Phenotypic, Molecular Detection, and Antibiogram Analysis of Pseudomonas strain from Oreochromis Niloticus .L 1758 (Nile Tilapia) from aquaculture pond, Ethiopia

Phenotypic, Molecular Detection, and Antibiogram Analysis of Pseudomonas strain from Oreochromis Niloticus .L 1758 (Nile Tilapia) from aquaculture pond, Ethiopia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Phenotypic, Molecular Detection, and Antibiogram Analysis of Pseudomonas strain from Oreochromis Niloticus .L 1758 (Nile Tilapia) from aquaculture pond, Ethiopia Alemu kebede Abdi, NATARAJAN pavanasam, Tesfaye Rufael, Bayeta Senbata, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5023769/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Pseudomonas species (including P. aeruginosa, P. putida, and P. fluorescens) are zoonotic bacterial pathogens that frequently cause disease and significant mortality among both cultured and wild fish worldwide. In Ethiopia, Pseudomonas species have been identified in Sebeta fish ponds and Rift Valley lakes. However, information on the molecular and phenotypic characteristics of Pseudomonas species in Ethiopian aquaculture ponds is limited. To address this gap, a cross-sectional study was conducted from November 2022 to May 2023 in selected aquaculture ponds in Ethiopia. A total of 637 samples were aseptically collected from the muscle, liver, spleen, and kidney of fish in these ponds using purposive sampling methods. The samples were cultured on Pseudomonas base agar with the selective supplement cetriNix (FD029) media and glycerol and subjected to morphological and biochemical tests to isolate and identify Pseudomonas species. The pathogen was isolated from 81 samples, accounting for 12.7% of the total. Among these isolates, 85.6% exhibited virulence traits, such as β-hemolysis on blood agar with 5% sheep blood. Additionally, 75 strains (92.59%) were confirmed using conventional PCR with Pseudomonas-specific primers and an optimized protocol. Among the PCR-positive samples, 8 (10.66%) were identified as P. aeruginosa, 28 (37.63%) as P. putida, and 39 (52%) as P. fluorescens from Nile Tilapia (O. niloticus). Antibiotic susceptibility testing on ten representative isolates showed that all Pseudomonas isolates were susceptible to Ciprofloxacin, Gentamicin, and Ceftriaxone, but resistant to Amoxicillin and Penicillin. The study concludes that Pseudomonas species (including P. aeruginosa, P. putida, and P. fluorescens) strains carrying the virulence gene Psul, which are β-hemolytic and resistant to commonly used antibiotics in human and veterinary medicine, are present in Ethiopian aquaculture. The detection of this pathogen in 75 fish samples is concerning due to the potential for outbreaks and zoonotic transmission. Therefore, further research into the molecular epidemiology of the disease is needed to understand potential inter-host transmission and antibiotic resistance traits. Additionally, public awareness about the risks of consuming undercooked or raw fish meat should be raised. Antibiogram pseudomonas spp. Ethiopia Nile tilapia PCR Aquaculture pond Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 1. Introduction Nile tilapia, Oreochromis niloticus , L is one of the commercially important fast-growing and well-adapted freshwater fish cultivated extensively worldwide (Munguti, et al. 2022). Cultured Nile tilapia is so far the most widespread species in earthen ponds in many countries. Nile tilapia plays an important role in the human diet with an ever-growing need globally 2020 (FAO (2022). Although Nile tilapia is resistant to diseases and suitable for intensive aquaculture, it increases production and makes it an affordable protein source for everyone (Abdel latif, 2020). Nowadays this high protein source is threatened by bacterial diseases especially those caused by drug resistance and highly virulent bacteria such as Pseudomonas spp. (Osman, et al., 2021). However, Bacterial infections in aquaculture hatcheries and farms significantly reduce productivity, posing a challenge to the growth of the aquaculture industry and negatively impacting the environment and public health. This situation greatly hinders both, economic and socioeconomic development in countries that rely on aquaculture and fisheries (Austin, 2007). Pseudomonas spp. are facultative anaerobic, Gram-negative bacteria from the family Pseudomonadaceae . They are found worldwide and have a wide range of hosts, including, both cold-blooded and warm-blooded animals, as well as humans. Pseudomonas is a well-known bacterial pathogen that frequently causes disease and mass mortalities among cultured and wild fishes worldwide (Sarkar, et al., 2021). Pseudomonas aeruginosa has gained increased attention due to pathogenicity to humans and emerged as a foodborne pathogen of extreme importance (Palma, et al., 2020). Pseudomonas putida and P. Fluorescens have been recorded as serious bacterial pathogens of fish and were characterized by causing high mortalities and economic losses among fish farms (Austin & Austin, 2007). High antibiotic resistance is seen in pseudomonas infections (Shbaita, et al 2023) and regarded universally exhibit resistance to Amoxicillin-clavulanate and Ampicillin for quite a long time (Araya Shamble, et al., 2023) in these times, becoming a serious public health concern. In Ethiopia however, less attention has been given to pathogens of fish including those which have zoonotic importance except few isolated cases (Anwar Nuru, et al., 2012). For instance, bacterial and parasitic fish pathogens were surveyed in the Sebeta fish pond (Eshetu Yimer, 2000; Kassa Nebiyu and Marshet, 021). Pseudomonas aeruginosa was reported as the most frequent isolate from Rift Valley Lake and the pathogen was associated with outbreak and mortality (Dissasa, et al., 2022). In Ethiopia, intensive and semi-intensive aquaculture is emerging as a commercial venture. Private investors are increasingly showing interest in fish farming. Additionally, major projects like the Great Renaissance Dam, Gilgal Gibe1, 2, 3 and various other dams and reservoirs are being constructed for irrigation, hydropower generation, and other purposes. These water bodies can also be stocked with diverse fish species, potentially providing a source of income for many young Ethiopians in rural communities engaged in fishing, benefiting from the expansions in aquaculture in the country. Despite the potential contribution of aquaculture and fisheries in the country emerging zoonotic bacterial pathogens like Pseudomonas , bacterial could constrain the productivity and safety of the fish industry in the country. This appeal for a proactive investigation into important pathogens in fish ponds in Ethiopia. Therefore, knowing the infection status and characteristics of Pseudomonas spp . in fish and fish products is paramount to understanding the epidemiology and associated risks to public health. Molecular techniques using PCR-based methods allow fast, sensitive, and exact identification of the bacteria that have been described for the detection of fish diseases; the 16S rDNA gene is one of these important methods, especially when used alongside phenotypic characteristics for microbial identification in the diagnostic laboratory (Buller, (2014). To this end, the present study was intended to isolate and determine the prevalence and antimicrobial sensitivity of pseudomonas infecting tilapia in selected fish ponds in Ethiopia. The specific objectives of the study were to isolate and molecular detection of pseudomonas spp . infection of Nile tilapia to determine the susceptibility of pseudomonas isolates to major antimicrobials of veterinary and human importance and to reveal phenotypic traits and Genotypic of pseudomonas spp. isolates. 2. Materials and Methods National Fisheries and Aquatic Life Research Center (NFALRC) Sebeta, Centre for Aquaculture Research and Education(CARE), Hawassa University, and Batu Fisheries Research Station, Batu were selected as the study sites. Sebeta Fisheries Station is located at 24 km southwest of, Addis Ababa, the capital city of Ethiopia. It is located at 90N, 390 E, and 2200 amsl, characterized by a moderately warm climate with an annual mean temperature of 200C and total annual precipitation of 1200mm. CARE at Hawassa University located in the Sidama Region, South eastern part of Ethiopia (60 33’N ‘300 22’-380 29’) is approximately 278 km south of Addis Ababa, Ethiopia. Batu Aquaculture and Fisheries and Other Aquatic Life Research Center located in the Central Rift Valley of Oromia state(7.90N & 37.7 E) lies 165 km East of Addis Ababa. It has an elevation of 1638 masl. For the study, O. niloticus was collected from all three stations. A cross-sectional study was conducted from December 2022 to May 2023. 2.1.1. Study population The present studies were conducted on O. niloticus having various sizes and weights collected from National Fisheries and Aquatic Life Research Center, Education (CARE), Hawassa University, and Batu Fishery and other aquatic life research centers Aquaculture. Nile Tilapia Were selected based on availability and consumer preference. Sample : A total of 240 Nile tilapia, 80 fish each from National Fisheries and Aquatic Life Research Center (NFALRC), Sebeta; CARE, Hawassa University, and Batu Fishery and Other Aquatic Life Research Center were collected using seine nets with mesh size ranging from 5-6.5 mm. 2.2. Isolation and identification of bacterial pathogens A. Sampling procedure A purposive sampling strategy was followed in selecting fishes. Fish species with suggestive lesions (hemorrhages on the external surface, base of pectoral and tail fin, ulcer on the skin, abdominal distention, unilateral or bilateral exophthalmia, prolapsed anus, and fin rot were selected. Fish were killed and examination of the internal organs were carried out according to the method described by Wu, et al. (2019). Fish sample was collected, and kept in sterile plastic bags plastic bag containing water from the pond (Wu et al., 2019). Where immediately transports laboratories for post-mortem. Muscles, liver, spleen, and kidney of affected Nile tilapia were removed and were kept in to the falcon tube (15ml) containing 5ml of alkaline peptone water pH 8.5 (Oxoid England ) were kept at 4 o c . They were then suitably labelled and were transported to Animal Health institute (AHI) at Sebeta with icebox for further studies. 2.2.1. Isolation of bacterial pathogens Two gram each of muscle tissue, liver, kidney and spleen were taken aseptically and enriched on Tryptone soya broth as per the method described by (Buller, 2014 & Nair et al., 2021 ).The Tryptone soya broth was incubated for 24 hrs at 37°C. A loop-ful enriched homogenate was streaked on to Pseudomonas Agar Base with glycerol and rehydrated by cetriNix supplement (FD 029) incubated for 24 hrs at 37°C. A single colony from each suspected isolate were picked up and re-streaked on a new plate of its perused nutrient agar and re-incubated for 24 hrs at 37°C. Each pure colony from the nutrient agar medium was used as a stock culture for further biochemical identification. 2.2.2. Identification of bacterial pathogens Pseudomonas spp. were identified biochemically to species level based on colony characteristics (colony morphology and arrangement) and staining characteristic and conventional biochemical tests methods (Austin and Austin, 2016).Primary identification of pure culture of the isolates was done based on gram reaction, catalase and oxidase tests according to the procedures described by Duman et al. (2021). Gram Staining was done according to the procedure described by Rowland et al. (2013). Accordingly, gram-negative colonies, short rods were considered for further tests (Walsh, 1996 & Buller, 2014). Pseudomonas spp. were further identified by biochemical characteristics using conventional tests including gram staining of the microorganisms, cytochrome oxidase, catalase, motility, urease, indole, methyl red test, Voges- Proskauer test(MR-VP) and Triple Sugar Iron Agar . The biochemical analyses were conducted in triplicates using by API20E (Buller, 2014). 3. Phenotypic characterization of Pseudomonas spp virulence determinants The isolates pseudomonas bacteria were examined for their hemolytic activity on 5% whole sheep blood with Blood agar medium (sigma). The results are recorded after 24 hours of incubation at 37°C and checked for the type (α or ß) of hemolytic activity. 4. Molecular detection and characterization of Pseudomonas spp 4.1. DNA extraction Genomic DNA was extracted using the DNA extraction kit (DNeasy kit, Qiagen, Germany) following the manufacturer's instructions. Qiagen DNeasy DNA extraction protocol for bacterial cultures adapted from Qiagen DNeasy handbook, 2020. Briefly, 200μl of the sample suspension were incubated at 70°C for 10 min after the addition of 20μl of proteinase K and 200μl (AL) Buffer or lysis buffer by vortexing. Then, 200μl of 100% ethanol were added to the lysate and mixed thoroughly by overtaxing. Washing and centrifugation of the sample was performed following the manufacturer's recommendations. Then, nucleic acid was eluted with 200μl of elution buffer provided in the kit. 4.2. Conventional PCR amplification Pseudomonas spp. PCR was performed using a PCR (Gel Doc TM XR+ Exposure time (sec) 0.086 (Auto – Intense bands with software –version) and the marker used were Ethidium bromide. The Amplification reactions were performed in a reaction mixture of 2.5 µl of PCR volumes buffer (225 µl ) pH 8.4 , 1u Taq polymerase .0.8 µl MgCl2 (15mM) 2.5µl dNTPs (dGTP, dTTP, dATP, and dCTP ) 2mM of each gene primer (F and R), 9.2 µL of RNase-free distilled water and 2µl of genomic DNA template. The PCR program consisted of an initial step at 94 °C for 5 minutes and, followed by 35 cycles of denaturation at 94 °C for 30 second and Annealing at 50°C for 45 second depending on Type of the primer and 72 o c for 45 sec and one final extension cycle of 72 o c for 10 minutes 35cycle. Then the amplified product was running g 1.2 agarose gel electronics, which stained using Ethidium bromide. Primer were designed Two specific primers previously described by Spilker et al.( 2004 ) based on the sequence of the Pseudomonas gene from the strain Pseudomonas sub sp. Pseudomonas species were used(ATCC 27853 , ATTC 17527and ATTC 17574 ). Primer Sequence(5 , 3 , ) Amplified Reference Pseudomonas species 16SrDNA GACGGGTGAGTAATGCCTA(F) 618 bp Spilker et al., 2004 CACTGGTGTTCCTTCCTATA(R) 5. Antiprogram analysis Pseudomonas spp. strains were subjected to antibiotic sensitivity tests using the Kirby-Bauer disc diffusion method (CLSIM45, 2022). For the disc diffusion method, bacteria isolates were inoculated in TSB and incubated at 35ºC for 16-20 h. The turbid broth were cultivated on Muller Hinton agar (Oxoid, CM0405), reaped, and then re-suspended in 0.85 sterilized saline solution and the turbidity was adjusted according to McFarland obesity tube No. 0.5. Isolates were streaked on Muller Hinton agar (Oxoid, CM0337) and disks were placed, incubation was done at 37ºC overnight. The used antibiotics were Amoxicillin-clavulanate (AMC, 30 µg), Penicillin (P, 10µg), Ampicillin (AMP, 10µg), Ceftriaxone (CRO, 30 µg), Gentamicin (CN, 10µg), Streptomycin (S, 10µg), Tetracycline (TE, 30µg), Ciprofloxacin (CIP, 5µg), Trimethoprim Sulfamethoxazole (SXT, 25µg) and Erythromycin (E 15µg). After a period of 18-24 hrs. Incubation, the zones of inhibition were compared and measured according to the manufacturer’s instructions (CLSIM45, 2022). The results were interpreted as sensitive, intermediate, and resistant according to the reference values. The formula below were used to calculate the Multiple Antibiotic Resistance (MAR index) of the present isolates against tested antibiotics. MAR index = X/(Y×Z) Where; X–Total of antibiotic resistance case Y–Total of antibiotics used in the study Z–Total of isolates. When the use of antibiotics is seldom or of low dose use for an animal of treatment, the MAR value is usually equal to or less than 0.2. In contrast, the elevated rate of use or the high risk of exposure to antibiotics for animal treatment was yield a MAR index value that is more than 0.2. 6. Data analysis The bacterial infection status of different fish tissue samples was assessed, and the proportion of infected samples was compared across various categories using the Chi-squared test. The prevalence of bacterial species in fish species, tissue samples, and study areas was analyzed using one-way analysis of variance (ANOVA). Statistical analysis was conducted with IBM SPSS software version 27 (IBM, Chicago, USA), with a significance level set at p<0.05. The overall antibiotic response of each isolate was determined by calculating the number of bacteria that were resistant, intermediate, or sensitive to antibiotics relative to the total number of bacteria isolates tested. 7. Results Clinical examination The clinical examination of the naturally infected O. niloticus showed body depigmentation, corneal opacity, ragged fins and tail, exophthalmia, detachment of scales, body ulceration, and hemorrhages all over the body, especially at fins and tails. In some cases, the infected fish showed erythema around the mouth and swelling in the abdomen. Postmortem examination Postmortem examination showed that the infected fish suffered from splenomegaly, fused gills, enlarged and dark congested kidney, congested liver with distended gall bladder and some cases showed a change in liver color (pale or green) and ascetic fluid watery inconsistent. Bacteriological identification and biochemical characterization of Pseudomonas spp. Based on 14 morphological and biochemical tests, a total of 81 isolates were presumptively identified as Pseudomonas spp. They appeared heterotrophic, motile, Gram-negative rod-shaped bacterium of about 1–5 µm long and 0.5–1.0 µm wide and green-blue pigment, pigment, and non-pigment with a Pseudomonas Agar Base with glyceryl and rehydrated by cetriNix supplement (FD 029) HI media, creamy white on Nutrient agar and grey hemolysis with Blood agar. Colonies were gram-negative short rods that gave a positive reaction for oxidase, catalase, citrate utilization, ferment glucose with production of gas, acid production (Sucrose and Mannitol), and Motile. They gave negative results towards, urea hydrolysis and non-glucose fermenters, indole production, and produced variable results with MR-VP as presented in (Figure 3). Table 1. Distribution of Pseudomonas spp isolates with respect to study area Sources Study area Nile tilapia Hawassa Zipway Sebeta Total Positive 8(10.96 %) 44(23.78 %) 29(7.65 %) 81 Pearson chi- square = 29.3788 Pr = 0.000 The distribution of Pseudomonas species in the study area indicated a higher prevalence in Ziway, with 44 (23.78%), followed by Hawassa with 8 (10.96%) and Sebeta with 29 (7.65%). This distribution was statistically significant (P > 0.000), highlighting Ziway as the most affected area (Table 1). Table 2: Distribution of Pseudomonas spp detection from the organs. Sources of sample from Nile tilapia Organs Isolate of bacteria No. of isolates Liver Spleen Kidney Muscle Ps .putida 28 5 (17.85 %) 1(3.57 % ) 8 (28.57%) 14(50 %), Ps. fluoresces 39 3(9.38 %). 9 (20 %) 11 (27.5 % ) 16 (35%) Ps. Aeruginosa 8 1 (12.5%) 3 (35.5 %) 2 (25 %), 2 (25 %) The distribution of Pseudomonas species across four organs: liver, spleen, kidney, and muscle revealed that P. putida predominated in muscle with 14 (50%), followed by kidney with 8 (28.57%), liver with 5 (17.85%), and spleen with 1 (3.57%). P. fluorescens showed higher prevalence in muscle with 16 (35.0%), followed by kidney with 11 (27.57%), spleen with 9 (20%), and liver with 3 (9.38%). P. aeruginosa was more prevalent in spleen with 3 (35.5%), followed by kidney with 2 (25.0%), muscle with 2 (25.0%), and liver with 1 (12.5%). The distribution did not show statistical significance (P < 0.060). Hemolysis assay Hemolytic activity of Pseudomonas s pp was assessed on a blood agar base with 5% sheep blood. Accordingly, from the present study it was found that 85.71 % (n=7/9) isolates of P. aeruginosa , 77.78 % (n=25/29) P. putida and 86.05 % (n=37/43) P. fluorescens of naturally collected fish show β hemolysis respectively and 22.22 % (n=2/9), 13.79% (n=4/29) and 13.95 % (n=6/43) of isolates show α hemolysis. The hemolysis pattern results in the media displaying clear halos around bacterial colonies as shown in Fig .4. The current study shows that 85.19 % (n=69/81) of Pseudomonas isolates show β hemolysis and only 14.81 % (n=12/81) show α hemolysis. 8. Molecular detection and characterization of Pseudomonas spp Conventional PCR amplification Pseudomonas spp. and virulence gene A total of 81 isolates, 75 (92.59%) of which were Pseudomonas spp , were confirmed through conventional PCR. The finding indicated that this protocol is a highly effective method for extracting DNA from Pseudomonas species ( P. aeruginosa, P. putida, and P. fluorescens ), as evidenced by the substantial amount of genomic DNA obtained, as shown in Figures (5, 6, 7 & 8). Table (3): Antibiotic sensitivity test Antimicrobial disk Conc. Result and interpretation (%) MAR index S I R Amoxicillin-clavulanate AMC, 30 µg 0(0.0%) 0(0.0%) 14(100%) 0.0186 Penicillin P,10µg 0(0.0%) 0(0.0%) 14(100%) 0.0186 Ampicillin AMP, 10µg 0(0.0%) 0(0.0%) 14(100%) 0.0186 Ceftriaxone CRO, 30 µg 0(0.0%) 14(100%) 0(0.0%) 0 Gentamicin CN, 10µg 13(92.9) %) 1(7.1%) 0(0.0%) 0 Streptomycin S, 10µg 14(100%) 0(0.0%) 0(0.0%) 0 Tetracycline TE, 30µg 14(100%) 0(0.0%) 0(0.0%) 0 Ciprofloxacin CIP, 5µg 14(100%) 0(0.0%) 0(0.0%) 0 Trimethoprim Sulfamethoxazole SXT, 25µg 0(0.0%) 0(0.0%) 14(100%) 0.0186 Erythromycin E,5µg 0(0.0%) 3(21.4%) 11(78.6%) 0.0146 Average MAR Index 0.0178 Figure: antibiotic drug sensitivity showed: R: Resistance, I: intermediate and S: Susceptibility (AMC) Amoxicillin-clavulanate, (P)Penicillin , (AMP)Ampicillin, (CRO)Ceftriaxone, (CN) Gentamicin , (S ) Streptomycin, (TE)Tetracycline , (CIP)Ciprofloxacin,(SXT) Trimethoprim Sulfamethoxazole and (E) Erythromycin. 9. Discussion Bacterial diseases are considered the most serious disease problem among freshwater fishes (Pękala-Safińska. (2018). Pseudomonas species are one of the most predominant bacterial fish pathogens that cause extremely fish mortalities and substantial economic losses (Nair, et al .2021). Pseudomonas spp. has gained increased attention due to its pathogenicity to humans and the ubiquity of the organism in the environment, food, and water (Milligan, et al. 2023). Isolation of Pseudomonas spp. from three-aquaculture Nile tilapia along its value chain during the current study adds more evidence for the wide ecological distribution of the bacteria. The clinical sing and postmortem findings observed in the current study of Nile tilapia showed hemorrhages on the external surface of the body, the base of the pectoral and tail fin, ulcers on the skin, abdominal distention, prolapsed anus, and fin rot (Figure 1). Postmortem examination showed that the infected fish suffered from splenomegaly, congestion in gills, enlarged gall bladder, and some cases a liver change in color shows (figure.2). The observed clinical and postmortem findings were nearly similar to those described by (Khalil, et al .2010; Magdy et al ., 2014 and Abd- Eltawab, et al , 2020). The phenotypic and biochemical characteristics of the isolated Pseudomonas species ( P. aeruginosa, P. putida, and P. fluorescens ) matched those outlined in Bergey's Manual of Determinative Bacteriology (Garrity, 2001). Additionally, similar findings were reported with by Algammal et al . (2020), Desissa, et al. (2022), and Dina, et a l. (2023). This study examines O. niloticus fish infected with Pseudomonas spp. pathogens, demonstrating the species' vulnerability to this bacterial disease. The majority of the identified bacterial pathogens were found to originate from the Ziway pond, significantly outnumbering those from the Sebeta and Hawassa ponds (p<0.000), as shown in Table 1. The hemolytic activity of the isolates was determined as a crucial virulence factor. Accordingly, from overall all isolates, 85.19% showed β hemolysis, and only 14.81% shows α hemolysis. These pathogens generate toxins that cause lethality, hemolysis, and entero-toxigenicity, which are common in the primary spoilage microorganisms found in seafood. If fish is consumed without proper cooking, these entero-toxigenic pathogens may lead to human diarrheal outbreaks. For the first time, molecular detection and characterization of isolates using conventional PCR has provided evidence for the presence of the Pseudomonas genus in Pseudomonas spp. infecting fish in Ethiopia. Molecular characterization using conventional PCR confirmed the presence of a specific gene in Pseudomonas spp. infecting fish in Ethiopia. The optimized PCR protocol, targeting this gene, revealed that the adhesin gene was present in 92.59% of P seudomonas species ( including P. aeruginosa, P. fluorescens, and P. putida ) isolated from the samples, aligning with findings by (Ardura et al, 2013& Abd El Aziz (2015). The adhesin gene, a virulence gene coding for a surface protein, facilitates bacterial surface binding, colonization, and host tissue infection. Targeting this gene is crucial for species identification and future research on recombinant adhesin as a potential vaccine against pseudomonads. Among the 75 PCR-positive samples, 8 (10.66%) were P. aeruginosa, 28 (37.63%) were P. putida, and 39 (52%) were P. fluorescens from O. niloticus , with no disease outbreaks reported in any ponds at that time. The current study examined the distribution of Pseudomonas species in various organs of Nile tilapia. It found that Pseudomonas putida was most prevalent in muscle lesions and least in the spleen, while Pseudomonas fluorescens was most common in the kidney and least in the liver. Pseudomonas aeruginosa was predominantly found in the spleen and least in the liver, as shown in Table 2. These results, with the highest prevalence in muscle lesions and lowest in the liver, differ somewhat from the findings reported by Eissa et al. (2010), El-Deen, (2014), El-Kader, and Mousa-Balabe & Atwa (2017) for Oreochromis niloticus. .As explained by Gilda (2001), disease occurrence in fish depends on the pathogen, host, and environment. The 52% detection rate of P. fluorescens aligns with reports from Egypt (Eid et al 2016). Overall, P. fluorescens was the most dominant Pseudomonas pathogen and the most prevalent fish pathogen in ponds, consistent with findings by Akinbowale et al . (2007) and Li et al . (2020). The current investigation into the microbial ecology of Oreochromis niloticus (Nile tilapia) revealed a prevalent presence of bacterial pathogens within this fish species. This finding aligns with previous reports by Meronet et al. (2020) and Desissa et al. (2023), which highlighted the susceptibility of Nile tilapia to a diverse array of potential bacterial pathogenic agents, particularly Gram-negative bacteria such as Pseudomonas spp. and Aeromonas spp. Bacterial pathogens of fish and zoonotic bacteria, including Pseudomonas spp. ( P. fluorescens, P. putida, a nd Pseudomonas aeruginosa) , were recovered from naturally infected fish in aquaculture farms in Ethiopia, consistent with observations in Egypt (Austin and Austin, 2016 and Desissa et al., 2023 ) which reports in Ethiopia. Variations in the prevalence of Pseudomonas species in fish worldwide can be linked to factors such as sampling times and geographic regions (Devarajan et al ., 2017). The differences observed in the current study could be due to the number and size of the fish examined environmental conditions, geographic location, the seasons during which the study was conducted, and the sensitivity and specificity of the methods used for bacterial identification. The conventional PCR amplification of the total DNA obtained (Figure 5) using this protocol proved to be a highly efficient method for extracting DNA from Pseudomonas spp ( P. aeruginosa, P. putida, and P. fluorescens ), resulting in good yields of genomic DNA. In present study, two sets of primers, Ps16S-F and Ps16S-R, were used, and specifically designed for P. aeruginosa, P. putida, and P. fluorescens . These primers target variable regions within the 16S rRNA gene. PCR assays with these primers successfully amplified DNA fragments of the anticipated sizes, as shown in all figures. The 16S rRNA gene sequence has historically served as a valuable tool for bacterial identification and taxonomic classification, contributing significantly to the phylogenetic studies of bacterial species (Church, et al ., 2020 ).The findings indicated that following this protocol resulted in a highly effective method for extracting DNA from Pseudomonas species ( P. aeruginosa, P. putida, and P. fluorescens ), as evidenced by the significant amount of genomic DNA obtained, as shown in all above Figure. The finding inline (khulod et al . (2012) and Dina et al . (2023). The results of antibiotic sensitivity testing for the isolated Pseudomonas spp against 10 commercial antibiotic discs are shows in Table 3. The sensitivity profile revealed that Pseudomonas spp. were generally most sensitive to Ceftriaxone, Ciprofloxacin, Streptomycin, and Tetracycline, followed by Gentamicin (CN, 10 µg, 92.9%). All isolates showed high resistance to Amoxicillin-clavulanate and Ampicillin. Additionally, amoxicillin and penicillin exhibited no bactericidal activity (100% resistance). The multi-antibiotic resistance index was 0.18. The results agree with (El Barbary and Hal, 2016; Eid, et al . 2016: Das et al., 2020) for the Pseudomonas spp. The rise in bacterial infections in fish and antimicrobial resistance (AMR) worldwide poses a significant threat to the sustainability of the fishery and aquaculture sectors 10. Conclusion The pathogen was isolated and identified in 81 samples, with phenotypic assessments showing that 85.19% of the isolates exhibited the virulence trait of ß-hemolysis. Molecular characterization using conventional PCR revealed the presence of the ATCCA genes in 75 (92.59%) of the isolates. Additionally, antimicrobial susceptibility tests on the isolated Pseudomonas spp. strains indicated resistance to amoxicillin-clavulanate, ampicillin, and penicillin. The phenotypic and genotypic analyses provided epidemiological evidence of a virulent Pseudomonas spp. strain spreading among the fish population in Ethiopian ponds. The detection of the pathogen in the hematopoietic organs of the sampled fish population raises concerns about potential outbreaks. The identified Pseudomonas spp. isolates possess virulence traits that aid in colonization, infection, and pathogenicity, along with the ability to resist antibiotics commonly used in human and veterinary medicine. Pseudomonas spp. is an emerging zoonotic pathogen, and fish in ponds and fish products from the National Fisheries and Aquatic Life Research Center (NFALRC) in Sebeta, CARE at Hawassa University, and Batu Fishery and Other Aquatic Life Research Center are potential sources of infection for humans in the area. Declarations Funding This research was partially funded by the Animal Health Institute and the Department of Aquatic Science, Fisheries, and Aquaculture at Hawassa University, Ethiopia. The funding sources did not influence the study design, data collection, analysis, or interpretation, the writing of the report, or the decision to submit the article for publication. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Author Details AKA Animal Health Institute Department of Fish Disease Research desk, and AAM and BS Animal Health Institute Department of Molecular and Bioinformatics Research desk, TRC Animal Health Institute, NP, Hawassa University, Department of Aquatic Sciences, Fisheries and Aquaculture. Ethics approval This dissertation work was conducted following the fish handling and sample collection guidelines established by Hawassa University, College of Natural and Computational Science, in 2023. The study protocol was approved by the Research Ethics Committee of the same institution. Additionally, the fish were euthanized and rendered unconscious during sample collection to ensure animal welfare. The euthanasia procedure followed the "American Veterinary Medical Association Guideline for Euthanasia" published in 2020. The fish were euthanized by transecting the spinal cord behind the skull, as described by Austin (2016) Data Availability The datasets used and analyzed during the current study are available from the corresponding author on reasonable request. References Abd El-Aziz D.M. (2015): Detection of Pseudomonas spp. in chicken and fish sold in markets of Assiut City, Egypt. Journal of food Quality Hazards Control 2: 86-89. Abdel-latif .H.M.R. (2020). Natural co-infection of cultured Nile tilapia Oreochromis niloticus with Aeromonas hydrophila and Gyrodactylus cichlidarum experiencing high mortality during summer. Aquac Res.; 1(1):1–13. Akinbowale, A.L., Peng, H., Grant, P.and Barton, M.D., 2007. Antibioticand heavy metal resistance in motile aeromonads and pseudomonads from rainbow trout (Oncorhynchus mykiss) farms in Australia. International Journal of Antimicrobial Agents, 30(1), 177-182. Araya, S., Gebreyohannes, Z., Tadlo, G., Gessew, G. T., & Negesso, A. E. (2023). Epidemiology and multidrug resistance of Pseudomonas aeruginosa and Acinetobacter baumanni isolated from clinical samples in Ethiopia. Infection and Drug Resistance, 2765-2773. Ardura, Alba, Ana R. Linde, and Eva Garcia-Vazquez. (2013). "Genetic Detection of Pseudomonas spp. in Commercial Amazonian Fish" International Journal of Environmental Research and Public Health 10, no. 9: 3954-3966. https://doi.org/10.3390/ijerph10093954 Austin B, Austin DA (2007) Bacterial fish pathogens, diseases of farmed and wild fish. (4th edn), Praxis Publishing Ltd, Chichester, UK. Austin. B, Austin, D. A. (2016). Bacterial Fish Pathogens. Bacterial Fish Pathogens. 124–156 p. Buller NB (2014). Bacteria from fish and other aquatic animals: A practical identification manual. CABI Publishing, Oxford shire, UK. Church, D. L., Cerutti, L., Gürtler, A., Griener, T., Zelazny, A., & Emler, S. (2020). Performance and application of 16S rRNA gene cycle sequencing for routine identification of bacteria in the clinical microbiology laboratory. Clinical microbiology reviews, 33(4), 10-1128. CLSIM45. M100 Performance Standards for Antimicrobial. 2022. 48–52 p. Das, S., Azad, M., Bimal, K., & Oraon, V. (2020). Antimicrobial Susceptibility Pattern of Pseudomonas aeruginosa with Special Reference to ESBL Producers from Various Clinical Samples at a Tertiary Care Center in Bihar. International Journal of Research and Review, 7(1). Devarajan, N., Köhler, T., Sivalingam, P., van Delden, C., Mulaji, C. K., Mpiana, P. T., & Poté, J. (2017). Antibiotic resistant Pseudomonas spp. in the aquatic environment: a prevalence study under tropical and temperate climate conditions. Water research, 115, 256-265. Dissasa, Guta, Brook Lemma, and Hassen Mamo (2022). "Isolation and Identification of major bacteria from three Ethiopian rift valley lakes live and processed fish, and water samples: Implications in sanitary system of fish products." Duman, M., Mulet, M., Altun, S., Saticioglu, I. B., Ozdemir, B., Ajmi, N... & García-Valdés, E. (2021). The diversity of Pseudomonas species isolated from fish farms in Turkey. Aquaculture, 535, 736369. Eid, Hamza, Azza El Tabiy, and Sara Fathy. (2016) "Prevalence and molecular characterization of Pseudomonas species isolated from fish markets in port-said." Suez Canal Veterinary Medical Journal. SCVMJ 21.1: 1-12. Eissa, N. M. E., El-Ghiet, E. A., Shaheen, A. A., & Abbass, A. (2010). Characterization of Pseudomonas species isolated from tilapia “Oreochromis niloticus” in Qaroun and Wadi-El-Rayan lakes, Egypt. Global Veterinaria, 5(2), 116-121. EL-Deen, A. G. S. 2014. Role of nigella sativa in decreasing mortalities in Nile tilapia caused by Pseudomonas septicemia. Assiut.Vet. Med. J. 60 (142): 89-94. El-Kader, M. F. A., and Tarek Mahmoud Mousa-Balabel. (2017) "Isolation and molecular characterization of some bacteria implicated in the seasonal summer mortalities of farm-raised Oreochromis niloticus at Kafr El-Sheikh and Dakahlia Governorates." Alexandria Journal of Veterinary Sciences 53.2: 107-113. Eshetu .Y (2000). Preliminary survey of parasites and bacterial pathogens of sh at Lake Ziway. Ethiop J Sci.; 23: 25–33. FAO (2022). The State of World Fisheries and Aquaculture. Contributing to food security and nutrition for all. Khalil, S. A.; Khalil, R. H.; Saad, T.T. and Safaa, M. H. (2010): Studies on Pseudomonas Septicemia among Cultured Oreochromis niloticus, Journal of the Arabian aquaculture society, vol. 5 no 1. Li, X. M., Zhu, Y. J., Ringø, E., & Yang, D. (2020). Prevalence of Aeromonas hydrophila and Pseudomonas fluorescens and factors influencing them in different freshwater fish ponds. Iranian Journal of Fisheries Sciences, 19(1), 111-124. Magdy, I., El-Hady, M., Ahmed, H., Elmeadawy, S. & Kenwy, A (2014). A contribution on Pseudomonas aeruginosa infection in African catfish (Clarias gariepinus). Res. J. Pharm. Biol. Chem. Sci. 5, 575–588. Milligan, E. G., Calarco, J., Davis, B. C., Keenum, I. M., Liguori, K., Pruden, A., & Harwood, V. J. (2023). A systematic review of culture-based methods for monitoring antibiotic-resistant Acinetobacter, Aeromonas, and Pseudomonas as environmentally relevant pathogens in wastewater and surface water. Current Environmental Health Reports, 10(2), 154-171. Munguti, J. M., Nairuti, R., Iteba, J. O., Obiero, K. O., Kyule, D., Opiyo, M. A. & Ogello, E. O. (2022). Nile tilapia (Oreochromis niloticus Linnaeus, 1758) culture in Kenya: Emerging production technologies and socio‐economic impacts on local livelihoods. Aquaculture, Fish and Fisheries, 2(4): 265-276. Nair, S. G., Lipton, A., De los Ríos-Escalante, P., & Ibáñez-Arancibia, E. (2021). Isolation and characterization of bacterial pathogens, Pseudomonas aeruginosa and Enterobacter cloacae from the moribund fish, Etroplus maculatus. J. Mater. Environ. Sci, 12, 1332-1349. Kassa, Nebyu, and A. M. Mitiku. "Bacterial flora of Nile tilapia of pond fish and their relationship with predisposing factors." Int J Adv Res Biol Sci 8.6 (2021): 186-197. Anwar Nuru, B. M., & Yimer, E. (2012). Occurrence and distribution of bacterial pathogens of fish in the southern gulf of Lake Tana, Bahir Dar, Ethiopia. Proteus (p.), 2, 2-4. Osman, K. M., da Silva Pires, Á., Franco, O. L., Saad, A., Hamed, M., Naim, H., ... & Elbehiry, A. (2021). Nile tilapia (Oreochromis niloticus) as an aquatic vector for Pseudomonas species of medical importance: Antibiotic Resistance Association with Biofilm Formation, Quorum Sensing and Virulence. Aquaculture, 532, 736068. Palma, E., Tilocca, B., & Roncada, P. (2020). Antimicrobial resistance in veterinary medicine: An overview. International Journal of Molecular Sciences, 21(6) 1914. Pękala-Safińska, Agnieszka (2018)."Contemporary threats of bacterial infections in freshwater fish." Journal of veterinary research 62.3: 261-267. Sarkar. P. Issac, P. K., Raju, S. V., Elumalai, P., Arshad, A., & Arockiaraj, J. (2021). Pathogenic bacterial toxins and virulence influences in cultivable fish. Aquaculture Research, 52(6), 2361-2376. Shbaita, S., Abatli, S., Sweileh, M. W., Aiesh, B. M., Sabateen, A., Salameh, H. T. & Zyoud, S. E. H. (2023). Antibiotic resistance profiles and associated factors of Pseudomonas Infections among patients admitted to large tertiary care hospital from a developing country. Antimicrobial Resistance & Infection Control, 12(1): 1-12. Spilker, T., Coenye, T., Vandamme, P., & LiPuma, J. J. (2004): PCR-based assay for differentiation of Pseudomonas aeruginosa from other Pseudomonas species recovered from cystic fibrosis patients. Journal of clinical microbiology, 42(5): 2074-2079. Wu C-J, Ko W-C, Lee N-Y, Su S-L, Li C-W. crossm. Am Soc Microbiol. 2019; 85(21):1–12. Additional Declarations No competing interests reported. Supplementary Files PseudomonasAlemu6180samples2024060616hr01minmerged.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5023769","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":350312445,"identity":"bbafa936-db55-4c0a-b34e-34373665ee15","order_by":0,"name":"Alemu kebede Abdi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBklEQVRIiWNgGAWjYDACdhBRYWPAIMEARBVADjNzA34tzCDiTBpUyxmQCCMRWhjbDkO0MLaBhAho4W9mPrqZh43ZmF+6+eCNj/Nqo/nbgVp+VGzDqUXiMFvabR4eNjPJOceSLWduO5474zBjA2PPmdu4rTnMY3abR4LHxuBGjpk077ZjuQ1ALcyMbbi1yB/m/3abx0DCxv5G/jfpv3OO5c4npMXgMA/bbZ4EAzMDiRw2acaGmtwNhLQYHmYzuznnQIKxxJ1jxpY9xw7kbgRqOYjPL3LHm5/dePvvv2H/7OaHN37U1OXOO3/44IMfFXi8jwYOg8kDRKsHgjpSFI+CUTAKRsEIAQBYjFwz9WDohQAAAABJRU5ErkJggg==","orcid":"","institution":"Animal Health Institute, Sebeta, Ethiopia","correspondingAuthor":true,"prefix":"","firstName":"Alemu","middleName":"kebede","lastName":"Abdi","suffix":""},{"id":350312446,"identity":"d1b26345-76aa-423c-be7d-aa4451120faf","order_by":1,"name":"NATARAJAN pavanasam","email":"","orcid":"","institution":"Hawassa University, Hawassa city ,Ethiopia","correspondingAuthor":false,"prefix":"","firstName":"NATARAJAN","middleName":"","lastName":"pavanasam","suffix":""},{"id":350312447,"identity":"d4148e94-a975-4069-89cd-75e02d6d9f1f","order_by":2,"name":"Tesfaye Rufael","email":"","orcid":"","institution":"Animal Health Institute, Sebeta, Ethiopia","correspondingAuthor":false,"prefix":"","firstName":"Tesfaye","middleName":"","lastName":"Rufael","suffix":""},{"id":350312448,"identity":"d7aa5f1e-e376-4a2e-9352-1b86831ff4ce","order_by":3,"name":"Bayeta Senbata","email":"","orcid":"","institution":"Animal Health Institute, Sebeta, Ethiopia","correspondingAuthor":false,"prefix":"","firstName":"Bayeta","middleName":"","lastName":"Senbata","suffix":""},{"id":350312449,"identity":"1a2d07f4-712a-4ee6-9b4a-a71a60ae1517","order_by":4,"name":"Abde Aliy Mohamed","email":"","orcid":"","institution":"Animal Health Institute, Sebeta, Ethiopia","correspondingAuthor":false,"prefix":"","firstName":"Abde","middleName":"Aliy","lastName":"Mohamed","suffix":""}],"badges":[],"createdAt":"2024-09-03 09:31:47","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5023769/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5023769/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":64156848,"identity":"b04d42bd-a15c-407b-baac-78e4daf53758","added_by":"auto","created_at":"2024-09-09 05:40:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":730198,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eClinical Symptoms Apparently health of Nile tilapia\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5023769/v1/33623f3db2ff92b082813765.png"},{"id":64156849,"identity":"92b2ba1e-888d-4598-841b-244e66f826d1","added_by":"auto","created_at":"2024-09-09 05:40:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":363864,"visible":true,"origin":"","legend":"\u003cp\u003ePostmortem symptoms of Nile Tilapia\u003c/p\u003e\n\u003cp\u003eE. Gall bladder enlargement, yellowish liver, empty intestine, (D) enlarged and kidney tubular congestion, fused gills and ascetic fluid accumulation.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5023769/v1/d6048c6ff110fbb54949ade1.png"},{"id":64156857,"identity":"f6bf4977-8ba3-4fc9-99b4-175e6d949e5d","added_by":"auto","created_at":"2024-09-09 05:40:52","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":365749,"visible":true,"origin":"","legend":"\u003cp\u003eA. Pseudomonas base agar B. Nutrient Agar \u0026nbsp;\u0026nbsp;C. Blood Agar\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5023769/v1/af1686e15ff0d0241aab021f.png"},{"id":64157277,"identity":"d1783675-8f3f-40a6-b808-ece5206e09e8","added_by":"auto","created_at":"2024-09-09 05:56:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":402076,"visible":true,"origin":"","legend":"\u003cp\u003eHemolysis Assay\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5023769/v1/aa1a527ebab7f7825be13fe9.png"},{"id":64156858,"identity":"8ee48f91-d93d-4af6-be37-6e051616429a","added_by":"auto","created_at":"2024-09-09 05:40:52","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":257202,"visible":true,"origin":"","legend":"\u003cp\u003eGel electrophoresis of a specific gene of \u003cem\u003epseudomonas\u003c/em\u003espp (\u003cem\u003eP. aeruginosa, P .putida, and P. fluoresences)\u003c/em\u003e(16Sr RAN); Lane L: 100-1000 bp DNA Ladder; P: Positive control (at 618 bp.); N: Negative control; Lane (1-10): Represent positive P. aeruginosa \u003cem\u003eP.putida and P.fluoresences\u003c/em\u003e, isolates for 16SrRAN gene.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5023769/v1/48a537dd9bedb94d0ea03fe5.png"},{"id":64157728,"identity":"04c0d5ff-01e3-485f-8446-04830828f71b","added_by":"auto","created_at":"2024-09-09 06:04:51","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":233734,"visible":true,"origin":"","legend":"\u003cp\u003eGel electrophoresis of specific gene of pseudomonas spp (\u003cem\u003eP. aeruginosa, P. putida \u003c/em\u003eand \u003cem\u003eP.fluoresences) \u003c/em\u003e(16SrRNA); Lane L: 100-1000 bp DNA Ladder; P: Positive control (at 618 bp.); N: Negative control; Lane (1-10): lane, 7 \u0026amp; 8 were showed negative and Representatives positive are \u003cem\u003eP. aeruginosa P. putida \u003c/em\u003eand \u003cem\u003eP.fluoresences\u003c/em\u003e, isolates for 16Sr RNA gene.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5023769/v1/53e26bed8faa615396c8d279.png"},{"id":64156859,"identity":"ddbc5a9b-648b-439f-b32f-aa3c23ddab65","added_by":"auto","created_at":"2024-09-09 05:40:52","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":297704,"visible":true,"origin":"","legend":"\u003cp\u003eGel electrophoresis of a specific gene of pseudomonas spp (\u003cem\u003eP. aeruginosa, P. putida \u003c/em\u003eand \u003cem\u003eP.fluoresences)\u003c/em\u003e(16SrRNA); Lane L: 100-1000 bp DNA Ladder; P: Positive control (at 618 bp.); N: Negative control; Lane (1-10): lane, 23 \u0026amp; 31 were showed negative and Representatives positive are \u003cem\u003eP. aeruginosa P.putida \u003c/em\u003eand \u003cem\u003eP.fluoresences,\u003c/em\u003eisolates for 16SrRNA gene.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5023769/v1/95f6512327a78e473c97c72b.png"},{"id":64156852,"identity":"dea12aa9-be3e-43ee-932d-9a3bf1da4a15","added_by":"auto","created_at":"2024-09-09 05:40:51","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":292271,"visible":true,"origin":"","legend":"\u003cp\u003edisplays gel electrophoresis results of a specific gene from Pseudomonas species \u003cem\u003e(P. aeruginosa, P. putida, \u003c/em\u003eand\u003cem\u003e P. fluorescens)\u003c/em\u003e (16SrRNA). Lane L shows a 100-1000 bp DNA ladder, with lane P indicating the positive control at 618 bp, and lane N representing the negative control. Lanes 1 to 10 show positive isolates of P. aeruginosa, P. putida, and P. fluorescens for the 16SrRNA gene, while lanes 65, 75, and 81 showed negative results.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-5023769/v1/883c1ed9ddf5462e24d59c9e.png"},{"id":64158110,"identity":"9e281b03-184a-4680-91a3-caa41dddb724","added_by":"auto","created_at":"2024-09-09 06:12:51","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":279277,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 5 depicts gel electrophoresis results showing a specific gene of Pseudomonas species (\u003cem\u003eP. aeruginosa, P. putida, and P. fluorescens)\u003c/em\u003e (16Sr RNA). Lane L displays a 100-1000 bp DNA ladder, with lane P indicating the positive control at 618 bp. Lane N represents the negative control. Lanes 1 to 10 show positive isolates of P. aeruginosa, P. putida, and P. fluorescens for the 16Sr RNA gene.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-5023769/v1/7b18bd54b1823eae78dcfbce.png"},{"id":64157279,"identity":"17b65810-5b0b-448e-b954-451d086c9ae6","added_by":"auto","created_at":"2024-09-09 05:56:51","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":211298,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 8 displays gel electrophoresis results of a specific gene from Pseudomonas species (\u003cem\u003eP. aeruginosa, P. putida, and P. fluorescens\u003c/em\u003e) (16SrRNA). Lane L shows a 100-1000 bp DNA ladder, with lane P indicating the positive control at 618 bp, and lane N representing the negative control. Lanes 1 to 10 show positive isolates of P. aeruginosa, P. putida, and P. fluorescens for the 16SrRNA gene, while lanes 65, 75, and 81 showed negative results.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-5023769/v1/c69fb47eef0767718e776364.png"},{"id":64776192,"identity":"8bd5e7bb-0fae-4530-a723-8da30942b96b","added_by":"auto","created_at":"2024-09-18 16:45:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4676645,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5023769/v1/3c480b1e-bd59-4618-b04f-ac2ec1594c87.pdf"},{"id":64157278,"identity":"b64763c9-567e-4fbf-9b66-20f4b9cac61e","added_by":"auto","created_at":"2024-09-09 05:56:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1798626,"visible":true,"origin":"","legend":"","description":"","filename":"PseudomonasAlemu6180samples2024060616hr01minmerged.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5023769/v1/e26c035c9b9d14a0235936ea.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Phenotypic, Molecular Detection, and Antibiogram Analysis of Pseudomonas strain from Oreochromis Niloticus .L 1758 (Nile Tilapia) from aquaculture pond, Ethiopia","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eNile tilapia,\u003cem\u003e\u0026nbsp;Oreochromis niloticus\u003c/em\u003e,\u003cem\u003e\u0026nbsp;L\u0026nbsp;\u003c/em\u003eis one of the commercially important fast-growing and well-adapted freshwater fish cultivated extensively worldwide (Munguti, et al. 2022). Cultured Nile tilapia is so far the most widespread species in earthen ponds in many countries. \u0026nbsp; Nile tilapia plays an important role in the human diet with an ever-growing need globally 2020 (FAO (2022). Although Nile tilapia is resistant to diseases and suitable for intensive aquaculture,\u0026nbsp;it increases production and makes it an affordable protein source for everyone (Abdel latif, 2020).\u0026nbsp;Nowadays this high protein source is threatened by bacterial diseases especially those caused by drug resistance and highly virulent bacteria such as Pseudomonas spp. (Osman, \u003cem\u003eet al.,\u003c/em\u003e 2021). However, Bacterial infections in aquaculture hatcheries and farms significantly reduce productivity, posing a challenge to the growth of the aquaculture industry and negatively impacting the environment and public health. This situation greatly hinders both, economic and socioeconomic development in countries that rely on aquaculture and fisheries (Austin, 2007).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePseudomonas\u0026nbsp;\u003c/em\u003espp. are facultative anaerobic, Gram-negative bacteria from the family \u003cem\u003ePseudomonadaceae\u003c/em\u003e. They are found worldwide and have a wide range of hosts, including, both cold-blooded and warm-blooded animals, as well as humans. Pseudomonas is a well-known bacterial pathogen that frequently causes disease and mass mortalities among cultured and wild fishes worldwide (Sarkar, \u003cem\u003eet al.,\u003c/em\u003e 2021). \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e has gained increased attention due to pathogenicity to humans and emerged as a foodborne pathogen of extreme importance (Palma, et al., 2020). \u003cem\u003ePseudomonas putida and P. \u0026nbsp;Fluorescens\u003c/em\u003e have been recorded as serious bacterial pathogens of fish and were characterized by causing high mortalities and economic losses among fish farms (Austin \u0026amp; Austin, 2007). High antibiotic resistance is seen in pseudomonas infections (Shbaita, et al 2023) and regarded universally exhibit resistance to Amoxicillin-clavulanate and Ampicillin for quite a long time (Araya Shamble, et al., 2023) in these times, becoming a serious public health concern. In Ethiopia however, less attention has been given to pathogens of fish including those which have zoonotic importance except few isolated cases (Anwar Nuru, et al., 2012). For instance, bacterial and parasitic fish pathogens were surveyed in the Sebeta fish pond (Eshetu Yimer, 2000; Kassa Nebiyu and Marshet, 021). Pseudomonas aeruginosa was reported as the most frequent isolate from Rift Valley Lake and the pathogen was associated with outbreak and mortality (Dissasa, et al., 2022).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn Ethiopia, intensive and semi-intensive aquaculture is emerging as a commercial venture. Private investors are increasingly showing interest in fish farming. Additionally, major projects like the Great Renaissance Dam, Gilgal Gibe1, 2, 3 and various other dams and reservoirs are being constructed for irrigation, hydropower generation, and other purposes. These water bodies can also be stocked with diverse fish species, potentially providing a source of income for many young Ethiopians in rural communities engaged in fishing, benefiting from the expansions in aquaculture in the country. \u0026nbsp; Despite the potential contribution of aquaculture and fisheries in the country emerging zoonotic bacterial pathogens like \u003cem\u003ePseudomonas\u003c/em\u003e, bacterial could constrain the productivity and safety of the fish industry in the country. This appeal for a proactive investigation into important pathogens in fish ponds in Ethiopia. Therefore, knowing the infection status and characteristics of \u003cem\u003ePseudomonas\u003c/em\u003e spp\u003cem\u003e.\u003c/em\u003e in fish and fish products is paramount to understanding the epidemiology and associated risks to public health. Molecular techniques using PCR-based methods allow fast, sensitive, and exact identification of the bacteria that have been \u0026nbsp; described for the detection of fish diseases; the 16S rDNA gene is one of these important methods, especially when used alongside phenotypic characteristics for microbial identification in the diagnostic laboratory (Buller, (2014). To this end, the present study was intended to isolate and determine the prevalence and antimicrobial sensitivity of \u003cem\u003epseudomonas\u003c/em\u003e infecting tilapia in selected fish ponds in Ethiopia. The specific objectives of the study were to isolate and molecular detection of \u003cem\u003epseudomonas\u0026nbsp;\u003c/em\u003espp\u003cem\u003e.\u003c/em\u003e infection of Nile tilapia to determine the susceptibility of \u003cem\u003epseudomonas\u003c/em\u003e isolates to major antimicrobials of veterinary and human importance and to reveal phenotypic traits and Genotypic of \u003cem\u003epseudomonas spp.\u003c/em\u003e isolates.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cp\u003eNational Fisheries and Aquatic Life Research Center (NFALRC) Sebeta, Centre for Aquaculture Research and Education(CARE), Hawassa University, and Batu Fisheries Research Station, Batu were selected as the study sites. Sebeta Fisheries Station is located at 24 km southwest of, Addis Ababa, the capital city of Ethiopia. It is located at 90N, 390 E, and \u0026nbsp;2200 amsl, \u0026nbsp; characterized by a moderately warm climate with an annual mean temperature of 200C and total annual precipitation of 1200mm. CARE at \u0026nbsp;Hawassa University located in the Sidama Region, South eastern part of Ethiopia (60 33\u0026rsquo;N \u0026lsquo;300 22\u0026rsquo;-380 29\u0026rsquo;) \u0026nbsp;is approximately 278 km south of Addis Ababa, Ethiopia. Batu Aquaculture and Fisheries and Other Aquatic Life Research Center located in the Central Rift Valley of Oromia state(7.90N \u0026amp; 37.7 E) \u0026nbsp;lies 165 km East of \u0026nbsp;Addis Ababa. \u0026nbsp; It has an elevation of 1638 masl. For the study, \u003cem\u003eO. niloticus\u003c/em\u003e was collected from all three stations. A cross-sectional study was conducted from December 2022 to May 2023.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.1.1. Study population\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe present studies were conducted on \u003cem\u003eO. niloticus\u003c/em\u003e having various sizes and weights collected from National Fisheries and Aquatic Life Research Center, Education (CARE), Hawassa University, and Batu Fishery and other aquatic life research centers Aquaculture. Nile Tilapia Were selected based on availability and consumer preference.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSample\u003c/strong\u003e: A total of 240 Nile tilapia, 80 fish each from National Fisheries and Aquatic Life Research Center (NFALRC), Sebeta; CARE, Hawassa University, and Batu Fishery and Other Aquatic Life Research Center were collected using seine nets with mesh size ranging from 5-6.5 mm.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2. Isolation and identification of bacterial pathogens\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Sampling procedure \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA purposive sampling strategy was followed in selecting fishes. Fish species with suggestive lesions (hemorrhages on the external surface, \u0026nbsp;base of pectoral and tail fin, ulcer on the skin, abdominal distention, unilateral or bilateral exophthalmia, prolapsed anus, and fin rot were selected. Fish were killed and examination of the internal organs were carried out according to the method described by Wu, et al. (2019). Fish sample was collected, and kept in sterile plastic bags plastic bag containing water from the pond (Wu et al., 2019). Where immediately transports laboratories for post-mortem. \u0026nbsp;Muscles, liver, spleen, and kidney of affected Nile tilapia were removed and were kept in to the falcon tube (15ml) containing 5ml of alkaline peptone water pH \u0026nbsp;8.5 (Oxoid England ) were \u0026nbsp;kept at 4\u003csup\u003eo\u003c/sup\u003ec . They were then suitably labelled and were transported to Animal Health institute (AHI) at Sebeta with icebox for further studies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.1. Isolation of bacterial pathogens \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwo \u0026nbsp;gram each of muscle tissue, liver, kidney and spleen were taken aseptically and enriched on \u0026nbsp;Tryptone soya broth as per the method described by (Buller, \u0026nbsp;2014 \u0026amp; Nair et al., 2021 ).The Tryptone soya broth was incubated for 24 hrs at 37\u0026deg;C. A loop-ful enriched homogenate was streaked on to Pseudomonas Agar Base with glycerol and rehydrated by cetriNix supplement (FD 029) incubated for 24 hrs at 37\u0026deg;C. A single colony from each suspected isolate were picked up and re-streaked on a new plate of its perused nutrient agar and re-incubated for 24 hrs at 37\u0026deg;C. Each pure colony from the nutrient agar medium was used as a stock culture for further biochemical identification.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.2. Identification of bacterial pathogens\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePseudomonas spp. were identified biochemically to species level based on colony \u0026nbsp;characteristics (colony morphology and arrangement) and \u0026nbsp;staining \u0026nbsp;characteristic and conventional \u0026nbsp;biochemical tests methods (Austin and Austin, 2016).Primary identification of pure culture of the isolates was done based on gram reaction, catalase and oxidase tests according to the procedures described by Duman et al. (2021). Gram Staining was done according to the procedure described by Rowland et al. (2013). Accordingly, gram-negative colonies, short rods were considered for further tests (Walsh, 1996 \u0026amp; Buller, 2014). Pseudomonas spp. were further identified by biochemical characteristics using conventional tests including gram staining of the microorganisms, cytochrome oxidase, catalase, motility, urease, indole, methyl red test, Voges- Proskauer test(MR-VP) and Triple Sugar Iron Agar . The biochemical analyses were conducted in triplicates using by API20E (Buller, 2014). \u0026nbsp;\u003c/p\u003e"},{"header":"3. Phenotypic characterization of Pseudomonas spp virulence determinants ","content":"\u003cp\u003eThe isolates pseudomonas bacteria were examined for their hemolytic activity on 5% whole sheep blood with Blood agar medium (sigma). \u0026nbsp;The results are \u0026nbsp; recorded after 24 hours of incubation at 37\u0026deg;C and checked for the type (\u0026alpha; \u0026nbsp;or \u0026szlig;) of hemolytic activity.\u003c/p\u003e"},{"header":"4. Molecular detection and characterization of Pseudomonas spp","content":"\u003cp\u003e\u003cstrong\u003e4.1. DNA extraction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenomic DNA was extracted using the DNA extraction kit (DNeasy kit, Qiagen, Germany) following the manufacturer\u0026apos;s instructions. Qiagen DNeasy DNA extraction protocol for bacterial cultures adapted from Qiagen DNeasy handbook, 2020. Briefly, 200\u0026mu;l of the sample suspension were incubated at 70\u0026deg;C for 10 min after the addition of 20\u0026mu;l of proteinase K and 200\u0026mu;l (AL) Buffer or lysis buffer by vortexing. Then, 200\u0026mu;l of 100% ethanol were added to the lysate and mixed thoroughly by overtaxing. Washing and centrifugation of the sample was performed following the manufacturer\u0026apos;s recommendations. Then, nucleic acid was eluted with 200\u0026mu;l of elution buffer provided in the kit.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.2. Conventional PCR amplification Pseudomonas spp.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePCR was performed using a PCR (Gel Doc \u003csup\u003eTM\u003c/sup\u003e XR+ Exposure time (sec) 0.086 (Auto \u0026ndash; Intense bands with software \u0026ndash;version) and the marker used were Ethidium bromide. The \u0026nbsp;Amplification reactions were performed in a reaction mixture of 2.5 \u0026micro;l of PCR volumes buffer (225 \u0026micro;l ) pH 8.4 , 1u Taq polymerase .0.8 \u0026micro;l \u0026nbsp;MgCl2 (15mM) 2.5\u0026micro;l \u0026nbsp;dNTPs (dGTP, dTTP, dATP, and dCTP ) \u0026nbsp;2mM of each gene primer \u0026nbsp;(F and R), \u0026nbsp;9.2 \u0026nbsp;\u0026micro;L of RNase-free distilled water and 2\u0026micro;l of genomic DNA template. The PCR program consisted of an initial step at 94 \u0026deg;C for 5 minutes and, followed by 35 cycles of denaturation at 94 \u0026deg;C for 30 second and Annealing at 50\u0026deg;C for \u0026nbsp;45 second depending on Type of the primer and \u0026nbsp; 72\u003csup\u003eo\u003c/sup\u003ec for 45 sec and one final extension cycle of 72\u003csup\u003eo\u003c/sup\u003ec for 10 minutes 35cycle. Then the amplified product was running g 1.2 agarose gel \u0026nbsp; electronics, which stained using Ethidium bromide.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimer were designed\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwo specific primers previously described by Spilker et al.( 2004 ) based on the sequence of the Pseudomonas gene from the strain Pseudomonas sub sp. Pseudomonas species were \u0026nbsp;used(ATCC 27853 , ATTC 17527and ATTC 17574 ).\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.29210134128167%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.046199701937404%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;Sequence(5\u003csup\u003e,\u0026nbsp;\u003c/sup\u003e\u0026nbsp; \u0026nbsp;3\u003csup\u003e,\u003c/sup\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.263785394932937%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAmplified\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.39791356184799%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReference\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.29210134128167%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003ePseudomonas\u0026nbsp;\u003c/em\u003especies 16SrDNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.046199701937404%\" valign=\"top\"\u003e\n \u003cp\u003eGACGGGTGAGTAATGCCTA(F)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.263785394932937%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e618 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.39791356184799%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eSpilker et al., 2004\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" valign=\"top\"\u003e\n \u003cp\u003eCACTGGTGTTCCTTCCTATA(R)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"5. Antiprogram analysis","content":"\u003cp\u003ePseudomonas spp. strains were \u0026nbsp; subjected to antibiotic sensitivity tests using the Kirby-Bauer disc diffusion method (CLSIM45, 2022). For the disc diffusion method, bacteria isolates were inoculated in TSB and incubated at 35\u0026ordm;C for 16-20 h. The turbid broth were cultivated on Muller Hinton agar (Oxoid, CM0405), reaped, and then re-suspended in 0.85 sterilized saline solution and the turbidity was adjusted according to McFarland obesity tube No. 0.5. Isolates were streaked on Muller Hinton agar (Oxoid, CM0337) and disks were placed, incubation was done at 37\u0026ordm;C overnight. The used antibiotics were Amoxicillin-clavulanate (AMC, 30 \u0026micro;g), Penicillin (P, 10\u0026micro;g), Ampicillin (AMP, 10\u0026micro;g), Ceftriaxone (CRO, 30 \u0026micro;g), Gentamicin (CN, 10\u0026micro;g), Streptomycin (S, 10\u0026micro;g), Tetracycline (TE, 30\u0026micro;g), Ciprofloxacin (CIP, 5\u0026micro;g), Trimethoprim Sulfamethoxazole (SXT, 25\u0026micro;g) and Erythromycin (E 15\u0026micro;g). After a period of 18-24 hrs. Incubation, the zones of inhibition were compared and measured according to the manufacturer\u0026rsquo;s instructions (CLSIM45, 2022). The results were interpreted as sensitive, intermediate, and resistant according to the reference values. The formula below were used to calculate the Multiple Antibiotic Resistance (MAR index) of the present isolates against tested antibiotics.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMAR index = X/(Y\u0026times;Z)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWhere; X\u0026ndash;Total of antibiotic resistance case \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eY\u0026ndash;Total of antibiotics used in the study \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eZ\u0026ndash;Total of isolates. When the use of antibiotics is seldom or of low dose use for an animal of treatment, the MAR value is usually equal to or less than 0.2. In contrast, the elevated rate of use or the high risk of exposure to antibiotics for animal treatment was yield a MAR index value that is more than 0.2.\u003c/p\u003e"},{"header":"6. Data analysis","content":"\u003cp\u003eThe bacterial infection status of different fish tissue samples was assessed, and the proportion of infected samples was compared across various categories using the Chi-squared test. The prevalence of bacterial species in fish species, tissue samples, and study areas was analyzed using one-way analysis of variance (ANOVA). Statistical analysis was conducted with IBM SPSS software version 27 (IBM, Chicago, USA), with a significance level set at p\u0026lt;0.05. The overall antibiotic response of each isolate was determined by calculating the number of bacteria that were resistant, intermediate, or sensitive to antibiotics relative to the total number of bacteria isolates tested.\u003c/p\u003e"},{"header":"7. Results","content":"\u003cp\u003e\u003cstrong\u003eClinical examination\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe clinical examination of the naturally infected \u003cem\u003eO. niloticus\u003c/em\u003e showed body depigmentation, corneal opacity, ragged fins and tail, exophthalmia, detachment of scales, body ulceration, and hemorrhages all over the body, especially at fins and tails. In some cases, the infected fish showed erythema around the mouth and swelling in the abdomen.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePostmortem examination\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePostmortem examination showed that the infected fish suffered from splenomegaly, fused gills, enlarged and dark congested kidney, congested liver with distended gall bladder and some cases showed a change in liver color (pale or green) and ascetic fluid watery inconsistent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBacteriological identification and biochemical characterization of Pseudomonas spp.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBased on 14 morphological and biochemical tests, a total of 81 isolates were presumptively identified as Pseudomonas spp. They appeared heterotrophic, motile, Gram-negative rod-shaped bacterium of about 1\u0026ndash;5 \u0026micro;m long and 0.5\u0026ndash;1.0 \u0026micro;m wide and green-blue pigment, pigment, and non-pigment with a Pseudomonas Agar Base with glyceryl and rehydrated by cetriNix supplement (FD 029) HI media, creamy white on Nutrient agar and grey hemolysis with Blood agar. Colonies were gram-negative short rods that gave a positive reaction for oxidase, catalase, citrate utilization, ferment glucose with production of gas, acid production (Sucrose and Mannitol), and Motile. They gave negative results towards, urea hydrolysis and non-glucose fermenters, indole production, and produced variable results with MR-VP as presented in (Figure 3).\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"612\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"5\" valign=\"top\"\u003e\n \u003cp\u003eTable 1. Distribution of Pseudomonas spp isolates with respect to study area\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.647058823529413%\" valign=\"top\"\u003e\n \u003cp\u003eSources\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"69.6078431372549%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003eStudy area\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.745098039215685%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.647058823529413%\" valign=\"top\"\u003e\n \u003cp\u003eNile tilapia\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.137254901960784%\" valign=\"top\"\u003e\n \u003cp\u003eHawassa\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.45098039215686%\" valign=\"top\"\u003e\n \u003cp\u003eZipway\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.019607843137255%\" valign=\"top\"\u003e\n \u003cp\u003eSebeta\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.745098039215685%\" valign=\"top\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.647058823529413%\" valign=\"top\"\u003e\n \u003cp\u003ePositive\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.137254901960784%\" valign=\"top\"\u003e\n \u003cp\u003e8(10.96 %)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.45098039215686%\" valign=\"top\"\u003e\n \u003cp\u003e44(23.78 %)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.019607843137255%\" valign=\"top\"\u003e\n \u003cp\u003e29(7.65 %)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.745098039215685%\" valign=\"top\"\u003e\n \u003cp\u003e81\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"87.25490196078431%\" colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003ePearson chi- square = 29.3788 \u0026nbsp; \u0026nbsp;Pr = 0.000\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.745098039215685%\" valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eThe distribution of Pseudomonas species in the study area indicated a higher prevalence in Ziway, with 44 (23.78%), followed by Hawassa with 8 (10.96%) and Sebeta with 29 (7.65%). This distribution was statistically significant (P \u0026gt; 0.000), highlighting Ziway as the most affected area (Table 1).\u003c/p\u003e\n\u003cp\u003eTable 2: Distribution of \u003cem\u003ePseudomonas\u003c/em\u003e spp detection from the organs.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"624\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003eSources of sample from Nile tilapia\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.576923076923077%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.42307692307692%\" colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003eOrgans \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp; Isolate of bacteria\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.576923076923077%\" valign=\"top\"\u003e\n \u003cp\u003eNo. of isolates\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.423076923076923%\" valign=\"top\"\u003e\n \u003cp\u003eLiver\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003eSpleen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.46794871794872%\" valign=\"top\"\u003e\n \u003cp\u003eKidney\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.07051282051282%\" valign=\"top\"\u003e\n \u003cp\u003eMuscle\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; Ps .putida \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.576923076923077%\" valign=\"top\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.423076923076923%\" valign=\"top\"\u003e\n \u003cp\u003e5 (17.85 %)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003e1(3.57 % )\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.46794871794872%\" valign=\"top\"\u003e\n \u003cp\u003e8 (28.57%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.07051282051282%\" valign=\"top\"\u003e\n \u003cp\u003e14(50 %),\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;Ps. fluoresces\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.576923076923077%\" valign=\"top\"\u003e\n \u003cp\u003e39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.423076923076923%\" valign=\"top\"\u003e\n \u003cp\u003e3(9.38 %).\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003e9 (20 %)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.46794871794872%\" valign=\"top\"\u003e\n \u003cp\u003e11 (27.5 % )\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.07051282051282%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp; 16 (35%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;Ps. Aeruginosa\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.576923076923077%\" valign=\"top\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.423076923076923%\" valign=\"top\"\u003e\n \u003cp\u003e1 (12.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003e3 (35.5 %)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.46794871794872%\" valign=\"top\"\u003e\n \u003cp\u003e2 (25 %), \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.07051282051282%\" valign=\"top\"\u003e\n \u003cp\u003e2 (25 %)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003eThe distribution of Pseudomonas species across four organs: liver, spleen, kidney, and muscle revealed that \u003cem\u003eP. putida\u003c/em\u003e predominated in muscle with 14 (50%), followed by kidney with 8 (28.57%), liver with 5 (17.85%), and spleen with 1 (3.57%). \u003cem\u003eP. fluorescens\u003c/em\u003e showed higher prevalence in muscle with 16 (35.0%), followed by kidney with 11 (27.57%), spleen with 9 (20%), and liver with 3 (9.38%). \u003cem\u003eP. aeruginosa\u003c/em\u003e was more prevalent in spleen with 3 (35.5%), followed by kidney with 2 (25.0%), muscle with 2 (25.0%), and liver with 1 (12.5%). The distribution did not show statistical significance (P \u0026lt; 0.060).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHemolysis assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHemolytic activity of \u003cem\u003ePseudomonas s\u003c/em\u003epp was assessed on a blood agar base with 5% sheep blood. Accordingly, from the present study it was found that 85.71 % (n=7/9) isolates of \u003cem\u003eP. aeruginosa\u003c/em\u003e, 77.78 % (n=25/29) \u003cem\u003eP. putida\u003c/em\u003e and 86.05 % (n=37/43) \u003cem\u003eP. fluorescens\u003c/em\u003e of naturally collected fish show \u0026beta; hemolysis respectively and 22.22 % (n=2/9), 13.79% (n=4/29) and 13.95 % (n=6/43) of isolates show \u0026alpha; hemolysis.\u003c/p\u003e\n\u003cp\u003eThe hemolysis pattern results in the media displaying clear halos around bacterial colonies as shown in Fig .4. The current study shows that 85.19 % (n=69/81) of \u003cem\u003ePseudomonas\u003c/em\u003e isolates show \u0026beta; hemolysis and only 14.81 % (n=12/81) show \u0026alpha; hemolysis.\u003c/p\u003e"},{"header":"8. Molecular detection and characterization of Pseudomonas spp","content":"\u003cp\u003e\u003cstrong\u003eConventional PCR amplification \u003cem\u003ePseudomonas spp.\u003c/em\u003e and virulence gene\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 81 isolates, 75 (92.59%) of which were \u003cem\u003ePseudomonas spp\u003c/em\u003e, were confirmed through conventional PCR. The finding indicated that this protocol is a highly effective method for extracting DNA from Pseudomonas species (\u003cem\u003eP. aeruginosa, P. putida,\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;P. fluorescens\u003c/em\u003e), as evidenced by the substantial amount of genomic DNA obtained, as shown in Figures (5, 6, 7 \u0026amp; 8).\u003c/p\u003e\n\u003cp\u003eTable (3): Antibiotic sensitivity test\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"654\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.77981651376147%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eAntimicrobial disk\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.678899082568808%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eConc.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.61467889908257%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u0026nbsp;\u003c/strong\u003eResult and interpretation (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMAR index\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"34.146341463414636%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.70731707317073%\" valign=\"top\"\u003e\n \u003cp\u003eI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.146341463414636%\" valign=\"top\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.77981651376147%\" valign=\"top\"\u003e\n \u003cp\u003eAmoxicillin-clavulanate\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.678899082568808%\" valign=\"top\"\u003e\n \u003cp\u003eAMC, 30 \u0026micro;g\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e14(100%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0.0186\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.77981651376147%\" valign=\"top\"\u003e\n \u003cp\u003ePenicillin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.678899082568808%\" valign=\"top\"\u003e\n \u003cp\u003eP,10\u0026micro;g\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e14(100%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0.0186\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.77981651376147%\" valign=\"top\"\u003e\n \u003cp\u003eAmpicillin\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.678899082568808%\" valign=\"top\"\u003e\n \u003cp\u003eAMP, 10\u0026micro;g\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e14(100%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0.0186\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.77981651376147%\" valign=\"top\"\u003e\n \u003cp\u003eCeftriaxone\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.678899082568808%\" valign=\"top\"\u003e\n \u003cp\u003eCRO, 30 \u0026micro;g\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e14(100%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.77981651376147%\" valign=\"top\"\u003e\n \u003cp\u003eGentamicin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.678899082568808%\" valign=\"top\"\u003e\n \u003cp\u003eCN, 10\u0026micro;g\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e13(92.9) %)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e1(7.1%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.77981651376147%\" valign=\"top\"\u003e\n \u003cp\u003eStreptomycin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.678899082568808%\" valign=\"top\"\u003e\n \u003cp\u003eS, 10\u0026micro;g\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e14(100%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.77981651376147%\" valign=\"top\"\u003e\n \u003cp\u003eTetracycline\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.678899082568808%\" valign=\"top\"\u003e\n \u003cp\u003eTE, 30\u0026micro;g\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e14(100%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.77981651376147%\" valign=\"top\"\u003e\n \u003cp\u003eCiprofloxacin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.678899082568808%\" valign=\"top\"\u003e\n \u003cp\u003eCIP, 5\u0026micro;g\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e14(100%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.77981651376147%\" valign=\"top\"\u003e\n \u003cp\u003eTrimethoprim Sulfamethoxazole\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.678899082568808%\" valign=\"top\"\u003e\n \u003cp\u003eSXT, 25\u0026micro;g\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e14(100%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0.0186\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.77981651376147%\" valign=\"top\"\u003e\n \u003cp\u003eErythromycin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.678899082568808%\" valign=\"top\"\u003e\n \u003cp\u003eE,5\u0026micro;g\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e0(0.0%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e3(21.4%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e11(78.6%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e0.0146\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.77981651376147%\" valign=\"top\"\u003e\n \u003cp\u003eAverage MAR Index\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.293577981651374%\" colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.0178\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eFigure: antibiotic drug sensitivity showed:\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cem\u003eR: Resistance, I: intermediate and S: \u0026nbsp;Susceptibility (AMC) Amoxicillin-clavulanate, (P)Penicillin , (AMP)Ampicillin, (CRO)Ceftriaxone, (CN) Gentamicin , (S ) Streptomycin, (TE)Tetracycline , (CIP)Ciprofloxacin,(SXT) Trimethoprim Sulfamethoxazole and (E) Erythromycin.\u003c/em\u003e\u003c/p\u003e"},{"header":"9. Discussion","content":"\u003cp\u003eBacterial diseases are considered the most serious disease problem among freshwater fishes (Pękala-Safińska. (2018). Pseudomonas species are one of the most predominant bacterial fish pathogens that cause extremely fish mortalities and substantial economic losses (Nair, \u003cem\u003eet al\u003c/em\u003e.2021). \u003cem\u003ePseudomonas\u0026nbsp;\u003c/em\u003espp. has gained increased attention due to its pathogenicity to humans and the ubiquity of the organism in the environment, food, and water (Milligan, \u003cem\u003eet al.\u0026nbsp;\u003c/em\u003e2023).\u0026nbsp;\u0026nbsp;Isolation of Pseudomonas spp. from three-aquaculture Nile tilapia along its value chain during the current study adds more evidence for the wide ecological distribution of the bacteria. The clinical sing and postmortem findings observed in the current study of Nile tilapia showed hemorrhages on the external surface of the body, the base of the pectoral and tail fin, ulcers on the skin, abdominal distention, prolapsed anus, and fin rot (Figure 1). Postmortem examination showed that the infected fish suffered from splenomegaly, congestion in gills, enlarged gall bladder, and some cases a liver change in color shows (figure.2).\u0026nbsp;The observed clinical and postmortem findings were nearly similar to those described by (Khalil,\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e.2010; Magdy \u003cem\u003eet al\u003c/em\u003e., 2014 and Abd- Eltawab, \u003cem\u003eet al\u003c/em\u003e, 2020). The phenotypic and biochemical characteristics of the isolated Pseudomonas species (\u003cem\u003eP. aeruginosa, P. putida, and P. fluorescens\u003c/em\u003e) matched those outlined in Bergey\u0026apos;s Manual of Determinative Bacteriology (Garrity, 2001). Additionally, similar findings were reported with by Algammal \u003cem\u003eet al\u003c/em\u003e. \u0026nbsp;(2020), Desissa, \u003cem\u003eet al.\u003c/em\u003e (2022), and Dina, \u003cem\u003eet a\u003c/em\u003el. (2023). This study examines \u003cem\u003eO. niloticus\u003c/em\u003e fish infected with Pseudomonas spp. pathogens, demonstrating the species\u0026apos; vulnerability to this bacterial disease. The majority of the identified bacterial pathogens were found to originate from the Ziway pond, significantly outnumbering those from the Sebeta and Hawassa ponds (p\u0026lt;0.000), as shown in Table 1.\u003c/p\u003e\n\u003cp\u003eThe hemolytic activity of the isolates was determined as a crucial virulence factor. Accordingly, from overall all isolates, 85.19% showed \u0026beta; hemolysis, and only 14.81% shows \u0026alpha; hemolysis. These pathogens generate toxins that cause lethality, hemolysis, and entero-toxigenicity, which are common in the primary spoilage microorganisms found in seafood. If fish is consumed without proper cooking, these entero-toxigenic pathogens may lead\u0026nbsp;to human diarrheal outbreaks.\u003c/p\u003e\n\u003cp\u003eFor the first time, molecular detection and characterization of isolates using conventional PCR has provided evidence for the presence of the \u003cem\u003ePseudomonas\u003c/em\u003e genus in \u003cem\u003ePseudomonas\u0026nbsp;\u003c/em\u003espp. infecting fish in Ethiopia. Molecular characterization using conventional PCR confirmed the presence of a specific gene in Pseudomonas spp. infecting fish in Ethiopia. The optimized PCR protocol, targeting this gene, revealed that the adhesin gene was present in 92.59% of P\u003cem\u003eseudomonas species (\u003c/em\u003eincluding\u003cem\u003e\u0026nbsp;P. aeruginosa, P. fluorescens,\u0026nbsp;\u003c/em\u003eand \u003cem\u003eP. putida\u003c/em\u003e) isolated from the samples, aligning with findings by (Ardura et al, 2013\u0026amp; Abd El Aziz (2015). The adhesin gene, a virulence gene coding for a surface protein, facilitates bacterial surface binding, colonization, and host tissue infection. Targeting this gene is crucial for species identification and future research on recombinant adhesin as a potential vaccine against pseudomonads. Among the 75 PCR-positive samples, 8 (10.66%) were \u003cem\u003eP. aeruginosa,\u0026nbsp;\u003c/em\u003e28 (37.63%)\u003cem\u003e\u0026nbsp;\u003c/em\u003ewere\u003cem\u003e\u0026nbsp;P. putida, and\u0026nbsp;\u003c/em\u003e39 (52%) were\u003cem\u003e\u0026nbsp;P. fluorescens\u0026nbsp;\u003c/em\u003efrom\u003cem\u003e\u0026nbsp;O. niloticus\u003c/em\u003e, with no disease outbreaks reported in any ponds at that time. The current study examined the distribution of Pseudomonas species in various organs of Nile tilapia. It found that Pseudomonas putida was most prevalent in muscle lesions and least in the spleen, while Pseudomonas fluorescens was most common in the kidney and least in the liver. Pseudomonas aeruginosa was predominantly found in the spleen and least in the liver, as shown in Table 2. These results, with the highest prevalence in muscle lesions and lowest in the liver, differ somewhat from the findings reported by Eissa \u003cem\u003eet al.\u003c/em\u003e (2010), El-Deen, (2014), El-Kader, and Mousa-Balabe \u0026amp; Atwa (2017) for Oreochromis niloticus. .As explained by Gilda (2001), disease occurrence in fish depends on the pathogen, host, and environment. The 52% detection rate of \u003cem\u003eP. fluorescens\u0026nbsp;\u003c/em\u003ealigns with reports from Egypt (Eid \u003cem\u003eet al\u003c/em\u003e 2016). Overall, \u003cem\u003eP. fluorescens\u003c/em\u003e was the most dominant Pseudomonas pathogen and the most prevalent fish pathogen in ponds, consistent with findings by Akinbowale \u003cem\u003eet al\u003c/em\u003e. (2007) and Li \u003cem\u003eet al\u003c/em\u003e. (2020). The current investigation into the microbial ecology of Oreochromis niloticus (Nile tilapia) revealed a prevalent presence of bacterial pathogens within this fish species. This finding aligns with previous reports by Meronet et al. (2020) and Desissa et al. (2023), which highlighted the susceptibility of Nile tilapia to a diverse array of potential bacterial pathogenic agents, particularly Gram-negative bacteria such as Pseudomonas spp. and Aeromonas spp.\u003c/p\u003e\n\u003cp\u003eBacterial pathogens of fish and zoonotic bacteria, including Pseudomonas spp. \u0026nbsp;(\u003cem\u003eP. fluorescens, P. putida, a\u003c/em\u003end\u003cem\u003e\u0026nbsp;Pseudomonas aeruginosa)\u003c/em\u003e, were recovered from naturally infected fish in aquaculture farms in Ethiopia, consistent with \u0026nbsp; observations in Egypt (Austin and Austin, 2016 and \u0026nbsp; Desissa et \u003cem\u003eal., 2023\u003c/em\u003e) which reports in Ethiopia. Variations in the prevalence of Pseudomonas species in fish worldwide can be linked to factors such as sampling times and geographic regions (Devarajan \u003cem\u003eet al\u003c/em\u003e., 2017). The differences observed in the current study could be due to the number and size of the fish examined environmental conditions, geographic location, the seasons during which the study was conducted, and the sensitivity and specificity of the methods used for bacterial identification.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe conventional PCR amplification\u003c/strong\u003e of the total DNA obtained (Figure 5) using this protocol proved to be a highly efficient method for extracting DNA from \u003cem\u003ePseudomonas spp\u003c/em\u003e (\u003cem\u003eP. aeruginosa, P. putida, and P. fluorescens\u003c/em\u003e), resulting in good yields of genomic DNA.\u003c/p\u003e\n\u003cp\u003eIn present study, two sets of primers, Ps16S-F and Ps16S-R, were used, and specifically designed for \u003cem\u003eP. aeruginosa, P. putida,\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;P. fluorescens\u003c/em\u003e. These primers target variable regions within the 16S rRNA gene. PCR assays with these primers successfully amplified DNA fragments of the anticipated sizes, as shown in all figures. The 16S rRNA \u0026nbsp;gene sequence \u0026nbsp;has historically served as a valuable tool for bacterial identification and taxonomic classification, contributing significantly to the phylogenetic studies of bacterial species (Church, \u003cem\u003eet al\u003c/em\u003e., 2020 ).The findings indicated that following this protocol resulted in a highly effective method for extracting DNA from Pseudomonas species (\u003cem\u003eP. aeruginosa, P. putida, and P. fluorescens\u003c/em\u003e), as evidenced by the significant amount of genomic DNA obtained, as shown in all \u0026nbsp;above Figure. The finding inline (khulod \u003cem\u003eet al\u003c/em\u003e. (2012) and Dina \u003cem\u003eet al\u003c/em\u003e. (2023).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe results of antibiotic sensitivity testing for the isolated Pseudomonas spp against 10 commercial antibiotic discs are shows in Table 3. The sensitivity profile revealed that Pseudomonas spp. were generally most sensitive to Ceftriaxone, Ciprofloxacin, Streptomycin, and Tetracycline, followed by Gentamicin (CN, 10 \u0026micro;g, 92.9%). All isolates showed high resistance to Amoxicillin-clavulanate and Ampicillin. Additionally, amoxicillin and penicillin exhibited no bactericidal activity (100% resistance). The multi-antibiotic resistance index was 0.18. The results agree with \u0026nbsp; (El Barbary and Hal, 2016; Eid, \u003cem\u003eet al\u003c/em\u003e. 2016: Das et al., 2020) for the Pseudomonas spp. The rise in bacterial infections in fish and antimicrobial resistance (AMR) worldwide poses a significant threat to the sustainability of the fishery and aquaculture sectors\u0026nbsp;\u003c/p\u003e"},{"header":"10. Conclusion","content":"\u003cp\u003eThe pathogen was isolated and identified in 81 samples, with phenotypic assessments showing that 85.19% of the isolates exhibited the virulence trait of \u0026szlig;-hemolysis. Molecular characterization using conventional PCR revealed the presence of the ATCCA genes in 75 (92.59%) of the isolates. Additionally, antimicrobial susceptibility tests on the isolated Pseudomonas spp. strains indicated resistance to amoxicillin-clavulanate, ampicillin, and penicillin. The phenotypic and genotypic analyses provided epidemiological evidence of a virulent Pseudomonas spp. strain spreading among the fish population in Ethiopian ponds. The detection of the pathogen in the hematopoietic organs of the sampled fish population raises concerns about potential outbreaks. The identified Pseudomonas spp. isolates possess virulence traits that aid in colonization, infection, and pathogenicity, along with the ability to resist antibiotics commonly used in human and veterinary medicine. Pseudomonas spp. is an emerging zoonotic pathogen, and fish in ponds and fish products from the National Fisheries and Aquatic Life Research Center (NFALRC) in Sebeta, CARE at Hawassa University, and Batu Fishery and Other Aquatic Life Research Center are potential sources of infection for humans in the area.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis research was partially funded by the Animal Health Institute and the Department of Aquatic Science, Fisheries, and Aquaculture at Hawassa University, Ethiopia. The funding sources did not influence the study design, data collection, analysis, or interpretation, the writing of the report, or the decision to submit the article for publication.\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003eAuthor Details\u003c/p\u003e\n\u003cp\u003eAKA Animal Health Institute Department of Fish Disease Research desk, and \u0026nbsp;AAM and BS \u0026nbsp; \u0026nbsp;Animal Health Institute Department of Molecular and Bioinformatics Research desk, TRC Animal Health Institute, NP, Hawassa University, Department of Aquatic Sciences, Fisheries and Aquaculture.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEthics approval\u003c/p\u003e\n\u003cp\u003eThis dissertation work was conducted following the fish handling and sample collection guidelines established by Hawassa University, College of Natural and Computational Science, in 2023. The study protocol was approved by the Research Ethics Committee of the same institution. Additionally, the fish were euthanized and rendered unconscious during sample collection to ensure animal welfare. The euthanasia procedure followed the \u0026quot;American Veterinary Medical Association Guideline for Euthanasia\u0026quot; published in 2020. The fish were euthanized by transecting the spinal cord behind the skull, as described by Austin (2016)\u003c/p\u003e\n\u003cp\u003eData Availability\u003c/p\u003e\n\u003cp\u003eThe datasets used and analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbd El-Aziz D.M. (2015): Detection of Pseudomonas spp. in chicken and fish sold in markets of Assiut City, Egypt. Journal of food Quality Hazards Control 2: 86-89.\u003c/li\u003e\n\u003cli\u003eAbdel-latif .H.M.R. (2020). Natural co-infection of cultured Nile tilapia Oreochromis niloticus with Aeromonas hydrophila and Gyrodactylus cichlidarum experiencing high mortality during summer. Aquac Res.; 1(1):1\u0026ndash;13.\u003c/li\u003e\n\u003cli\u003eAkinbowale, A.L., Peng, H., Grant, P.and Barton, M.D., 2007. Antibioticand heavy metal resistance in motile aeromonads and pseudomonads from rainbow trout (Oncorhynchus mykiss) farms in Australia. International Journal of Antimicrobial Agents, 30(1), 177-182.\u003c/li\u003e\n\u003cli\u003eAraya, S., Gebreyohannes, Z., Tadlo, G., Gessew, G. T., \u0026amp; Negesso, A. E. (2023). Epidemiology and multidrug resistance of Pseudomonas aeruginosa and Acinetobacter baumanni isolated from clinical samples in Ethiopia. Infection and Drug Resistance, 2765-2773.\u003c/li\u003e\n\u003cli\u003eArdura, Alba, Ana R. Linde, and Eva Garcia-Vazquez. (2013). \u0026quot;Genetic Detection of Pseudomonas spp. in Commercial Amazonian Fish\u0026quot; International Journal of Environmental Research and Public Health 10, no. 9: 3954-3966. https://doi.org/10.3390/ijerph10093954 \u003c/li\u003e\n\u003cli\u003eAustin B, Austin DA (2007) Bacterial fish pathogens, diseases of farmed and wild fish. (4th edn), Praxis Publishing Ltd, Chichester, UK.\u003c/li\u003e\n\u003cli\u003eAustin. B, Austin, D. A. (2016). Bacterial Fish Pathogens. Bacterial Fish Pathogens. 124\u0026ndash;156 p.\u003c/li\u003e\n\u003cli\u003eBuller NB (2014). Bacteria from fish and other aquatic animals: A practical identification manual. CABI Publishing, Oxford shire, UK.\u003c/li\u003e\n\u003cli\u003eChurch, D. L., Cerutti, L., G\u0026uuml;rtler, A., Griener, T., Zelazny, A., \u0026amp; Emler, S. (2020). Performance and application of 16S rRNA gene cycle sequencing for routine identification of bacteria in the clinical microbiology laboratory. Clinical microbiology reviews, 33(4), 10-1128.\u003c/li\u003e\n\u003cli\u003eCLSIM45. M100 Performance Standards for Antimicrobial. 2022. 48\u0026ndash;52 p.\u003c/li\u003e\n\u003cli\u003eDas, S., Azad, M., Bimal, K., \u0026amp; Oraon, V. (2020). Antimicrobial Susceptibility Pattern of Pseudomonas aeruginosa with Special Reference to ESBL Producers from Various Clinical Samples at a Tertiary Care Center in Bihar. International Journal of Research and Review, 7(1).\u003c/li\u003e\n\u003cli\u003eDevarajan, N., K\u0026ouml;hler, T., Sivalingam, P., van Delden, C., Mulaji, C. K., Mpiana, P. T., \u0026amp; Pot\u0026eacute;, J. (2017). Antibiotic resistant Pseudomonas spp. in the aquatic environment: a prevalence study under tropical and temperate climate conditions. Water research, 115, 256-265.\u003c/li\u003e\n\u003cli\u003eDissasa, Guta, Brook Lemma, and Hassen Mamo (2022). \u0026quot;Isolation and Identification of major bacteria from three Ethiopian rift valley lakes live and processed fish, and water samples: Implications in sanitary system of fish products.\u0026quot; \u003c/li\u003e\n\u003cli\u003eDuman, M., Mulet, M., Altun, S., Saticioglu, I. B., Ozdemir, B., Ajmi, N... \u0026amp; Garc\u0026iacute;a-Vald\u0026eacute;s, E. (2021). The diversity of Pseudomonas species isolated from fish farms in Turkey. Aquaculture, 535, 736369.\u003c/li\u003e\n\u003cli\u003eEid, Hamza, Azza El Tabiy, and Sara Fathy. (2016) \u0026quot;Prevalence and molecular characterization of Pseudomonas species isolated from fish markets in port-said.\u0026quot; Suez Canal Veterinary Medical Journal. SCVMJ 21.1: 1-12.\u003c/li\u003e\n\u003cli\u003eEissa, N. M. E., El-Ghiet, E. A., Shaheen, A. A., \u0026amp; Abbass, A. (2010). Characterization of Pseudomonas species isolated from tilapia \u0026ldquo;Oreochromis niloticus\u0026rdquo; in Qaroun and Wadi-El-Rayan lakes, Egypt. Global Veterinaria, 5(2), 116-121.\u003c/li\u003e\n\u003cli\u003eEL-Deen, A. G. S. 2014. Role of nigella sativa in decreasing mortalities in Nile tilapia caused by Pseudomonas septicemia. Assiut.Vet. Med. J. 60 (142): 89-94.\u003c/li\u003e\n\u003cli\u003eEl-Kader, M. F. A., and Tarek Mahmoud Mousa-Balabel. (2017) \u0026quot;Isolation and molecular characterization of some bacteria implicated in the seasonal summer mortalities of farm-raised Oreochromis niloticus at Kafr El-Sheikh and Dakahlia Governorates.\u0026quot; Alexandria Journal of Veterinary Sciences 53.2: 107-113.\u003c/li\u003e\n\u003cli\u003eEshetu .Y (2000). Preliminary survey of parasites and bacterial pathogens of sh at Lake Ziway. Ethiop J Sci.; 23: 25\u0026ndash;33.\u003c/li\u003e\n\u003cli\u003eFAO (2022). The State of World Fisheries and Aquaculture. Contributing to food security and nutrition for all.\u003c/li\u003e\n\u003cli\u003eKhalil, S. A.; Khalil, R. H.; Saad, T.T. and Safaa, M. H. (2010): Studies on Pseudomonas Septicemia among Cultured Oreochromis niloticus, Journal of the Arabian aquaculture society, vol. 5 no 1.\u003c/li\u003e\n\u003cli\u003eLi, X. M., Zhu, Y. J., Ring\u0026oslash;, E., \u0026amp; Yang, D. (2020). Prevalence of Aeromonas hydrophila and Pseudomonas fluorescens and factors influencing them in different freshwater fish ponds. Iranian Journal of Fisheries Sciences, 19(1), 111-124.\u003c/li\u003e\n\u003cli\u003eMagdy, I., El-Hady, M., Ahmed, H., Elmeadawy, S. \u0026amp; Kenwy, A (2014). A contribution on Pseudomonas aeruginosa infection in African catfish (Clarias gariepinus). Res. J. Pharm. Biol. Chem. Sci. 5, 575\u0026ndash;588.\u003c/li\u003e\n\u003cli\u003eMilligan, E. G., Calarco, J., Davis, B. C., Keenum, I. M., Liguori, K., Pruden, A., \u0026amp; Harwood, V. J. (2023). A systematic review of culture-based methods for monitoring antibiotic-resistant Acinetobacter, Aeromonas, and Pseudomonas as environmentally relevant pathogens in wastewater and surface water. Current Environmental Health Reports, 10(2), 154-171.\u003c/li\u003e\n\u003cli\u003eMunguti, J. M., Nairuti, R., Iteba, J. O., Obiero, K. O., Kyule, D., Opiyo, M. A. \u0026amp; Ogello, E. O. (2022). Nile tilapia (Oreochromis niloticus Linnaeus, 1758) culture in Kenya: Emerging production technologies and socio‐economic impacts on local livelihoods. Aquaculture, Fish and Fisheries, 2(4): 265-276.\u003c/li\u003e\n\u003cli\u003eNair, S. G., Lipton, A., De los R\u0026iacute;os-Escalante, P., \u0026amp; Ib\u0026aacute;\u0026ntilde;ez-Arancibia, E. (2021). Isolation and characterization of bacterial pathogens, Pseudomonas aeruginosa and Enterobacter cloacae from the moribund fish, Etroplus maculatus. J. Mater. Environ. Sci, 12, 1332-1349.\u003c/li\u003e\n\u003cli\u003eKassa, Nebyu, and A. M. Mitiku. \u0026quot;Bacterial flora of Nile tilapia of pond fish and their relationship with predisposing factors.\u0026quot; Int J Adv Res Biol Sci 8.6 (2021): 186-197.\u003c/li\u003e\n\u003cli\u003eAnwar Nuru, B. M., \u0026amp; Yimer, E. (2012). Occurrence and distribution of bacterial pathogens of fish in the southern gulf of Lake Tana, Bahir Dar, Ethiopia. Proteus (p.), 2, 2-4.\u003c/li\u003e\n\u003cli\u003eOsman, K. M., da Silva Pires, \u0026Aacute;., Franco, O. L., Saad, A., Hamed, M., Naim, H., ... \u0026amp; Elbehiry, A. (2021). Nile tilapia (Oreochromis niloticus) as an aquatic vector for Pseudomonas species of medical importance: Antibiotic Resistance Association with Biofilm Formation, Quorum Sensing and Virulence. Aquaculture, 532, 736068.\u003c/li\u003e\n\u003cli\u003ePalma, E., Tilocca, B., \u0026amp; Roncada, P. (2020). Antimicrobial resistance in veterinary medicine: An overview. International Journal of Molecular Sciences, 21(6) 1914.\u003c/li\u003e\n\u003cli\u003ePękala-Safińska, Agnieszka (2018).\u0026quot;Contemporary threats of bacterial infections in freshwater fish.\u0026quot; Journal of veterinary research 62.3: 261-267.\u003c/li\u003e\n\u003cli\u003eSarkar. P. Issac, P. K., Raju, S. V., Elumalai, P., Arshad, A., \u0026amp; Arockiaraj, J. (2021). Pathogenic bacterial toxins and virulence influences in cultivable fish. Aquaculture Research, 52(6), 2361-2376.\u003c/li\u003e\n\u003cli\u003eShbaita, S., Abatli, S., Sweileh, M. W., Aiesh, B. M., Sabateen, A., Salameh, H. T. \u0026amp; Zyoud, S. E. H. (2023). Antibiotic resistance profiles and associated factors of Pseudomonas Infections among patients admitted to large tertiary care hospital from a developing country. Antimicrobial Resistance \u0026amp; Infection Control, 12(1): 1-12.\u003c/li\u003e\n\u003cli\u003eSpilker, T., Coenye, T., Vandamme, P., \u0026amp; LiPuma, J. J. (2004): PCR-based assay for differentiation of Pseudomonas aeruginosa from other Pseudomonas species recovered from cystic fibrosis patients. Journal of clinical microbiology, 42(5): 2074-2079.\u003c/li\u003e\n\u003cli\u003eWu C-J, Ko W-C, Lee N-Y, Su S-L, Li C-W. crossm. Am Soc Microbiol. 2019; 85(21):1\u0026ndash;12.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Antibiogram, pseudomonas spp., Ethiopia, Nile tilapia, PCR, Aquaculture pond","lastPublishedDoi":"10.21203/rs.3.rs-5023769/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5023769/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Pseudomonas species (including P. aeruginosa, P. putida, and P. fluorescens) are zoonotic bacterial pathogens that frequently cause disease and significant mortality among both cultured and wild fish worldwide. In Ethiopia, Pseudomonas species have been identified in Sebeta fish ponds and Rift Valley lakes. However, information on the molecular and phenotypic characteristics of Pseudomonas species in Ethiopian aquaculture ponds is limited. To address this gap, a cross-sectional study was conducted from November 2022 to May 2023 in selected aquaculture ponds in Ethiopia. A total of 637 samples were aseptically collected from the muscle, liver, spleen, and kidney of fish in these ponds using purposive sampling methods. The samples were cultured on Pseudomonas base agar with the selective supplement cetriNix (FD029) media and glycerol and subjected to morphological and biochemical tests to isolate and identify Pseudomonas species. The pathogen was isolated from 81 samples, accounting for 12.7% of the total. Among these isolates, 85.6% exhibited virulence traits, such as β-hemolysis on blood agar with 5% sheep blood. Additionally, 75 strains (92.59%) were confirmed using conventional PCR with Pseudomonas-specific primers and an optimized protocol. Among the PCR-positive samples, 8 (10.66%) were identified as P. aeruginosa, 28 (37.63%) as P. putida, and 39 (52%) as P. fluorescens from Nile Tilapia (O. niloticus). Antibiotic susceptibility testing on ten representative isolates showed that all Pseudomonas isolates were susceptible to Ciprofloxacin, Gentamicin, and Ceftriaxone, but resistant to Amoxicillin and Penicillin. The study concludes that Pseudomonas species (including P. aeruginosa, P. putida, and P. fluorescens) strains carrying the virulence gene Psul, which are β-hemolytic and resistant to commonly used antibiotics in human and veterinary medicine, are present in Ethiopian aquaculture. The detection of this pathogen in 75 fish samples is concerning due to the potential for outbreaks and zoonotic transmission. Therefore, further research into the molecular epidemiology of the disease is needed to understand potential inter-host transmission and antibiotic resistance traits. Additionally, public awareness about the risks of consuming undercooked or raw fish meat should be raised.","manuscriptTitle":"Phenotypic, Molecular Detection, and Antibiogram Analysis of Pseudomonas strain from Oreochromis Niloticus .L 1758 (Nile Tilapia) from aquaculture pond, Ethiopia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-09 05:40:47","doi":"10.21203/rs.3.rs-5023769/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"469a484b-ef5a-42c8-85d4-6cbe41ef188b","owner":[],"postedDate":"September 9th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-06-07T07:23:13+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-09 05:40:47","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5023769","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5023769","identity":"rs-5023769","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}