C-type natriuretic peptide mitigates apoptosis in ovarian granulosa cells through the cGMP pathway independent of PKG signaling

C-type natriuretic peptide mitigates apoptosis in ovarian granulosa cells through the cGMP pathway independent of PKG signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article C-type natriuretic peptide mitigates apoptosis in ovarian granulosa cells through the cGMP pathway independent of PKG signaling Yi Wei, Hong Deng, Qi Liu, Yingjie Wu, Lei An, Jianhui Tian, Guangyin Xi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7484101/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 05 Dec, 2025 Read the published version in Journal of Ovarian Research → Version 1 posted 9 You are reading this latest preprint version Abstract Background Mammalian follicular development is a highly coordinated process governed by hormonal and paracrine cues. Apoptosis of granulosa cells is a central driver of follicular atresia, triggered by insufficient anti-apoptotic signals or activation of pro-apoptotic pathways. C-type natriuretic peptide (CNP), a naturally occurring peptide present in follicular fluid, has been widely recognized as a oocyte meiosis arrester. However, the regulation of CNP on apoptosis of ovarian granulosa cells remains poorly defined. Methods RNA sequencing (RNA-seq) was performed on bovine granulosa cells treated with or without CNP to characterize transcriptomic changes and identify differentially regulated pathways. For functional assays, in vitro culture models of bovine mural granulosa cells, cumulus-oocyte complexes (COCs), and oocytectomized complexes (OOXs) were established to evaluate the effects of CNP on cell survival. Cultured granulosa cells were pretreated with pharmacologic inhibitors to identify the signaling pathways involved in apoptosis regulation by CNP. Apoptosis was assessed by TUNEL assay, while apoptosis-related gene and protein expression levels were analyzed by RT-qPCR and western blotting, respectively. In vitro maturation (IVM) of oocytes was performed to evaluate functional significance of cGMP-dependent protein kinase (PKG) inhibition. Results Transcriptomic profiling revealed that CNP administration significantly downregulated multiple apoptosis-related pathways, including the IL17 signaling pathway, TNF signaling, and NF-κBpathways. Functionally, CNP suppressed apoptosis in both mural granulosa cells and cumulus cells, independent of oocyte presence. Notably, PKG inhibition by KT5823 also reduced granulosa cell apoptosis, and the anti-apoptotic effects of CNP were preserved despite PKG blockade. Conversely, ectopic PKG overexpression enhanced apoptosis, demonstrating a pro-apoptotic role for PKG in this context. Incorporation of KT5823 into the IVM system attenuated cumulus cell apoptosis and improved bovine and ovine oocyte developmental competence. Conclusions These findings reveal that the anti-apoptotic effect of CNP on granulosa cells is independent of PKG signaling. CNP exerts transcriptional suppression of apoptosis-related pathways, while pharmacological PKG inhibition represents a promising approach to enhance the quality of in vitro matured oocytes. C-type natriuretic peptide PKG Granulosa cells apoptosis oocyte in vitro maturation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Ovarian granulosa cells, the primary cellular component of follicular development, are crucial for supplying essential nutrients and maintaining the microenvironment for oocytes. Abnormal apoptosis in these cells has been demonstrated to impair follicle development [ 1 ]. Mammalian follicle development is a dynamic process regulated by various hormones and signaling factors. It is well-established that granulosa cell apoptosis is triggered when these cells fail to receive adequate anti-apoptotic signals or when pro-apoptotic factors are excessively activated, leading to follicular atresia [ 2 ]. Key apoptotic pathways involved include the death receptor (extrinsic) pathway, the mitochondrial (intrinsic) pathway, the endoplasmic reticulum stress pathway, and the caspase-independent pathway [ 3 , 4 ]. Current research on anti-apoptotic factors in follicular development primarily focuses on FSH, E2, TGF-β, and IGF-1. These factors exert their anti-apoptotic effects predominantly by interacting with surface receptors on granulosa cells, thereby modulating various apoptotic pathways [ 5 – 8 ]. Follicular development is a complex, multifactorial process, and other regulatory factors likely play roles in this process. Research that focuses on identifying and characterizing these additional factors contributes to a better understanding of the mechanisms underlying female reproductive health. C-type natriuretic peptide (CNP), encoded by the Nppc gene, is extensively distributed across various tissues and organs. It activates intracellular cyclic guanosine monophosphate (cGMP) synthesis by binding to natriuretic peptide receptor 2 (NPR2), which in turn regulating biological processes such as the cell cycle, autophagy, apoptosis, and metabolism [ 9 ]. Studies have shown that most oocytes in mature follicles in Nppc or Npr2 mutant mice failed to maintain meiotic arrest, suggesting that CNP is a key meiosis arrester [ 10 ]. CNP produced by mural granulosa cells stimulated NPR2 localized in cumulus cells to generate cyclic guanosine monophosphate (cGMP), which was transferred to the oocyte through gap junctions between cumulus cells and the oocytes. The elevated cGMP inhibited the activity of phosphodiesterase 3A (PDE3A), thereby reducing cyclic adenosine monophosphate (cAMP) hydrolysis, sustaining high cAMP levels, and ultimately arresting meiosis at the diplotene stage [ 10 ]. Xi et al. demonstrated that the addition of CNP to the culture medium significantly enhanced the growth of preantral follicles and promoted granulosa cell viability independently of follicle-stimulating hormone [ 11 ]. However, while the role of CNP in maintaining meiotic arrest has been extensively studied, its impact on granulosa cells, a key mediator in follicle development, remains underexplored. Protein kinase G (PKG), a serine/threonine kinase and key mediator of cGMP signaling, plays a critical role in various cellular processes, including apoptosis, differentiation, and proliferation [ 12 ]. Under different conditions, PKG has a dual role in regulating cell apoptosis. It has been reported that activation of the cGMP/PKG pathway was associated with dopamine neuron degeneration, while inhibition of PKG could reverse cell apoptosis [ 13 , 14 ]. However, some studies have shown that inhibition of PKG can eliminate the effect of cGMP in alleviating hydrogen peroxide-induced apoptosis [ 15 ]. While CNP and cGMP are known to enhance granulosa cell activity during follicular development, the role of PKG in this process remains poorly understood. Existing research suggests that cGMP-activated downstream pathways are complex and vary across cell types, leaving the specific effects of PKG on ovarian granulosa cells and its influence on follicular development largely unexplored. In vitro maturation (IVM) is a technology that simulates the in vivo environment under laboratory conditions to enable immature oocytes to complete meiosis and cytoplasmic maturation. IVM technology has important application value in assisted reproductive medicine, especially in the fields of treatment of polycystic ovary syndrome (PCOS), oocyte cryopreservation and embryo engineering [ 16 ]. However, this technology still faces many challenges, such as the fact that oocytes matured in vitro tend to show lower developmental potential compared to those matured in vivo [ 17 ]. This may be related to the in vitro culture conditions that cannot fully mimic the complex physiological environment in vivo , resulting in problems such as abnormal cell cycle regulation and chromosomal abnormalities [ 18 , 19 ]. By optimizing culture conditions and improving the culture medium formula to simulate the in vivo oocyte maturation environment, it is expected to improve the development potential of in vitro matured oocytes. This will effectively promote the application of IVM technology in clinical practice, thereby improving the success rate and safety of assisted reproduction. The present study aimed to investigate the effects of CNP and PKG on the apoptosis of ovarian granulosa cells using various cell culture models. Our findings reveal that CNP exerts its anti-apoptotic effects via cGMP, rather than through PKG. Furthermore, inhibition of PKG significantly enhances the developmental potential of in vitro matured oocytes, likely by mitigating apoptosis in cumulus cells. Therefore, our study not only provides new insights into understanding the mechanism of mammalian follicle development, but also presents a promising strategy for improving the quality of in vitro matured oocytes. Materials and methods Granulosa cells, COCs and OOXs culture Bovine ovaries obtained from the slaughterhouse were immersed in physiological saline containing penicillin and streptomycin, and transported to the laboratory within 3 hours. Follicular fluid was aspirated from antral follicles (3–8 mm in diameter). Following a 30-minute incubation at 37°C, the fluid was filtered through a 40 µm cell strainer to isolate granulosa cells. The suspension was then centrifuged at 1200 rpm for 5 minutes and the granulosa cell pellet was resuspended and washed twice with DMEM/F12 medium supplemented with 2% penicillin and streptomycin. The washed bovine ovarian granulosa cells were subsequently seeded into culture dishes and incubated at 37°C in a 5% CO₂ atmosphere with saturated humidity for 24 hours. Cumulus-oocyte complexes (COCs), characterized by dense, uniformly cytoplasmic oocytes surrounded by 3–4 layers of cumulus cells, were isolated under a stereomicroscope. Oocytes from selected COCs were mechanically removed to obtain oocytectomized complexes (OOXs). The isolated COCs and OOXs were then transferred to M199 medium containing 2% penicillin-streptomycin and washed twice. Following washing, the COCs and OOXs were plated in culture dishes and incubated at 38.5°C in a 5% CO₂ atmosphere with saturated humidity for 24 hours. In vitro embryo production The collected COCs were washed three times with BO-maturation solution. They were subsequently placed into a four-well culture plate containing 500 µL/well BO-maturation solution, which had been equilibrated for at least 2 hours. The plate was incubated at 38.5°C with 5% CO₂ and saturated humidity for 22 hours to allow for maturation. Post-maturation, the COCs were washed three times with BO-semen solution. They were then transferred to a four-well culture plate containing 500 µL/well fertilization solution, which had also been equilibrated for more than 2 hours. For fertilization, a tube of frozen semen was thawed in a 37°C water bath and added to a 15 mL centrifuge tube containing 6 mL of semen washing solution. The semen was gently mixed, centrifuged at 1800 r/min for 5 minutes, and the supernatant was discarded. This process was repeated twice, after which the sperm pellet was resuspended to a density of approximately 1×10 6 /mL. Subsequently, 75–80 µL of the resuspended sperm was added to each well. The plate was incubated at 38.5°C with 5% CO₂ and saturated humidity for 16 hours. Following fertilization, the oocytes were transferred from the fertilization solution to washing solution. After removal of the cumulus cells in the washing solution, the oocytes were transferred to BO-IVC solution and washed three times. They were then placed into a BO-IVC four-well culture plate (500 µL/well, 50 oocytes/well, overlaid with mineral oil) that had been pre-equilibrated for approximately 4 hours, and cultured for 7 days. TdT-mediated dUTP nick end labeling (TUNEL) assay Cells or embryos removed from the culture medium were washed with 0.1% PBS-PVP and fixed in 4% paraformaldehyde overnight at 4°C. Following fixation, samples were washed three times and permeabilized with 0.5% Triton X-100 in PBS at room temperature for 1 hour. TUNEL staining was performed using the One-Step TUNEL Cell Apoptosis Detection Kit (Beyotime, Shanghai, China, C1088) according to the manufacturer’s protocol. Finally, the cell nuclei were stained with 10 µL of DAPI solution. Apoptotic cells were visualized using confocal laser scanning microscopy (CLSM, Leica, Germany), with green fluorescence indicating apoptosis. Immunostaining Cells or embryos were first washed with 0.1% PBS-PVP and fixed in 4% paraformaldehyde overnight at 4°C. Following fixation, they were permeabilized with 1% Triton X-100 in PBS at room temperature for 30 minutes. The samples were then washed three times with 0.1% PBS-PVP. To block nonspecific binding, the samples were incubated in 1% BSA blocking solution at room temperature for 2 hours. The primary antibody, diluted 1:500 in antibody diluent, was applied overnight at 4°C. On the following day, the samples were washed three times with 0.1% PBS-PVP. The secondary antibody, diluted 1:1000 in antibody diluent, was then applied at room temperature in the dark for 1 hour. After washing three times with antibody diluent and once with 0.1% PBS-PVP, the samples were mounted on slides with DAPI solution, covered, and imaged using a fluorescence microscope with consistent exposure settings for both control and experimental groups. Fluorescence intensity was quantified using ImageJ. PRKG2 plasmid construction The coding sequence (CDS) of PRKG2 (NM_001144099) was amplified from bovine granulosa cell cDNA using PCR with 2 × Phanta Max Master Mix (Vazyme, Nanjing, China). The resulting fragment, including homology arms, was then inserted into the eukaryotic expression vector pPCAGGS, which was pre-digested with FastDigest Not Ⅰ (Thermo Fisher, Shanghai, China). Seamless cloning was performed using the Seamless Cloning Kit (Beyotime Biotechnology, Shanghai, China) to ligate the PRKG2 CDS into the vector. The integrity of the constructed vector was confirmed by DNA sequencing. Sequencing was carried out using forward primers 5'-GTTCGGCTTCTGGCGTGTGA-3' and 5' GACATGGTGGAATGCATGTA-3', and reverse primers 5'-CACACTGAAGTCATGTCCTT-3' and 5'-CCTTGCTCACCATAGATCTT-3'. Transfection and RNA extraction Transfection and RNA extraction Bovine granulosa cells were seeded in 24-well plates at a density of 5 × 10⁵ cells per well, and transfection was initiated when the cells reached 70–80% confluence. Cells were transfected with either a pCAGGS empty vector or a PRKG2 overexpression vector using Lipofectamine™ 8000 (Beyotime Biotechnology, Shanghai, China). The optimal plasmid concentration was determined according to the manufacturer’s guidelines. Briefly, 0.8 µg vector was diluted in 50 µL of Opti-MEM™ I Reduced Serum Medium (Gibco, CA, USA) and incubated at room temperature for 5 minutes. The diluted DNA was then combined with Lipofectamine 8000, mixed gently, and incubated for 20 minutes at room temperature. A 100 µL aliquot of the transfection mixture was added to each well containing 500 µL cell culture medium. Cells were harvested 24 hours post-transfection for further analysis. RNA extraction and purification were carried out using Trizol reagent. RNA isolation and Quantitative real-time PCR (RT-qPCR) Total RNA was extracted from bovine ovarian granulosa cells and COCs using the Trizol method, followed by reverse transcription with the HiScript® III RT SuperMix (Vazyme, Nanjing, China). qRT-PCR was conducted using the Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on the CFX Real-Time PCR Detection System, with data analysis performed using CFX Manager™ software. GAPDH served as the internal reference, and gene expression levels were quantified using the 2 −ΔΔCt method. The primer sequences are listed in Table 1 . Table 1 Primers for qRT-PCR Gene Name Primer Sequences (5’-3’) ATG3 Forward: GGTTGTTCGGCTATGATGAG Reverse: GGGAGATGAGGGTGATTTTC ATG5 Forward: TTT GAA TAT GAA GGC ACA CC Reverse: TGT AAA CCC ATC CAG AGTTG ATG7 Forward: ATTGCTGCATCAAGAGACCCA Reverse: CCTTCTGGCGATTATGGTCA BCL-2 Forward: ATGCGGCCCCTGTTTGATTT Reverse: GGCTTCACTTATGGCCCAGAT BAX Forward: CCCTTTTGCTTCAGGGTTTCA Reverse: TCAGACACTCGCTCAGCTTC CASPASE-3 Forward: GTTCATCCAGGCTCTTTGTG Reverse: AAGGACTCATATTCTATTGCTACC FAS Forward: AAAATGCCCACATGGCTGGT Reverse: CGTTTTTCCGTTTGCCAGGAG FASL Forward: TTTCATGGTTCTGGTGGCCC Reverse: GACTGGGGTGACCTATTTGC LC3 Forward: TTATCCGAGAGCAGCAGCATCC Reverse: AGGCTTGATTAGCATTGAGC TNF-α Forward: TCTCTCTCACATACCCTGCCA Reverse: CCCGGATCATGCTTTTGGTG P62 Forward: AGGACTGAAGGAAGCTGCAC Reverse: GAGAGGGACTCAATCAGCCG GAPDH Forward: CACCCTCAAGATTGTCAGCA Reverse: GGTCATAAGTCCCTCCACGA Western blotting analysis Bovine granulosa cells were lysed in RIPA buffer, and protein concentrations were quantified using the BCA protein assay kit (Beyotime Biotechnology, Shanghai, China). Proteins were resolved by SDS-PAGE and transferred onto a PVDF membrane. The membrane was incubated overnight at 4°C with primary antibodies, followed by a 2-hour incubation at room temperature with HRP-conjugated secondary antibodies. Protein bands were visualized using the Tanon-4200 imaging system (Tanon, Shanghai, China). Band intensities were quantified with ImageJ, and data were analyzed using GraphPad Prism 9.0. The antibodies used were as follows: CASPASE-3 (Proteintech, 19677-1-AP), ATG-5 (Santa Cruz Biotechnology, sc-133158), and LC-3 (Proteintech, 18725-1-AP). RNA-seq data processing and analysis Bovine granulosa cells were harvested 24 hours post-treatment, and total RNA was extracted using the Trizol method. RNA sequencing was performed by Anoroad (Beijing, China), with RNA concentration and integrity assessed using a Nanodrop spectrophotometer and Agilent 2100 bioanalyzer. mRNA was enriched using Oligo(dT) magnetic beads, followed by fragmentation and first-strand cDNA synthesis using random oligonucleotide primers in an M-MuLV reverse transcriptase system. The RNA strand was degraded by RNaseH, and second-strand cDNA was synthesized using DNA polymerase I. The double-stranded cDNA was purified, end-repaired, A-tailed, and ligated to sequencing adapters. cDNA fragments of approximately 250–300 bp were selected using AMPure XP beads, followed by PCR amplification and further purification with AMPure XP beads. The library was constructed using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA, E7530L). After preliminary quantification with a Qubit 2.0 Fluorometer, the library was diluted to 1.5 ng/µL. The insert size was confirmed with an Agilent 2100 bioanalyzer, and the effective library concentration (> 1.5 nM) was determined by RT-qPCR. Sequencing was performed on an Illumina platform using the sequencing-by-synthesis method, wherein each incorporated fluorescently labeled dNTP emits a specific signal captured by the sequencer, generating the corresponding sequence information. Statistical analysis This study mainly uses Excel and GraphPad software for statistical analysis of data. Immunofluorescence intensity and cell number were analyzed using Image J software. The statistical analysis of significance between two groups used two independent samples t test, and the statistical analysis of significance between multiple groups used one-way analysis of variance. Significance is marked differently according to the P value, "*" represents P < 0.05, "**" represents P < 0.01 and "***" represents P < 0.001. Results Transcriptomic analysis reveals the effects of CNP on granulosa cells in bovine To investigate the potential regulatory effects of CNP on granulosa cell function, we performed transcriptome sequencing on CNP-treated granulosa cells. Principal component analysis (PCA) demonstrated high intra-group consistency and clear inter-group separation among treatments (Fig. 1 A). Differential expression analysis with DESeq2 identified 1,084 differentially expressed genes (DEGs), visualized using a volcano plot. Compared to controls, 545 genes were downregulated and 539 upregulated in CNP-treated granulosa cells (Fig. 1 B). Gene Ontology (GO) enrichment analysis revealed significant overrepresentation of processes related to apoptotic regulation and signaling (Fig. 1 C). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis indicated enrichment in the TNF, IL17, NF-κB, PI3K-AKT, and cGMP-PKG signaling pathways (Fig. 1 D). Gene Set Enrichment Analysis (GSEA) further demonstrated significant downregulation of gene sets involved in apoptosis, NF-κB, TNF, and related signaling pathways following CNP treatment (Fig. 1 E). Collectively, these results suggest that CNP significantly affected the transcriptional profile of granulosa cells, especially signaling pathways and biological processes associated with apoptosis. CNP alleviates apoptosis of ovarian mural granulosa cells We examined the effect of C-type natriuretic peptide (CNP) on apoptosis in ovarian mural granulosa cells cultured under serum-free conditions, a well-established model for inducing apoptosis [ 20 ]. Cell purity was confirmed via immunofluorescence staining for follicle-stimulating hormone receptor (FSHR), a granulosa cell-specific marker. Nearly all isolated cells exhibited positive FSHR staining, verifying their identity as ovarian mural granulosa cells (Fig. 2 A). TUNEL staining was employed to assess the effect of CNP on apoptosis in ovarian granulosa cells. The proportion of TUNEL-positive cells was significantly reduced in the CNP-treated group compared to controls ( P < 0.001) (Fig. 2 B, C). Quantitative real-time PCR analysis revealed significant downregulation of pro-apoptotic genes CASPASE-3 , FAS , FASL , and TNF-α , accompanied by upregulation of the anti-apoptotic gene BCL-2 ( P < 0.05) (Fig. 2 D). Western blotting confirmed these findings, demonstrating marked downregulation of CASPASE-3 protein in CNP-treated granulosa cells (Fig. 2 F). Numerous studies have established that autophagy substantially contributes to apoptosis in ovarian granulosa cells [ 21 ]. Notably, CNP administration significantly decreased mRNA levels of autophagy-related genes ATG3 , ATG5 , ATG7 , and LC3 ( P < 0.05) (Fig. 2 E). Furthermore, protein levels of LC3B-II and ATG5 were reduced in CNP-treated cells (Fig. 2 F). Collectively, these data indicate that CNP inhibits both apoptosis and autophagy in ovarian mural granulosa cells. CNP suppresses cumulus cell apoptosis independently of oocytes In the ovary, cumulus cells predominantly express natriuretic peptide receptor 2 (NPR2), whose expression is regulated by oocytes [ 10 , 22 ]. To assess whether CNP influences apoptosis of cumulus granulosa cells in an oocyte-dependent manner, we cultured COCs and OOXs (Fig. 3 A). TUNEL staining demonstrated that CNP treatment significantly decreased apoptosis levels in both COCs and OOXs compared to controls ( P 0.05) (Fig. 3 B, D). Quantitative real-time PCR revealed that CNP significantly downregulated the expression of apoptosis-related genes BAX , CASP3 , FAS , and FASL , as well as autophagy-related genes ATG3 , ATG5 , ATG7 , and LC3 in cumulus cells ( P < 0.05) (Fig. 3 E). These results suggest that CNP inhibits apoptosis of cumulus cells independently of the presence of oocytes. CNP inhibits apoptosis of ovarian granulosa cells independently of PKG Building on the observed anti-apoptotic effects of CNP on ovarian granulosa cells, we investigated the specific pathways mediating this response. Previous studies have established the role of the cGMP-PKG pathway in mediating CNP’s physiological effects [ 23 ]. Accordingly, we explored whether cGMP-PKG is involved in CNP-mediated inhibition of apoptosis in ovarian granulosa cells. To investigate this, granulosa cells were treated with 8-Br-cGMP (a cGMP analog) and KT5823 (a PKG inhibitor). TUNEL staining showed that treatment with 8-Br-cGMP, alone or combined with CNP, significantly reduced apoptosis compared to controls ( P < 0.05) (Fig. 4 A, B). However, KT5823 did not reverse CNP’s anti-apoptotic effect; notably, treatment with KT5823 alone also significantly reduced apoptosis levels ( P < 0.001) (Fig. 4 C, D). Quantitative real-time PCR revealed that 8-Br-cGMP alone or combined with CNP significantly downregulated FASL mRNA levels ( P < 0.05) (Fig. 4 E). Both CNP and KT5823 downregulated apoptosis- and autophagy-related genes, with combined treatment significantly decreasing BAX , CASPASE-3 , and ATG5 mRNA levels ( P < 0.05) (Fig. 4 F). These findings suggest that CNP’s anti-apoptotic effect in ovarian granulosa cells is independent of the cGMP-PKG pathway, and that PKG may paradoxically promote apoptosis in these cells. PKG induces apoptosis in ovarian granulosa cells To avoid potential off-target effects of KT5823, we overexpressed PKG in ovarian granulosa cells to further clarify its role in apoptosis. Efficient PKG overexpression was confirmed in granulosa cells (Fig. 5 A). Subsequent TUNEL assays demonstrated a significant increase in apoptosis in PKG-overexpressing cells relative to controls ( P < 0.001) (Fig. 5 B, C). Quantitative real-time PCR analysis revealed significant upregulation of mRNA levels for apoptosis-related genes CASPASE-3 , FAS , FASL and LC3 in the PKG-overexpressing group (Fig. 5 D). These findings indicate that PKG acts as a positive regulator of apoptosis in ovarian granulosa cells. PKG inhibition enhances the developmental competence of in vitro matured oocytes During in vitro culture of COCs, the health and function of cumulus cells are essential for supporting oocyte maturation and developmental competence. Impaired cumulus cell viability has been associated with reduced oocyte quality following maturation [ 24 ]. Based on our previous findings that inhibition of PKG alleviates apoptosis in ovarian granulosa cells, we further examined whether PKG inhibition could reduce apoptosis in cumulus cells and improve oocyte developmental potential during in vitro COC culture (Fig. 6 A). The results show that KT5823 treatment significantly decreased apoptosis in cumulus granulosa cells compared to controls ( P < 0.001) (Fig. 6 B, C). Furthermore, KT5823 supplementation during in vitro maturation significantly increased blastocyst formation rates ( P < 0.05) (Fig. 6 D). Quantitative analysis of lineage-specific cell populations revealed that KT5823 treatment significantly increased the ICM/TE ratio, as evidenced by a higher proportion of SOX2-positive inner cell mass (ICM) cells relative to CDX2-positive trophectoderm (TE) cells (Fig. 6 E, F). To evaluate potential species conservatism effects, 1 µM KT5823 was added to the in vitro maturation medium of ovine oocytes, which similarly resulted in a significant increase in blastocyst formation rate ( P < 0.05) (Fig. 6 G). Collectively, these results indicate that PKG inhibition during in vitro maturation reduces cumulus cell apoptosis and enhances oocyte developmental competence in both bovine and ovine species. Discussion This study demonstrates that the anti-apoptotic effect of CNP is replicated by cGMP. Although both 8-Br-cGMP and CNP exhibited comparable anti-apoptotic effects, these effects were not mediated through the cGMP downstream effector, PKG. Moreover, overexpression of the PKG-encoding gene PRKG2 increased apoptosis in bovine ovarian granulosa cells, while the PKG inhibitor KT5823 did not influence CNP’s anti-apoptotic action. Interestingly, KT5823 alone exerted anti-apoptotic effects and enhanced the developmental competence of in vitro matured oocytes. These findings suggest that the anti-apoptotic effect of CNP is independent of a PKG-dependent pathway and that PKG inhibition improve the quality of oocytes matured in vitro by reducing cumulus cell apoptosis. Granulosa cells encase the oocyte, forming the follicle structure and orchestrating follicle development, maturation, and atresia. Apoptosis of granulosa cells is a fundamental mechanism underlying follicular atresia, governed by hormones, steroids, cytokines, and growth factors, and involving multiple signaling pathways. During follicular development, granulosa cell apoptosis and autophagy are widely recognized as key drivers of follicular atresia [ 25 ]. The interaction between CNP and ovarian granulosa cells remains poorly understood. In this study, CNP treatment effectively mimicked the physiological state of granulosa cells in healthy follicles, significantly downregulating gene expression associated with the apoptosis signaling pathways, NF-κB signaling pathways and TNF signaling pathways. These findings establish a theoretical foundation for the potential role of CNP in mitigating ovarian granulosa cell apoptosis, warranting further clinical investigation. The FAS/FASL pathway is widely recognized as a key mediator of granulosa cell apoptosis, where activation of FAS triggers the recruitment of FADD, subsequently inducing CASPASE-8 and initiating apoptosis. However, our findings revealed a downregulation of FASL in both GCs and COCs [ 26 ]. This suggests that CNP may mitigate granulosa cell apoptosis through alternative pathways, such as the mitochondrial apoptotic pathway. Moreover, TNF-α promotes granulosa cell apoptosis, a process that can be inhibited by CASPASE inhibitors [ 27 ]. The BCL-2 family regulates mitochondrial and intracellular apoptotic pathways, comprising both anti-apoptotic (BCL-2) and pro-apoptotic (BAX) proteins [ 28 ]. This study shows that CNP significantly reduces the mRNA and protein levels of CASPASE-3, FASL, and TNF-α, while markedly increasing the mRNA and protein levels of BCL-2. Additionally, CNP inhibits granulosa cell apoptosis and reduces autophagy levels. Autophagy generally acts as a cytoprotective mechanism under conditions such as hypoxia, starvation, and nutrient deprivation. However, when apoptotic pathways are activated, autophagy can become maladaptive and contribute to cell death [ 29 ]. Research indicates that LC3 protein expression is elevated in rat granulosa cells, suggesting that autophagy predominantly occurs within these cells and may contribute to follicular atresia through granulosa cell death [ 30 ]. LC3, P62, ATG3, ATG5, and ATG7 serve as markers of autophagy [ 31 ]. This study demonstrates that CNP mitigates autophagy levels in bovine granulosa cells, as evidenced by reduced mRNA expression of LC3, P62, and ATG5. The precise molecular circuitry through which CNP attenuates autophagic flux in granulosa cells remains to be systematically elucidated and warrants comprehensive investigation in future studies. Previous studies have not observed apoptotic cumulus cells in COCs from atretic follicles, potentially due to variations in criteria for classifying follicles or COCs as healthy or atretic [ 32 ]. In contrast, our study found that COCs cultured for 24 hours without serum exhibited a small number of apoptotic cumulus cells, as indicated by TUNEL staining. Furthermore, CNP treatment significantly reduced cumulus cell apoptosis. Notably, the anti-apoptotic effect of CNP appears independent of oocytes, as there was no significant difference in apoptosis levels between OOXs and COCs, while the apoptosis level in the surrounding granulosa cells was markedly higher than in cumulus cells. These findings support earlier research suggesting that oocytes inhibit cumulus cell apoptosis during early atresia, with the onset of apoptosis in COCs marking the cessation of follicular atresia [ 26 ]. In this study, we observed that CNP treatment significantly down-regulated apoptosis in OOXs. Granulosa cells and oocytes are intricately linked in both tissue structure and function. The apoptosis of granulosa cells directly influences oocyte development, subsequently impacting female reproductive function. Factors such as insulin-like growth factor 1 (IGF-1), epidermal growth factor (EGF), thyroxine (T4), growth hormone (GH), and estradiol play critical roles in cell survival, proliferation, and apoptosis inhibition [ 33 – 36 ]. cAMP and cGMP act as second messengers in the downstream signaling pathways of various growth factors [ 37 – 41 ]. Research indicates that cGMP in granulosa cells is activated by the NPPC/NPR2 system, and this cGMP is subsequently transferred to oocytes via gap junctions [ 10 ]. Our study demonstrates that cGMP markedly reduces apoptosis in bovine ovarian granulosa cells. Notably, the anti-apoptotic effect of CNP is more pronounced when combined with cGMP, likely due to CNP's role in enhancing cGMP expression [ 42 ]. Intracellular cGMP signaling primarily regulates its effects through downstream effector proteins, predominantly PKG [ 43 ]. PKG, a serine/threonine protein kinase, is the principal mediator of cGMP signaling and is involved in various cellular processes, including apoptosis, differentiation, and neural plasticity [ 12 ]. Despite its significant role, the effects of PKG on ovarian granulosa cells and embryonic development remain underexplored. Notably, extensive research has linked PKG activation with increased cell apoptosis, suggesting a positive correlation between PKG stimulation and enhanced apoptotic processes. Research indicates that the upregulation of the cGMP/PKG pathway in the nervous system contributes to dopamine neuron degeneration and apoptosis. Conversely, inhibition of PKG mitigates this increase in cell death [ 14 ]. In this study, we observed that cGMP mediates the anti-apoptotic effects of CNP in granulosa cells. To investigate whether the downstream PKG signaling pathway is involved, we employed the PKG inhibitor KT5823. Notably, after 24 hours of treatment, blocking PKG signaling did not abrogate the anti-apoptotic effect of CNP on granulosa cells, consistent with findings in neuronal cells. Although the precise molecular mechanisms through which PKG affects apoptosis remain unclear, it is likely that PKG influences apoptosis by regulating members of the BCL-2 and CASPASE families. Previous studies have demonstrated that activation of PKG via the Nitric Oxide / cyclic Guanosine Monophosphate (NO/cGMP) signaling pathway upregulates Bax and caspase-3, while inhibition of PKG reduces levels of pro-apoptotic proteins such as BAX and CASPASE3, thereby attenuating apoptosis [ 14 ]. These results indicate that the PKG signaling pathway does not mediate the anti-apoptotic effects of CNP on granulosa cells. Other signaling pathways may be implicated in this process, warranting further investigation. During the in vitro maturation of oocytes, apoptotic or functionally impaired cumulus cells result in a decline in oocyte quality, which subsequently affects their developmental potential [ 44 – 48 ]. Our results indicate that the incorporation of a PKG inhibitor into the IVM culture medium significantly enhances the developmental potential of oocytes, evident from an elevated blastocyst rate, an augmented number of ICM cells, and an improved ICM/TE ratio. This beneficial effect can be attributed, at least in part, to the improved state of cumulus cells. More crucially, we have demonstrated that inhibiting PKG to improve the oocyte quality may exhibit species conservation. Although the live birth rate of IVM (30%-40%) is still lower than that of traditional in vitro fertilization (IVF) (50%-60%), its advantages in safety, cost-effectiveness, and ethical acceptability make it the preferred or only feasible clinical assisted reproductive option for specific populations, including those with PCOS, cancer patients, and individuals in resource-limited areas [ 49 ]. Our study may provide a promising strategy for improving the human oocyte IVM system and advancing human assisted reproductive technology (ART). Conclusion In summary, our study elucidates the role of CNP in inhibiting follicular granulosa cell apoptosis, which is not dependent on the typical downstream target of cGMP, PKG. Conversely, we found that PKG actually serves as an inducer of ovarian granulosa cell apoptosis. Furthermore, based on these findings, we developed a feasible approach to improve the quality of in vitro matured oocytes by inhibiting cumulus cell apoptosis through the supplementation of PKG inhibitor in IVM medium, which provides scientific evidence for its application in both human ART and in vitro production of agricultural animal embryos. Declarations Acknowledgements Y.W. and H.D. performed the experiments and analyzed the data. Q.L. participated in data analysis processes. Y.W., L.A., J.T. and G.X. conceived the experimental designs. Y.W. and G.X. wrote the manuscript. Author contributions All authors participated in study design, data analysis and interpretation. Funding This study was supported by the Sci-Tech Innovation 2030 Agenda (No. 2023ZD040750202), the National Natural Science Foundation of China (Grant No. 32202672), the Major Science and Technology Project of Xinjiang Autonomous Region (No. 2023A02011), and the Central Guidance for Local Science and Technology Development Funds (No. 2024ZY0160). Availability of data and materials The dataset generated and analyzed during the current study are available in the PRJCA042776 repository [https://ngdc.cncb.ac.cn/gsub/]. Ethics approval and consent to participate N/A. Consent for publication N/A. Competing interests The authors declare no competing interests. Author details 1 Key Laboratory of Animal Genetics, Breeding and Reproduction of the Ministry of Agriculture and Rural Affairs, National Engineering Laboratory for Animal Breeding, College of Animal Science and Technology, China Agricultural University, Beijing, China References Shi S, Hu Y, Song X, et al. Totipotency of miR-184 in porcine granulosa cells. Mol Cell Endocrinol. 2022;558:111765. Matsuda F, Inoue N, Manabe N, et al. Follicular growth and atresi-a in mammalian ovaries: regulation by survival and death of granulosa cells. J Reprod Dev. 2012;58(1):44-50. Dong Y, Chen H, Gao J, et al. Molecular machinery an-d interplay of apoptosis and autophagy in coronary heart disease. J Mol Cell Cardiol. 2019;136:27-41. Obeng E. Apoptosis (programmed cell death) and its signals-A review. Braz J Biol. 2020;81(4):1133-43. Zhang C, Guo L, Zhu B, et al. Effects of 3, 5, 3′-triiodothyronine (t3) and follicle stimulating hormone on apoptosis and proliferation of rat ovarian granulosa cells. Chin J Physiol. 2013;56(5):298-305. Du X, Zhang L, Li X, et al. TGF-β signaling controls FSHR signaling-reduced ovarian granulosa cell apoptosis through the SMAD4/miR-143 axis. Cell Death Dis. 2016;7(11):e2476-e2476. Han Y, Wang S, Wang Y, et al. IGF-1 inhibits apoptosis of porcine primary granulosa cell by targeting degradation of BimEL. Int J Mol Sci. 2019;20(21):5356. Guo Z, Lu H, Li Q, et al. Estrogen receptor β mediates the feedback loop between 17β-Estradiol and CYP19A1, which controls transcriptomic stability, inhibits granulosa cell apoptosis, induces oocyte maturation and influences sow fertility. Int J Biol Macromol. 2025;317(Pt 2):144879. Koller KJ, Lowe DG, Bennett GL, et al. Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP). Science. 1991;252(5002):120-3. Zhang M, Su YQ, Sugiura K, et al. Granulosa cell ligand NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes. Science. 2010;330(6002):366-9. Xi G, Wang W, Fazlani SA, et al. C-type natri-uretic peptide enhances mouse preantral follicle growth. Reproduction. 2019;157(5):445-55. Shariatpanahi M, Khodagholi F, Ashabi G, et al. The involvement of protein kinase G inhibitor in regulation of apoptosis and autophagy markers in spatial memory deficit induced by Aβ. Fundam Clin Pharmacol. 2016;30(4):364-75. Wu Y, Cai Q, Li W, et al. Active PKG II inhibite-d the growth and migration of ovarian cancer cells through blocking Raf/MEK and PI3K/Akt signaling pathways. Biosci Rep. 2019;39(8):BSR20190405. Wu Y, Yuan M, Su W, et al. The constitutive-ly active PKG II mutant effectively inhibits gastric cancer development via a blockade of EGF/EGFR-associated signalling cascades. Ther Adv Med Oncol. 2018;10:1758834017751635. Yoo YM, Jung EM, Ahn C, et al. Nitric oxide prevents H2O2-ind-uced apoptosis in SK-N-MC human neuroblastoma cells. Int J Biol Sci. 2018;14(14):1974. Trounson A, Wood C, Kausche A. In vitro maturation and the fertilization and developmental competence of oocytes recovered from untreated polycystic ovarian patients. Fertil Steril. 1994;62(2):353-62. Yang ZY, Chian RC. Development of in vitro maturation techniques for clinical applications. Fertil Steril. 2017;108(4):577-84. Jones GM, Cram DS, Song B, et al. Gene expression profiling of human oocytes following in vivo or in vitro maturation. Hum Reprod. 2008;23(5):1138-44. Shimoi G, Tomita M, Kataoka M, et al. Destabilization of spin-dle assembly checkpoint causes aneuploidy during meiosis II in murine post-ovulatory aged oocytes. J Reprod Dev. 2019;65(1):57-66. D'Herde K, Leybaert L. Intracellular free calcium related to apoptotic ce-ll death in quail granulosa cell sheets kept in serum-free culture. Cell Death Differ. 1997;4(1):59-65. Stringer JM, Alesi LR, Winship AL, et al. Beyond apoptosis: eviden-ce of other regulated cell death pathways in the ovary throughout development and life. Hum Reprod Update. 2023;29(4):434-56. Xi G, An L, Jia Z, et al. Natriuretic peptide receptor 2 (NPR2) localized in bovine oocyte underlies a unique mechanism for C-type natriuretic peptide (CNP)-induced meiotic arrest. Theriogenology. 2018;106:198-209. Wu K, Mei C, Chen Y, et al. C-type natriuretic pept-ide regulates sperm capacitation by the cGMP/PKG signalling pathway via Ca2+ influx and tyrosine phosphorylation. Reprod Biomed Online. 2019;38(3):289-99. Coticchio G, Dal Canto M, Mignini Renzini M, et al. Oocyte maturation: gamete-somatic cells interactions, meiotic resumption, cytoskeletal dynamics and cytoplasmic reorganization. Hum Reprod Update. 2015;21(4):427-54. Jiang JY, Cheung CK, Wang Y, et al. Regulation of cell death and cell survival gene expression during ovarian follicular development and atresia. Front Biosci. 2003;8:d222-d37. Manabe N, Imai Y, Ohno H, et al. Apoptosis occurs in granulosa cells but not cumulus cells in the atretic antral follicles in pig ovaries. Experientia. 1996;52(7):647-51. Jääskeläinen M, Kyrönlahti A, Anttonen M, et al. TRAIL pathway components and their putative role in granulosa cell apoptosis in the human ovary. Differentiation. 2009;77(4):369-76. Tano M, Minegishi T, Kishi H, et al. The e-ffect of follicle-stimulating hormone (FSH) on the expression of FSH receptor in cultured rat granulosa cells. Life Sci. 1999;64(12):1063-9. Zheng Y, Ma L, Liu N, et al. Autophagy an-d apoptosis of porcine ovarian granulosa cells during follicular development. Animals. 2019;9(12):1111. Choi J, Jo M, Lee E, et al. Induction of apoptotic cell death via acc-umulation of autophagosomes in rat granulosa cells. Fertil Steril. 2011;95(4):1482-6. Gawriluk TR, Rucker EB. BECN1, corpus luteum function, and preterm labor. Autophagy. 2015;11(1):183-4. Durlinger AL, Kramer P, Karels B, et al. Apoptotic and proliferative changes during induced atresia of pre-ovulatory follicles in the rat. Hum Reprod. 2000;15(12):2504-11. Sharma GT, Dubey PK, Kumar GS. Effects of IGF-1, TGF-α plus TGF-β1 and bFGF on in vitro survival, growth and apoptosis in FSH-stimulated buffalo (Bubalis bubalus) preantral follicles. Growth Horm IGF Res. 2010;20(4):319-25. Markstrom E, Svensson E, Shao R, et al. Survival factors regulating ovarian apoptosis--dependence on follicle differentiation. Reproduction. 2002;123(1):23-30. Chun SY, Hsueh AJ. Paracrine mechanisms of ovarian follicle apoptosis. J Reprod Immunol. 1998;39(1-2):63-75. Hsueh AJ, Billig H, Tsafriri A. Ovarian follicle atresia: a hormonally co-ntrolled apoptotic process. Endocr Rev. 1994;15(6):707-24. Mani SK, Oyola MG. Progesterone signaling mechanisms in brain and b-ehavior. Front Endocrinol (Lausanne). 2012;3:7. Vaccari S, Weeks JL 2nd, Hsieh M, et al. Cyclic GMP signaling is involved in the luteinizing hormone-dependent meiotic maturation of mouse oocytes. Biol Reprod. 2009;81(3):595-604. Norris RP, Ratzan WJ, Freudzon M, et al. Nikolaev VO, Jaffe LA. Cyclic GMP from the surrounding somatic cells regulates cyclic AMP and meiosis in the mouse oocyte. Development. 2009;136(11):1869-78. Lee SY, Andoh T, Murphy DL, et al. 17β‐Estradiol activates ICI 182,780‐sensitive estrogen receptors and cyclic GMP‐dependent thioredoxin expression for neuroprotection. FASEB J. 2003;17(8):1-20. Butt E, Geiger J, Jarchau T, et al. The cGMP-dependent protein kinase-gene, protein, and function. Neurochem Res. 1993;18(1):27-42. Wigglesworth K, Lee KB, O’Brien MJ, et al. Bidirectional communication between oocytes and ovarian follicular somatic cells is required for meiotic arrest of mammalian oocytes. Proc Natl Acad Sci U S A. 2013;110(39):E3723-E9. Mangmool S, Duangrat R, Parichatikanond W, et al. New therapeut-ics for heart failure: focusing on cGMP signaling. Int J Mol Sci. 2023;24(16):12866. Downs SM. The influence of glucose, cumulus cells, and metabolic cou-pling on ATP levels and meiotic control in the isolated mouse oocyte. Dev Biol. 1995;167(2):502-12. Fontana J, Martínková S, Petr J, et al. Metabolic coop-eration in the ovarian follicle. Physiol Res. 2020;69(1):33-48. Su YQ, Sugiura K, Eppig JJ. Mouse oocyte control of granulosa cell de-velopment and function: paracrine regulation of cumulus cell metabolism. Semin Reprod Med. 2009;27(1):32-42. Niles LP, Wang J, Shen L, et al. Melatonin receptor mRNA expression in human granulosa cells. Mol Cell Endocrinol. 1999;156(1-2):107-10. Reiter RJ, Tamura H, Tan DX, et al. Melatonin and the circadian sys-tem: contributions to successful female reproduction. Fertil Steril. 2014;102(2):321-8. Wessel JA, Hunt S, van Wely M, et al. Alternatives to in vi-tro fertilization. Fertil Steril. 2023;120(3 Pt 1):483-93. Additional Declarations No competing interests reported. Supplementary Files Additionalfiles1.pptx Cite Share Download PDF Status: Published Journal Publication published 05 Dec, 2025 Read the published version in Journal of Ovarian Research → Version 1 posted Editorial decision: Revision requested 24 Sep, 2025 Reviews received at journal 24 Sep, 2025 Reviews received at journal 14 Sep, 2025 Reviewers agreed at journal 10 Sep, 2025 Reviewers agreed at journal 09 Sep, 2025 Reviewers invited by journal 09 Sep, 2025 Editor assigned by journal 08 Sep, 2025 Submission checks completed at journal 08 Sep, 2025 First submitted to journal 28 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7484101","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":514967814,"identity":"e06fbdd8-e7fb-4cda-9837-e5e5e2fe6fdd","order_by":0,"name":"Yi Wei","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Wei","suffix":""},{"id":514967816,"identity":"a25d9d2b-90af-4de7-a9d5-84def744aa8c","order_by":1,"name":"Hong Deng","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Hong","middleName":"","lastName":"Deng","suffix":""},{"id":514967820,"identity":"c6081d66-1713-4fdd-9725-24613a7ca895","order_by":2,"name":"Qi Liu","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qi","middleName":"","lastName":"Liu","suffix":""},{"id":514967821,"identity":"5d86f78d-fc97-4803-8d7d-1bf58ea1bd50","order_by":3,"name":"Yingjie Wu","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yingjie","middleName":"","lastName":"Wu","suffix":""},{"id":514967822,"identity":"4c7dbb45-22e2-4c41-aa3f-8eb2826e47ad","order_by":4,"name":"Lei An","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Lei","middleName":"","lastName":"An","suffix":""},{"id":514967823,"identity":"509425f3-402c-417b-8f84-8a6c5834fc53","order_by":5,"name":"Jianhui Tian","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jianhui","middleName":"","lastName":"Tian","suffix":""},{"id":514967824,"identity":"80f772af-59a2-455f-bca6-45d7864e3184","order_by":6,"name":"Guangyin Xi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+ElEQVRIiWNgGAWjYDACZijNxsB84MCHCgk5eRK0sCUenHHGwtiwgXj7eJQP87ZVJDIcIKDO4Dj7NYmfO2oT+6R7GA7wzpNIYGxgfvjoBh4tks08ZZK9Z44ntsmcPXBAcptEHjsDm7FxDh4t/Mw8aRK8bccS2yTyEg4YbpMoZmzgYZPGp4UNqEXyL1hLjsGBxDkSiQ0HCGjhZ2Y/Js3bVgPRcrCBCC1AvzBby7YdMG6TSEs42HBMwtiwmYBfDM4ff3jzbVud7PwZyYc//6mpk5Nnb374GJ8WYHQYAInDjg1wAWacSmGA/QGQqLMnqG4UjIJRMApGLgAA9FVOIicnnLwAAAAASUVORK5CYII=","orcid":"","institution":"China Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Guangyin","middleName":"","lastName":"Xi","suffix":""}],"badges":[],"createdAt":"2025-08-29 02:23:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7484101/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7484101/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13048-025-01879-w","type":"published","date":"2025-12-05T15:58:16+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":91415258,"identity":"58ebdcc4-b41a-4e2d-b27f-fc2739583dcf","added_by":"auto","created_at":"2025-09-16 09:16:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":152415,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptomic analysis of CNP-treated bovine granulosa cells. \u003cstrong\u003eA\u003c/strong\u003e Principal component analysis (PCA) of transcriptomes from control and CNP-treated granulosa cells shows clear separation between groups; \u003cstrong\u003eB\u003c/strong\u003e Volcano plot of differentially expressed genes (DEGs), with 539 upregulated and 545 downregulated (\u003cem\u003eP\u003c/em\u003e ≤ 0.05, |log₂FC| ≥ 1); \u003cstrong\u003eC\u003c/strong\u003eGene Ontology (GO) enrichment analysis reveals significant enrichment in terms related to apoptosis, including “regulation of apoptotic process,” “regulation of programmed cell death,” and “apoptotic process”; \u003cstrong\u003eD\u003c/strong\u003e Bubble plot of KEGG pathway enrichment, highlighting DEGs enriched in pathways such as TNF signaling, PI3K-AKT signaling, and cGMP-PKG signaling; \u003cstrong\u003eE\u003c/strong\u003e Gene Set Enrichment Analysis (GSEA) plots showing significant downregulation of apoptosis-related pathways in CNP-treated granulosa cells\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7484101/v1/cfd38251fbee167fcd3778b7.png"},{"id":91415259,"identity":"2d5d7fc0-5933-4cf3-9763-94067aa2ebe9","added_by":"auto","created_at":"2025-09-16 09:16:17","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":172695,"visible":true,"origin":"","legend":"\u003cp\u003eCNP alleviates apoptosis of bovine ovarian mural granulosa cells\u003c/p\u003e\n\u003cp\u003eCNP reduces apoptosis and autophagy in bovine ovarian granulosa cells. \u003cstrong\u003eA\u003c/strong\u003e Immunofluorescence staining for the granulosa cell marker FSHR in bovine ovarian granulosa cells. Green: FSHR; Blue: DAPI. Scale bar, 50 μm; \u003cstrong\u003eB\u003c/strong\u003e TUNEL assay of granulosa cells treated with or without CNP. Green: TUNEL; Blue: DAPI. Scale bar, 200 μm; \u003cstrong\u003eC\u003c/strong\u003e Quantification of apoptosis based on the ratio of TUNEL (green) fluorescence intensity to DAPI-stained nuclear area (blue); \u003cstrong\u003eD, E\u003c/strong\u003e Relative mRNA expression levels of apoptosis-related genes \u003cstrong\u003eD\u003c/strong\u003eand autophagy-related genes \u003cstrong\u003eE\u003c/strong\u003e after 24 h of CNP treatment, normalized to GAPDH; \u003cstrong\u003eF\u003c/strong\u003e Protein levels of CASPASE-3, LC3B and ATG5 assessed by Western blot analysis\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7484101/v1/269df67a93630fc64ee877a3.png"},{"id":91417739,"identity":"5ac57eb6-fbf9-4936-bcd8-69956d6f42a9","added_by":"auto","created_at":"2025-09-16 09:40:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":132782,"visible":true,"origin":"","legend":"\u003cp\u003eCNP suppresses cumulus cell apoptosis independently of oocytes\u003c/p\u003e\n\u003cp\u003eCNP inhibits cumulus cell apoptosis independently of oocyte presence. \u003cstrong\u003eA\u003c/strong\u003e Representative images of cumulus–oocyte complexes (COCs) and oocytectomized complexes (OOXs). Scale bar, 100 μm; \u003cstrong\u003eB, C\u003c/strong\u003eImmunofluorescence images of TUNEL-stained COCs and OOXs. Green: TUNEL; blue: DAPI. Scale bar, 50 μm; \u003cstrong\u003eD\u003c/strong\u003e Quantification of apoptosis based on the ratio of green fluorescence intensity (TUNEL) to the area of blue fluorescence (DAPI); \u003cstrong\u003eE\u003c/strong\u003e Relative mRNA levels of apoptosis- and autophagy-related genes in COCs after 24 h of CNP treatment, normalized to GAPDH\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7484101/v1/d97a225e14dd55cbed01cc26.png"},{"id":91415265,"identity":"0f3579b1-0d12-466b-9aad-bd6432b5da58","added_by":"auto","created_at":"2025-09-16 09:16:17","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":179223,"visible":true,"origin":"","legend":"\u003cp\u003eCNP inhibits apoptosis of ovarian granulosa cells independently of PKG\u003c/p\u003e\n\u003cp\u003eCNP exerts anti-apoptotic effects via cGMP, but not through the PKG pathway. \u003cstrong\u003eA\u003c/strong\u003e Representative TUNEL staining images of ovarian granulosa cells treated with 8-Br-cGMP for 24 h. Green: TUNEL; blue: DAPI. Scale bar, 200 μm; \u003cstrong\u003eB\u003c/strong\u003e Quantification of apoptosis based on the ratio of green fluorescence intensity (TUNEL) to blue fluorescence area (DAPI); \u003cstrong\u003eC\u003c/strong\u003e Representative TUNEL staining images of granulosa cells treated with KT5823 for 24 h. Green: TUNEL; blue: DAPI. Scale bar, 200 μm; \u003cstrong\u003eD\u003c/strong\u003eQuantification of apoptosis in KT5823-treated cells, calculated as in \u003cstrong\u003eB\u003c/strong\u003e; \u003cstrong\u003eE\u003c/strong\u003e Relative mRNA levels of apoptosis- and autophagy-related genes in granulosa cells following 8-Br-cGMP treatment, normalized to GAPDH; \u003cstrong\u003eF\u003c/strong\u003eRelative mRNA levels of apoptosis- and autophagy-related genes in granulosa cells following KT5823 treatment, normalized to GAPDH\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7484101/v1/ea481ba3c50a84122d5142e2.png"},{"id":91416578,"identity":"06542908-eadf-4413-bb61-4119971bcd38","added_by":"auto","created_at":"2025-09-16 09:32:17","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":67719,"visible":true,"origin":"","legend":"\u003cp\u003ePKG induces apoptosis in ovarian granulosa cells\u003c/p\u003e\n\u003cp\u003ePKG overexpression promotes apoptosis in bovine ovarian granulosa cells. \u003cstrong\u003eA\u003c/strong\u003e Quantification of PRKG2 mRNA levels in granulosa cells transfected with Lipofectamine™ 8000 alone (Lipo), Lipofectamine™ 8000 with vehicle (Lipo + vehicle), or Lipofectamine™ 8000 with the PRKG2 overexpression plasmid (Lipo + PRKG2). The Lipo and Lipo + vehicle groups served as negative and solvent controls, respectively; \u003cstrong\u003eB\u003c/strong\u003eRepresentative TUNEL staining images of granulosa cells 24 h after PRKG2 overexpression. Green: TUNEL; blue: DAPI. Scale bar = 50 μm; \u003cstrong\u003eC\u003c/strong\u003e Apoptosis was quantified as the ratio of green fluorescence intensity (TUNEL) to the area of blue fluorescence (DAPI); \u003cstrong\u003eD\u003c/strong\u003e Relative mRNA levels of apoptosis- and autophagy-related genes in PRKG2-overexpressing granulosa cells, normalized to GAPDH\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7484101/v1/51beb6b9f5fe55cb2194f8f0.png"},{"id":91416166,"identity":"0b397d69-5d43-4515-8ffb-c57a81870341","added_by":"auto","created_at":"2025-09-16 09:24:17","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":185537,"visible":true,"origin":"","legend":"\u003cp\u003ePKG inhibition enhances the developmental competence of in vitro matured oocytes\u003c/p\u003e\n\u003cp\u003eCNP improves oocyte developmental competence by modulating cumulus granulosa cell apoptosis. \u003cstrong\u003eA\u003c/strong\u003e Schematic diagram of the experimental design; \u003cstrong\u003eB\u003c/strong\u003e Representative TUNEL staining images of cumulus–oocyte complexes (COCs) treated with KT5823. Apoptosis was quantified by the ratio of green fluorescence intensity (TUNEL) to blue fluorescence area (DAPI); \u003cstrong\u003eC\u003c/strong\u003e. Green: TUNEL; blue: DAPI. Scale bar = 50 μm; \u003cstrong\u003eD\u003c/strong\u003eCleavage and blastocyst rates of bovine oocytes in designated groups; \u003cstrong\u003eE\u003c/strong\u003eImmunofluorescence images of SOX2 and CDX2 in blastocysts cultured with KT5823 during in \u003cem\u003evitro\u003c/em\u003e maturation (IVM). Scale bar = 20 μm; \u003cstrong\u003eF\u003c/strong\u003e Total cell number, trophectoderm (TE) cell number, inner cell mass (ICM) cell number, and ICM/TE ratio in blastocysts. TE and ICM cell numbers were determined by counting CDX2-positive and NANOG-positive cells, respectively; \u003cstrong\u003eG\u003c/strong\u003eCleavage and blastocyst rates of ovine oocytes in designated groups\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7484101/v1/7822bea41feef48630b7e236.png"},{"id":97724975,"identity":"d7dab527-a16d-40d7-881c-e6cbc4b201e1","added_by":"auto","created_at":"2025-12-08 16:14:00","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1756790,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7484101/v1/40e08401-25b9-4a90-aaeb-6e294d9171d3.pdf"},{"id":91415283,"identity":"41899bd8-4aa1-4117-9548-db95c6c29714","added_by":"auto","created_at":"2025-09-16 09:16:18","extension":"pptx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":7880428,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfiles1.pptx","url":"https://assets-eu.researchsquare.com/files/rs-7484101/v1/4caa110950fa16bb452666c5.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"C-type natriuretic peptide mitigates apoptosis in ovarian granulosa cells through the cGMP pathway independent of PKG signaling","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOvarian granulosa cells, the primary cellular component of follicular development, are crucial for supplying essential nutrients and maintaining the microenvironment for oocytes. Abnormal apoptosis in these cells has been demonstrated to impair follicle development [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Mammalian follicle development is a dynamic process regulated by various hormones and signaling factors. It is well-established that granulosa cell apoptosis is triggered when these cells fail to receive adequate anti-apoptotic signals or when pro-apoptotic factors are excessively activated, leading to follicular atresia [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Key apoptotic pathways involved include the death receptor (extrinsic) pathway, the mitochondrial (intrinsic) pathway, the endoplasmic reticulum stress pathway, and the caspase-independent pathway [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Current research on anti-apoptotic factors in follicular development primarily focuses on FSH, E2, TGF-β, and IGF-1. These factors exert their anti-apoptotic effects predominantly by interacting with surface receptors on granulosa cells, thereby modulating various apoptotic pathways [\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Follicular development is a complex, multifactorial process, and other regulatory factors likely play roles in this process. Research that focuses on identifying and characterizing these additional factors contributes to a better understanding of the mechanisms underlying female reproductive health.\u003c/p\u003e\u003cp\u003eC-type natriuretic peptide (CNP), encoded by the \u003cem\u003eNppc\u003c/em\u003e gene, is extensively distributed across various tissues and organs. It activates intracellular cyclic guanosine monophosphate (cGMP) synthesis by binding to natriuretic peptide receptor 2 (NPR2), which in turn regulating biological processes such as the cell cycle, autophagy, apoptosis, and metabolism [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Studies have shown that most oocytes in mature follicles in \u003cem\u003eNppc\u003c/em\u003e or \u003cem\u003eNpr2\u003c/em\u003e mutant mice failed to maintain meiotic arrest, suggesting that CNP is a key meiosis arrester [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. CNP produced by mural granulosa cells stimulated NPR2 localized in cumulus cells to generate cyclic guanosine monophosphate (cGMP), which was transferred to the oocyte through gap junctions between cumulus cells and the oocytes. The elevated cGMP inhibited the activity of phosphodiesterase 3A (PDE3A), thereby reducing cyclic adenosine monophosphate (cAMP) hydrolysis, sustaining high cAMP levels, and ultimately arresting meiosis at the diplotene stage [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Xi et al. demonstrated that the addition of CNP to the culture medium significantly enhanced the growth of preantral follicles and promoted granulosa cell viability independently of follicle-stimulating hormone [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, while the role of CNP in maintaining meiotic arrest has been extensively studied, its impact on granulosa cells, a key mediator in follicle development, remains underexplored.\u003c/p\u003e\u003cp\u003eProtein kinase G (PKG), a serine/threonine kinase and key mediator of cGMP signaling, plays a critical role in various cellular processes, including apoptosis, differentiation, and proliferation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Under different conditions, PKG has a dual role in regulating cell apoptosis. It has been reported that activation of the cGMP/PKG pathway was associated with dopamine neuron degeneration, while inhibition of PKG could reverse cell apoptosis [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, some studies have shown that inhibition of PKG can eliminate the effect of cGMP in alleviating hydrogen peroxide-induced apoptosis [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. While CNP and cGMP are known to enhance granulosa cell activity during follicular development, the role of PKG in this process remains poorly understood. Existing research suggests that cGMP-activated downstream pathways are complex and vary across cell types, leaving the specific effects of PKG on ovarian granulosa cells and its influence on follicular development largely unexplored.\u003c/p\u003e\u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003e maturation (IVM) is a technology that simulates the \u003cem\u003ein vivo\u003c/em\u003e environment under laboratory conditions to enable immature oocytes to complete meiosis and cytoplasmic maturation. IVM technology has important application value in assisted reproductive medicine, especially in the fields of treatment of polycystic ovary syndrome (PCOS), oocyte cryopreservation and embryo engineering [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. However, this technology still faces many challenges, such as the fact that oocytes matured \u003cem\u003ein vitro\u003c/em\u003e tend to show lower developmental potential compared to those matured \u003cem\u003ein vivo\u003c/em\u003e [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. This may be related to the \u003cem\u003ein vitro\u003c/em\u003e culture conditions that cannot fully mimic the complex physiological environment \u003cem\u003ein vivo\u003c/em\u003e, resulting in problems such as abnormal cell cycle regulation and chromosomal abnormalities [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. By optimizing culture conditions and improving the culture medium formula to simulate the \u003cem\u003ein vivo\u003c/em\u003e oocyte maturation environment, it is expected to improve the development potential of \u003cem\u003ein vitro\u003c/em\u003e matured oocytes. This will effectively promote the application of IVM technology in clinical practice, thereby improving the success rate and safety of assisted reproduction.\u003c/p\u003e\u003cp\u003eThe present study aimed to investigate the effects of CNP and PKG on the apoptosis of ovarian granulosa cells using various cell culture models. Our findings reveal that CNP exerts its anti-apoptotic effects via cGMP, rather than through PKG. Furthermore, inhibition of PKG significantly enhances the developmental potential of \u003cem\u003ein vitro\u003c/em\u003e matured oocytes, likely by mitigating apoptosis in cumulus cells. Therefore, our study not only provides new insights into understanding the mechanism of mammalian follicle development, but also presents a promising strategy for improving the quality of \u003cem\u003ein vitro\u003c/em\u003e matured oocytes.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eGranulosa cells, COCs and OOXs culture\u003c/h2\u003e\u003cp\u003eBovine ovaries obtained from the slaughterhouse were immersed in physiological saline containing penicillin and streptomycin, and transported to the laboratory within 3 hours. Follicular fluid was aspirated from antral follicles (3\u0026ndash;8 mm in diameter). Following a 30-minute incubation at 37\u0026deg;C, the fluid was filtered through a 40 \u0026micro;m cell strainer to isolate granulosa cells. The suspension was then centrifuged at 1200 rpm for 5 minutes and the granulosa cell pellet was resuspended and washed twice with DMEM/F12 medium supplemented with 2% penicillin and streptomycin. The washed bovine ovarian granulosa cells were subsequently seeded into culture dishes and incubated at 37\u0026deg;C in a 5% CO₂ atmosphere with saturated humidity for 24 hours.\u003c/p\u003e\u003cp\u003eCumulus-oocyte complexes (COCs), characterized by dense, uniformly cytoplasmic oocytes surrounded by 3\u0026ndash;4 layers of cumulus cells, were isolated under a stereomicroscope. Oocytes from selected COCs were mechanically removed to obtain oocytectomized complexes (OOXs). The isolated COCs and OOXs were then transferred to M199 medium containing 2% penicillin-streptomycin and washed twice. Following washing, the COCs and OOXs were plated in culture dishes and incubated at 38.5\u0026deg;C in a 5% CO₂ atmosphere with saturated humidity for 24 hours.\u003c/p\u003e\u003cp\u003e\u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003eembryo production\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe collected COCs were washed three times with BO-maturation solution. They were subsequently placed into a four-well culture plate containing 500 \u0026micro;L/well BO-maturation solution, which had been equilibrated for at least 2 hours. The plate was incubated at 38.5\u0026deg;C with 5% CO₂ and saturated humidity for 22 hours to allow for maturation. Post-maturation, the COCs were washed three times with BO-semen solution. They were then transferred to a four-well culture plate containing 500 \u0026micro;L/well fertilization solution, which had also been equilibrated for more than 2 hours. For fertilization, a tube of frozen semen was thawed in a 37\u0026deg;C water bath and added to a 15 mL centrifuge tube containing 6 mL of semen washing solution. The semen was gently mixed, centrifuged at 1800 r/min for 5 minutes, and the supernatant was discarded. This process was repeated twice, after which the sperm pellet was resuspended to a density of approximately 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e/mL. Subsequently, 75\u0026ndash;80 \u0026micro;L of the resuspended sperm was added to each well. The plate was incubated at 38.5\u0026deg;C with 5% CO₂ and saturated humidity for 16 hours. Following fertilization, the oocytes were transferred from the fertilization solution to washing solution. After removal of the cumulus cells in the washing solution, the oocytes were transferred to BO-IVC solution and washed three times. They were then placed into a BO-IVC four-well culture plate (500 \u0026micro;L/well, 50 oocytes/well, overlaid with mineral oil) that had been pre-equilibrated for approximately 4 hours, and cultured for 7 days.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eTdT-mediated dUTP nick end labeling (TUNEL) assay\u003c/h3\u003e\n\u003cp\u003eCells or embryos removed from the culture medium were washed with 0.1% PBS-PVP and fixed in 4% paraformaldehyde overnight at 4\u0026deg;C. Following fixation, samples were washed three times and permeabilized with 0.5% Triton X-100 in PBS at room temperature for 1 hour. TUNEL staining was performed using the One-Step TUNEL Cell Apoptosis Detection Kit (Beyotime, Shanghai, China, C1088) according to the manufacturer\u0026rsquo;s protocol. Finally, the cell nuclei were stained with 10 \u0026micro;L of DAPI solution. Apoptotic cells were visualized using confocal laser scanning microscopy (CLSM, Leica, Germany), with green fluorescence indicating apoptosis.\u003c/p\u003e\n\u003ch3\u003eImmunostaining\u003c/h3\u003e\n\u003cp\u003eCells or embryos were first washed with 0.1% PBS-PVP and fixed in 4% paraformaldehyde overnight at 4\u0026deg;C. Following fixation, they were permeabilized with 1% Triton X-100 in PBS at room temperature for 30 minutes. The samples were then washed three times with 0.1% PBS-PVP. To block nonspecific binding, the samples were incubated in 1% BSA blocking solution at room temperature for 2 hours. The primary antibody, diluted 1:500 in antibody diluent, was applied overnight at 4\u0026deg;C. On the following day, the samples were washed three times with 0.1% PBS-PVP. The secondary antibody, diluted 1:1000 in antibody diluent, was then applied at room temperature in the dark for 1 hour. After washing three times with antibody diluent and once with 0.1% PBS-PVP, the samples were mounted on slides with DAPI solution, covered, and imaged using a fluorescence microscope with consistent exposure settings for both control and experimental groups. Fluorescence intensity was quantified using ImageJ.\u003c/p\u003e\n\u003ch3\u003ePRKG2 plasmid construction\u003c/h3\u003e\n\u003cp\u003eThe coding sequence (CDS) of \u003cem\u003ePRKG2\u003c/em\u003e (NM_001144099) was amplified from bovine granulosa cell cDNA using PCR with 2 \u0026times; Phanta Max Master Mix (Vazyme, Nanjing, China). The resulting fragment, including homology arms, was then inserted into the eukaryotic expression vector pPCAGGS, which was pre-digested with FastDigest Not Ⅰ (Thermo Fisher, Shanghai, China). Seamless cloning was performed using the Seamless Cloning Kit (Beyotime Biotechnology, Shanghai, China) to ligate the \u003cem\u003ePRKG2\u003c/em\u003e CDS into the vector. The integrity of the constructed vector was confirmed by DNA sequencing. Sequencing was carried out using forward primers 5'-GTTCGGCTTCTGGCGTGTGA-3' and 5' GACATGGTGGAATGCATGTA-3', and reverse primers 5'-CACACTGAAGTCATGTCCTT-3' and 5'-CCTTGCTCACCATAGATCTT-3'.\u003c/p\u003e\n\u003ch3\u003eTransfection and RNA extraction\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eTransfection and RNA extraction\u003c/div\u003e\u003cp\u003eBovine granulosa cells were seeded in 24-well plates at a density of 5 \u0026times; 10⁵ cells per well, and transfection was initiated when the cells reached 70\u0026ndash;80% confluence. Cells were transfected with either a pCAGGS empty vector or a \u003cem\u003ePRKG2\u003c/em\u003e overexpression vector using Lipofectamine\u0026trade; 8000 (Beyotime Biotechnology, Shanghai, China). The optimal plasmid concentration was determined according to the manufacturer\u0026rsquo;s guidelines. Briefly, 0.8 \u0026micro;g vector was diluted in 50 \u0026micro;L of Opti-MEM\u0026trade; I Reduced Serum Medium (Gibco, CA, USA) and incubated at room temperature for 5 minutes. The diluted DNA was then combined with Lipofectamine 8000, mixed gently, and incubated for 20 minutes at room temperature. A 100 \u0026micro;L aliquot of the transfection mixture was added to each well containing 500 \u0026micro;L cell culture medium. Cells were harvested 24 hours post-transfection for further analysis. RNA extraction and purification were carried out using Trizol reagent.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eRNA isolation and Quantitative real-time PCR (RT-qPCR)\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from bovine ovarian granulosa cells and COCs using the Trizol method, followed by reverse transcription with the HiScript\u0026reg; III RT SuperMix (Vazyme, Nanjing, China). qRT-PCR was conducted using the Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on the CFX Real-Time PCR Detection System, with data analysis performed using CFX Manager\u0026trade; software. \u003cem\u003eGAPDH\u003c/em\u003e served as the internal reference, and gene expression levels were quantified using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method. The primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers for qRT-PCR\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene Name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer Sequences (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eATG3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: GGTTGTTCGGCTATGATGAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: GGGAGATGAGGGTGATTTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eATG5\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: TTT GAA TAT GAA GGC ACA CC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: TGT AAA CCC ATC CAG AGTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eATG7\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: ATTGCTGCATCAAGAGACCCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: CCTTCTGGCGATTATGGTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eBCL-2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: ATGCGGCCCCTGTTTGATTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: GGCTTCACTTATGGCCCAGAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eBAX\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: CCCTTTTGCTTCAGGGTTTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: TCAGACACTCGCTCAGCTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eCASPASE-3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: GTTCATCCAGGCTCTTTGTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: AAGGACTCATATTCTATTGCTACC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eFAS\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: AAAATGCCCACATGGCTGGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: CGTTTTTCCGTTTGCCAGGAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eFASL\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: TTTCATGGTTCTGGTGGCCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: GACTGGGGTGACCTATTTGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eLC3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: TTATCCGAGAGCAGCAGCATCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: AGGCTTGATTAGCATTGAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eTNF-α\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: TCTCTCTCACATACCCTGCCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: CCCGGATCATGCTTTTGGTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eP62\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: AGGACTGAAGGAAGCTGCAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: GAGAGGGACTCAATCAGCCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: CACCCTCAAGATTGTCAGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: GGTCATAAGTCCCTCCACGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eWestern blotting analysis\u003c/h3\u003e\n\u003cp\u003eBovine granulosa cells were lysed in RIPA buffer, and protein concentrations were quantified using the BCA protein assay kit (Beyotime Biotechnology, Shanghai, China). Proteins were resolved by SDS-PAGE and transferred onto a PVDF membrane. The membrane was incubated overnight at 4\u0026deg;C with primary antibodies, followed by a 2-hour incubation at room temperature with HRP-conjugated secondary antibodies. Protein bands were visualized using the Tanon-4200 imaging system (Tanon, Shanghai, China). Band intensities were quantified with ImageJ, and data were analyzed using GraphPad Prism 9.0. The antibodies used were as follows: CASPASE-3 (Proteintech, 19677-1-AP), ATG-5 (Santa Cruz Biotechnology, sc-133158), and LC-3 (Proteintech, 18725-1-AP).\u003c/p\u003e\n\u003ch3\u003eRNA-seq data processing and analysis\u003c/h3\u003e\n\u003cp\u003eBovine granulosa cells were harvested 24 hours post-treatment, and total RNA was extracted using the Trizol method. RNA sequencing was performed by Anoroad (Beijing, China), with RNA concentration and integrity assessed using a Nanodrop spectrophotometer and Agilent 2100 bioanalyzer. mRNA was enriched using Oligo(dT) magnetic beads, followed by fragmentation and first-strand cDNA synthesis using random oligonucleotide primers in an M-MuLV reverse transcriptase system. The RNA strand was degraded by RNaseH, and second-strand cDNA was synthesized using DNA polymerase I. The double-stranded cDNA was purified, end-repaired, A-tailed, and ligated to sequencing adapters. cDNA fragments of approximately 250\u0026ndash;300 bp were selected using AMPure XP beads, followed by PCR amplification and further purification with AMPure XP beads. The library was constructed using the NEBNext\u0026reg; Ultra\u0026trade; RNA Library Prep Kit for Illumina\u0026reg; (NEB, USA, E7530L). After preliminary quantification with a Qubit 2.0 Fluorometer, the library was diluted to 1.5 ng/\u0026micro;L. The insert size was confirmed with an Agilent 2100 bioanalyzer, and the effective library concentration (\u0026gt;\u0026thinsp;1.5 nM) was determined by RT-qPCR. Sequencing was performed on an Illumina platform using the sequencing-by-synthesis method, wherein each incorporated fluorescently labeled dNTP emits a specific signal captured by the sequencer, generating the corresponding sequence information.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eThis study mainly uses Excel and GraphPad software for statistical analysis of data. Immunofluorescence intensity and cell number were analyzed using Image J software. The statistical analysis of significance between two groups used two independent samples t test, and the statistical analysis of significance between multiple groups used one-way analysis of variance. Significance is marked differently according to the \u003cem\u003eP\u003c/em\u003e value, \"*\" represents \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, \"**\" represents \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 and \"***\" represents \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eTranscriptomic analysis reveals the effects of CNP on granulosa cells in bovine\u003c/h2\u003e\u003cp\u003eTo investigate the potential regulatory effects of CNP on granulosa cell function, we performed transcriptome sequencing on CNP-treated granulosa cells. Principal component analysis (PCA) demonstrated high intra-group consistency and clear inter-group separation among treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Differential expression analysis with DESeq2 identified 1,084 differentially expressed genes (DEGs), visualized using a volcano plot. Compared to controls, 545 genes were downregulated and 539 upregulated in CNP-treated granulosa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Gene Ontology (GO) enrichment analysis revealed significant overrepresentation of processes related to apoptotic regulation and signaling (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis indicated enrichment in the TNF, IL17, NF-κB, PI3K-AKT, and cGMP-PKG signaling pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Gene Set Enrichment Analysis (GSEA) further demonstrated significant downregulation of gene sets involved in apoptosis, NF-κB, TNF, and related signaling pathways following CNP treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Collectively, these results suggest that CNP significantly affected the transcriptional profile of granulosa cells, especially signaling pathways and biological processes associated with apoptosis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eCNP alleviates apoptosis of ovarian mural granulosa cells\u003c/h2\u003e\u003cp\u003eWe examined the effect of C-type natriuretic peptide (CNP) on apoptosis in ovarian mural granulosa cells cultured under serum-free conditions, a well-established model for inducing apoptosis [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Cell purity was confirmed via immunofluorescence staining for follicle-stimulating hormone receptor (FSHR), a granulosa cell-specific marker. Nearly all isolated cells exhibited positive FSHR staining, verifying their identity as ovarian mural granulosa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eA).\u003c/p\u003e\u003cp\u003eTUNEL staining was employed to assess the effect of CNP on apoptosis in ovarian granulosa cells. The proportion of TUNEL-positive cells was significantly reduced in the CNP-treated group compared to controls (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, C). Quantitative real-time PCR analysis revealed significant downregulation of pro-apoptotic genes \u003cem\u003eCASPASE-3\u003c/em\u003e, \u003cem\u003eFAS\u003c/em\u003e, \u003cem\u003eFASL\u003c/em\u003e, and \u003cem\u003eTNF-α\u003c/em\u003e, accompanied by upregulation of the anti-apoptotic gene \u003cem\u003eBCL-2\u003c/em\u003e (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Western blotting confirmed these findings, demonstrating marked downregulation of CASPASE-3 protein in CNP-treated granulosa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Numerous studies have established that autophagy substantially contributes to apoptosis in ovarian granulosa cells [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Notably, CNP administration significantly decreased mRNA levels of autophagy-related genes \u003cem\u003eATG3\u003c/em\u003e, \u003cem\u003eATG5\u003c/em\u003e, \u003cem\u003eATG7\u003c/em\u003e, and \u003cem\u003eLC3\u003c/em\u003e (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Furthermore, protein levels of LC3B-II and ATG5 were reduced in CNP-treated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Collectively, these data indicate that CNP inhibits both apoptosis and autophagy in ovarian mural granulosa cells.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eCNP suppresses cumulus cell apoptosis independently of oocytes\u003c/h2\u003e\u003cp\u003eIn the ovary, cumulus cells predominantly express natriuretic peptide receptor 2 (NPR2), whose expression is regulated by oocytes [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. To assess whether CNP influences apoptosis of cumulus granulosa cells in an oocyte-dependent manner, we cultured COCs and OOXs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). TUNEL staining demonstrated that CNP treatment significantly decreased apoptosis levels in both COCs and OOXs compared to controls (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, no significant difference in apoptosis was observed between COCs and OOXs following CNP treatment (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, D). Quantitative real-time PCR revealed that CNP significantly downregulated the expression of apoptosis-related genes \u003cem\u003eBAX\u003c/em\u003e, \u003cem\u003eCASP3\u003c/em\u003e, \u003cem\u003eFAS\u003c/em\u003e, and \u003cem\u003eFASL\u003c/em\u003e, as well as autophagy-related genes \u003cem\u003eATG3\u003c/em\u003e, \u003cem\u003eATG5\u003c/em\u003e, \u003cem\u003eATG7\u003c/em\u003e, and \u003cem\u003eLC3\u003c/em\u003e in cumulus cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). These results suggest that CNP inhibits apoptosis of cumulus cells independently of the presence of oocytes.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eCNP inhibits apoptosis of ovarian granulosa cells independently of PKG\u003c/h2\u003e\u003cp\u003eBuilding on the observed anti-apoptotic effects of CNP on ovarian granulosa cells, we investigated the specific pathways mediating this response. Previous studies have established the role of the cGMP-PKG pathway in mediating CNP\u0026rsquo;s physiological effects [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Accordingly, we explored whether cGMP-PKG is involved in CNP-mediated inhibition of apoptosis in ovarian granulosa cells. To investigate this, granulosa cells were treated with 8-Br-cGMP (a cGMP analog) and KT5823 (a PKG inhibitor). TUNEL staining showed that treatment with 8-Br-cGMP, alone or combined with CNP, significantly reduced apoptosis compared to controls (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B). However, KT5823 did not reverse CNP\u0026rsquo;s anti-apoptotic effect; notably, treatment with KT5823 alone also significantly reduced apoptosis levels (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, D). Quantitative real-time PCR revealed that 8-Br-cGMP alone or combined with CNP significantly downregulated \u003cem\u003eFASL\u003c/em\u003e mRNA levels (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Both CNP and KT5823 downregulated apoptosis- and autophagy-related genes, with combined treatment significantly decreasing \u003cem\u003eBAX\u003c/em\u003e, \u003cem\u003eCASPASE-3\u003c/em\u003e, and \u003cem\u003eATG5\u003c/em\u003e mRNA levels (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). These findings suggest that CNP\u0026rsquo;s anti-apoptotic effect in ovarian granulosa cells is independent of the cGMP-PKG pathway, and that PKG may paradoxically promote apoptosis in these cells.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003ePKG induces apoptosis in ovarian granulosa cells\u003c/h2\u003e\u003cp\u003eTo avoid potential off-target effects of KT5823, we overexpressed PKG in ovarian granulosa cells to further clarify its role in apoptosis. Efficient PKG overexpression was confirmed in granulosa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Subsequent TUNEL assays demonstrated a significant increase in apoptosis in PKG-overexpressing cells relative to controls (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, C). Quantitative real-time PCR analysis revealed significant upregulation of mRNA levels for apoptosis-related genes \u003cem\u003eCASPASE-3\u003c/em\u003e, \u003cem\u003eFAS\u003c/em\u003e, \u003cem\u003eFASL\u003c/em\u003e and \u003cem\u003eLC3\u003c/em\u003e in the PKG-overexpressing group (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). These findings indicate that PKG acts as a positive regulator of apoptosis in ovarian granulosa cells.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePKG inhibition enhances the developmental competence of in\u003c/b\u003e \u003cb\u003evitro\u003c/b\u003e \u003cb\u003ematured oocytes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eDuring \u003cem\u003ein vitro\u003c/em\u003e culture of COCs, the health and function of cumulus cells are essential for supporting oocyte maturation and developmental competence. Impaired cumulus cell viability has been associated with reduced oocyte quality following maturation [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Based on our previous findings that inhibition of PKG alleviates apoptosis in ovarian granulosa cells, we further examined whether PKG inhibition could reduce apoptosis in cumulus cells and improve oocyte developmental potential during \u003cem\u003ein vitro\u003c/em\u003e COC culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The results show that KT5823 treatment significantly decreased apoptosis in cumulus granulosa cells compared to controls (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, C). Furthermore, KT5823 supplementation during \u003cem\u003ein vitro\u003c/em\u003e maturation significantly increased blastocyst formation rates (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Quantitative analysis of lineage-specific cell populations revealed that KT5823 treatment significantly increased the ICM/TE ratio, as evidenced by a higher proportion of SOX2-positive inner cell mass (ICM) cells relative to CDX2-positive trophectoderm (TE) cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e6\u003c/span\u003eE, F). To evaluate potential species conservatism effects, 1 \u0026micro;M KT5823 was added to the \u003cem\u003ein vitro\u003c/em\u003e maturation medium of ovine oocytes, which similarly resulted in a significant increase in blastocyst formation rate (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). Collectively, these results indicate that PKG inhibition during in vitro maturation reduces cumulus cell apoptosis and enhances oocyte developmental competence in both bovine and ovine species.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study demonstrates that the anti-apoptotic effect of CNP is replicated by cGMP. Although both 8-Br-cGMP and CNP exhibited comparable anti-apoptotic effects, these effects were not mediated through the cGMP downstream effector, PKG. Moreover, overexpression of the PKG-encoding gene PRKG2 increased apoptosis in bovine ovarian granulosa cells, while the PKG inhibitor KT5823 did not influence CNP\u0026rsquo;s anti-apoptotic action. Interestingly, KT5823 alone exerted anti-apoptotic effects and enhanced the developmental competence of \u003cem\u003ein vitro\u003c/em\u003e matured oocytes. These findings suggest that the anti-apoptotic effect of CNP is independent of a PKG-dependent pathway and that PKG inhibition improve the quality of oocytes matured \u003cem\u003ein vitro\u003c/em\u003e by reducing cumulus cell apoptosis.\u003c/p\u003e\u003cp\u003eGranulosa cells encase the oocyte, forming the follicle structure and orchestrating follicle development, maturation, and atresia. Apoptosis of granulosa cells is a fundamental mechanism underlying follicular atresia, governed by hormones, steroids, cytokines, and growth factors, and involving multiple signaling pathways. During follicular development, granulosa cell apoptosis and autophagy are widely recognized as key drivers of follicular atresia [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The interaction between CNP and ovarian granulosa cells remains poorly understood. In this study, CNP treatment effectively mimicked the physiological state of granulosa cells in healthy follicles, significantly downregulating gene expression associated with the apoptosis signaling pathways, NF-κB signaling pathways and TNF signaling pathways. These findings establish a theoretical foundation for the potential role of CNP in mitigating ovarian granulosa cell apoptosis, warranting further clinical investigation.\u003c/p\u003e\u003cp\u003eThe FAS/FASL pathway is widely recognized as a key mediator of granulosa cell apoptosis, where activation of FAS triggers the recruitment of FADD, subsequently inducing CASPASE-8 and initiating apoptosis. However, our findings revealed a downregulation of FASL in both GCs and COCs [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. This suggests that CNP may mitigate granulosa cell apoptosis through alternative pathways, such as the mitochondrial apoptotic pathway. Moreover, TNF-α promotes granulosa cell apoptosis, a process that can be inhibited by CASPASE inhibitors [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The BCL-2 family regulates mitochondrial and intracellular apoptotic pathways, comprising both anti-apoptotic (BCL-2) and pro-apoptotic (BAX) proteins [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. This study shows that CNP significantly reduces the mRNA and protein levels of CASPASE-3, FASL, and TNF-α, while markedly increasing the mRNA and protein levels of BCL-2. Additionally, CNP inhibits granulosa cell apoptosis and reduces autophagy levels.\u003c/p\u003e\u003cp\u003eAutophagy generally acts as a cytoprotective mechanism under conditions such as hypoxia, starvation, and nutrient deprivation. However, when apoptotic pathways are activated, autophagy can become maladaptive and contribute to cell death [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Research indicates that LC3 protein expression is elevated in rat granulosa cells, suggesting that autophagy predominantly occurs within these cells and may contribute to follicular atresia through granulosa cell death [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. LC3, P62, ATG3, ATG5, and ATG7 serve as markers of autophagy [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. This study demonstrates that CNP mitigates autophagy levels in bovine granulosa cells, as evidenced by reduced mRNA expression of LC3, P62, and ATG5. The precise molecular circuitry through which CNP attenuates autophagic flux in granulosa cells remains to be systematically elucidated and warrants comprehensive investigation in future studies.\u003c/p\u003e\u003cp\u003ePrevious studies have not observed apoptotic cumulus cells in COCs from atretic follicles, potentially due to variations in criteria for classifying follicles or COCs as healthy or atretic [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In contrast, our study found that COCs cultured for 24 hours without serum exhibited a small number of apoptotic cumulus cells, as indicated by TUNEL staining. Furthermore, CNP treatment significantly reduced cumulus cell apoptosis. Notably, the anti-apoptotic effect of CNP appears independent of oocytes, as there was no significant difference in apoptosis levels between OOXs and COCs, while the apoptosis level in the surrounding granulosa cells was markedly higher than in cumulus cells. These findings support earlier research suggesting that oocytes inhibit cumulus cell apoptosis during early atresia, with the onset of apoptosis in COCs marking the cessation of follicular atresia [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In this study, we observed that CNP treatment significantly down-regulated apoptosis in OOXs.\u003c/p\u003e\u003cp\u003eGranulosa cells and oocytes are intricately linked in both tissue structure and function. The apoptosis of granulosa cells directly influences oocyte development, subsequently impacting female reproductive function. Factors such as insulin-like growth factor 1 (IGF-1), epidermal growth factor (EGF), thyroxine (T4), growth hormone (GH), and estradiol play critical roles in cell survival, proliferation, and apoptosis inhibition [\u003cspan additionalcitationids=\"CR34 CR35\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. cAMP and cGMP act as second messengers in the downstream signaling pathways of various growth factors [\u003cspan additionalcitationids=\"CR38 CR39 CR40\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Research indicates that cGMP in granulosa cells is activated by the NPPC/NPR2 system, and this cGMP is subsequently transferred to oocytes via gap junctions [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Our study demonstrates that cGMP markedly reduces apoptosis in bovine ovarian granulosa cells. Notably, the anti-apoptotic effect of CNP is more pronounced when combined with cGMP, likely due to CNP's role in enhancing cGMP expression [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIntracellular cGMP signaling primarily regulates its effects through downstream effector proteins, predominantly PKG [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. PKG, a serine/threonine protein kinase, is the principal mediator of cGMP signaling and is involved in various cellular processes, including apoptosis, differentiation, and neural plasticity [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Despite its significant role, the effects of PKG on ovarian granulosa cells and embryonic development remain underexplored. Notably, extensive research has linked PKG activation with increased cell apoptosis, suggesting a positive correlation between PKG stimulation and enhanced apoptotic processes. Research indicates that the upregulation of the cGMP/PKG pathway in the nervous system contributes to dopamine neuron degeneration and apoptosis. Conversely, inhibition of PKG mitigates this increase in cell death [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn this study, we observed that cGMP mediates the anti-apoptotic effects of CNP in granulosa cells. To investigate whether the downstream PKG signaling pathway is involved, we employed the PKG inhibitor KT5823. Notably, after 24 hours of treatment, blocking PKG signaling did not abrogate the anti-apoptotic effect of CNP on granulosa cells, consistent with findings in neuronal cells. Although the precise molecular mechanisms through which PKG affects apoptosis remain unclear, it is likely that PKG influences apoptosis by regulating members of the BCL-2 and CASPASE families. Previous studies have demonstrated that activation of PKG via the Nitric Oxide / cyclic Guanosine Monophosphate (NO/cGMP) signaling pathway upregulates Bax and caspase-3, while inhibition of PKG reduces levels of pro-apoptotic proteins such as BAX and CASPASE3, thereby attenuating apoptosis [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. These results indicate that the PKG signaling pathway does not mediate the anti-apoptotic effects of CNP on granulosa cells. Other signaling pathways may be implicated in this process, warranting further investigation.\u003c/p\u003e\u003cp\u003eDuring the \u003cem\u003ein vitro\u003c/em\u003e maturation of oocytes, apoptotic or functionally impaired cumulus cells result in a decline in oocyte quality, which subsequently affects their developmental potential [\u003cspan additionalcitationids=\"CR45 CR46 CR47\" citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Our results indicate that the incorporation of a PKG inhibitor into the IVM culture medium significantly enhances the developmental potential of oocytes, evident from an elevated blastocyst rate, an augmented number of ICM cells, and an improved ICM/TE ratio. This beneficial effect can be attributed, at least in part, to the improved state of cumulus cells. More crucially, we have demonstrated that inhibiting PKG to improve the oocyte quality may exhibit species conservation. Although the live birth rate of IVM (30%-40%) is still lower than that of traditional \u003cem\u003ein vitro\u003c/em\u003e fertilization (IVF) (50%-60%), its advantages in safety, cost-effectiveness, and ethical acceptability make it the preferred or only feasible clinical assisted reproductive option for specific populations, including those with PCOS, cancer patients, and individuals in resource-limited areas [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Our study may provide a promising strategy for improving the human oocyte IVM system and advancing human assisted reproductive technology (ART).\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, our study elucidates the role of CNP in inhibiting follicular granulosa cell apoptosis, which is not dependent on the typical downstream target of cGMP, PKG. Conversely, we found that PKG actually serves as an inducer of ovarian granulosa cell apoptosis. Furthermore, based on these findings, we developed a feasible approach to improve the quality of \u003cem\u003ein vitro\u003c/em\u003e matured oocytes by inhibiting cumulus cell apoptosis through the supplementation of PKG inhibitor in IVM medium, which provides scientific evidence for its application in both human ART and \u003cem\u003ein vitro\u003c/em\u003e production of agricultural animal embryos.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eY.W. and H.D. performed the experiments and analyzed the data. Q.L. participated in data analysis processes. Y.W., L.A., J.T. and G.X. conceived the experimental designs. Y.W. and G.X. wrote the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors participated in study design, data analysis and interpretation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Sci-Tech Innovation 2030 Agenda (No. 2023ZD040750202), the National Natural Science Foundation of China (Grant No. 32202672), the Major Science and Technology Project of Xinjiang Autonomous Region (No. 2023A02011), and the Central Guidance for Local Science and Technology Development Funds (No. 2024ZY0160).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe dataset generated and analyzed during the current study are available in the PRJCA042776 repository [https://ngdc.cncb.ac.cn/gsub/].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eN/A.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eN/A.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003e Key Laboratory of Animal Genetics, Breeding and Reproduction of the Ministry of Agriculture and Rural Affairs, National Engineering Laboratory for Animal Breeding, College of Animal Science and Technology, China Agricultural University, Beijing, China\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eShi S, Hu Y, Song X, et al. Totipotency of miR-184 in porcine granulosa cells. Mol Cell Endocrinol. 2022;558:111765.\u003c/li\u003e\n\u003cli\u003eMatsuda F, Inoue N, Manabe N, et al. Follicular growth and atresi-a in mammalian ovaries: regulation by survival and death of granulosa cells. J Reprod Dev. 2012;58(1):44-50.\u003c/li\u003e\n\u003cli\u003eDong Y, Chen H, Gao J, et al. Molecular machinery an-d interplay of apoptosis and autophagy in coronary heart disease. J Mol Cell Cardiol. 2019;136:27-41.\u003c/li\u003e\n\u003cli\u003eObeng E. Apoptosis (programmed cell death) and its signals-A review. Braz J Biol. 2020;81(4):1133-43.\u003c/li\u003e\n\u003cli\u003eZhang C, Guo L, Zhu B, et al. Effects of 3, 5, 3\u0026prime;-triiodothyronine (t3) and follicle stimulating hormone on apoptosis and proliferation of rat ovarian granulosa cells. Chin J Physiol. 2013;56(5):298-305.\u003c/li\u003e\n\u003cli\u003eDu X, Zhang L, Li X, et al. TGF-\u0026beta; signaling controls FSHR signaling-reduced ovarian granulosa cell apoptosis through the SMAD4/miR-143 axis. Cell Death Dis. 2016;7(11):e2476-e2476.\u003c/li\u003e\n\u003cli\u003eHan Y, Wang S, Wang Y, et al. IGF-1 inhibits apoptosis of porcine primary granulosa cell by targeting degradation of BimEL. Int J Mol Sci. 2019;20(21):5356.\u003c/li\u003e\n\u003cli\u003eGuo Z, Lu H, Li Q, et al. Estrogen receptor \u0026beta; mediates the feedback loop between 17\u0026beta;-Estradiol and CYP19A1, which controls transcriptomic stability, inhibits granulosa cell apoptosis, induces oocyte maturation and influences sow fertility. Int J Biol Macromol. 2025;317(Pt 2):144879.\u003c/li\u003e\n\u003cli\u003eKoller KJ, Lowe DG, Bennett GL, et al. Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP). Science. 1991;252(5002):120-3.\u003c/li\u003e\n\u003cli\u003eZhang M, Su YQ, Sugiura K, et al. Granulosa cell ligand NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes. Science. 2010;330(6002):366-9.\u003c/li\u003e\n\u003cli\u003eXi G, Wang W, Fazlani SA, et al. C-type natri-uretic peptide enhances mouse preantral follicle growth. Reproduction. 2019;157(5):445-55.\u003c/li\u003e\n\u003cli\u003eShariatpanahi M, Khodagholi F, Ashabi G, et al. The involvement of protein kinase G inhibitor in regulation of apoptosis and autophagy markers in spatial memory deficit induced by A\u0026beta;. Fundam Clin Pharmacol. 2016;30(4):364-75.\u003c/li\u003e\n\u003cli\u003eWu Y, Cai Q, Li W, et al. Active PKG II inhibite-d the growth and migration of ovarian cancer cells through blocking Raf/MEK and PI3K/Akt signaling pathways. Biosci Rep. 2019;39(8):BSR20190405.\u003c/li\u003e\n\u003cli\u003eWu Y, Yuan M, Su W, et al. The constitutive-ly active PKG II mutant effectively inhibits gastric cancer development via a blockade of EGF/EGFR-associated signalling cascades. Ther Adv Med Oncol. 2018;10:1758834017751635.\u003c/li\u003e\n\u003cli\u003eYoo YM, Jung EM, Ahn C, et al. Nitric oxide prevents H2O2-ind-uced apoptosis in SK-N-MC human neuroblastoma cells. Int J Biol Sci. 2018;14(14):1974.\u003c/li\u003e\n\u003cli\u003eTrounson A, Wood C, Kausche A. In vitro maturation and the fertilization and developmental competence of oocytes recovered from untreated polycystic ovarian patients. Fertil Steril. 1994;62(2):353-62.\u003c/li\u003e\n\u003cli\u003eYang ZY, Chian RC. Development of in vitro maturation techniques for clinical applications. Fertil Steril. 2017;108(4):577-84.\u003c/li\u003e\n\u003cli\u003eJones GM, Cram DS, Song B, et al. Gene expression profiling of human oocytes following in vivo or in vitro maturation. Hum Reprod. 2008;23(5):1138-44.\u003c/li\u003e\n\u003cli\u003eShimoi G, Tomita M, Kataoka M, et al. Destabilization of spin-dle assembly checkpoint causes aneuploidy during meiosis II in murine post-ovulatory aged oocytes. J Reprod Dev. 2019;65(1):57-66.\u003c/li\u003e\n\u003cli\u003eD\u0026apos;Herde K, Leybaert L. Intracellular free calcium related to apoptotic ce-ll death in quail granulosa cell sheets kept in serum-free culture. Cell Death Differ. 1997;4(1):59-65.\u003c/li\u003e\n\u003cli\u003eStringer JM, Alesi LR, Winship AL, et al. Beyond apoptosis: eviden-ce of other regulated cell death pathways in the ovary throughout development and life. Hum Reprod Update. 2023;29(4):434-56.\u003c/li\u003e\n\u003cli\u003eXi G, An L, Jia Z, et al. Natriuretic peptide receptor 2 (NPR2) localized in bovine oocyte underlies a unique mechanism for C-type natriuretic peptide (CNP)-induced meiotic arrest. Theriogenology. 2018;106:198-209.\u003c/li\u003e\n\u003cli\u003eWu K, Mei C, Chen Y, et al. C-type natriuretic pept-ide regulates sperm capacitation by the cGMP/PKG signalling pathway via Ca2+ influx and tyrosine phosphorylation. Reprod Biomed Online. 2019;38(3):289-99.\u003c/li\u003e\n\u003cli\u003eCoticchio G, Dal Canto M, Mignini Renzini M, et al. Oocyte maturation: gamete-somatic cells interactions, meiotic resumption, cytoskeletal dynamics and cytoplasmic reorganization. Hum Reprod Update. 2015;21(4):427-54.\u003c/li\u003e\n\u003cli\u003eJiang JY, Cheung CK, Wang Y, et al. Regulation of cell death and cell survival gene expression during ovarian follicular development and atresia. Front Biosci. 2003;8:d222-d37.\u003c/li\u003e\n\u003cli\u003eManabe N, Imai Y, Ohno H, et al. Apoptosis occurs in granulosa cells but not cumulus cells in the atretic antral follicles in pig ovaries. Experientia. 1996;52(7):647-51.\u003c/li\u003e\n\u003cli\u003eJ\u0026auml;\u0026auml;skel\u0026auml;inen M, Kyr\u0026ouml;nlahti A, Anttonen M, et al. TRAIL pathway components and their putative role in granulosa cell apoptosis in the human ovary. Differentiation. 2009;77(4):369-76.\u003c/li\u003e\n\u003cli\u003eTano M, Minegishi T, Kishi H, et al. The e-ffect of follicle-stimulating hormone (FSH) on the expression of FSH receptor in cultured rat granulosa cells. Life Sci. 1999;64(12):1063-9.\u003c/li\u003e\n\u003cli\u003eZheng Y, Ma L, Liu N, et al. Autophagy an-d apoptosis of porcine ovarian granulosa cells during follicular development. Animals. 2019;9(12):1111.\u003c/li\u003e\n\u003cli\u003eChoi J, Jo M, Lee E, et al. Induction of apoptotic cell death via acc-umulation of autophagosomes in rat granulosa cells. Fertil Steril. 2011;95(4):1482-6.\u003c/li\u003e\n\u003cli\u003eGawriluk TR, Rucker EB. BECN1, corpus luteum function, and preterm labor. Autophagy. 2015;11(1):183-4.\u003c/li\u003e\n\u003cli\u003eDurlinger AL, Kramer P, Karels B, et al. Apoptotic and proliferative changes during induced atresia of pre-ovulatory follicles in the rat. Hum Reprod. 2000;15(12):2504-11.\u003c/li\u003e\n\u003cli\u003eSharma GT, Dubey PK, Kumar GS. Effects of IGF-1, TGF-\u0026alpha; plus TGF-\u0026beta;1 and bFGF on in vitro survival, growth and apoptosis in FSH-stimulated buffalo (Bubalis bubalus) preantral follicles. Growth Horm IGF Res. 2010;20(4):319-25.\u003c/li\u003e\n\u003cli\u003eMarkstrom E, Svensson E, Shao R, et al. Survival factors regulating ovarian apoptosis--dependence on follicle differentiation. Reproduction. 2002;123(1):23-30.\u003c/li\u003e\n\u003cli\u003eChun SY, Hsueh AJ. Paracrine mechanisms of ovarian follicle apoptosis. J Reprod Immunol. 1998;39(1-2):63-75.\u003c/li\u003e\n\u003cli\u003eHsueh AJ, Billig H, Tsafriri A. Ovarian follicle atresia: a hormonally co-ntrolled apoptotic process. Endocr Rev. 1994;15(6):707-24.\u003c/li\u003e\n\u003cli\u003eMani SK, Oyola MG. Progesterone signaling mechanisms in brain and b-ehavior. Front Endocrinol (Lausanne). 2012;3:7.\u003c/li\u003e\n\u003cli\u003eVaccari S, Weeks JL 2nd, Hsieh M, et al. Cyclic GMP signaling is involved in the luteinizing hormone-dependent meiotic maturation of mouse oocytes. Biol Reprod. 2009;81(3):595-604.\u003c/li\u003e\n\u003cli\u003eNorris RP, Ratzan WJ, Freudzon M, et al. Nikolaev VO, Jaffe LA. Cyclic GMP from the surrounding somatic cells regulates cyclic AMP and meiosis in the mouse oocyte. Development. 2009;136(11):1869-78.\u003c/li\u003e\n\u003cli\u003eLee SY, Andoh T, Murphy DL, et al. 17\u0026beta;‐Estradiol activates ICI 182,780‐sensitive estrogen receptors and cyclic GMP‐dependent thioredoxin expression for neuroprotection. FASEB J. 2003;17(8):1-20.\u003c/li\u003e\n\u003cli\u003eButt E, Geiger J, Jarchau T, et al. The cGMP-dependent protein kinase-gene, protein, and function. Neurochem Res. 1993;18(1):27-42.\u003c/li\u003e\n\u003cli\u003eWigglesworth K, Lee KB, O\u0026rsquo;Brien MJ, et al. Bidirectional communication between oocytes and ovarian follicular somatic cells is required for meiotic arrest of mammalian oocytes. Proc Natl Acad Sci U S A. 2013;110(39):E3723-E9.\u003c/li\u003e\n\u003cli\u003eMangmool S, Duangrat R, Parichatikanond W, et al. New therapeut-ics for heart failure: focusing on cGMP signaling. Int J Mol Sci. 2023;24(16):12866.\u003c/li\u003e\n\u003cli\u003eDowns SM. The influence of glucose, cumulus cells, and metabolic cou-pling on ATP levels and meiotic control in the isolated mouse oocyte. Dev Biol. 1995;167(2):502-12.\u003c/li\u003e\n\u003cli\u003eFontana J, Mart\u0026iacute;nkov\u0026aacute; S, Petr J, et al. Metabolic coop-eration in the ovarian follicle. Physiol Res. 2020;69(1):33-48.\u003c/li\u003e\n\u003cli\u003eSu YQ, Sugiura K, Eppig JJ. Mouse oocyte control of granulosa cell de-velopment and function: paracrine regulation of cumulus cell metabolism. Semin Reprod Med. 2009;27(1):32-42.\u003c/li\u003e\n\u003cli\u003eNiles LP, Wang J, Shen L, et al. Melatonin receptor mRNA expression in human granulosa cells. Mol Cell Endocrinol. 1999;156(1-2):107-10.\u003c/li\u003e\n\u003cli\u003eReiter RJ, Tamura H, Tan DX, et al. Melatonin and the circadian sys-tem: contributions to successful female reproduction. Fertil Steril. 2014;102(2):321-8.\u003c/li\u003e\n\u003cli\u003eWessel JA, Hunt S, van Wely M, et al. Alternatives to in vi-tro fertilization. Fertil Steril. 2023;120(3 Pt 1):483-93.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-ovarian-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jovr","sideBox":"Learn more about [Journal of Ovarian Research](http://ovarianresearch.biomedcentral.com)","snPcode":"13048","submissionUrl":"https://submission.nature.com/new-submission/13048/3","title":"Journal of Ovarian Research","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"C-type natriuretic peptide, PKG, Granulosa cells, apoptosis, oocyte, in vitro maturation","lastPublishedDoi":"10.21203/rs.3.rs-7484101/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7484101/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground \u003c/strong\u003eMammalian follicular development is a highly coordinated process governed by hormonal and paracrine cues. Apoptosis of granulosa cells is a central driver of follicular atresia, triggered by insufficient anti-apoptotic signals or activation of pro-apoptotic pathways. C-type natriuretic peptide (CNP), a naturally occurring peptide present in follicular fluid, has been widely recognized as a oocyte meiosis arrester. However, the regulation of CNP on apoptosis of ovarian granulosa cells remains poorly defined.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods \u003c/strong\u003eRNA sequencing (RNA-seq) was performed on bovine granulosa cells treated with or without CNP to characterize transcriptomic changes and identify differentially regulated pathways. For functional assays, in vitro culture models of bovine mural granulosa cells, cumulus-oocyte complexes (COCs), and oocytectomized complexes (OOXs) were established to evaluate the effects of CNP on cell survival. Cultured granulosa cells were pretreated with pharmacologic inhibitors to identify the signaling pathways involved in apoptosis regulation by CNP. Apoptosis was assessed by TUNEL assay, while apoptosis-related gene and protein expression levels were analyzed by RT-qPCR and western blotting, respectively. \u003cem\u003eIn vitro \u003c/em\u003ematuration (IVM) of oocytes was performed to evaluate functional significance of cGMP-dependent protein kinase (PKG) inhibition.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults \u003c/strong\u003eTranscriptomic profiling revealed that CNP administration significantly downregulated multiple apoptosis-related pathways, including the IL17 signaling pathway, TNF signaling, and NF-κBpathways. Functionally, CNP suppressed apoptosis in both mural granulosa cells and cumulus cells, independent of oocyte presence. Notably, PKG inhibition by KT5823 also reduced granulosa cell apoptosis, and the anti-apoptotic effects of CNP were preserved despite PKG blockade. Conversely, ectopic PKG overexpression enhanced apoptosis, demonstrating a pro-apoptotic role for PKG in this context. Incorporation of KT5823 into the IVM system attenuated cumulus cell apoptosis and improved bovine and ovine oocyte developmental competence.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions \u003c/strong\u003eThese findings reveal that the anti-apoptotic effect of CNP on granulosa cells is independent of PKG signaling. CNP exerts transcriptional suppression of apoptosis-related pathways, while pharmacological PKG inhibition represents a promising approach to enhance the quality of \u003cem\u003ein vitro\u003c/em\u003e matured oocytes.\u003c/p\u003e","manuscriptTitle":"C-type natriuretic peptide mitigates apoptosis in ovarian granulosa cells through the cGMP pathway independent of PKG signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-16 09:16:13","doi":"10.21203/rs.3.rs-7484101/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-24T11:15:46+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-24T08:09:26+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-15T02:14:45+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"57243454193331087179674027279731312341","date":"2025-09-10T23:29:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"84343760919006330994818006353720207820","date":"2025-09-09T11:26:47+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-09T06:07:45+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-09T01:19:51+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-08T04:53:34+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Ovarian Research","date":"2025-08-29T02:18:24+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-ovarian-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jovr","sideBox":"Learn more about [Journal of Ovarian Research](http://ovarianresearch.biomedcentral.com)","snPcode":"13048","submissionUrl":"https://submission.nature.com/new-submission/13048/3","title":"Journal of Ovarian Research","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9f2bf8ec-3153-4ac9-8ba3-bf52d9dc291a","owner":[],"postedDate":"September 16th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-12-08T16:13:13+00:00","versionOfRecord":{"articleIdentity":"rs-7484101","link":"https://doi.org/10.1186/s13048-025-01879-w","journal":{"identity":"journal-of-ovarian-research","isVorOnly":false,"title":"Journal of Ovarian Research"},"publishedOn":"2025-12-05 15:58:16","publishedOnDateReadable":"December 5th, 2025"},"versionCreatedAt":"2025-09-16 09:16:13","video":"","vorDoi":"10.1186/s13048-025-01879-w","vorDoiUrl":"https://doi.org/10.1186/s13048-025-01879-w","workflowStages":[]},"version":"v1","identity":"rs-7484101","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7484101","identity":"rs-7484101","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}