Supplementation with Kluyveromyces marxianus probiotic yeasts in sows and their piglets in early post- weaning: effects in biological and productive parameters

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Weaning in pig production is a stressful event that impacts intestinal biology and increases the risk of infections, impairing piglet development and leading to economic losses. Antibiotic preventive administration has been used to improve the productive parameters, but nowadays this practice has been banned because of its contribution to antimicrobial resistance generation. So, alternatives are urgently needed. Kluyveromyces marxianus CIDCA 9121 has immunomodulatory and convenient biotechnological properties and was studied for preventing post-weaning stress, for which 8 sows were supplemented with 109 CFU per kg of feed from 20 days before piglets´ birth until weaning. Then, piglets were supplemented with 2x109 CFU/ kg of feed for 20 days more. A control group of 8 sows and their piglets not supplemented with yeast was included. Productive parameters were registered from birth to 60 days of age. Five days post-weaning, 5 animals from each group were euthanized; small intestines and blood were taken for histopathology analysis and amino acid analysis respectively. Intestinal content was sampled to determine the main bacterial groups by qPCR. Piglets born from supplemented sows (n = 132) weighed more than controls (n = 130; p < 0,05). During farrowing, there were no differences among groups but 40 days after weaning the supplemented group weighted 10% more than the control group (p < 0,05). We found an increase in citrullinemia and in the small intestine mucosal thickness in supplemented piglets post-weaning indicating better tolerance to post-weaning stress. Our results suggest that K. marxianus CIDCA 9121 is a good candidate for supplementation of gestating sows and postweaning piglets.
Full text 140,356 characters · extracted from preprint-html · click to expand
Supplementation with Kluyveromyces marxianus probiotic yeasts in sows and their piglets in early post- weaning: effects in biological and productive parameters | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Supplementation with Kluyveromyces marxianus probiotic yeasts in sows and their piglets in early post- weaning: effects in biological and productive parameters María Dolores Pendón, Malena Ferreyra Compagnucci, Eugenio Valette, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6590564/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Weaning in pig production is a stressful event that impacts intestinal biology and increases the risk of infections, impairing piglet development and leading to economic losses. Antibiotic preventive administration has been used to improve the productive parameters, but nowadays this practice has been banned because of its contribution to antimicrobial resistance generation. So, alternatives are urgently needed. Kluyveromyces marxianus CIDCA 9121 has immunomodulatory and convenient biotechnological properties and was studied for preventing post-weaning stress, for which 8 sows were supplemented with 10 9 CFU per kg of feed from 20 days before piglets´ birth until weaning. Then, piglets were supplemented with 2x10 9 CFU/ kg of feed for 20 days more. A control group of 8 sows and their piglets not supplemented with yeast was included. Productive parameters were registered from birth to 60 days of age. Five days post-weaning, 5 animals from each group were euthanized; small intestines and blood were taken for histopathology analysis and amino acid analysis respectively. Intestinal content was sampled to determine the main bacterial groups by qPCR. Piglets born from supplemented sows (n = 132) weighed more than controls (n = 130; p < 0,05). During farrowing, there were no differences among groups but 40 days after weaning the supplemented group weighted 10% more than the control group (p < 0,05). We found an increase in citrullinemia and in the small intestine mucosal thickness in supplemented piglets post-weaning indicating better tolerance to post-weaning stress. Our results suggest that K. marxianus CIDCA 9121 is a good candidate for supplementation of gestating sows and postweaning piglets. probiotic yeasts antimicrobial resistance post-weaning stress porcine production Figures Figure 1 Figure 2 Figure 3 Introduction Pork is an increasingly demanded product, accounting of 34% of global meat consumption. Its production has incremented 130% in the last 60 years worldwide, stimulated by a rising demand due to growing global population and changes in socioeconomical situation [ 1 ]. It is expected that this trend will continue for the next years. The increase in production has been achieved by combining sustained improvement in pig nutrition science and better production practices. In the last decades, production is concentrating in larger producers that can manage sustained investments and receive larger profits [ 2 ]. In the setting of pork producing farms, weaning of piglets is one of the major stressful events that may impact in the overall farm productivity [ 3 ]. The usual practice is to transfer litter of piglets from farrowing where lactation takes place in contact with the sow and its littermates to the nursing area that is shared with other piglets born at the same time from other sows. This procedure induces social stress on piglets by increasing interactions among them and restructuring their social hierarchy. Furthermore, an abrupt dietary shift is produced from lactation to solid feed, which impacts on the intestinal microbiota and gut health. These changes determine modification of gastrointestinal physiology and increased susceptibility to infections that can result in impaired feed conversion, reduction in weight gain rate and increased morbidity and mortality [ 4 ]. The use of antibiotics to mitigate this problem tends to be minimized according to sanitary regulation aiming to reduce antimicrobial resistance generation. In the last years, restrictions to the use of antibiotics in animal production has been included in EU regulations and more recently in China, USA and other countries [ 5 – 7 ] The use of probiotics appears as an appropriate intervention to minimize post-weaning stress and the use of antibiotics [ 8 , 9 ]. There are reports of successful use of bacterial and yeast probiotics to improve weight gain and to establish an appropriate microbiota [ 10 ]. It is remarkable that different strategies have shown positive effects in the weaning scenario. The administration of probiotics to sows at the end stage of the pregnancy and during lactation contributes to better post-partum recovery and lactation capacity and, on the other hand, it may also contribute to the piglet microbiota diversity and functionality [ 11 – 14 ]. Moreover, the administration of probiotics to piglets after weaning alleviates postweaning stress by promoting better intestinal health and lowering infection rate either by competition/washing out pathogenic microorganisms or by inducing stronger immune function in the piglets [ 15 – 18 ]. In recent years, our group has characterized the probiotic capacity of several strains of Kluyveromyces marxianus yeast, that have also the capacity to grow on cheese whey or whey permeate, and present high specific growth rates as well as tolerance to high temperatures. This offers an alternative that adds value to this by-product of cheese industry and is attractive to high-scale production[ 19 , 20 ]. Remarkably, K. marxianus CIDCA 9121 grown in whey permeate has shown anti-inflammatory activity on intestinal epithelial cells and colitis models in rodents being an interesting candidate strain to promote intestinal health [ 20 ]. In the present work, K. marxianus CIDCA 9121 was administrated to gestating sows and their piglets in the first three weeks post weaning in order to evaluate its impact on productive parameters and biomarkers of post-weaning stress. Materials and Methods Freeze-dried yeast obtention The demands of daily farm work made it impossible to administer fresh refrigerated yeast. Therefore, this study utilized freeze-dried and fractionated yeast. Kluyveromyces marxianus CIDCA 9121 biomass was obtained following a two-stage fermentation process (batch and fed-batch) in a 15 L bioreactor using optimized media containing whey permeate 150 g/L, ammonium sulfate 7 g/L and yeast hydrolysate 7 g/L. Cells were harvested after 40 h and subsequently freeze-dried in an L-I-E260-CR RIFICOR freeze-dryer under controlled conditions (condenser temperature − 35°C, vacuum pressure 16 Pa, shelf temperature 25°C). The final product yielded a viable cell count of 5.5 x10 9 CFU/g of K. marxianus CIDCA 9121. Animals and experimental procedures The experimental protocols were approved by Institutional Animal Care and Use Committee of the Faculty of Exact Sciences, National University of La Plata (Protocol Number 002-44-24). The study was conducted in the facilities of a commercial farm ‘Las 4B’ SA, located in Buenos Aires, Argentina (35°26'12.3"S 58°18'24.3"W). The trial was performed from October 2023 to January 2024. Sixteen pregnant Topigs Norsvin® TN70 sows (average parity 3.9) were randomly assigned to two experimental groups (n = 8) at days 111–115 of gestation: a control group (Control) that received a basal diet and an yeast supplemented group (Km9121) that received a basal diet supplemented on top with freeze-dried K. marxianus CIDCA 9121 yeast at a dose of 1.4 g of lyophilized product/sow/day. Supplementation was carried out during the last 20 days of gestation and the first 21 days of lactation. After weaning, piglets born to supplemented sows received a daily dose of approximately 1x10⁹ CFU/day, while piglets born to control sows received only the basal diet. In this case, the yeast dose was top-dressed onto a reduced portion of balanced feed placed in plastic nursery feeders. All animals received ad libitum access to water and a basal diet of balanced feed formulated according to the nutritional requirements set out commonly used on the farm, based in four different phases (phase 1, first week after weaning, phase 2, second week after weaning, phase three, from day 35 to 49 of age and phase four from day 49 until the end of farrowing) shifting from a dairy-based initial formulation but stepwise including growing amounts of corn and soybean based ingredients that constitute 95% of the composition of phase 4 diet. During gestation and farrowing sows were housed individually in gestating cages, at 21 days piglets were transferred to nursery where they remained in separate groups according to treatment. The appropriate ambient temperature was maintained 27–30°C and the relative humidity was maintained at 55–65%. Pens were cleaned daily. Sows and piglets received routine vaccinations according to the farm's immunization program. No alterations were made to the standard feed during the experimental period. Measurements and collected parameters Litter parameters recorded at farrowing included: farrowing duration per litter, interval between piglet expulsion, litter size, total number of live-born piglets and mummies from both experimental groups. Additionally, a colostrum sample was collected within 24 hours post-farrowing and stored at -20°C, immediately after collection. Piglets were weighed at birth and their individual weights were monitored at day 7, 14 (lactation phase), 21 (weaning) and 42 (post-weaning yeast supplementation phase), and on subsequent days after cessation of yeast supplementation. Blood samples were collected via anterior vena cava puncture at 19 and 25 days of age from 5 piglets per group. Subsequently, blood samples were centrifuged at 1,500 xg for 10 minutes to obtain serum. Serum samples were then stored at -20°C until further analysis of anti-flagellin antibodies, serum IgG dosage, and levels of nitrogenous amino acids: ornithine, glutamine, arginine, proline, and glutamic acid. Randomly selected piglets (n = 5 per group) were sacrificed for tissue sampling five days after weaning. Animals were mechanically stunned and bled following the common commercial slaughtering practices and tissue samples from duodenum, ileum and colon and cecal content were obtained for subsequent measurements. Determination of sIgA concentration in colostrum Pig secretory immunoglobulin A (sIgA) levels were determined using the CSB-E12063p Pig sIgA ELISA Kit (CUSABIO, Houston, USA) according to the manufacturer's instructions. This sandwich ELISA employs a pair of specific anti-IgA antibodies, one conjugated to an enzyme for colorimetric detection. A standard curve (150 ng/mL to 37.5 µg/mL) was generated using the kit's provided IgA standard. Colostrum samples (diluted 1:100 in 0.05% (v/v) PBS-Tween 20 with 1% (w/v) milk protein) were incubated for 1 h at 37°C. After washing, peroxidase-conjugated anti-IgA was added and incubated for 1 h at 37°C. Following additional washes, 3,3′,5,5′-tetramethylbenzidine (TMB) substrate was added for 20 min, and the reaction was stopped with 2 M sulfuric acid. Absorbance was measured at 450 nm using a Varioskan Lux microplate reader (Thermo Scientific, USA). Brix measurement of colostrum samples Measurements were made according to Hasan et al. (2016) with a digital refractometer MA871 (Milkwaukee Inc., Rocky Mount, NC 27804 USA). Determination of citrullinemia and nitrogen amino acids levels on piglets The analysis of citrulline, proline, arginine, glutamine, ornithine, and glutamic acid concentrations in pig serum was performed by HPLC/DAD using an Agilent HP1290 liquid chromatograph (binary pump, degasser, column thermostat, autosampler, and DAD detector), after derivatization with dinitrofluorobenzene (Sanger's reagent). Samples were deproteinized with 30% (w/v) trichloroacetic acid, centrifuged at 7.630 xg for 5 min, and derivatized. A 50 µL volume of supernatant was mixed with 50 µL of 50 mM borate/boric acid buffer pH 9.20, 30 µL of Sanger's reagent solution in acetonitrile, and 170 µL of acetonitrile. They were maintained at 45°C for 45 min, and then the reaction was stopped with 0.5 M HCl. The derivatized samples were centrifuged, filtered and injected into the chromatograph. Amino acid standard mixtures of the six amino acids of interest at three concentration levels, previously derivatized, were used as standards. Immunological evaluation Pig immunoglobulin G (IgG) levels in serum were quantified using the CSB-E06804p Pig IgG ELISA Kit (CUSABIO, Houston, USA) following the manufacturer's protocol. This sandwich ELISA employs a pair of specific anti-IgG antibodies, one conjugated to an enzyme for colorimetric detection. A standard curve (580 ng/mL to 150 µg/mL) was generated using the kit's provided IgG standard. Samples (diluted 1:50 in 0.05% (v/v) PBS-Tween 20 with 1% (w/v) milk protein) were incubated for 1 h at 37°C. After washing, peroxidase-conjugated anti-IgG was added and incubated for 1 h at 37°C. Following additional washes, TMB substrate was added for 20 min, and the reaction was stopped with 2 M sulfuric acid. Absorbance was measured at 450 nm using a Varioskan Lux microplate reader (Thermo Scientific, USA). An indirect enzyme-linked immunosorbent assay (ELISA) was employed to quantify specific antibodies against Lawsonia intracellularis and Salmonella sp ., in order to evaluate the immune response following on-farm vaccination. Microtiter plates (NUNC, Maxisorp, USA) were coated with a 1 µg/mL solution of purified Salmonella sp. flagellin (Hiriart et al., 2013) in phosphate buffer (pH 7.4) and incubated overnight at 4°C. For measurement of anti- Lawsonia antibodies, plates were coated with the whole microorganism extract used for vaccination, suspended in carbonate buffer pH 9.0 at a concentration of 10 mg/mL. After washing and blocking with 3% (w/v) milk protein in PBS, the plates were incubated with a 1:50 dilution of porcine sera. Bound IgG was detected by incubating with a peroxidase-conjugated anti-IgG antibody (CUSABIO, USA). The colorimetric reaction was developed using o-phenylenediamine dihydrochloride (OPD) substrate and stopped with 2 M sulfuric acid. Absorbance was measured at 492 nm using a Varioskan Lux microplate reader (Thermo Scientific, USA). Intestinal metabolites and microbial analysis Determination of organic acids by Gas Chromatography Organic acids levels in cecal content were determined qualitatively and quantitatively by Gas Chromatography according to Bengoa et al. (2020) (20) using an Agilent 7890A GC system fitted with a DBFATWAX UI 30 m x 0.25 mm x 0.25 µm (Agilent Technologies, Santa Clara, CA, USA) coupled to a flame ionization detector (FID). Briefly, 1 mL of cecal content suspended in distilled water (1:4 dilution) was centrifuged at 7,630 xg for 10 min. The obtained supernatant was filtered through a 0.22 µm membrane (Millipore Corporation, USA). The temperature at the injection port and at the FID was 280°C. Helium was used as carrier gas at a flow rate of 1.6 mL/min. For the run, 2 µL of the sample was injected with a 25:1 split and a temperature program that consisted of a ramp from 120 to 134°C at a speed of 1°C/min. Identification of organic acids was achieved by comparison with the retention times of standards and quantification was based on the corresponding peak areas using calibration curves constructed with standard solutions (Sigma Chemical Co., USA) of glacial acetic acid (5–100 mM), propionic acid (5–50 mM), and butyric acid (1–30 mM). DNA Isolation DNA extractions were performed by using a commercial TIANamp Stool DNA Kit (Tiangen, Beijing, China) following the manufacturer’s instructions. DNA concentration and quality were determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, United States). The DNA samples were used for qPCR and DGGE analysis. Determination of microbial populations by qPCR analysis Quantification of microbial populations was achieved using quantitative PCR (qPCR) with specific primers targeting the 16S ribosomal RNA (rRNA) gene of the Phyla Bacteroidetes, Firmicutes, Actinobacteria, Proteobacteria (beta and gamma subgroups), and Tenericutes. Total bacterial load was quantified using specific primers targeting a universal sequence of the Eubacteria 16S rRNA gene. Primer pairs of each target group are shown in Table 1 . Table 1 Primers used for microbiota group analysis Target group Primer Sequence 5´-3´ References Actinobacteria Act664F TGTAGCGGTGGAATGCGC [ 43 ] Act941R AATTAAGCCACATGCTCCGCT Bacteroidetes Bac960F GTTTAATTCGATGATACGCGAG Bac1100R TTAASCCGACACCTCACGG Betaproteobacterias Beta979F AACGCGAAAAACCTTACCTACC Beta1130R TGCCCTTTCGTAGCAACTAGTG Delta and Gammaproteobacteria Gamma877F GCTAACGCATTAAGTRYCCCG Gamma1066R GCCATGCRGCACCTGTCT Firmicutes Firm934F GGAGYATGTGGTTTAATTCGAAGCA Firm1060R AGCTGACGACAACCATGCAC Tenericutes Ten662F ATGTGTAGCGGTAAAATGCGTAA Ten862R CMTACTTGCGTACGTACTACT Eubacteria HDA1F ACTCCTACGGGAGGCAGCAG [ 44 ] HDA2 R GTATTACCGCGGCTGCTGGCAC The reactions were performed in a BioRad CFX Opus 96 real-time PCR system using the following cycling program: an initial denaturation step 10 min at 95°C, 40 amplification cycles of 95°C for 15 s, an annealing/extension phase at 60°C for 30 s, and a final elongation step at 72°C for 30 s. A melting curve analysis was performed by increasing the temperature by 0.5°C every 5 seconds between 55°C and 95°C. Real-time PCRs were carried out in 96-well optical plates and qPCR mixtures contained 10 µL of DNA template (final concentration 20ng/24 µL), 12 µL of iQ SYBR Green SuperMix reagent (BioRad) and 1 µL of each forward and reverse primer. For each primer set, a no-template control (NTC) was included, where pharmaceutical-grade water was used instead of template DNA. Melting curve analysis (Tm) was performed to validate Ct values and confirm the specific amplification of target amplicons. Relative quantification of the target populations was performed using their threshold cycle (Ct) values, normalized to the total bacterial load. The total bacterial load was estimated from the Ct values obtained with Eubacteria 16S rRNA primers, which were set to represent 100%. % Relative abundance = 2 − (Ct Spec − Ct Univ) x100 where Ct Spec and Ct Univ are Ct values register by thermocycler for 16sRNA of specific group and 16sRNA of Eubacteria group, respectively. Microbiota Analysis by Denaturing-gradient-gel electrophoresis ( DGGE) The microbiota in cecal content was analyzed by partial amplification of the 16S rRNA gene using universal primers 338F-GC (GCclamp-ACTCCTACGGGAGGCAGCAG) and 518R (ATTACCGCGGCTGCTG) according to Bakke et al. (2011) [ 21 ]. PCR amplification was performed using Taq polymerase Pegasus (PBL Biological Products, Argentina) following the manufactures instruction and using 0.5 ng/µL of DNA template. The reaction was carried out in a T100 thermal cycler (Bio-rad laboratories, Irvine, CA, United States) with the following amplification program: 94°C for 5 min; 35 cycles of 94°C for 30 s, 60°C for 45 s and 72°C for 20 s; and a final extension step at 72°C for 1 min. The amplification products were analyzed by electrophoresis in 1% (w/v) agarose gels with ethidium bromide and revealed under UV light. DGGE was performed in a DGGE-2401 analyzer (C.B.S. Scientific Co., Del Mar, CA, United States). The PCR products (15 µL) were seeded in 8 g/100 mL polyacrylamide gels (15x20x 0.075 cm) in TAE buffer [50X TAE is 2 M Tris, 1 M acetic acid, and 50 mM EDTA (pH 8.0)]. A denaturing gradient of Urea-Formamide 40–60% (v/v) (100% corresponds to Urea 7 M and Formamide 40% v/v) was used to achieve the optimal separation of the bands corresponding to Eubacteria. Electrophoresis was carried out at 90 V for 16 h at 60°C. Gels were then stained by immersion for 30 min in a 0.1 mL/L Sybr-Gold solution (Invitrogen, United States) in TAE buffer and observed under UV light. Band patterns obtained for each sample were compered using the Gel compar II program (Applied maths NV, Sint-Martens-Latem, Belgium). The percentage of similarity between the samples was calculated using the Dice Similarity Coefficient and the corresponding UPGMA dendrograms were constructed. Intestinal Histological Evaluation Intestinal tissue specimens were opened to remove the content and were washed twice with PBS. Then portions were fixed with formaldehyde 10% (v/v) and embedded in paraffin. Embedded samples were cut with a microtome at a thickness of 4 mm and stained with hematoxylin and eosin. Morphometric studies on crypt and villi length, mucosal thickness and crypt/villi ratio were performed following procedure described by Vecchio et al [ 22 ].Briefly, an extensive image registry of sections of each animal’s duodenum and ileum segments at x40, x100 and x400 microscopy fields was performed using a Nikon Ni-Eclipse microscope (Nikon Instruments Inc., USA). Determination of IEL counting and morphometric parameters was performed on a double-blind scoring system by a trained observer. Statistical analyses Statistical analysis was performed using GraphPad software version 8.02 (San Diego, CA, USA). Mann Whitney test were used to determine the significance of differences between two groups. P values less than 0.05 were considered statistically significant. Results In order to evaluate the effects of the supplementation with probiotic yeast K. marxianus CIDCA 9121 on post-weaning stress, gestating sows were supplemented in the last three weeks of pregnancy and during lactation as well as the weaned piglets for the first three post-weaning weeks. Each experimental group consisted of 8 sows that received usual feeding program (control) or yeast supplementation (Km9121). Sows were randomly assigned to each group, resulting in a parity of 3.34 (Km9121) and 4.5 (control). A total of 123 and 120 piglets were born in control and Km9121 group respectively. No differences were observed in the different delivery parameters (Table 2 ). Remarkably, piglets born from mothers that received yeast supplementation were bigger than controls (1.60+/-0.19 kg/animal vs 1.37 +/-0.15kg/animal, p < 0.05). No differences were observed in the IgA content of colostrum, nor in the refractometry levels that usually correlate with IgG content[ 23 ], (not shown). Table 2 Effect of yeast culture supplementation from late gestation on farrowing performance of sows Variables Ctr Km 9121 P-value No of sows 8 8 Litter size 15.4 ± 5.0 15.0 ± 2.4 0.453 Live-born piglets, n 123 120 Average piglets’ weight at birth, Kg 1.37 ± 0.15 1.6 ± 0.19 0.021 Litter weight at birth, Kg 23.96 ± 4,23 20.80 ± 6.56 0.136 Birth duration, h 3.45 ± 0.5 3.48 ± 0.5 0.764 Average piglet expulsion interval, min 13.00 ± 0.02 13.00 ± 0.03 0.396 Abbreviation: Ctr = Sows control group, Km 9121 = sows yeast group Although at weaning both groups have similar weights (6.06 kg/animal in both groups), there are several indicators that show a beneficial effect in the Km9121 group. During lactation we registered lower number of cases of neonatal diarrhea and of milder intensity in the supplemented group (not shown). All cases were mild and did not required medication or changes in practice and since there were very few, we could not establish statistical significance in the comparison between groups. Five days post-weaning, five animals of each group were randomly sacrificed to evaluate intestinal histopathology. Interestingly, animals in the Km9121 group have longer crypts and villi in duodenum (Fig. 1 A, B, C, p < 0.05), resulting in a larger mucosal thickness (Fig. 1 D, p < 0.05), without changes in villous/crypt ratio (Fig. 1 E) indicating a more trophic intestine. In concordance, the evaluation of citrulline blood levels showed higher levels of this marker of functional enterocyte mass[ 24 ] in the Km9121 group (Fig. 2 G, p = 0.055), and also higher blood levels of other amino acids related with nitrogen metabolism (Supplementary Fig. 1). Furthermore, we quantified the number of IELs in terminal small intestine, as a rough indicator of intestinal defense status, finding a larger value in the yeast group (Fig. 1 F, p < 0.05). We analyzed the intestinal microbiota in the cecum of sacrificed animals. An initial comparison using DGGE methodology to evaluate similarities among samples showed that most individuals of the yeast group clustered together whereas most controls grouped in a different cluster, indicating that the yeast supplementation had an influence in the cecal microbiota structure (Supplementary Fig. 2). We quantified by qPCR the relative amount of major microbial groups and a predominance of the Bacteroidetes phylum was observed in most samples, except for one control (C5) and two yeast-supplemented samples (Y4 and Y5), where Firmicutes were predominant. In piglets where Bacteroidetes was predominant, the relative composition of this phylum ranged 23–38% in control pig samples and 29–43% in supplemented pigs and the Firmicutes phylum ranged 6–22% and 18–21% respectively. The other groups analyzed represented less than 1% of the total microbiota in both yeast-supplemented and non-yeast-supplemented piglets. When analyzing the short chain fatty acids in cecal content, no differences were found in acetate, propionate and butyrate levels between control and supplemented group (Fig. 2 B, C, D). Although there is a trend in supplemented animals to show higher levels of total organic acids (Fig. 2 E), there is high dispersion among the samples analyzed. Animals in the Km9121 group received a daily dose of 10 9 CFU/kg of feed during three weeks after weaning along the nursing period. At 12 weeks of age, at the ending of this period we evaluated the presence of anti- Lawsonia antibodies as a measurement of response to vaccination in 10 animals randomly selected of each group. Although there are no significant differences between groups, there is a trend to have higher levels of specific antibodies in the yeast group (Fig. 3 A). Furthermore, anti-flagellin antibodies were evaluated as a measurement of integrity of intestinal barrier in the same samples, showing no differences between groups (Fig. 3 B). Remarkably, at 42 days post weaning, the average weight of Km9121 group was significantly higher than the control group showing around 10% higher average weight (Fig. 3 C, p < 0.05), being 21.69 kg, the average weigh of the Km9121 group whereas the control group showed an average weight of 19.11 kg. Discussion Our study showed that supplementation with K. marxianus CIDCA 9121 to sows at the end of pregnancy and during lactation and to piglets after weaning had a positive effect on post-weaning stress and piglet weight. The capacity of K. marxianus to ferment lactose allows the use of whey permeate to produce yeast biomass, being an interesting technology to deal with the great volume of this by-product of cheese industry [ 20 ]. Since this was the first experiment performed with this strain in a productive farm, we decided to use an experimental design that covers both major uses of probiotics in pork production, the administration to sows and the supplementation of piglets’ diet post weaning. As was observed by Hu et al. (2024) supplemented sows in the last weeks of pregnancy with a mixture of probiotic bacterial strains [ 11 ], an increase in average weight at birth was detected in the present study, which correlates with piglet survival rate [ 25 ]. On the other hand, Le Floch et al. (2022) performed an experiment supplementing gestating sows with the probiotic yeast Saccharomyces boulardii and did not observe an increase in birth weight, although they found changes in piglets’ fecal microbiota upon yeast administration [ 26 ]. Hasan et al. (2018) using supplementation with yeast hydrolysate [ 27 ] as well as Scollo et al (2023) using inactivated Saccharomyces cerevisiae supplementation [ 28 ] and Zhao et al (2024) using live Saccharomyces cerevisiae supplementation [ 29 ] did not observed changes in weight at birth. These differences may be due to the probiotic strains used, the amount of microorganisms administrated or other factors associated to the experimental design. Interestingly, different reports [ 11 ] [ 13 ] have shown that supplementation of sows with a mixture of probiotic bacterial strains lowers the incidence of piglet diarrhea during lactation. Similarly, in the present work, more cases of neonatal diarrhea and of longer duration were observed in the control group than in the group supplemented with probiotic yeast. Other reported beneficial effect of the probiotic supplementation to sows is a lower impact on metabolic effort associated to lactation reflected by lower loss of backfat pad [ 11 , 30 ]however this parameter was not evaluated in our study. Regarding IgA and IgG levels in colostrum, we evidenced no differences because of yeast supplementation, in coincidence with results obtained by Hu et al (2024) who observed a rise in immunoglobulins at 20 days of lactation but no differences at birth [ 11 ]. In the present study, the differences in weight observed at birth were not sustained to the end of lactation (Table 1 ). However, 40 days after weaning, there was a 10% weight gain in average in the group that received supplementation with K. marxianus CIDCA 9121 and differences in weight lasted until the end of nursery. Both groups started the nursing period with similar weights, indicating that this difference is exclusively determined by the weight gain after weaning. This positive effect could be attributed not only to the intervention with the probiotic yeast in the nursing period but also to the influence of the previous intervention of sows with yeast supplementation during gestation and lactation. Hu et al. (2024) performed an experiment having groups of animals born from sows that received probiotic supplementation but received conventional feeding after weaning whereas other group born from sows that received conventional feeding but after weaning were supplemented with a probiotic mixture [ 11 ]. In both cases, they observed an increased weight at the end of nursing period, indicating that both factors can contribute to this parameter. Interestingly, the group which both sows and piglets received probiotic supplementation had only a marginal weight gain after nursing and this was lower than the gain of the groups where only sows received supplementation or the piglets. Miotto Galli et al. (2024) supplied a mixture of different probiotic bacteria using a similar 2x2 factorial design on control vs supplemented and gestation/lactation vs post weaning. these authors observed the major effects on weight in the case of sow supplementation, both in the weight at birth and at the end of lactation, indicating the importance of the maternal imprinting in piglet development [ 31 ]. Considering this, further investigation is required regarding the effects of K. marxianus CIDCA 9121 supplementation either at pregnancy/lactation or exclusively in the postweaning. The post weaning period is the most stressful moment of the productive cycle and supplementation with probiotics has shown positive effects to overcome this moment. In our experiment, it was evident that the supplemented group have a lower impact of the weaning stress in the intestinal mucosa resulting in longer villi and crypts at the small intestine (Fig. 1 ). Similar results were observed by Sandrini et al (2024) using a supplementation of a mixture of probiotic yeast to piglets after weaning. Remarkably, these authors did not find impact in productive parameters [ 32 ]. A positive effect on intestinal histological parameters and growth performance was reported by Boontiam et al. (2022) using yeast hydrolysate as supplement to very early weaned pigs [ 33 ]. Improvement of histological and permeability parameters by probiotic supplementation in the postweaning period has also been shown by others [ 34 , 35 ]. In coincidence with better histological parameters [ 36 ], we also detected higher levels of serum citrulline in the group that received the probiotic yeast supplementation. This is also indicative of a higher functional enterocyte mass and has been shown to correlate with the increase of weight during the nursing period [ 24 ]. Many different studies have documented changes in intestinal microbiota of piglets supplemented with probiotics, either post-weaning [ 32 ] or conditioned by supplementing sows during late pregnancy and lactation [ 11 , 30 , 37 ]. In our case, we performed a partial characterization using approximate molecular methods, finding small differences between the groups that may have influenced the observed productive and histological differences. In agreement with all the different reports that have described changes in the microbiota associated with probiotic intervention, a direct causal relationship cannot be established. The high representation of the "Others" group found in this study can be attributed to the combined contribution of multiple taxa, less abundant than Firmicutes and Bacteroidetes, which individually comprise a smaller fraction of the total microbiota[ 38 – 41 ] .We detected a wider dispersion in SCFA levels in the cecum of the K. marxianus CIDCA 9121-supplemented group; however, we were unable to correlate individual variations with the analysis of microbial content. Taken together, these data indicate that variations in the gut microbiota of treated animals could be partially responsible for the changes observed between the groups. It has been reported that probiotic supplementation can improve piglet immune function [ 42 ]. We evaluated the response to anti- Lawsonia vaccination using an in house optimized indirect ELISA and found no differences between groups (Fig. 3 ). A deeper characterization of the effects of K. marxianus supplementation in piglet immune function will be performed in future works. In summary, we have shown the beneficial effects of using K. marxianus CIDCA 9121 as supplement for sows during late gestation and lactation and for weaned piglets. We observed remarkable effects on productive parameters and attenuation of post-weaning stress. Considering the favorable technological properties of the characterized strain, it appears as an attractive candidate to be used to cover the ever-growing demands of porcine production industry. Declarations Funding statement: This work was supported by grants PICTA 2021-0060 and PICT 2020–03973 from Agencia Nacional I + D + I (ANPCyT) and grant number FITBA A09-2022 from the Ministry of Production, Science and Technology from Provincia de Buenos Aires, Argentina. Ethics statement : The animal study was reviewed and approved by Institutional Animal Care and Use Committee of the Faculty of Exact Sciences, National University of La Plata (Protocol Number 002-44-24). Author Contribution M.D.P., M.F.C., E.V., J.I.G., C.D., A.A.B., M.E.T., A.J.E., M.M., S.C., G.C. performed experimental work and participated in data analysis; E.V., S.W., M.R., G.L.G. participated in study design; S.C., G.C., M.R., G.L.G. participated in funding acquisition, and M.D.P., M.F.C., G.L.G. and M.R. write the manuscript. Acknowledgement The authors thank Mr. JI Ortiz for providing the farm “Granja las 4B” facilities and his staff for their collaboration in carrying out the trials and Miss YM Leonardi for her collaboration in caring for the animals and taking samples on the farm. References Kim SW, Gormley A, Jang KB, Duarte ME. - Invited Review - Current status of global pig production: an overview and research trends. Anim Biosci. 2024;37: 719–729. doi: 10.5713/AB.23.0367 Sanz-Fernández S, Rodríguez-Hernández P, Díaz-Gaona C, Tusell L, Quintanilla R, Rodríguez-Estévez V. Evolution of Sow Productivity and Evaluation Parameters: Spanish Farms as a Benchmark. Vet Sci. 2024;11. doi: 10.3390/VETSCI11120626 Papatsiros VG, Maragkakis G, Papakonstantinou GI. Stress Biomarkers in Pigs: Current Insights and Clinical Application. Vet Sci. 2024;11. doi: 10.3390/VETSCI11120640 Moeser AJ, Pohl CS, Rajput M. Weaning stress and gastrointestinal barrier development: Implications for lifelong gut health in pigs. Anim Nutr. 2017;3: 313–321. doi: 10.1016/J.ANINU.2017.06.003 Schmerold I, van Geijlswijk I, Gehring R. European regulations on the use of antibiotics in veterinary medicine. Eur J Pharm Sci. 2023;189. doi: 10.1016/J.EJPS.2023.106473 Patel SJ, Wellington M, Shah RM, Ferreira MJ. Antibiotic Stewardship in Food-producing Animals: Challenges, Progress, and Opportunities. Clin Ther. 2020;42: 1649–1658. doi: 10.1016/J.CLINTHERA.2020.07.004 MoARA. National Action Plan for Veterinary Antimicrobial Use Reduction (2021–2025), Ministry of Agriculture Rural Affairs. In: 2024. Jiang Z, Yang M, Su W, Mei L, Li Y, Guo Y, et al. Probiotics in piglet: from gut health to pathogen defense mechanisms. Front Immunol. 2024;15. doi: 10.3389/FIMMU.2024.1468873 Liu HY, Zhu C, Zhu M, Yuan L, Li S, Gu F, et al. Alternatives to antibiotics in pig production: looking through the lens of immunophysiology. Stress biology. 2024;4. doi: 10.1007/S44154-023-00134-W Jiang Z, Yang M, Su W, Mei L, Li Y, Guo Y, et al. Probiotics in piglet: from gut health to pathogen defense mechanisms. Front Immunol. 2024;15. doi: 10.3389/FIMMU.2024.1468873 Hu T, Song Z, Yang L, Chen K, Wu Y, Xie F, et al. Maternal probiotic mixture supplementation optimizes the gut microbiota structure of offspring piglets through the gut-breast axis. Anim Nutr. 2024;19. doi: 10.1016/J.ANINU.2024.04.025 Ruampatana J, Suwimonteerabutr J, Homyog K, Mekboonsonglarp W, Kanjanavaikoon K, der Veken W Van, et al. Clostridium butyricum Probiotic Feed Additive: Modulation of Sow Milk Metabolomics and Mitigation of Pre-Weaning Piglet Diarrhea. Animals (Basel). 2024;14. doi: 10.3390/ANI14142098 Innamma N, Kaeoket K. Feeding Sows with Multi-Species Probiotics During Late Pregnancy and the Lactating Period Influences IgA Concentration in Colostrum and Subsequently Increases the Survival Rate of Piglets in Porcine Epidemic Diarrhea Outbreak Herd. Animals (Basel). 2025;15. doi: 10.3390/ANI15010103 Wongsamart R, Somboonna N, Cheibchalard T, Klankeo P, Ruampatana J, Nuntapaitoon M. Probiotic Bacillus licheniformis DSMZ 28710 improves sow milk microbiota and enhances piglet health outcomes. Sci Rep. 2025;15. doi: 10.1038/S41598-024-84573-Z Huang CW, Liu SY, Bhattarai BP, Lee TY, Chang HT, Lin HC, et al. Live Multi-Strain Probiotics Enhance Growth Performance by Regulating Intestinal Morphology and Microbiome Population in Weaning Piglets. Microorganisms. 2024;12. doi: 10.3390/MICROORGANISMS12112334 Yoon KN, Choi YH, Keum GB, Yeom SJ, Kim SS, Kim ES, et al. Lactiplantibacillus argentoratensis AGMB00912 alleviates diarrhea and promotes the growth performance of piglets during the weaning transition. BMC Microbiol. 2024;24: 404. doi: 10.1186/S12866-024-03536-6 Shu Z, Zhang J, Zhou Q, Peng Y, Huang Y, Zhou Y, et al. Effects of inactivated Lactobacillus rhamnosus on growth performance, serum indicators, and colonic microbiota and metabolism of weaned piglets. BMC Vet Res. 2024;20: 422. doi: 10.1186/S12917-024-04133-5 Xue L, Long S, Cheng B, Song Q, Zhang C, Hansen LHB, et al. Dietary Triple-Strain Bacillus-Based Probiotic Supplementation Improves Performance, Immune Function, Intestinal Morphology, and Microbial Community in Weaned Pigs. Microorganisms. 2024;12. doi: 10.3390/MICROORGANISMS12081536 Romanin DE, Llopis S, Genovés S, Martorell P, Ramón VD, Garrote GL, et al. Probiotic yeast Kluyveromyces marxianus CIDCA 8154 shows anti-inflammatory and anti-oxidative stress properties in in vivo models. Benef Microbes. 2016;7. doi: 10.3920/BM2015.0066 Pendón MD, Madeira J V., Romanin DE, Rumbo M, Gombert AK, Garrote GL. A biorefinery concept for the production of fuel ethanol, probiotic yeast, and whey protein from a by-product of the cheese industry. Appl Microbiol Biotechnol. 2021 [cited 2 May 2021]. doi: 10.1007/s00253-021-11278-y Bakke I, De Schryver P, Boon N, Vadstein O. PCR-based community structure studies of bacteria associated with eukaryotic organisms: a simple PCR strategy to avoid co-amplification of eukaryotic DNA. J Microbiol Methods. 2011;84: 349–351. doi: 10.1016/J.MIMET.2010.12.015 Dezillio LEV, Romanin DE, Marinoff IMI, Vernengo J, Zárate JCA, Machuca MA, et al. Experimental study to assess the impact of vasopressors administered during maintenance of the brain-dead donation in the quality of the intestinal graft. J Trauma Acute Care Surg. 2022;92: 380–387. doi: 10.1097/TA.0000000000003473 Hasan SMK, Junnikkala S, Valros A, Peltoniemi O, Oliviero C. Validation of Brix refractometer to estimate colostrum immunoglobulin G content and composition in the sow. Animal. 2016;10: 1728–1733. doi: 10.1017/S1751731116000896 Soraci AL, Decundo JM, Dieguez SN, Martínez G, Pérez Gaudio DS, Amanto FA. Citrullinemia is a suitable biomarker for post weaning performance in piglets under intensive farming. J Am Vet Med Assoc. 2023;261: 858–864. doi: 10.2460/JAVMA.22.12.0543 Cabrera RA, Lin X, Campbell JM, Moeser AJ, Odle J. Influence of birth order, birth weight, colostrum and serum immunoglobulin G on neonatal piglet survival. J Anim Sci Biotechnol. 2012;3. doi: 10.1186/2049-1891-3-42 Le Floc’h N, Achard CS, Eugenio FA, Apper E, Combes S, Quesnel H. Effect of live yeast supplementation in sow diet during gestation and lactation on sow and piglet fecal microbiota, health, and performance. J Anim Sci. 2022;100. doi: 10.1093/JAS/SKAC209 Hasan S, Junnikkala S, Peltoniemi O, Paulin L, Lyyski A, Vuorenmaa J, et al. Dietary supplementation with yeast hydrolysate in pregnancy influences colostrum yield and gut microbiota of sows and piglets after birth. PLoS One. 2018;13. doi: 10.1371/JOURNAL.PONE.0197586 Scollo A, Borello I, Ghilardi M, Cavagnini A. The Administration of Inactivated and Stabilized Whole-Cells of Saccharomyces cerevisiae to Gestating Sows Improves Lactation Efficiency and Post-Weaning Antimicrobial Use. Vet Sci. 2023;10. doi: 10.3390/VETSCI10090576 Zhao Y, Lin Y, Xu S, Hua L, Feng B, Fang Z, et al. Amino acid standardized ileal digestibility together with concentrations of digestible and metabolizable energy in Saccharomyces cerevisiae yeast and soybean meal for gestating sows. J Anim Sci. 2024;102. doi: 10.1093/JAS/SKAD402 Law K, Johnston LJ, Urriola PE, Gomez A. Maternal Programming of Nursery Pig Performance and Gut Microbiome through Live Yeast Supplementation. Animals (Basel). 2024;14. doi: 10.3390/ANI14060910 Galli GM, Andretta I, Levesque C, Stefanello T, Carvalho CL, Perez Pelencia JY, et al. Using probiotics to improve nutrient digestibility and gut-health of weaned pigs: a comparison of maternal and nursery supplementation strategies. Front Vet Sci. 2024;11. doi: 10.3389/FVETS.2024.1356455 Sandrini S, Perricone V, Cremonesi P, Castiglioni B, Biscarini F, Verdile N, et al. Yeast mixture supplementation modulates faecal microbiota and ileum morphology of weaning pigs. Animal. 2024;18. doi: 10.1016/J.ANIMAL.2024.101275 Boontiam W, Bunchasak C, Kim YY, Kitipongpysan S, Hong J. Hydrolyzed Yeast Supplementation to Newly Weaned Piglets: Growth Performance, Gut Health, and Microbial Fermentation. Animals (Basel). 2022;12. doi: 10.3390/ANI12030350 Shonyela SM, Feng B, Yang W, Yang G, Wang C. The regulatory effect of Lactobacillus rhamnosus GG on T lymphocyte and the development of intestinal villi in piglets of different periods. AMB Express. 2020;10. doi: 10.1186/S13568-020-00980-1 Kalita A, Talukdar M, Sarma K, Kalita PC, Roychoudhury P, Kalita G, et al. Small intestinal mucosal cells in piglets fed with probiotic and zinc: a qualitative and quantitative microanatomical study. Folia Morphol (Warsz). 2021;80: 605–617. doi: 10.5603/FM.A2020.0091 Shen YB, Piao XS, Kim SW, Wang L, Liu P, Yoon I, et al. Effects of yeast culture supplementation on growth performance, intestinal health, and immune response of nursery pigs. J Anim Sci. 2009;87: 2614–2624. doi: 10.2527/JAS.2008-1512 Liu Y, Jia X, Chang J, Jiang X, Che L, Lin Y, et al. Effect of yeast culture supplementation in sows during late gestation and lactation on growth performance, antioxidant properties, and intestinal microorganisms of offspring weaned piglets. Front Microbiol. 2023;13. doi: 10.3389/FMICB.2022.1105888 Yang Y, Liu Y, Liu J, Wang H, Guo Y, Du M, et al. Composition of the Fecal Microbiota of Piglets at Various Growth Stages. Front Vet Sci. 2021;8. doi: 10.3389/FVETS.2021.661671 , Zhang D, Ji H, Liu H, Wang S, Wang J, Wang Y. Changes in the diversity and composition of gut microbiota of weaned piglets after oral administration of Lactobacillus or an antibiotic. Appl Microbiol Biotechnol. 2016;100: 10081–10093. doi: 10.1007/S00253-016-7845-5 , Gresse R, Durand FC, Dunière L, Blanquet-Diot S, Forano E. Microbiota composition and functional profiling throughout the gastrointestinal tract of commercial weaning piglets. Microorganisms. 2019;7. doi: 10.3390/MICROORGANISMS7090343 , Guevarra RB, Hong SH, Cho JH, Kim BR, Shin J, Lee JH, et al. The dynamics of the piglet gut microbiome during the weaning transition in association with health and nutrition. J Anim Sci Biotechnol. 2018;9. doi: 10.1186/S40104-018-0269-6 , Saha S, Namai F, Nishiyama K, Villena J, Kitazawa H. Role of immunomodulatory probiotics in alleviating bacterial diarrhea in piglets: a systematic review. J Anim Sci Biotechnol. 2024;15. doi: 10.1186/S40104-024-01070-Z Yang YW, Chen MK, Yang BY, Huang XJ, Zhang XR, He LQ, et al. Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in mouse feces. Appl Environ Microbiol. 2015;81: 6749–6756. doi: 10.1128/AEM.01906-15 , Walter J, Tannock GW, Tilsala-Timisjarvi A, Rodtong S, Loach DM, Munro K, et al. Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PCR primers. Appl Environ Microbiol. 2000;66: 297–303. doi: 10.1128/AEM.66.1.297-303.2000 , Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure1.jpg Supplementary Figure 1. Nitrogenous amino acid profiles in piglet blood 5 days post-weaning. Glutamic, Arginine, Ornithine, Proline and Glutamine plasma content of Control group (●) and Km9121 group (○). SupplementaryFigure2.jpg Supplementary Figure 2. Microbiota similarity analysis by DGGE. PCR-based DGGE fingerprints obtained of cecal content samples from 5 days post-weaning piglets supplemented with Km9121 (Y) and unsupplemented Controls (C). Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6590564","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":452958896,"identity":"eead50ca-5777-4218-bc72-59f945019269","order_by":0,"name":"María Dolores Pendón","email":"","orcid":"","institution":"Centro Investigación y Desarrollo en Ciencia y Tecnología de Alimentos, CIDCA (CONICET-UNLP-CICPBA)","correspondingAuthor":false,"prefix":"","firstName":"María","middleName":"Dolores","lastName":"Pendón","suffix":""},{"id":452958898,"identity":"2bde7fec-0014-418e-9958-078ebfb10424","order_by":1,"name":"Malena Ferreyra Compagnucci","email":"","orcid":"","institution":"Instituto de Estudios Inmunológicos y Fisiopatológicos, IIFP (UNLP-CONICET-Centro Asociado CICPBA)","correspondingAuthor":false,"prefix":"","firstName":"Malena","middleName":"Ferreyra","lastName":"Compagnucci","suffix":""},{"id":452958899,"identity":"dc801ff4-ba54-4949-8e62-26021f45757c","order_by":2,"name":"Eugenio Valette","email":"","orcid":"","institution":"Cátedra de Producción Porcina (Facultad de Ciencias Veterinarias, UNLP)","correspondingAuthor":false,"prefix":"","firstName":"Eugenio","middleName":"","lastName":"Valette","suffix":""},{"id":452958900,"identity":"dc99dcef-be00-4c1c-9fb8-b042c63feb9d","order_by":3,"name":"Juan Ignacio Girardi","email":"","orcid":"","institution":"Instituto de Estudios Inmunológicos y Fisiopatológicos, IIFP (UNLP-CONICET-Centro Asociado CICPBA)","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"Ignacio","lastName":"Girardi","suffix":""},{"id":452958902,"identity":"bdf382a6-8586-4671-8496-9c26115b4a3d","order_by":4,"name":"Agustina Juliana Errea","email":"","orcid":"","institution":"Instituto de Estudios Inmunológicos y Fisiopatológicos, IIFP (UNLP-CONICET-Centro Asociado CICPBA)","correspondingAuthor":false,"prefix":"","firstName":"Agustina","middleName":"Juliana","lastName":"Errea","suffix":""},{"id":452958905,"identity":"34aa2435-f02a-4e1f-a488-cf4e66b11c1e","order_by":5,"name":"Carolina Dardis","email":"","orcid":"","institution":"Centro Investigación y Desarrollo en Ciencia y Tecnología de Alimentos, CIDCA (CONICET-UNLP-CICPBA)","correspondingAuthor":false,"prefix":"","firstName":"Carolina","middleName":"","lastName":"Dardis","suffix":""},{"id":452958906,"identity":"0b94e321-80a9-4fc2-a851-f8650cded397","order_by":6,"name":"Ana Agustina Bengoa","email":"","orcid":"","institution":"Centro Investigación y Desarrollo en Ciencia y Tecnología de Alimentos, CIDCA (CONICET-UNLP-CICPBA)","correspondingAuthor":false,"prefix":"","firstName":"Ana","middleName":"Agustina","lastName":"Bengoa","suffix":""},{"id":452958909,"identity":"430db73a-dc4c-4ce6-b5a1-bee91caaf395","order_by":7,"name":"María Eugenia Tanco","email":"","orcid":"","institution":"Centro Investigación y Desarrollo en Ciencia y Tecnología de Alimentos, CIDCA (CONICET-UNLP-CICPBA)","correspondingAuthor":false,"prefix":"","firstName":"María","middleName":"Eugenia","lastName":"Tanco","suffix":""},{"id":452958910,"identity":"61d7d75f-925d-4f86-8672-6dc1e7c97d50","order_by":8,"name":"Mariana Machuca","email":"","orcid":"","institution":"Cátedra de Patología Especial (Facultad de Ciencias Veterinarias, UNLP)","correspondingAuthor":false,"prefix":"","firstName":"Mariana","middleName":"","lastName":"Machuca","suffix":""},{"id":452958911,"identity":"4a9331bf-185e-41b3-8f03-c5c127cc2bd6","order_by":9,"name":"Sara Williams","email":"","orcid":"","institution":"Cátedra de Producción Porcina (Facultad de Ciencias Veterinarias, UNLP)","correspondingAuthor":false,"prefix":"","firstName":"Sara","middleName":"","lastName":"Williams","suffix":""},{"id":452958912,"identity":"6e33343c-d6eb-4083-9c4d-01368754d5e0","order_by":10,"name":"Sebastian Cavalitto","email":"","orcid":"","institution":"Centro Investigación y Desarrollo en Fermentaciones Industriales CINDEFI (UNLP-CONICET)","correspondingAuthor":false,"prefix":"","firstName":"Sebastian","middleName":"","lastName":"Cavalitto","suffix":""},{"id":452958915,"identity":"76306b7d-b2ca-467b-91ea-4e7c94ecba7f","order_by":11,"name":"Germán Cairo","email":"","orcid":"","institution":"Beneficial Germs S. A","correspondingAuthor":false,"prefix":"","firstName":"Germán","middleName":"","lastName":"Cairo","suffix":""},{"id":452958916,"identity":"5e433d22-a707-4f49-b322-1740a9d7f716","order_by":12,"name":"Martín Rumbo","email":"","orcid":"","institution":"Instituto de Estudios Inmunológicos y Fisiopatológicos, IIFP (UNLP-CONICET-Centro Asociado CICPBA)","correspondingAuthor":false,"prefix":"","firstName":"Martín","middleName":"","lastName":"Rumbo","suffix":""},{"id":452958917,"identity":"f3c068d5-13dd-4409-9355-a209b7ee7afc","order_by":13,"name":"Graciela Liliana Garrote","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABA0lEQVRIiWNgGAWjYDADfgnGBoYHQAYfiMdDWIMBg+QMoJYEIJONaC0GN4AUUVrk/Rc/+1xR8UfO+HZz44MEhsN5bNINjA/etjHImzdg12J445nxzDNnDIzN7hxsNgBqKWaTOcBsOLeNwXDOARxaZhwwZmxsM0jcdiOxTQKoBUSySfO2MTDOwOEwwxnHP4O01G+egdDC/huoxR6XFnn+HrAtCQYSSLYwA7Uk4tJiIMFTzNhwxthwBtgvBumJbTIHmyXnnJNIxmlL//HNjA0VcvL8s9sfPvhQYZ3YL9188MObMhtbnLbcSEDhAjEoGQBJHBpAthxAF8KteBSMglEwCkYoAAD/Blip6VSAfQAAAABJRU5ErkJggg==","orcid":"","institution":"Centro Investigación y Desarrollo en Ciencia y Tecnología de Alimentos, CIDCA (CONICET-UNLP-CICPBA)","correspondingAuthor":true,"prefix":"","firstName":"Graciela","middleName":"Liliana","lastName":"Garrote","suffix":""}],"badges":[],"createdAt":"2025-05-05 01:08:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6590564/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6590564/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":82491254,"identity":"2edf5058-ab63-4f58-8d59-1bede05e246b","added_by":"auto","created_at":"2025-05-12 06:44:45","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":146169,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntestinal histopathology, citrulline and IgG serum levels of piglets at 5 days post-weaning.\u003c/strong\u003e \u0026nbsp;Photomicrograph of H\u0026amp;E-stained cross section of duodenum and ileum samples (A). Morphometric analysis of Crypt depth (B), Villus height (C), Mucosa thickness (D), V/C ratio (E), Intraepithelial lymphocytes (IELs) count (F), Plasma citrulline level (G), and Serum IgG level (H) in piglets from Km9121 and Control groups. **p \u0026lt; 0.01; ***p \u0026lt; 0,005; ****p \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6590564/v1/dc60b216f8eae4249a8c0646.jpg"},{"id":82490352,"identity":"c5f55c3a-c1ed-416d-9ab4-e776e15f35ce","added_by":"auto","created_at":"2025-05-12 06:36:45","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":93068,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBacterial composition and short chain fatty acids (SCFA) in cecal content of 5 days post-weaning piglets\u003c/strong\u003e. \u0026nbsp;Percentual relative composition of bacterial phyla and classes identified by qPCR analysis. Total microbial load was assessed by amplification of 16S RNA using universal eubacteria primers and used as 100%. Specific primers for Actinobacteria, Bacteroidetes, Betaproteobacterias, Delta and Gammaproteobacteria, Firmicutes, Tenericutes were employed to evaluate relative amount of each group (A). GC quantification of Acetic (B), Propionic (C), Butyric (D), and Total SCFAs (E) in cecal content of pigs supplemented with \u003cem\u003eK. marxianus\u003c/em\u003e CIDCA 9121 and unsupplemented controls. Individual micromole per gram measurements, mean value and standard deviations (±SD) are presented.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6590564/v1/b75c5877d153a2e18ddd2134.jpg"},{"id":82491253,"identity":"ef883763-99f9-4b50-956e-193351814303","added_by":"auto","created_at":"2025-05-12 06:44:45","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":54252,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDeterminations during nursery period: \u003c/strong\u003eAnti-\u003cem\u003eLawsonia\u003c/em\u003e antibody analysis to determine vaccination efficacy (A) and anti-\u003cem\u003eSalmonella\u003c/em\u003e flagellin antibody analysis as indicators of intestinal barrier function (B), both performed by indirect ELISA on serum samples taken from 10 randomly selected animals per group.\u003cstrong\u003e \u003c/strong\u003eWeigh measurement of piglets 2 weeks after completing supplementation with \u003cem\u003eK. marxianus\u003c/em\u003eCIDCA 9121 (8 weeks of age). The data were obtained by batch weighing of 25 piglets randomly chosen (C). *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6590564/v1/2ad5872aa0fdea66442d6e9c.jpg"},{"id":83773415,"identity":"83f94a1e-bbf4-4f5e-a75d-591f62310a6c","added_by":"auto","created_at":"2025-06-02 13:08:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1260817,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6590564/v1/bfb09833-6596-4ea8-94e8-4bbb24cc2300.pdf"},{"id":82491252,"identity":"fec1301d-e6c7-462c-a180-90f712f724a4","added_by":"auto","created_at":"2025-05-12 06:44:45","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":60411,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 1.\u003c/strong\u003e \u003cstrong\u003eNitrogenous amino acid profiles in piglet blood 5 days post-weaning\u003c/strong\u003e. Glutamic, Arginine, Ornithine, Proline and Glutamine plasma content of Control group (●) and Km9121 group (○).\u003c/p\u003e","description":"","filename":"SupplementaryFigure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6590564/v1/2eb116e4675c96b8fadb3b98.jpg"},{"id":82490354,"identity":"0eb26d78-7520-40c7-8086-e588f121bf0f","added_by":"auto","created_at":"2025-05-12 06:36:45","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":52431,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 2.\u003c/strong\u003e \u003cstrong\u003eMicrobiota similarity analysis by DGGE. \u003c/strong\u003ePCR-based DGGE fingerprints obtained of cecal content samples from 5 days post-weaning piglets supplemented with Km9121 (Y) and unsupplemented Controls (C).\u003c/p\u003e","description":"","filename":"SupplementaryFigure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6590564/v1/cf0323d43dd4210936d42b19.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Supplementation with Kluyveromyces marxianus probiotic yeasts in sows and their piglets in early post- weaning: effects in biological and productive parameters","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePork is an increasingly demanded product, accounting of 34% of global meat consumption. Its production has incremented 130% in the last 60 years worldwide, stimulated by a rising demand due to growing global population and changes in socioeconomical situation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It is expected that this trend will continue for the next years. The increase in production has been achieved by combining sustained improvement in pig nutrition science and better production practices. In the last decades, production is concentrating in larger producers that can manage sustained investments and receive larger profits [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In the setting of pork producing farms, weaning of piglets is one of the major stressful events that may impact in the overall farm productivity [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The usual practice is to transfer litter of piglets from farrowing where lactation takes place in contact with the sow and its littermates to the nursing area that is shared with other piglets born at the same time from other sows. This procedure induces social stress on piglets by increasing interactions among them and restructuring their social hierarchy. Furthermore, an abrupt dietary shift is produced from lactation to solid feed, which impacts on the intestinal microbiota and gut health. These changes determine modification of gastrointestinal physiology and increased susceptibility to infections that can result in impaired feed conversion, reduction in weight gain rate and increased morbidity and mortality [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The use of antibiotics to mitigate this problem tends to be minimized according to sanitary regulation aiming to reduce antimicrobial resistance generation. In the last years, restrictions to the use of antibiotics in animal production has been included in EU regulations and more recently in China, USA and other countries [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eThe use of probiotics appears as an appropriate intervention to minimize post-weaning stress and the use of antibiotics [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. There are reports of successful use of bacterial and yeast probiotics to improve weight gain and to establish an appropriate microbiota [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. It is remarkable that different strategies have shown positive effects in the weaning scenario. The administration of probiotics to sows at the end stage of the pregnancy and during lactation contributes to better post-partum recovery and lactation capacity and, on the other hand, it may also contribute to the piglet microbiota diversity and functionality [\u003cspan additionalcitationids=\"CR12 CR13\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Moreover, the administration of probiotics to piglets after weaning alleviates postweaning stress by promoting better intestinal health and lowering infection rate either by competition/washing out pathogenic microorganisms or by inducing stronger immune function in the piglets [\u003cspan additionalcitationids=\"CR16 CR17\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn recent years, our group has characterized the probiotic capacity of several strains of \u003cem\u003eKluyveromyces marxianus\u003c/em\u003e yeast, that have also the capacity to grow on cheese whey or whey permeate, and present high specific growth rates as well as tolerance to high temperatures. This offers an alternative that adds value to this by-product of cheese industry and is attractive to high-scale production[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Remarkably, \u003cem\u003eK. marxianus\u003c/em\u003e CIDCA 9121 grown in whey permeate has shown anti-inflammatory activity on intestinal epithelial cells and colitis models in rodents being an interesting candidate strain to promote intestinal health [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In the present work, \u003cem\u003eK. marxianus\u003c/em\u003e CIDCA 9121 was administrated to gestating sows and their piglets in the first three weeks post weaning in order to evaluate its impact on productive parameters and biomarkers of post-weaning stress.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eFreeze-dried yeast obtention\u003c/h2\u003e \u003cp\u003eThe demands of daily farm work made it impossible to administer fresh refrigerated yeast. Therefore, this study utilized freeze-dried and fractionated yeast. \u003cem\u003eKluyveromyces marxianus\u003c/em\u003e CIDCA 9121 biomass was obtained following a two-stage fermentation process (batch and fed-batch) in a 15 L bioreactor using optimized media containing whey permeate 150 g/L, ammonium sulfate 7 g/L and yeast hydrolysate 7 g/L. Cells were harvested after 40 h and subsequently freeze-dried in an L-I-E260-CR RIFICOR freeze-dryer under controlled conditions (condenser temperature \u0026minus;\u0026thinsp;35\u0026deg;C, vacuum pressure 16 Pa, shelf temperature 25\u0026deg;C). The final product yielded a viable cell count of 5.5 x10\u003csup\u003e9\u003c/sup\u003e CFU/g of \u003cem\u003eK. marxianus\u003c/em\u003e CIDCA 9121.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAnimals and experimental procedures\u003c/h3\u003e\n\u003cp\u003e The experimental protocols were approved by Institutional Animal Care and Use Committee of the Faculty of Exact Sciences, National University of La Plata (Protocol Number 002-44-24). The study was conducted in the facilities of a commercial farm \u0026lsquo;Las 4B\u0026rsquo; SA, located in Buenos Aires, Argentina (35\u0026deg;26'12.3\"S 58\u0026deg;18'24.3\"W). The trial was performed from October 2023 to January 2024. Sixteen pregnant Topigs Norsvin\u0026reg; TN70 sows (average parity 3.9) were randomly assigned to two experimental groups (n\u0026thinsp;=\u0026thinsp;8) at days 111\u0026ndash;115 of gestation: a control group (Control) that received a basal diet and an yeast supplemented group (Km9121) that received a basal diet supplemented \u003cem\u003eon top\u003c/em\u003e with freeze-dried \u003cem\u003eK. marxianus\u003c/em\u003e CIDCA 9121 yeast at a dose of 1.4 g of lyophilized product/sow/day. Supplementation was carried out during the last 20 days of gestation and the first 21 days of lactation. After weaning, piglets born to supplemented sows received a daily dose of approximately 1x10⁹ CFU/day, while piglets born to control sows received only the basal diet. In this case, the yeast dose was top-dressed onto a reduced portion of balanced feed placed in plastic nursery feeders. All animals received \u003cem\u003ead libitum\u003c/em\u003e access to water and a basal diet of balanced feed formulated according to the nutritional requirements set out commonly used on the farm, based in four different phases (phase 1, first week after weaning, phase 2, second week after weaning, phase three, from day 35 to 49 of age and phase four from day 49 until the end of farrowing) shifting from a dairy-based initial formulation but stepwise including growing amounts of corn and soybean based ingredients that constitute 95% of the composition of phase 4 diet. During gestation and farrowing sows were housed individually in gestating cages, at 21 days piglets were transferred to nursery where they remained in separate groups according to treatment. The appropriate ambient temperature was maintained 27\u0026ndash;30\u0026deg;C and the relative humidity was maintained at 55\u0026ndash;65%. Pens were cleaned daily. Sows and piglets received routine vaccinations according to the farm's immunization program. No alterations were made to the standard feed during the experimental period.\u003c/p\u003e\n\u003ch3\u003eMeasurements and collected parameters\u003c/h3\u003e\n\u003cp\u003eLitter parameters recorded at farrowing included: farrowing duration per litter, interval between piglet expulsion, litter size, total number of live-born piglets and mummies from both experimental groups. Additionally, a colostrum sample was collected within 24 hours post-farrowing and stored at -20\u0026deg;C, immediately after collection. Piglets were weighed at birth and their individual weights were monitored at day 7, 14 (lactation phase), 21 (weaning) and 42 (post-weaning yeast supplementation phase), and on subsequent days after cessation of yeast supplementation. Blood samples were collected via anterior vena cava puncture at 19 and 25 days of age from 5 piglets per group. Subsequently, blood samples were centrifuged at 1,500 xg for 10 minutes to obtain serum. Serum samples were then stored at -20\u0026deg;C until further analysis of anti-flagellin antibodies, serum IgG dosage, and levels of nitrogenous amino acids: ornithine, glutamine, arginine, proline, and glutamic acid.\u003c/p\u003e \u003cp\u003eRandomly selected piglets (n\u0026thinsp;=\u0026thinsp;5 per group) were sacrificed for tissue sampling five days after weaning. Animals were mechanically stunned and bled following the common commercial slaughtering practices and tissue samples from duodenum, ileum and colon and cecal content were obtained for subsequent measurements.\u003c/p\u003e\n\u003ch3\u003eDetermination of sIgA concentration in colostrum\u003c/h3\u003e\n\u003cp\u003e Pig secretory immunoglobulin A (sIgA) levels were determined using the CSB-E12063p Pig sIgA ELISA Kit (CUSABIO, Houston, USA) according to the manufacturer's instructions. This sandwich ELISA employs a pair of specific anti-IgA antibodies, one conjugated to an enzyme for colorimetric detection. A standard curve (150 ng/mL to 37.5 \u0026micro;g/mL) was generated using the kit's provided IgA standard. Colostrum samples (diluted 1:100 in 0.05% (v/v) PBS-Tween 20 with 1% (w/v) milk protein) were incubated for 1 h at 37\u0026deg;C. After washing, peroxidase-conjugated anti-IgA was added and incubated for 1 h at 37\u0026deg;C. Following additional washes, 3,3\u0026prime;,5,5\u0026prime;-tetramethylbenzidine (TMB) substrate was added for 20 min, and the reaction was stopped with 2 M sulfuric acid. Absorbance was measured at 450 nm using a Varioskan Lux microplate reader (Thermo Scientific, USA).\u003c/p\u003e\n\u003ch3\u003eBrix measurement of colostrum samples\u003c/h3\u003e\n\u003cp\u003eMeasurements were made according to Hasan et al. (2016) with a digital refractometer MA871 (Milkwaukee Inc., Rocky Mount, NC 27804 USA).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of citrullinemia and nitrogen amino acids levels on piglets\u003c/h2\u003e \u003cp\u003eThe analysis of citrulline, proline, arginine, glutamine, ornithine, and glutamic acid concentrations in pig serum was performed by HPLC/DAD using an Agilent HP1290 liquid chromatograph (binary pump, degasser, column thermostat, autosampler, and DAD detector), after derivatization with dinitrofluorobenzene (Sanger's reagent). Samples were deproteinized with 30% (w/v) trichloroacetic acid, centrifuged at 7.630 xg for 5 min, and derivatized. A 50 \u0026micro;L volume of supernatant was mixed with 50 \u0026micro;L of 50 mM borate/boric acid buffer pH 9.20, 30 \u0026micro;L of Sanger's reagent solution in acetonitrile, and 170 \u0026micro;L of acetonitrile. They were maintained at 45\u0026deg;C for 45 min, and then the reaction was stopped with 0.5 M HCl. The derivatized samples were centrifuged, filtered and injected into the chromatograph. Amino acid standard mixtures of the six amino acids of interest at three concentration levels, previously derivatized, were used as standards.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eImmunological evaluation\u003c/h3\u003e\n\u003cp\u003ePig immunoglobulin G (IgG) levels in serum were quantified using the CSB-E06804p Pig IgG ELISA Kit (CUSABIO, Houston, USA) following the manufacturer's protocol. This sandwich ELISA employs a pair of specific anti-IgG antibodies, one conjugated to an enzyme for colorimetric detection. A standard curve (580 ng/mL to 150 \u0026micro;g/mL) was generated using the kit's provided IgG standard. Samples (diluted 1:50 in 0.05% (v/v) PBS-Tween 20 with 1% (w/v) milk protein) were incubated for 1 h at 37\u0026deg;C. After washing, peroxidase-conjugated anti-IgG was added and incubated for 1 h at 37\u0026deg;C. Following additional washes, TMB substrate was added for 20 min, and the reaction was stopped with 2 M sulfuric acid. Absorbance was measured at 450 nm using a Varioskan Lux microplate reader (Thermo Scientific, USA).\u003c/p\u003e \u003cp\u003eAn indirect enzyme-linked immunosorbent assay (ELISA) was employed to quantify specific antibodies against \u003cem\u003eLawsonia intracellularis\u003c/em\u003e and \u003cem\u003eSalmonella sp\u003c/em\u003e., in order to evaluate the immune response following on-farm vaccination. Microtiter plates (NUNC, Maxisorp, USA) were coated with a 1 \u0026micro;g/mL solution of purified \u003cem\u003eSalmonella\u003c/em\u003e sp. flagellin (Hiriart et al., 2013) in phosphate buffer (pH 7.4) and incubated overnight at 4\u0026deg;C. For measurement of anti-\u003cem\u003eLawsonia\u003c/em\u003e antibodies, plates were coated with the whole microorganism extract used for vaccination, suspended in carbonate buffer pH 9.0 at a concentration of 10 mg/mL. After washing and blocking with 3% (w/v) milk protein in PBS, the plates were incubated with a 1:50 dilution of porcine sera. Bound IgG was detected by incubating with a peroxidase-conjugated anti-IgG antibody (CUSABIO, USA). The colorimetric reaction was developed using o-phenylenediamine dihydrochloride (OPD) substrate and stopped with 2 M sulfuric acid. Absorbance was measured at 492 nm using a Varioskan Lux microplate reader (Thermo Scientific, USA).\u003c/p\u003e\n\u003ch3\u003eIntestinal metabolites and microbial analysis\u003c/h3\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of organic acids by Gas Chromatography\u003c/h2\u003e \u003cp\u003eOrganic acids levels in cecal content were determined qualitatively and quantitatively by Gas Chromatography according to Bengoa et al. (2020) (20) using an Agilent 7890A GC system fitted with a DBFATWAX UI 30 m x 0.25 mm x 0.25 \u0026micro;m (Agilent Technologies, Santa Clara, CA, USA) coupled to a flame ionization detector (FID). Briefly, 1 mL of cecal content suspended in distilled water (1:4 dilution) was centrifuged at 7,630 xg for 10 min. The obtained supernatant was filtered through a 0.22 \u0026micro;m membrane (Millipore Corporation, USA). The temperature at the injection port and at the FID was 280\u0026deg;C. Helium was used as carrier gas at a flow rate of 1.6 mL/min. For the run, 2 \u0026micro;L of the sample was injected with a 25:1 split and a temperature program that consisted of a ramp from 120 to 134\u0026deg;C at a speed of 1\u0026deg;C/min.\u003c/p\u003e \u003cp\u003eIdentification of organic acids was achieved by comparison with the retention times of standards and quantification was based on the corresponding peak areas using calibration curves constructed with standard solutions (Sigma Chemical Co., USA) of glacial acetic acid (5\u0026ndash;100 mM), propionic acid (5\u0026ndash;50 mM), and butyric acid (1\u0026ndash;30 mM).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eDNA Isolation\u003c/h2\u003e \u003cp\u003eDNA extractions were performed by using a commercial TIANamp Stool DNA Kit (Tiangen, Beijing, China) following the manufacturer\u0026rsquo;s instructions. DNA concentration and quality were determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, United States). The DNA samples were used for qPCR and DGGE analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of microbial populations by qPCR analysis\u003c/h2\u003e \u003cp\u003eQuantification of microbial populations was achieved using quantitative PCR (qPCR) with specific primers targeting the 16S ribosomal RNA (rRNA) gene of the Phyla Bacteroidetes, Firmicutes, Actinobacteria, Proteobacteria (beta and gamma subgroups), and Tenericutes. Total bacterial load was quantified using specific primers targeting a universal sequence of the Eubacteria 16S rRNA gene. Primer pairs of each target group are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for microbiota group analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence 5\u0026acute;-3\u0026acute;\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReferences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eActinobacteria\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAct664F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTAGCGGTGGAATGCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"11\" rowspan=\"12\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAct941R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAATTAAGCCACATGCTCCGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBacteroidetes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBac960F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTTAATTCGATGATACGCGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBac1100R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTAASCCGACACCTCACGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBetaproteobacterias\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBeta979F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAACGCGAAAAACCTTACCTACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBeta1130R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCCCTTTCGTAGCAACTAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDelta and Gammaproteobacteria\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGamma877F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTAACGCATTAAGTRYCCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGamma1066R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCATGCRGCACCTGTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFirmicutes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFirm934F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGYATGTGGTTTAATTCGAAGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFirm1060R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCTGACGACAACCATGCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTenericutes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTen662F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGTGTAGCGGTAAAATGCGTAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTen862R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCMTACTTGCGTACGTACTACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eEubacteria\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHDA1F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTCCTACGGGAGGCAGCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHDA2 R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTATTACCGCGGCTGCTGGCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe reactions were performed in a BioRad CFX Opus 96 real-time PCR system using the following cycling program: an initial denaturation step 10 min at 95\u0026deg;C, 40 amplification cycles of 95\u0026deg;C for 15 s, an annealing/extension phase at 60\u0026deg;C for 30 s, and a final elongation step at 72\u0026deg;C for 30 s. A melting curve analysis was performed by increasing the temperature by 0.5\u0026deg;C every 5 seconds between 55\u0026deg;C and 95\u0026deg;C. Real-time PCRs were carried out in 96-well optical plates and qPCR mixtures contained 10 \u0026micro;L of DNA template (final concentration 20ng/24 \u0026micro;L), 12 \u0026micro;L of iQ SYBR Green SuperMix reagent (BioRad) and 1 \u0026micro;L of each forward and reverse primer. For each primer set, a no-template control (NTC) was included, where pharmaceutical-grade water was used instead of template DNA.\u003c/p\u003e \u003cp\u003eMelting curve analysis (Tm) was performed to validate Ct values and confirm the specific amplification of target amplicons. Relative quantification of the target populations was performed using their threshold cycle (Ct) values, normalized to the total bacterial load. The total bacterial load was estimated from the Ct values obtained with Eubacteria 16S rRNA primers, which were set to represent 100%.\u003c/p\u003e \u003cp\u003e% Relative abundance\u0026thinsp;=\u0026thinsp;2 \u003csup\u003e\u0026minus; (Ct Spec \u0026minus; Ct Univ)\u003c/sup\u003e x100\u003c/p\u003e \u003cp\u003ewhere Ct Spec and Ct Univ are Ct values register by thermocycler for 16sRNA of specific group and 16sRNA of Eubacteria group, respectively.\u003c/p\u003e \u003cp\u003e \u003cem\u003eMicrobiota Analysis by\u003c/em\u003e Denaturing-gradient-gel electrophoresis (\u003cem\u003eDGGE)\u003c/em\u003e\u003c/p\u003e \u003cp\u003eThe microbiota in cecal content was analyzed by partial amplification of the 16S rRNA gene using universal primers 338F-GC (GCclamp-ACTCCTACGGGAGGCAGCAG) and 518R (ATTACCGCGGCTGCTG) according to Bakke et al. (2011) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. PCR amplification was performed using Taq polymerase Pegasus (PBL Biological Products, Argentina) following the manufactures instruction and using 0.5 ng/\u0026micro;L of DNA template. The reaction was carried out in a T100 thermal cycler (Bio-rad laboratories, Irvine, CA, United States) with the following amplification program: 94\u0026deg;C for 5 min; 35 cycles of 94\u0026deg;C for 30 s, 60\u0026deg;C for 45 s and 72\u0026deg;C for 20 s; and a final extension step at 72\u0026deg;C for 1 min. The amplification products were analyzed by electrophoresis in 1% (w/v) agarose gels with ethidium bromide and revealed under UV light.\u003c/p\u003e \u003cp\u003eDGGE was performed in a DGGE-2401 analyzer (C.B.S. Scientific Co., Del Mar, CA, United States). The PCR products (15 \u0026micro;L) were seeded in 8 g/100 mL polyacrylamide gels (15x20x 0.075 cm) in TAE buffer [50X TAE is 2 M Tris, 1 M acetic acid, and 50 mM EDTA (pH 8.0)]. A denaturing gradient of Urea-Formamide 40\u0026ndash;60% (v/v) (100% corresponds to Urea 7 M and Formamide 40% v/v) was used to achieve the optimal separation of the bands corresponding to Eubacteria. Electrophoresis was carried out at 90 V for 16 h at 60\u0026deg;C. Gels were then stained by immersion for 30 min in a 0.1 mL/L Sybr-Gold solution (Invitrogen, United States) in TAE buffer and observed under UV light. Band patterns obtained for each sample were compered using the Gel compar II program (Applied maths NV, Sint-Martens-Latem, Belgium). The percentage of similarity between the samples was calculated using the Dice Similarity Coefficient and the corresponding UPGMA dendrograms were constructed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eIntestinal Histological Evaluation\u003c/h2\u003e \u003cp\u003eIntestinal tissue specimens were opened to remove the content and were washed twice with PBS. Then portions were fixed with formaldehyde 10% (v/v) and embedded in paraffin. Embedded samples were cut with a microtome at a thickness of 4 mm and stained with hematoxylin and eosin. Morphometric studies on crypt and villi length, mucosal thickness and crypt/villi ratio were performed following procedure described by Vecchio et al [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].Briefly, an extensive image registry of sections of each animal\u0026rsquo;s duodenum and ileum segments at x40, x100 and x400 microscopy fields was performed using a Nikon Ni-Eclipse microscope (Nikon Instruments Inc., USA). Determination of IEL counting and morphometric parameters was performed on a double-blind scoring system by a trained observer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analyses\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed using GraphPad software version 8.02 (San Diego, CA, USA). Mann Whitney test were used to determine the significance of differences between two groups. P values less than 0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eIn order to evaluate the effects of the supplementation with probiotic yeast \u003cem\u003eK. marxianus\u003c/em\u003e CIDCA 9121 on post-weaning stress, gestating sows were supplemented in the last three weeks of pregnancy and during lactation as well as the weaned piglets for the first three post-weaning weeks. Each experimental group consisted of 8 sows that received usual feeding program (control) or yeast supplementation (Km9121). Sows were randomly assigned to each group, resulting in a parity of 3.34 (Km9121) and 4.5 (control). A total of 123 and 120 piglets were born in control and Km9121 group respectively. No differences were observed in the different delivery parameters (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Remarkably, piglets born from mothers that received yeast supplementation were bigger than controls (1.60+/-0.19 kg/animal \u003cem\u003evs\u003c/em\u003e 1.37 +/-0.15kg/animal, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). No differences were observed in the IgA content of colostrum, nor in the refractometry levels that usually correlate with IgG content[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], (not shown).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffect of yeast culture supplementation from late gestation on farrowing performance of sows\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariables\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCtr\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eKm 9121\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP-value\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo of sows\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLitter size\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15.4\u0026thinsp;\u0026plusmn;\u0026thinsp;5.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15.0\u0026thinsp;\u0026plusmn;\u0026thinsp;2.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.453\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLive-born piglets, n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e123\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAverage piglets\u0026rsquo; weight at birth, Kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.021\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLitter weight at birth, Kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e23.96\u0026thinsp;\u0026plusmn;\u0026thinsp;4,23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20.80\u0026thinsp;\u0026plusmn;\u0026thinsp;6.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.136\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBirth duration, h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.764\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAverage piglet expulsion interval, min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.396\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eAbbreviation: Ctr\u0026thinsp;=\u0026thinsp;Sows control group, Km 9121\u0026thinsp;=\u0026thinsp;sows yeast group\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAlthough at weaning both groups have similar weights (6.06 kg/animal in both groups), there are several indicators that show a beneficial effect in the Km9121 group. During lactation we registered lower number of cases of neonatal diarrhea and of milder intensity in the supplemented group (not shown). All cases were mild and did not required medication or changes in practice and since there were very few, we could not establish statistical significance in the comparison between groups. Five days post-weaning, five animals of each group were randomly sacrificed to evaluate intestinal histopathology. Interestingly, animals in the Km9121 group have longer crypts and villi in duodenum (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B, C, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), resulting in a larger mucosal thickness (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), without changes in villous/crypt ratio (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE) indicating a more trophic intestine. In concordance, the evaluation of citrulline blood levels showed higher levels of this marker of functional enterocyte mass[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] in the Km9121 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG, p\u0026thinsp;=\u0026thinsp;0.055), and also higher blood levels of other amino acids related with nitrogen metabolism (Supplementary Fig.\u0026nbsp;1). Furthermore, we quantified the number of IELs in terminal small intestine, as a rough indicator of intestinal defense status, finding a larger value in the yeast group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003eWe analyzed the intestinal microbiota in the cecum of sacrificed animals. An initial comparison using DGGE methodology to evaluate similarities among samples showed that most individuals of the yeast group clustered together whereas most controls grouped in a different cluster, indicating that the yeast supplementation had an influence in the cecal microbiota structure (Supplementary Fig.\u0026nbsp;2). We quantified by qPCR the relative amount of major microbial groups and a predominance of the Bacteroidetes phylum was observed in most samples, except for one control (C5) and two yeast-supplemented samples (Y4 and Y5), where Firmicutes were predominant. In piglets where Bacteroidetes was predominant, the relative composition of this phylum ranged 23\u0026ndash;38% in control pig samples and 29\u0026ndash;43% in supplemented pigs and the Firmicutes phylum ranged 6\u0026ndash;22% and 18\u0026ndash;21% respectively. The other groups analyzed represented less than 1% of the total microbiota in both yeast-supplemented and non-yeast-supplemented piglets. When analyzing the short chain fatty acids in cecal content, no differences were found in acetate, propionate and butyrate levels between control and supplemented group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, C, D). Although there is a trend in supplemented animals to show higher levels of total organic acids (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), there is high dispersion among the samples analyzed.\u003c/p\u003e \u003cp\u003eAnimals in the Km9121 group received a daily dose of 10\u003csup\u003e9\u003c/sup\u003e CFU/kg of feed during three weeks after weaning along the nursing period. At 12 weeks of age, at the ending of this period we evaluated the presence of anti-\u003cem\u003eLawsonia\u003c/em\u003e antibodies as a measurement of response to vaccination in 10 animals randomly selected of each group. Although there are no significant differences between groups, there is a trend to have higher levels of specific antibodies in the yeast group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Furthermore, anti-flagellin antibodies were evaluated as a measurement of integrity of intestinal barrier in the same samples, showing no differences between groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Remarkably, at 42 days post weaning, the average weight of Km9121 group was significantly higher than the control group showing around 10% higher average weight (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), being 21.69 kg, the average weigh of the Km9121 group whereas the control group showed an average weight of 19.11 kg.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study showed that supplementation with \u003cem\u003eK. marxianus\u003c/em\u003e CIDCA 9121 to sows at the end of pregnancy and during lactation and to piglets after weaning had a positive effect on post-weaning stress and piglet weight. The capacity of \u003cem\u003eK. marxianus\u003c/em\u003e to ferment lactose allows the use of whey permeate to produce yeast biomass, being an interesting technology to deal with the great volume of this by-product of cheese industry [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Since this was the first experiment performed with this strain in a productive farm, we decided to use an experimental design that covers both major uses of probiotics in pork production, the administration to sows and the supplementation of piglets\u0026rsquo; diet post weaning. As was observed by Hu et al. (2024) supplemented sows in the last weeks of pregnancy with a mixture of probiotic bacterial strains [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], an increase in average weight at birth was detected in the present study, which correlates with piglet survival rate [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. On the other hand, Le Floch et al. (2022) performed an experiment supplementing gestating sows with the probiotic yeast \u003cem\u003eSaccharomyces boulardii\u003c/em\u003e and did not observe an increase in birth weight, although they found changes in piglets\u0026rsquo; fecal microbiota upon yeast administration [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Hasan et al. (2018) using supplementation with yeast hydrolysate [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] as well as Scollo et al (2023) using inactivated \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e supplementation [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] and Zhao et al (2024) using live \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e supplementation [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] did not observed changes in weight at birth. These differences may be due to the probiotic strains used, the amount of microorganisms administrated or other factors associated to the experimental design. Interestingly, different reports [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] have shown that supplementation of sows with a mixture of probiotic bacterial strains lowers the incidence of piglet diarrhea during lactation. Similarly, in the present work, more cases of neonatal diarrhea and of longer duration were observed in the control group than in the group supplemented with probiotic yeast. Other reported beneficial effect of the probiotic supplementation to sows is a lower impact on metabolic effort associated to lactation reflected by lower loss of backfat pad [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]however this parameter was not evaluated in our study. Regarding IgA and IgG levels in colostrum, we evidenced no differences because of yeast supplementation, in coincidence with results obtained by Hu et al (2024) who observed a rise in immunoglobulins at 20 days of lactation but no differences at birth [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the present study, the differences in weight observed at birth were not sustained to the end of lactation (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). However, 40 days after weaning, there was a 10% weight gain in average in the group that received supplementation with \u003cem\u003eK. marxianus\u003c/em\u003e CIDCA 9121 and differences in weight lasted until the end of nursery. Both groups started the nursing period with similar weights, indicating that this difference is exclusively determined by the weight gain after weaning. This positive effect could be attributed not only to the intervention with the probiotic yeast in the nursing period but also to the influence of the previous intervention of sows with yeast supplementation during gestation and lactation. Hu et al. (2024) performed an experiment having groups of animals born from sows that received probiotic supplementation but received conventional feeding after weaning whereas other group born from sows that received conventional feeding but after weaning were supplemented with a probiotic mixture [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In both cases, they observed an increased weight at the end of nursing period, indicating that both factors can contribute to this parameter. Interestingly, the group which both sows and piglets received probiotic supplementation had only a marginal weight gain after nursing and this was lower than the gain of the groups where only sows received supplementation or the piglets. Miotto Galli et al. (2024) supplied a mixture of different probiotic bacteria using a similar 2x2 factorial design on control \u003cem\u003evs\u003c/em\u003e supplemented and gestation/lactation vs post weaning. these authors observed the major effects on weight in the case of sow supplementation, both in the weight at birth and at the end of lactation, indicating the importance of the maternal imprinting in piglet development [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Considering this, further investigation is required regarding the effects of \u003cem\u003eK. marxianus\u003c/em\u003e CIDCA 9121 supplementation either at pregnancy/lactation or exclusively in the postweaning.\u003c/p\u003e \u003cp\u003eThe post weaning period is the most stressful moment of the productive cycle and supplementation with probiotics has shown positive effects to overcome this moment. In our experiment, it was evident that the supplemented group have a lower impact of the weaning stress in the intestinal mucosa resulting in longer villi and crypts at the small intestine (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Similar results were observed by Sandrini et al (2024) using a supplementation of a mixture of probiotic yeast to piglets after weaning. Remarkably, these authors did not find impact in productive parameters [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. A positive effect on intestinal histological parameters and growth performance was reported by Boontiam et al. (2022) using yeast hydrolysate as supplement to very early weaned pigs [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Improvement of histological and permeability parameters by probiotic supplementation in the postweaning period has also been shown by others [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In coincidence with better histological parameters [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], we also detected higher levels of serum citrulline in the group that received the probiotic yeast supplementation. This is also indicative of a higher functional enterocyte mass and has been shown to correlate with the increase of weight during the nursing period [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Many different studies have documented changes in intestinal microbiota of piglets supplemented with probiotics, either post-weaning [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] or conditioned by supplementing sows during late pregnancy and lactation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. In our case, we performed a partial characterization using approximate molecular methods, finding small differences between the groups that may have influenced the observed productive and histological differences. In agreement with all the different reports that have described changes in the microbiota associated with probiotic intervention, a direct causal relationship cannot be established. The high representation of the \"Others\" group found in this study can be attributed to the combined contribution of multiple taxa, less abundant than Firmicutes and Bacteroidetes, which individually comprise a smaller fraction of the total microbiota[\u003cspan additionalcitationids=\"CR39 CR40\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] .We detected a wider dispersion in SCFA levels in the cecum of the \u003cem\u003eK. marxianus\u003c/em\u003e CIDCA 9121-supplemented group; however, we were unable to correlate individual variations with the analysis of microbial content. Taken together, these data indicate that variations in the gut microbiota of treated animals could be partially responsible for the changes observed between the groups. It has been reported that probiotic supplementation can improve piglet immune function [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. We evaluated the response to anti-\u003cem\u003eLawsonia\u003c/em\u003e vaccination using an in house optimized indirect ELISA and found no differences between groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). A deeper characterization of the effects of \u003cem\u003eK. marxianus\u003c/em\u003e supplementation in piglet immune function will be performed in future works.\u003c/p\u003e \u003cp\u003eIn summary, we have shown the beneficial effects of using \u003cem\u003eK. marxianus\u003c/em\u003e CIDCA 9121 as supplement for sows during late gestation and lactation and for weaned piglets. We observed remarkable effects on productive parameters and attenuation of post-weaning stress. Considering the favorable technological properties of the characterized strain, it appears as an attractive candidate to be used to cover the ever-growing demands of porcine production industry.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding statement:\u003c/h2\u003e \u003cp\u003eThis work was supported by grants PICTA 2021-0060 and PICT 2020\u0026ndash;03973 from Agencia Nacional I\u0026thinsp;+\u0026thinsp;D\u0026thinsp;+\u0026thinsp;I (ANPCyT) and grant number FITBA A09-2022 from the Ministry of Production, Science and Technology from Provincia de Buenos Aires, Argentina.\u003c/p\u003e \u003cp\u003e\u003cb\u003eEthics statement\u003c/b\u003e: The animal study was reviewed and approved by Institutional Animal Care and Use Committee of the Faculty of Exact Sciences, National University of La Plata (Protocol Number 002-44-24).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eM.D.P., M.F.C., E.V., J.I.G., C.D., A.A.B., M.E.T., A.J.E., M.M., S.C., G.C. performed experimental work and participated in data analysis; E.V., S.W., M.R., G.L.G. participated in study design; S.C., G.C., M.R., G.L.G. participated in funding acquisition, and M.D.P., M.F.C., G.L.G. and M.R. write the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors thank Mr. JI Ortiz for providing the farm \u0026ldquo;Granja las 4B\u0026rdquo; facilities and his staff for their collaboration in carrying out the trials and Miss YM Leonardi for her collaboration in caring for the animals and taking samples on the farm.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKim SW, Gormley A, Jang KB, Duarte ME. - Invited Review - Current status of global pig production: an overview and research trends. Anim Biosci. 2024;37: 719\u0026ndash;729. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5713/AB.23.0367\u003c/span\u003e\u003cspan address=\"10.5713/AB.23.0367\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanz-Fern\u0026aacute;ndez S, Rodr\u0026iacute;guez-Hern\u0026aacute;ndez P, D\u0026iacute;az-Gaona C, Tusell L, Quintanilla R, Rodr\u0026iacute;guez-Est\u0026eacute;vez V. Evolution of Sow Productivity and Evaluation Parameters: Spanish Farms as a Benchmark. Vet Sci. 2024;11. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/VETSCI11120626\u003c/span\u003e\u003cspan address=\"10.3390/VETSCI11120626\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePapatsiros VG, Maragkakis G, Papakonstantinou GI. Stress Biomarkers in Pigs: Current Insights and Clinical Application. Vet Sci. 2024;11. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/VETSCI11120640\u003c/span\u003e\u003cspan address=\"10.3390/VETSCI11120640\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoeser AJ, Pohl CS, Rajput M. Weaning stress and gastrointestinal barrier development: Implications for lifelong gut health in pigs. Anim Nutr. 2017;3: 313\u0026ndash;321. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.ANINU.2017.06.003\u003c/span\u003e\u003cspan address=\"10.1016/J.ANINU.2017.06.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmerold I, van Geijlswijk I, Gehring R. European regulations on the use of antibiotics in veterinary medicine. Eur J Pharm Sci. 2023;189. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.EJPS.2023.106473\u003c/span\u003e\u003cspan address=\"10.1016/J.EJPS.2023.106473\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatel SJ, Wellington M, Shah RM, Ferreira MJ. Antibiotic Stewardship in Food-producing Animals: Challenges, Progress, and Opportunities. Clin Ther. 2020;42: 1649\u0026ndash;1658. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.CLINTHERA.2020.07.004\u003c/span\u003e\u003cspan address=\"10.1016/J.CLINTHERA.2020.07.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoARA. National Action Plan for Veterinary Antimicrobial Use Reduction (2021\u0026ndash;2025), Ministry of Agriculture Rural Affairs. In: 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Z, Yang M, Su W, Mei L, Li Y, Guo Y, et al. Probiotics in piglet: from gut health to pathogen defense mechanisms. Front Immunol. 2024;15. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/FIMMU.2024.1468873\u003c/span\u003e\u003cspan address=\"10.3389/FIMMU.2024.1468873\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu HY, Zhu C, Zhu M, Yuan L, Li S, Gu F, et al. Alternatives to antibiotics in pig production: looking through the lens of immunophysiology. Stress biology. 2024;4. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/S44154-023-00134-W\u003c/span\u003e\u003cspan address=\"10.1007/S44154-023-00134-W\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Z, Yang M, Su W, Mei L, Li Y, Guo Y, et al. Probiotics in piglet: from gut health to pathogen defense mechanisms. Front Immunol. 2024;15. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/FIMMU.2024.1468873\u003c/span\u003e\u003cspan address=\"10.3389/FIMMU.2024.1468873\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu T, Song Z, Yang L, Chen K, Wu Y, Xie F, et al. Maternal probiotic mixture supplementation optimizes the gut microbiota structure of offspring piglets through the gut-breast axis. Anim Nutr. 2024;19. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.ANINU.2024.04.025\u003c/span\u003e\u003cspan address=\"10.1016/J.ANINU.2024.04.025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRuampatana J, Suwimonteerabutr J, Homyog K, Mekboonsonglarp W, Kanjanavaikoon K, der Veken W Van, et al. Clostridium butyricum Probiotic Feed Additive: Modulation of Sow Milk Metabolomics and Mitigation of Pre-Weaning Piglet Diarrhea. Animals (Basel). 2024;14. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ANI14142098\u003c/span\u003e\u003cspan address=\"10.3390/ANI14142098\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eInnamma N, Kaeoket K. Feeding Sows with Multi-Species Probiotics During Late Pregnancy and the Lactating Period Influences IgA Concentration in Colostrum and Subsequently Increases the Survival Rate of Piglets in Porcine Epidemic Diarrhea Outbreak Herd. Animals (Basel). 2025;15. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ANI15010103\u003c/span\u003e\u003cspan address=\"10.3390/ANI15010103\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWongsamart R, Somboonna N, Cheibchalard T, Klankeo P, Ruampatana J, Nuntapaitoon M. Probiotic Bacillus licheniformis DSMZ 28710 improves sow milk microbiota and enhances piglet health outcomes. Sci Rep. 2025;15. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/S41598-024-84573-Z\u003c/span\u003e\u003cspan address=\"10.1038/S41598-024-84573-Z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang CW, Liu SY, Bhattarai BP, Lee TY, Chang HT, Lin HC, et al. Live Multi-Strain Probiotics Enhance Growth Performance by Regulating Intestinal Morphology and Microbiome Population in Weaning Piglets. Microorganisms. 2024;12. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/MICROORGANISMS12112334\u003c/span\u003e\u003cspan address=\"10.3390/MICROORGANISMS12112334\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoon KN, Choi YH, Keum GB, Yeom SJ, Kim SS, Kim ES, et al. Lactiplantibacillus argentoratensis AGMB00912 alleviates diarrhea and promotes the growth performance of piglets during the weaning transition. BMC Microbiol. 2024;24: 404. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/S12866-024-03536-6\u003c/span\u003e\u003cspan address=\"10.1186/S12866-024-03536-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShu Z, Zhang J, Zhou Q, Peng Y, Huang Y, Zhou Y, et al. Effects of inactivated Lactobacillus rhamnosus on growth performance, serum indicators, and colonic microbiota and metabolism of weaned piglets. BMC Vet Res. 2024;20: 422. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/S12917-024-04133-5\u003c/span\u003e\u003cspan address=\"10.1186/S12917-024-04133-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue L, Long S, Cheng B, Song Q, Zhang C, Hansen LHB, et al. Dietary Triple-Strain Bacillus-Based Probiotic Supplementation Improves Performance, Immune Function, Intestinal Morphology, and Microbial Community in Weaned Pigs. Microorganisms. 2024;12. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/MICROORGANISMS12081536\u003c/span\u003e\u003cspan address=\"10.3390/MICROORGANISMS12081536\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRomanin DE, Llopis S, Genov\u0026eacute;s S, Martorell P, Ram\u0026oacute;n VD, Garrote GL, et al. Probiotic yeast Kluyveromyces marxianus CIDCA 8154 shows anti-inflammatory and anti-oxidative stress properties in in vivo models. Benef Microbes. 2016;7. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3920/BM2015.0066\u003c/span\u003e\u003cspan address=\"10.3920/BM2015.0066\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePend\u0026oacute;n MD, Madeira J V., Romanin DE, Rumbo M, Gombert AK, Garrote GL. A biorefinery concept for the production of fuel ethanol, probiotic yeast, and whey protein from a by-product of the cheese industry. Appl Microbiol Biotechnol. 2021 [cited 2 May 2021]. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00253-021-11278-y\u003c/span\u003e\u003cspan address=\"10.1007/s00253-021-11278-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBakke I, De Schryver P, Boon N, Vadstein O. PCR-based community structure studies of bacteria associated with eukaryotic organisms: a simple PCR strategy to avoid co-amplification of eukaryotic DNA. J Microbiol Methods. 2011;84: 349\u0026ndash;351. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.MIMET.2010.12.015\u003c/span\u003e\u003cspan address=\"10.1016/J.MIMET.2010.12.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDezillio LEV, Romanin DE, Marinoff IMI, Vernengo J, Z\u0026aacute;rate JCA, Machuca MA, et al. Experimental study to assess the impact of vasopressors administered during maintenance of the brain-dead donation in the quality of the intestinal graft. J Trauma Acute Care Surg. 2022;92: 380\u0026ndash;387. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/TA.0000000000003473\u003c/span\u003e\u003cspan address=\"10.1097/TA.0000000000003473\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHasan SMK, Junnikkala S, Valros A, Peltoniemi O, Oliviero C. Validation of Brix refractometer to estimate colostrum immunoglobulin G content and composition in the sow. Animal. 2016;10: 1728\u0026ndash;1733. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1017/S1751731116000896\u003c/span\u003e\u003cspan address=\"10.1017/S1751731116000896\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoraci AL, Decundo JM, Dieguez SN, Mart\u0026iacute;nez G, P\u0026eacute;rez Gaudio DS, Amanto FA. Citrullinemia is a suitable biomarker for post weaning performance in piglets under intensive farming. J Am Vet Med Assoc. 2023;261: 858\u0026ndash;864. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2460/JAVMA.22.12.0543\u003c/span\u003e\u003cspan address=\"10.2460/JAVMA.22.12.0543\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCabrera RA, Lin X, Campbell JM, Moeser AJ, Odle J. Influence of birth order, birth weight, colostrum and serum immunoglobulin G on neonatal piglet survival. J Anim Sci Biotechnol. 2012;3. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/2049-1891-3-42\u003c/span\u003e\u003cspan address=\"10.1186/2049-1891-3-42\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe Floc\u0026rsquo;h N, Achard CS, Eugenio FA, Apper E, Combes S, Quesnel H. Effect of live yeast supplementation in sow diet during gestation and lactation on sow and piglet fecal microbiota, health, and performance. J Anim Sci. 2022;100. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/JAS/SKAC209\u003c/span\u003e\u003cspan address=\"10.1093/JAS/SKAC209\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHasan S, Junnikkala S, Peltoniemi O, Paulin L, Lyyski A, Vuorenmaa J, et al. Dietary supplementation with yeast hydrolysate in pregnancy influences colostrum yield and gut microbiota of sows and piglets after birth. PLoS One. 2018;13. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/JOURNAL.PONE.0197586\u003c/span\u003e\u003cspan address=\"10.1371/JOURNAL.PONE.0197586\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScollo A, Borello I, Ghilardi M, Cavagnini A. The Administration of Inactivated and Stabilized Whole-Cells of Saccharomyces cerevisiae to Gestating Sows Improves Lactation Efficiency and Post-Weaning Antimicrobial Use. Vet Sci. 2023;10. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/VETSCI10090576\u003c/span\u003e\u003cspan address=\"10.3390/VETSCI10090576\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao Y, Lin Y, Xu S, Hua L, Feng B, Fang Z, et al. Amino acid standardized ileal digestibility together with concentrations of digestible and metabolizable energy in Saccharomyces cerevisiae yeast and soybean meal for gestating sows. J Anim Sci. 2024;102. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/JAS/SKAD402\u003c/span\u003e\u003cspan address=\"10.1093/JAS/SKAD402\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaw K, Johnston LJ, Urriola PE, Gomez A. Maternal Programming of Nursery Pig Performance and Gut Microbiome through Live Yeast Supplementation. Animals (Basel). 2024;14. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ANI14060910\u003c/span\u003e\u003cspan address=\"10.3390/ANI14060910\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalli GM, Andretta I, Levesque C, Stefanello T, Carvalho CL, Perez Pelencia JY, et al. Using probiotics to improve nutrient digestibility and gut-health of weaned pigs: a comparison of maternal and nursery supplementation strategies. Front Vet Sci. 2024;11. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/FVETS.2024.1356455\u003c/span\u003e\u003cspan address=\"10.3389/FVETS.2024.1356455\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSandrini S, Perricone V, Cremonesi P, Castiglioni B, Biscarini F, Verdile N, et al. Yeast mixture supplementation modulates faecal microbiota and ileum morphology of weaning pigs. Animal. 2024;18. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.ANIMAL.2024.101275\u003c/span\u003e\u003cspan address=\"10.1016/J.ANIMAL.2024.101275\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoontiam W, Bunchasak C, Kim YY, Kitipongpysan S, Hong J. Hydrolyzed Yeast Supplementation to Newly Weaned Piglets: Growth Performance, Gut Health, and Microbial Fermentation. Animals (Basel). 2022;12. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ANI12030350\u003c/span\u003e\u003cspan address=\"10.3390/ANI12030350\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShonyela SM, Feng B, Yang W, Yang G, Wang C. The regulatory effect of Lactobacillus rhamnosus GG on T lymphocyte and the development of intestinal villi in piglets of different periods. AMB Express. 2020;10. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/S13568-020-00980-1\u003c/span\u003e\u003cspan address=\"10.1186/S13568-020-00980-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalita A, Talukdar M, Sarma K, Kalita PC, Roychoudhury P, Kalita G, et al. Small intestinal mucosal cells in piglets fed with probiotic and zinc: a qualitative and quantitative microanatomical study. Folia Morphol (Warsz). 2021;80: 605\u0026ndash;617. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5603/FM.A2020.0091\u003c/span\u003e\u003cspan address=\"10.5603/FM.A2020.0091\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen YB, Piao XS, Kim SW, Wang L, Liu P, Yoon I, et al. Effects of yeast culture supplementation on growth performance, intestinal health, and immune response of nursery pigs. J Anim Sci. 2009;87: 2614\u0026ndash;2624. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2527/JAS.2008-1512\u003c/span\u003e\u003cspan address=\"10.2527/JAS.2008-1512\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Jia X, Chang J, Jiang X, Che L, Lin Y, et al. Effect of yeast culture supplementation in sows during late gestation and lactation on growth performance, antioxidant properties, and intestinal microorganisms of offspring weaned piglets. Front Microbiol. 2023;13. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/FMICB.2022.1105888\u003c/span\u003e\u003cspan address=\"10.3389/FMICB.2022.1105888\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Liu Y, Liu J, Wang H, Guo Y, Du M, et al. Composition of the Fecal Microbiota of Piglets at Various Growth Stages. Front Vet Sci. 2021;8. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/FVETS.2021.661671\u003c/span\u003e\u003cspan address=\"10.3389/FVETS.2021.661671\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e,\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang D, Ji H, Liu H, Wang S, Wang J, Wang Y. Changes in the diversity and composition of gut microbiota of weaned piglets after oral administration of Lactobacillus or an antibiotic. Appl Microbiol Biotechnol. 2016;100: 10081\u0026ndash;10093. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/S00253-016-7845-5\u003c/span\u003e\u003cspan address=\"10.1007/S00253-016-7845-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e,\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGresse R, Durand FC, Duni\u0026egrave;re L, Blanquet-Diot S, Forano E. Microbiota composition and functional profiling throughout the gastrointestinal tract of commercial weaning piglets. Microorganisms. 2019;7. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/MICROORGANISMS7090343\u003c/span\u003e\u003cspan address=\"10.3390/MICROORGANISMS7090343\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e,\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuevarra RB, Hong SH, Cho JH, Kim BR, Shin J, Lee JH, et al. The dynamics of the piglet gut microbiome during the weaning transition in association with health and nutrition. J Anim Sci Biotechnol. 2018;9. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/S40104-018-0269-6\u003c/span\u003e\u003cspan address=\"10.1186/S40104-018-0269-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e,\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaha S, Namai F, Nishiyama K, Villena J, Kitazawa H. Role of immunomodulatory probiotics in alleviating bacterial diarrhea in piglets: a systematic review. J Anim Sci Biotechnol. 2024;15. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/S40104-024-01070-Z\u003c/span\u003e\u003cspan address=\"10.1186/S40104-024-01070-Z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang YW, Chen MK, Yang BY, Huang XJ, Zhang XR, He LQ, et al. Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in mouse feces. Appl Environ Microbiol. 2015;81: 6749\u0026ndash;6756. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/AEM.01906-15\u003c/span\u003e\u003cspan address=\"10.1128/AEM.01906-15\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e,\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalter J, Tannock GW, Tilsala-Timisjarvi A, Rodtong S, Loach DM, Munro K, et al. Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PCR primers. Appl Environ Microbiol. 2000;66: 297\u0026ndash;303. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/AEM.66.1.297-303.2000\u003c/span\u003e\u003cspan address=\"10.1128/AEM.66.1.297-303.2000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e,\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"probiotic yeasts, antimicrobial resistance, post-weaning stress, porcine production","lastPublishedDoi":"10.21203/rs.3.rs-6590564/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6590564/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eWeaning in pig production is a stressful event that impacts intestinal biology and increases the risk of infections, impairing piglet development and leading to economic losses. Antibiotic preventive administration has been used to improve the productive parameters, but nowadays this practice has been banned because of its contribution to antimicrobial resistance generation. So, alternatives are urgently needed. \u003cem\u003eKluyveromyces marxianus\u003c/em\u003e CIDCA 9121 has immunomodulatory and convenient biotechnological properties and was studied for preventing post-weaning stress, for which 8 sows were supplemented with 10\u003csup\u003e9\u003c/sup\u003e CFU per kg of feed from 20 days before piglets\u0026acute; birth until weaning. Then, piglets were supplemented with 2x10\u003csup\u003e9\u003c/sup\u003e CFU/ kg of feed for 20 days more. A control group of 8 sows and their piglets not supplemented with yeast was included. Productive parameters were registered from birth to 60 days of age. Five days post-weaning, 5 animals from each group were euthanized; small intestines and blood were taken for histopathology analysis and amino acid analysis respectively. Intestinal content was sampled to determine the main bacterial groups by qPCR. Piglets born from supplemented sows (n\u0026thinsp;=\u0026thinsp;132) weighed more than controls (n\u0026thinsp;=\u0026thinsp;130; p\u0026thinsp;\u0026lt;\u0026thinsp;0,05). During farrowing, there were no differences among groups but 40 days after weaning the supplemented group weighted 10% more than the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0,05). We found an increase in citrullinemia and in the small intestine mucosal thickness in supplemented piglets post-weaning indicating better tolerance to post-weaning stress. Our results suggest that \u003cem\u003eK. marxianus\u003c/em\u003e CIDCA 9121 is a good candidate for supplementation of gestating sows and postweaning piglets.\u003c/p\u003e","manuscriptTitle":"Supplementation with Kluyveromyces marxianus probiotic yeasts in sows and their piglets in early post- weaning: effects in biological and productive parameters","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-12 06:36:40","doi":"10.21203/rs.3.rs-6590564/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1320c1d1-277f-44d3-90b9-0e1bcbc093a6","owner":[],"postedDate":"May 12th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-06-02T13:08:45+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-12 06:36:40","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6590564","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6590564","identity":"rs-6590564","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00