frazzon, A. P. G. (2023). Anthropic Impact on the Critically Endangered \u003cem\u003eMelanophryniscus admirabilis\u003c/em\u003e (Admirable Redbelly Toad): Evidence from the Presence of Multiresistant Enterobacteriaceae. \u003cstrong\u003eCurrent Microbiology\u003c/strong\u003e, 80(11), 339.\u003c/li\u003e\n\u003cli\u003eJim\u0026eacute;nez, R. R., Alvarado, G., Sandoval, J., \u0026amp; Sommer, S. (2020). Habitat disturbance influences the skin microbiome of a rediscovered neotropical-montane frog. \u003cstrong\u003eBMC microbiology\u003c/strong\u003e, 20, 1-14.\u003c/li\u003e\n\u003cli\u003eKhalifa, A. Y., AlMalki, M. A., \u0026amp; Bekhet, G. M. (2021). Pathological and mortality findings associated with \u003cem\u003eAeromonas hydrophila\u003c/em\u003e from frog eggs in Al‐Ahsa region of Saudi Arabia. \u003cstrong\u003eAquaculture Research\u003c/strong\u003e, 52(3), 1227-1236.\u003c/li\u003e\n\u003cli\u003eKnispel, S.R \u0026amp; Barros, F.B. (2006). Anf\u0026iacute;bios anuros da regi\u0026atilde;o urbana de Altamira (Amaz\u0026ocirc;nia Oriental), Par\u0026aacute;, Brasil.\u003cstrong\u003eBiotemas\u003c/strong\u003e. (22), 191-194.\u003c/li\u003e\n\u003cli\u003eLane, D.J. (1991) 16S/23S rRNA sequencing. In \u003cstrong\u003eNucleic Acid Techniques in Bacterial Systematics\u003c/strong\u003e. Chichester, Reino Unido.\u003c/li\u003e\n\u003cli\u003eLauer, A., Simon, M. A., Banning, J. L., Andr\u0026eacute;, E., Duncan, K., \u0026amp; Harris, R. N. (2007). Common cutaneous bacteria from the eastern red-backed salamander can inhibit pathogenic fungi. \u003cstrong\u003eCopeia,\u003c/strong\u003e 2007(3), 630-640.\u003c/li\u003e\n\u003cli\u003eLi, X., Wang, H., Li, Y., Chen, R., Zhang, P., Wang, X., ... \u0026amp; Shen, Y. (2023). Adaptive shifts of the skin and gut microbiomes during metamorphosis of anuran amphibians.\u003c/li\u003e\n\u003cli\u003eMalick, R. C., Bera, A. K., Chowdhury, H., Bhattacharya, M., Abdulla, T., Swain, H. S., ... \u0026amp; Das, B. K. (2020). Identification and pathogenicity study of emerging fish pathogens \u003cem\u003eAcinetobacter junii \u003c/em\u003eand \u003cem\u003eAcinetobacter pittii\u003c/em\u003e recovered from a disease outbreak in Labeo catla (Hamilton, 1822) and \u003cem\u003eHypophthalmichthys molitrix\u003c/em\u003e (Valenciennes, 1844) of freshwater wetland in West Bengal, India. \u003cstrong\u003eAquaculture Research\u003c/strong\u003e, 51(6), 2410-2420.\u003c/li\u003e\n\u003cli\u003eMartin H, C., Ib\u0026aacute;\u0026ntilde;ez, R., Nothias, L. F., Caraballo-Rodr\u0026iacute;guez, A. M., Dorrestein, P. C., \u0026amp; Guti\u0026eacute;rrez, M. (2020). Metabolites from microbes isolated from the skin of the Panamanian rocket frog \u003cem\u003eColostethus panamansis\u003c/em\u003e (Anura: Dendrobatidae). \u003cstrong\u003eMetabolites\u003c/strong\u003e, 10(10), 406.\u003c/li\u003e\n\u003cli\u003eMontezol, M., Cassel, M., Silva, D., Ferreira, A., \u0026amp; Mehanna, M. (2018). Gametogenesis and reproductive dynamics of \u003cem\u003eRhinella schneideri\u003c/em\u003e (Anura: Bufonidae): Influence of environmental and anthropogenic factors. \u003cstrong\u003eActa Zoologica\u003c/strong\u003e, 99(1), 93-104.\u003c/li\u003e\n\u003cli\u003eMurray, A. E., Preston, C. M., Massana, R., Taylor, L. T., Blakis, A., Wu, K., \u0026amp; DeLong, E. F. (1998). Seasonal and spatial variability of bacterial and archaeal assemblages in the coastal waters near Anvers Island, Antarctica. \u003cstrong\u003eApplied and Environmental Microbiology\u003c/strong\u003e, 64(7), 2585-2595.\u003c/li\u003e\n\u003cli\u003ePereira, E. N., Lira, C. S., \u0026amp;amp; Santos, E. M. (2016). Ocupa\u0026ccedil;\u0026atilde;o, distribui\u0026ccedil;\u0026atilde;o espacial e sazonal dos anf\u0026iacute;bios anuros, em fragmento de mata atl\u0026acirc;ntica. \u003cstrong\u003eRevista Ibero-Americana de Ci\u0026ecirc;ncias Ambientai\u003c/strong\u003es, 7(2), 70-83.\u003c/li\u003e\n\u003cli\u003eProen\u0026ccedil;a, D. N., Fasola, E., Lopes, I., \u0026amp; Morais, P. V. (2021). Characterization of the skin cultivable microbiota composition of the frog \u003cem\u003ePelophylax perezi\u003c/em\u003e inhabiting different environments. \u003cstrong\u003eInternational Journal of Environmental Research and Public Health\u003c/strong\u003e, 18(5), 2585.\u003c/li\u003e\n\u003cli\u003eRamey, AM e Ahlstrom, C.A (2020). Bact\u0026eacute;rias resistentes a antibi\u0026oacute;ticos na vida selvagem: Perspectivas sobre tend\u0026ecirc;ncias, aquisi\u0026ccedil;\u0026atilde;o e dissemina\u0026ccedil;\u0026atilde;o, lacunas de dados e dire\u0026ccedil;\u0026otilde;es futuras. \u003cstrong\u003eJournal of Wildlife Diseases\u003c/strong\u003e , \u003cem\u003e56\u003c/em\u003e (1), 1-15.\u003c/li\u003e\n\u003cli\u003eRodr\u0026iacute;guez-Bano, J., Pic\u0026oacute;n, E., Gij\u0026oacute;n, P., Hern\u0026aacute;ndez, J. R., Cisneros, J. M., Pena, C., ... \u0026amp; Pascual, A. (2010). Risk factors and prognosis of nosocomial bloodstream infections caused by extended-spectrum-\u0026beta;-lactamase-producing \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cstrong\u003eJournal of clinical microbiology\u003c/strong\u003e, \u003cem\u003e48\u003c/em\u003e(5), 1726-1731.\u003c/li\u003e\n\u003cli\u003eRoss, A. A.; Hoffmann, A. R.; Neufeld, J D. The skin microbiome of vertebrates. \u003cstrong\u003eMicrobiome\u003c/strong\u003e, v. 7, n. 1, p. 79, 2019.\u003c/li\u003e\n\u003cli\u003eRuthsatz, K., Lyra, M. L., Lambertini, C., Belasen, A. M., Jenkinson, T. S., da Silva Leite, D., ... \u0026amp; Vences, M.. Skin microbiome correlates with bioclimate and \u003cem\u003eBatrachochytrium dendrobatidis\u003c/em\u003e infection intensity in Brazil\u0026rsquo;s Atlantic Forest treefrogs. \u003cstrong\u003eScientific reports\u003c/strong\u003e, 10(1), 22311, 2020.\u003c/li\u003e\n\u003cli\u003eSchierack P, Romer A, Jores J, Kaspar H, Guenther S, Filter M, Eichberg J, Wieler LH. Isolation and characterization of intestinal \u003cem\u003eEscherichia coli\u003c/em\u003e clones from wild boars in Germany. \u003cstrong\u003eApplied and Environmental Microbiology\u003c/strong\u003e. 2009; 75:695-702\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"international-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"intm","sideBox":"Learn more about [International Microbiology](https://www.springer.com/journal/10123)","snPcode":"10123","submissionUrl":"https://submission.nature.com/new-submission/10123/3","title":"International Microbiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Scinax x-signatus, skin microbiota, Anura microbiota, synanthropic fauna","lastPublishedDoi":"10.21203/rs.3.rs-4492166/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4492166/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSome amphibians\u0026rsquo; species adapted to the urban ecosystem \u0026ndash; synanthropic - can have their cryptic interactions with microorganisms altered. In the case of anurans, the skin bacterial microbiota plays a fundamental role in host protection. However, it is not known how the composition and diversity of the skin microbiota of \u003cem\u003eScinax x-signatus\u003c/em\u003e, a synanthropic anuran, behaves in different fragments. In this study, we describe the culturable bacteria from the skin of individuals of the anthropic anuran \u003cem\u003eScinax x-signatus\u003c/em\u003e by sequencing the 16S rRNA gene obtained from the amplified product of polymerase chain reaction (PCR) technique. Skin swab samples were collected from 11 \u003cem\u003eS. x-signatus\u003c/em\u003e, 4 in a natural area and 7 in an anthropized area. Bacteria were isolated using different rich and selective culture media. A total of 20 bacterial isolates were identified, being 7 in control area and 13 in anthropized area, represented by the families Enterobacteriaceae (54.6%; n\u0026thinsp;=\u0026thinsp;7), Bacillaceae (18.2%; n\u0026thinsp;=\u0026thinsp;2) and Moraxellaceae (18.2%; n\u0026thinsp;=\u0026thinsp;2). Among their representatives, we report \u003cem\u003eEnterobacter\u003c/em\u003e as the most frequent genus and highlight the first report of \u003cem\u003eEscherichia coli\u003c/em\u003e. This first report of culturable skin bacteria of \u003cem\u003eScinax x-signatus\u003c/em\u003e, together with the first record of \u003cem\u003eE. coli\u003c/em\u003e, improves our knowledge of the skin microbiome of amphibians, contributing to their conservation and the maintenance of environmental health.\u003c/p\u003e","manuscriptTitle":"First characterization of cultivable skin bacteria in the synanthropic anuran Scinax x-signatus (ANURA: HYLIDAE) in northeast Brazil","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-16 16:02:50","doi":"10.21203/rs.3.rs-4492166/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorAssigned","content":"","date":"2024-06-20T14:33:48+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-19T04:01:51+00:00","index":"","fulltext":""},{"type":"submitted","content":"International Microbiology","date":"2024-05-28T16:08:54+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"international-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"intm","sideBox":"Learn more about [International Microbiology](https://www.springer.com/journal/10123)","snPcode":"10123","submissionUrl":"https://submission.nature.com/new-submission/10123/3","title":"International Microbiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6a43c168-55a1-4587-8a21-69725840dc1e","owner":[],"postedDate":"July 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-07-16T16:02:50+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-16 16:02:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4492166","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4492166","identity":"rs-4492166","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.