Impact of Klotho Genotype on Lactylation in Alzheimer’s Disease and Mechanistic Insights | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Impact of Klotho Genotype on Lactylation in Alzheimer’s Disease and Mechanistic Insights Yingying Cai, Ling Li, Zhuorong Li This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7770928/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 09 Mar, 2026 Read the published version in Immunity & Ageing → Version 1 posted 10 You are reading this latest preprint version Abstract Protein lactylation has emerged as a crucial regulator in the pathogenesis of Alzheimer’s disease (AD). Although the Klotho gene (KL) has been clinically linked to AD, its role in lactylation remains unclear. Here, we investigated the influence of Klotho genotype on lactylation and related inflammatory responses. Wild-type KL and the KL F352V variant were transfected into microglia and BV-2 cells of an AD model to assess effects on protein lactylation and cytokine release, followed by transcriptome sequencing to identify downstream mediators. Functional validation using qPCR, ELISA, Western blotting, and immunohistochemistry confirmed that KL expression markedly reduced lactylated protein levels and pro-inflammatory factors, while ameliorating pathological features in AD model mice. Transcriptomic analysis highlighted oncostatin M (OSM) as a key gene suppressed by KL, and OSM knockdown decreased both protein lactylation and inflammation, improving AD pathology in vivo. These findings demonstrate that KL protects against AD progression by inhibiting OSM-mediated signaling, thereby attenuating lactylation and neuroinflammation, and provide novel mechanistic insight into the genetic regulation of lactylation in neurodegeneration. AD Klotho Microglia BV-2 cells Protein lactylation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction AD is the most prevalent neurodegenerative condition, characterized by deterioration of cognitive faculties and memory loss [ 1 ]. With advancements in medical science and public health, incidence of diagnosed AD is escalating globally [ 2 ]. Pathological hallmarks of AD encompass substantial accumulation of amyloid-beta (Aβ) plaques and neurofibrillary tangles (NFTs) in brain, notably in hippocampus, alongside synaptic dysfunction and neuronal demise [ 3 , 4 ]. Investigations revealed elevated lactate levels in cerebrospinal fluid (CSF) of individuals with AD and mild cognitive impairment, suggesting that aberrant glucose metabolism might be implicated in etiology and progression of AD [ 5 , 6 ]. Recent findings have uncovered an increase in lactylation of histone 4 at lysine 12 (H4K12lac) within microglia in the context of AD pathology, along with metabolic disruptions that could potentially modulate lactate levels, leading to neuroinflammation in cerebral milieu of AD patients [ 7 ]. Although the precise function and mechanism of lactylation in AD remain to be fully elucidated, targeting the lactylation process is likely to emerge as a promising therapeutic avenue for AD treatment. KL is situated on chromosome 13’s q12 band, encoding a transmembrane protein instrumental in a multitude of physiological processes, including regulation of calcium homeostasis, modulation of phosphate metabolism, and retardation of aging [ 8 , 9 ]. One of the most captivating aspects of KL is its association with lifespan extension and age-related diseases. Growing evidence has demonstrated that experimental mice deficient in Klotho manifest signs of premature aging, while over-expression of Klotho is correlated with an extended lifespan and enhanced healthspan in various organisms [ 10 ]. Furthermore, studies have confirmed the presence of Klotho in CSF, as evidenced in AD mouse models [ 11 ]. Over-expression of Klotho has been shown to ameliorate clearance of Aβ in AD mice models harboring amyloid precursor protein/presenilin 1 (APP/PS1) mutations, and to enhance their cognitive functions [ 12 ]. Klotho F352V variant, also known as KL-VS allele, represents a missense mutation that substitutes valine for phenylalanine at the 352nd amino acid position. This genetic alteration tends to affect functionality of Klotho [ 13 ]. Research indicated that Klotho F352V variant has a capability to up-regulate expression of FGF23 coreceptors and decrease levels of calcitriol, potentially leading to bone loss in renal transplant recipients [ 14 ]. While the KL is presumed to be crucial in mitigating AD pathology by modulating protein lactylation, its precise impacts and inherent mechanisms remain to be fully elucidated. In this study, we investigated the functional roles of the KL and its variant, Klotho F352V, in neuroinflammation and lactylation processes in AD. Our results demonstrate that Klotho alleviates microglial lactylation in AD by suppressing the OSM/JAK1/STAT3 signaling pathway, thereby mitigating the pathological activation of microglia. These findings provide a potential therapeutic strategy for the treatment of AD. Material and methods Cell Isolation and Culture Newborn C57BL/6 mice were disinfected with 75% ethanol and decapitated to isolate the brains. The cerebral cortices were dissected under a microscope, washed with PBS, and digested with trypsin. Digestion was stopped by adding complete mixed glial cell culture medium, and the tissue was triturated into a single-cell suspension. The suspension was filtered through a 40 µm strainer and seeded into culture flasks. Microglia, identified by their semi-suspended growth, were isolated by shaking the flasks at 37°C. The suspended microglia were collected, filtered, and centrifuged to obtain primary microglia. BV-2 cells (CL-0493A, Procell, Wuhan, China) and microglia, were cultivated in DMEM medium (L110KJ, BasalMedia, Shanghai, China), supplemented with 10% fetal bovine serum (AC03L055, iLab, Shanghai, China) and 1% penicillin-streptomycin (C0009, Beyotime, Shanghai, China), under conditions of 37℃ and 5% CO 2 . Cellular sample procession We subjected microglia and BV-2 cells to the following treatments and group assignments: (1) Control group: Cells were transduced with lentivirus carrying an empty vector; (2) Model group: After 24 hours of transduction with lentivirus carrying an empty vector, cells were treated with 0.55 µM Aβ oligomers (S26139, Shanghai Yuanye Company) and 0.6 µM IBO for 24 hours; (3) Klotho WT group: Cells were transduced with lentivirus expressing WT Klotho for 24 hours; (4) Model + Klotho WT group: Following 24 hours of transduction with lentivirus expressing WT Klotho, cells were treated with 0.55 µM Aβ oligomers and 0.6 µM IBO for 24 hours; (5) Klotho F352V group: Cells were transduced with lentivirus expressing Klotho F352V for 24 hours; (6) Model + Klotho F352V group: After 24 hours of transduction with lentivirus expressing Klotho F352V, cells were treated with 0.55 µM Aβ oligomers and 0.6 µM IBO for 24 hours. Transcriptome sequencing and omics analysis We fetched samples from Model + Klotho WT and Model + Klotho F352V groups, conducting transcriptome sequencing along with bioinformatic analysis on them. Initially, we extracted total RNA from the samples with Trizol reagent, assessing the RNA quality via agarose gel electrophoresis. Subsequently, we utilized NEBNext® Ultra™ RNA Library Prep Kit (Illumina®, E7490, NEB, Beijing, China) to construct RNA libraries. We performed a preliminary quantification of the libraries with Qubit 2.0 and diluted them to a concentration of 1.5 ng/µL. Thereafter, we employed Agilent 2100 to examine distribution of insert fragments within the libraries. Once the quality was verified, we precisely quantified libraries through qRT-PCR method. Afterwards, we filtered raw data, removed adapters, and discarded reads containing ambiguous bases and low-quality sequences to obtain clean data. Subsequently, we aligned clean reads to reference genome via HISAT2 software, generating bam format files, and carried out analyses of genomic region distribution, gene expression quantification, and differential gene analysis. We screened for differential genes according to a criteria of |log2FoldChange|>1 and p < 0.05. We then employed ClusterProfiler to analyze enrichment of GO, KEGG, and DO terms within the set of differential genes. Finally, with the help of STRINGdb software package, we extracted interaction relationships of the differential gene list from databases, constructing a PPI network diagram. RNA extraction and qPCR We utilized Trizol reagent to extract total RNA from cells or tissues, and adhered to manufacturer’s protocol to reverse transcribe RNA into cDNA through Goldenstar™ RT6 cDNA Synthesis Kit (Tsingke, TSK302M, Beijing, China). Subsequently, we conducted qPCR analysis in accordance with instructions for the 2×T5 Fast qPCR Mix (SYBR Green I) (Tsingke, TSE002). We harnessed housekeeping gene GAPDH to normalize mRNA expressions of each gene and applied 2-ΔΔCt method to calculate the fold change in gene expression. Primer sequences, synthesized by Sangon Biotech (Shanghai, China), were detailed in Table 1 . Table 1 Primer sequences used for quantitative PCR targeting genes related to Klotho signaling and inflammation. Gene Forward (5'−3') Rverse (5'−3') Klotho ACGGGGTTGTAGCCAAGAAG CGGTAGAAGTGCAGAACCGT Aβ GCCCAGAATCAGCTACGGAA AACCTGGTCGAGTGGTCAGT OSM TCACGGTCCACTACAACACC CTGAAGACCCTCCCCACTGA JAK1 TCTGTCACAACCTCTTCGCC CATCAAGGAGTGGGGTTGCT STAT3 GAAGCCGACCCAGGTAGT CATCAATGAATGGTGTCACACAG GAPDH GGAGAGTGTTTCCTCGTCCC TTTGCCGTGAGTGGAGTCAT Western Blot We utilized a radioimmunoprecipitation assay lysis buffer containing protease inhibitors to extract total proteins from cells or tissues. Subsequently, we separated the proteins from different groups by SDS-PAGE, then transferring them onto PVDF membranes. Thereafter, we blocked the membranes with 5% skim milk for 1 h. Post-blocking, we incubated those membranes with primary antibodies targeting Aβ (A17911, Abclonal, Wuhan, China), Klotho (bs-2925R, Bioss, Beijing, China), L-lactyl (PTM-1401, PTM, Hangzhou, China), H4K12la (PTM-1401RM, PTM), OSM (A8705, Abclonal), JAK1 (A18323, Abclonal), STAT3 (A16975, Abclonal), p-STAT3 (AP0070, Abclonal), or GAPDH (A19056, Abclonal) overnight at 4℃. Following day, we incubated membranes with horseradish peroxidase (HRP)-conjugated secondary antibodies (AS014, Abclonal) at room temperature for 1 h. Ultimately, we developed protein bands via ECL reagent (34580, Thermo, Waltham, USA), performing quantitative analysis of the bands with Image J software. ELISA We harnessed a mouse TNF-α ELISA kit (FANKEW, F2132-B, Shanghai, China), a mouse IL-1β ELISA kit (FANKEW, F2040-B), a mouse iNOS ELISA kit (FANKEW, F2454-B), and a mouse IL-10 ELISA kit (FANKEW, F2176-B) to individually measure the levels of tumor necrosis factor-α (TNF-α), IL-1β, iNOS, and IL-10. All experimental procedures were carried out in strict accordance with protocols provided by manufacturers. Immunohistochemistry We performed antigen retrieval on deparaffinized tissue sections with an antigen retrieval solution (Servicebio, G1201, Wuhan, China). Subsequently, we added 5% goat serum (Beyotime, C0265) dropwise and sealed those sections with cover slips, followed by incubation at room temperature for 30 min. Thereafter, we incubated the sections with cover slips overnight at 4℃ in a solution containing 5% goat serum and primary antibodies against Klotho (Bioss, bs-2925R), Aβ (ABclonal, A24949), H4K12la (Immunoway, YK0013, Plano, USA), and L-lactyl (PTM, PTM-1401RM). After incubation, we washed those sections and further incubated them at room temperature with a rabbit secondary antibody (ZENBIO, 511203, Research Triangle, USA) for 1.5 h. Next, we conducted DAB staining (ZSGB, ZLI-9019, Beijing, China) on the tissue sections and cell cover slips in the dark for 1 min, terminating the staining with tap water. Subsequently, we counterstained sections and cell cover slips with hematoxylin (Servicebio, G1004) for 1 min, dehydrated them through a graded series of alcohol, and mounted them with neutral resin (SINOPHARM, 10004160, Beijing, China). Finally, we captured images of sections and cover slips with an Mshot MF53 inverted microscope (MSHOT, Guangzhou, China). Establishment of animal model We procured 24 amyloid precursor protein APP/PS1 mice and 6 wild-type (WT) mice, all at 6 weeks of age, from Ensville Biotech (Chongqing, China). These mice were housed in a standard animal facility under pathogen-free conditions, maintaining a 12-h light-dark cycle for one week. All surgical procedures were conducted under stringent sterile conditions. Mice were anesthetized by intraperitoneal injection of pentobarbital sodium (0.1–0.2 mL/10 g). After anesthesia, the heads of the mice were shaved, and the scalp was incised to expose the skull. The skull surface was cleaned with dry cotton swabs to ensure complete exposure. The lateral ventricle of the mice was located according to the mouse brain atlas, positioned 0.034 cm posterior to the sagittal suture and 0.09 cm lateral. Following the manufacturer’s instructions, lentiviral particles were prepared and slowly injected into the lateral ventricle using a cannula needle. The needle was left in place for 10 minutes post-injection before removal. This procedure was repeated every 48 hours, for a total of 4 injections. After the final injection, the mice’s learning and memory capabilities were assessed. The scalp was closed with surgical sutures, and the wound was disinfected with alcohol-soaked cotton swabs after each injection. Mice were continuously monitored until they regained consciousness. On account of the varying plasmids injected, we categorized those mice into five groups: (1) Control group: WT mice transfected with an empty vector plasmid; (2) Model group: APP/PS1 double transgenic mice transfected with an empty vector plasmid; (3) WT Klotho group: APP/PS1 mice transfected with a WT Klotho plasmid; (4) Klotho F352V group: APP/PS1 mice transfected with a Klotho F352V plasmid; (5) sh-OSM group: APP/PS1 mice transfected with a plasmid encoding Klotho F352V and shRNA-OSM. Water maze test In this segment of our study, we applied Morris water maze test to assess the spatial learning and memory capabilities of mice, making suitable modifications to the testing protocol. We established a dark, circular pool filled with opaque water, typically dyed black to obscure mice’s vision. Pool was demarcated into four quadrants, and various visual cues were arranged around the room to assist mice in spatial orientation. Distinctive objects varying in shape and color were affixed to the walls of each quadrant, serving as reference points. During the training phase, we submerged a concealed platform beneath the water’s surface in one of the quadrants. Each mouse was subjected to four trials per day for a period of 5 consecutive days. On the 5th day, we removed the platform and initiated the spatial exploration experiment. For this experiment, mice were positioned at the midpoint of the quadrant opposite the former platform, with their backs facing the pool wall. We documented the time the mice spent in the area where the platform had been and the number of times they crossed the platform’s location within a 60-s interval, and then conducted a thorough analysis of this data with Ethovision video tracking software. Statistical analysis Experimental data were presented as mean ± standard error, and Comparisons between two groups are conducted using a t-test, while comparisons among multiple groups are performed using One-way ANOVA, and GraphPad Prism 8 software (GraphPad Software, Inc., San Diego, CA, USA) was used for data analysis and visualization. Differences were considered statistically significant at p < 0.05. Results Impacts of various Klotho genotypes on lactate production induced by Aβ and IBO in microglia and BV-2 cells In this study, Klotho lentiviral vectors encoding empty vector, wild-type Klotho, and the F352V variant were constructed and transfected into microglial cells. An AD microglial cell model was established using Aβ oligomers and ibotenic acid (IBO) to evaluate the differential effects of KL on lactylation and inflammatory responses in AD. The results of the study demonstrated that the expression of Aβ protein and inflammatory factors was significantly elevated in the model group, consistent with the pathological features of AD, indicating the successful establishment of the AD model. Concurrently, it was observed that the mRNA expression level of Klotho was decreased, while the level of L-lactyl protein was markedly increased, suggesting that Klotho and protein lactylation may be involved in the pathological process of AD (Fig. 1 A-C). Compared with the Model group, the Klotho + Model group exhibited an increase in Klotho expression levels, along with a significant reduction in L-lactyl, Aβ protein, and inflammatory factor levels. These findings demonstrate that Klotho has the ability to suppress protein lactylation and inflammation, thereby ameliorating AD pathology. However, compared with the Model group, the Klotho F352V + Model group showed a significant upregulation in Klotho expression levels, while no significant differences were observed in the expression of Aβ protein or inflammatory factor levels. This indicates that the mutation of Klotho to Klotho F352V abolishes its ability to suppress protein lactylation and inflammation in AD. In contrast to the AD model group, the Klotho F352V + Model group exhibited significantly upregulated Klotho mRNA and protein levels, along with increased H4K12la expression. However, Aβ protein levels were unaltered, and pro-inflammatory cytokine levels showed no significant changes (Fig. 1 A-C). These findings indicate that the Klotho F352V fails to suppress AD-associated lactylation and inflammatory responses via regulation of protein expression. The BV-2 cell line, an in vitro model for microglial studies, mimics many microglial functions and is a valuable tool for studying neuroinflammation and neurodegenerative diseases. However, BV-2 cells differ from primary microglia. Thus, both primary and BV-2 cells were used in the experimental design to ensure reliable and physiologically relevant findings. Results from BV-2 cells treated identically to primary microglia confirmed that Klotho suppresses AD-associated lactylation and inflammation by modulating specific protein expression, while the Klotho F352V variant lacks this ability (Fig. 2 A-C). Impacts of Klotho WT and Klotho F352V on differential gene expression and enrichment analysis induced by Aβ and IBO in BV-2 cells In our investigation, we made volcano plots to visualize differentially expressed genes, providing a clear depiction of impacts of Klotho WT + Model group and Klotho F352V + Model group on expression and enrichment analyses of genes in BV-2 cells induced by Aβ and IBO (Fig. 3 A). Furthermore, we conducted hierarchical clustering analysis of expression profiles of differential genes to further verify the presence of distinct gene expression distribution patterns between two groups of samples. Figure 3 B distinctly illustrated conspicuous differences in expression patterns of differential genes across these two groups. We performed GO, KEGG, Reactome enrichment analyses, and DO disease association analysis on these differential genes. All our results indicated that these genes are most closely associated with systematic development at BP level, most significantly linked to endomembrane system and cellular protrusions at CC level, and most intimately related to cation binding and metal ion binding at MF level (Fig. 3 C). These differential genes showed the most notable association with cancer-related pathways, neuroactive ligand-receptor interaction pathways, and calcium signaling pathways (Fig. 3 D). Their association with neurological diseases, particularly AD and related syndromes, was the most evident (Fig s 3E, F). Additionally, proteins encoded by these differential genes represented interactions within biological systems (Fig. 3 G). Our transcriptomic analysis revealed that the OSM gene exhibited significant differential expression between Klotho and Klotho F352V-treated cells. OSM is known to be associated with the JAK1/STAT3 signaling pathway, which is linked to glycolysis and has been implicated in the pathogenesis of AD. These findings underscore the importance of Klotho as a potential therapeutic target for AD, suggesting that Klotho may modulate AD progression through the OSM/JAK1/STAT3 signaling pathway. Using qPCR and Western blot (WB) analyses, we evaluated the expression changes of related genes and proteins, elucidating the effects of different Klotho genotypes on the OSM/JAK1/STAT3 signaling pathway. Our results demonstrated that the expression levels of OSM, JAK1, and STAT3 were significantly higher in the Klotho F352V group compared to the Klotho group (Fig. 4 A, B). However, previous studies have shown that Klotho F352V does not promote AD progression. Combined with the current findings, these results suggest that Klotho may exert its therapeutic effects by suppressing the OSM/JAK1/STAT3 signaling pathway, thereby inhibiting microglial lactylation and contributing to the amelioration of AD pathology. Influence of Klotho genotypes on OSM/JAK1/STAT3 pathway in BV-2 cells induced by Aβ and IBO To further elucidate the underlying mechanisms, RNA interference (RNAi) technology was employed to investigate whether Klotho suppresses microglial lactylation and inflammation through the OSM/JAK1/STAT3 signaling pathway. The experimental results demonstrated that the OSM/JAK1/STAT3 signaling pathway was significantly activated in the Model group, accompanied by a marked upregulation of Aβ, L-lactyl, and inflammatory factor levels, as well as a decrease in Klotho protein expression (Fig. 5 A, B; Fig. 6 A, B). These findings indicate that activation of the OSM/JAK1/STAT3 signaling pathway promotes lactylation in microglia, contributing to the pathological progression of AD. Compared to the Model group, the Klotho + Model group exhibited significant inhibition of the OSM/JAK1/STAT3 signaling pathway, along with reduced levels of Aβ, L-lactyl protein, and inflammatory factors (Fig. 5 A, B; Fig. 6 A, B). These results further demonstrate that the KL reduces microglial lactylation by suppressing the OSM/JAK1/STAT3 signaling pathway. In contrast, the Klotho F352V + Model group showed no significant changes in the OSM/JAK1/STAT3 signaling pathway, L-lactyl protein levels, or Aβ and inflammatory factor levels (Fig. 5 A, B; Fig. 6 A, B), indicating that the Klotho F352V mutation loses its ability to inhibit the OSM/JAK1/STAT3 signaling pathway. Furthermore, compared to the Klotho F352V + Model group, the Klotho F352V + sh-OSM + Model group displayed decreased levels of Aβ, L-lactyl protein, and inflammatory factors, providing additional evidence that the OSM/JAK1/STAT3 signaling pathway promotes AD pathology by enhancing microglial lactylation. Consistent with these findings, BV-2 cell data also corroborate the conclusions (Fig. 7 A, B; Fig. 8 A, B). Klotho genotypes’ impacts on in vivo OSM/JAK1/STAT3 pathway Using the APP/PS1 mouse model, we delivered different Klotho genotypes and OSM-specific shRNA vectors to demonstrate that Klotho suppresses microglial lactylation via inhibition of the OSM/JAK1/STAT3 signaling pathway. Compared to wild-type mice, APP/PS1 mice prior to lentiviral vector injection exhibited significantly fewer platform crossings and reduced time spent in the target quadrant (Fig. 9 A). Following lentiviral vector injection, the Klotho + Model group demonstrated significantly increased platform crossings and prolonged time in the target quadrant compared to the Model group (Fig. 9 B). In contrast, the Klotho F352V + Model group showed no significant differences in platform crossings or time spent in the target quadrant relative to the Model group. However, the Klotho F352V + sh-OSM + Model group exhibited significantly increased platform crossings and longer time spent in the target quadrant. H&E staining results revealed that, compared to the NC group, the Model group exhibited significant pathological alterations in hippocampal neurons, including degeneration, somatic atrophy, and nuclear hyperchromasia. However, these pathological phenotypes were markedly alleviated in the Klotho + Model group. In contrast, the Klotho F352V + Model group showed no significant differences in neuronal pathology compared to the Model group. Notably, in the Klotho F352V + sh-OSM + Model group, the pathological phenotypes of neuronal cells were significantly improved again (Fig. 9 C). Immunohistochemical results similarly demonstrated that in Model group, Klotho protein levels were decreased, while Aβ levels were increased. Klotho overexpression reduced Aβ levels, whereas the Klotho F352V variant had no effect on Aβ accumulation. Notably, in the Klotho F352V + sh-OSM + Model group, Klotho levels remained unchanged, but Aβ levels were significantly reduced following OSM interference (Fig. 9 D). The results demonstrate that Klotho significantly ameliorates AD symptoms in APP/PS1 mice, including improvements in spatial memory and learning ability, alleviation of hippocampal neuronal pathological damage, and reduction of Aβ deposition. These therapeutic effects are consistent with those achieved by inhibition of the OSM/JAK1/STAT3 signaling pathway. However, the Klotho F352V mutant loses this protective effect, while suppression of OSM expression through sh-OSM interference significantly improves AD pathological phenotypes once again. These findings indicate that Klotho exerts its therapeutic effects in AD by inhibiting the OSM/JAK1/STAT3 signaling pathway, further underscoring the importance of Klotho as a potential therapeutic target for AD. qRT-PCR, Western blot, and ELISA results showed significant activation of the OSM signaling pathway in the Model group, along with elevated levels of L-lactyl, and pro-inflammatory cytokines. Transduction with Klotho inhibited the OSM pathway and reduced L-lactyl, and pro-inflammatory cytokine levels. In contrast, Klotho F352V transduction had no significant effects. However, in the Klotho F352V + sh-OSM + Model group, OSM interference led to a significant reduction in L-lactyl, and pro-inflammatory cytokine levels (Fig. 10 A-C). Taken together, these results demonstrate that Klotho alleviates AD-associated lactylation and inflammatory responses through suppression of the OSM/JAK1/STAT3 signaling pathway. Discussion AD is the most prevalent neurodegenerative condition globally, which is considered a leading cause of dementia [ 15 ]. The increase in global life expectancy is a contributing factor to the rising incidence of AD [ 7 ]. From a neurological perspective, AD is characterized by neuroinflammation, the formation of Aβ plaques, and the accumulation of intracellular NFTs, which are closely associated with the progressive decline in cognitive function and the onset of neurodegeneration in patients [ 16 ]. Recent research has suggested that lactate produced by microglia might be a crucial factor in pathology of AD [ 17 ]. Consequently, elucidating regulatory mechanisms of microglial lactoylation could potentially offer a novel therapeutic approach for AD treatment. Microglia, the resident immune cells of the central nervous system (CNS), is known as an indispensable factor in pathological conditions[ 18 ]. Upon our establishment of AD microglial and animal models, we conducted a comprehensive investigation to the functions of protein lactylation in AD. According to our findings, a notable escalation in the concentrations of Aβ and L-lactate (l-lactyl) across both AD cellular and animal models, thereby underscoring the heightened protein lactylation associated with AD pathology. Moreover, studies have shown that lactate derived from aerobic glycolysis strongly promotes the release of pro-inflammatory cytokines, such as TNF-α, IL-6, and IL-1β, from microglia [ 19 ]. Furthermore, our experimental results indicated an increase in secretion of various inflammatory factors in AD models. These findings suggest that protein lactylation and neuroinflammation are key features of AD. Therefore, targeting protein lactylation and neuroinflammation inhibition may represent a promising therapeutic strategy for AD. Klotho is a protein encoded by the KL, predominantly expressed in the kidneys and the choroid plexus of the brain [ 20 , 21 ]. Klotho is implicated in various age-related pathological processes [ 12 ], including cardiovascular diseases, chronic kidney disease, cancer, and neurodegenerative disorders [ 22 ]. Klotho expression is significantly reduced in the aging brain and in the brains of patients with early AD [ 23 ]. Furthermore, research in elderly amyloid mouse models has demonstrated that overexpression of Klotho protein in the brain can ameliorate AD-like pathology and cognitive deficits, and reverse neuronal damage. Additionally, Klotho can mitigate Aβ accumulation in mouse models by regulating Aβ-related transport proteins and the transformation of microglia [ 24 ]. Therefore, we believe that Klotho protein holds promise as a therapeutic target for AD. However, the role of Klotho in regulating protein lactylation in the context of AD pathology remains unclear. To investigate this further, we explored the impact of Klotho genotype on lactylation in AD and examined potential mechanisms, aiming to identify novel therapeutic targets. Our results demonstrated that, relative to the Model group, the Klotho + Model group exhibited significantly reduced levels of Klotho, Aβ, L-lactyl and pro-inflammatory cytokines, along with increased levels of anti-inflammatory factors. In contrast, the Klotho F352V + Model group showed markedly elevated Klotho levels but no significant changes in Aβ, L-lactyl, or pro-inflammatory cytokine levels. These findings suggest that Klotho may alleviate AD progression by inhibiting protein lactylation and neuroinflammation. These findings may be attributed to long-term microglia activation. Microglia activation plays a dual role in AD pathogenesis. On one hand, Aβ binding to pattern recognition receptors (PRRs) triggers acute activation of resting microglia, leading to cytokine expression and promoting Aβ phagocytosis, uptake, and clearance [ 25 ], thereby preventing Aβ deposition and amyloid plaque formation. Microglia that phagocytose Aβ and aggregate around plaques are characterized by an M2 activation phenotype [ 26 ]. On the other hand, long-term microglia activation can result in proliferation and a chronic inflammatory state, contributing to neurotoxicity and neurodegeneration [ 25 ]. This is because chronic exposure to Aβ induces microglia to release pro-inflammatory cytokines and neurotoxic substances, including TNF-α, IL-1, IL-6, IFN-γ, and reactive oxygen species [ 27 ]. Specifically, TNF-α is one of the most important pro-inflammatory cytokines in AD [ 28 ]. In vitro studies have shown that Aβ directly stimulates TNF-α production in microglia through activation of the transcription factor NF-κB [ 29 ]. TNF-α increases the expression of β- and γ-secretases, which generate Aβ from APP in vitro [ 30 , 31 ]. Therefore, pro-inflammatory cytokines, such as IFN-γ, IL-1β, and TNF-α, can reduce microglial phagocytic activity and promote a pro-inflammatory M1 phenotype [ 32 ], leading to elevated levels of Aβ and inflammatory factors. To further elucidate the mechanism by which Klotho F352V regulates AD protein lactylation, we conducted transcriptome analysis and identified OSM as a key mediator linking Klotho genotype to AD. Notably, Haitao Y et al.[ 33 ] found a significant correlation between OSM gene expression and the hallmark pathological markers of AD, Aβ and Tau. Studies have also reported elevated plasma OSM protein levels in both AD and Aβ-negative MCI patients [ 34 ]. Therefore, the Klotho may regulate OSM expression, potentially impacting the lactylation of AD proteins. Our findings that Klotho regulates protein lactylation via the OSM/JAK1/STAT3 pathway are further supported by studies in cancer metabolism. Previous research has identified OSM as an upstream signaling molecule in the JAK/STAT pathway [ 35 ], which has been shown to regulate glycolysis in lung cancer, renal cell carcinoma, and breast cancer cells [ 36 ]. The JAK/STAT pathway promotes Myc gene expression, which in turn enhances the expression of lactate dehydrogenase (LDH) and increases lactate production through HIF-1α-mediated transcription [ 37 ]. Lactate further activates the JAK/STAT pathway by promoting STAT3 phosphorylation and enhancing JAK1 protein translation, thereby promoting proliferation and metastasis in breast and colon cancer cells [ 38 ]. These findings highlight the conserved nature of this inflammatory metabolic circuit, supporting our hypothesis that Klotho modulates microglial lactylation in AD via the same OSM/JAK1/STAT3 axis. Recognizing the established links between microglial lactylation, Klotho, and the OSM/JAK/STAT signaling pathway in AD, we aim to elucidate how Klotho genotype proteins regulate lactylation via the OSM/JAK/STAT pathway, ultimately identifying novel therapeutic targets for AD treatment. Thus, we conducted both in vitro and in vivo experiments to explore the functional link between Klotho and the OSM/JAK1/STAT3 signaling pathway. These results revealed a significant increase in the expression of OSM, JAK1, and STAT3 in the Klotho group, but not in the Klotho F352V group. RNAi-mediated OSM downregulation significantly reduced OSM expression without altering Klotho levels, while also decreasing Aβ, L-lactyl, and pro-inflammatory cytokine levels. Klotho suppresses microglial protein lactylation and neuroinflammation through inhibition of the OSM/JAK1/STAT3 pathway, ultimately offering potential for AD prevention and treatment. Our study thus highlights the changes in lactylation during AD progression and elucidates the role of Klotho in regulating lactylation and its underlying mechanisms. These findings identify novel therapeutic targets for AD. Conclusion Klotho suppresses microglial protein lactylation and neuroinflammation through inhibition of the OSM/JAK1/STAT3 pathway, ultimately offering potential for AD prevention and treatment. Declarations Ethical Approval and Consent to participate All animal experiments were conducted in accordance with the guidelines of the Ethics Committee of Chengdu Medical College (Approval No. 2023-047). All procedures were performed in compliance with the relevant ethical standards for the care and use of laboratory animals. Consent for publication All participants provided written consent for the publication of their data and any accompanying images. Data availability The results of RNA-seq are available in the National Genomics Data Center (GSA: CRA021092), which are publicly accessible at https://ngdc.cncb.ac.cn/gsa. The datasets generated during the current study will be available form the corresponding author upon a reasonable request. Competing interests The authors declare no conflict of interest. Funding This study was supported by Sichuan Applied Psychology Research Center (CSXL-22210) and the Sichuan Provincial Department of Science and Technology (2020YJ0175). Authors' contributions Yingying Cai: Conceived and designed the study, supervised the experiments, wrote the manuscript; Ling Li: Performed the in vitro experiments, analyzed the data, and contributed to manuscript writing; Zhuorong Li: Performed the in vivo experiments, contributed to data analysis, and revised the manuscript. All authors contributed to and approved the final manuscript. All authors contributed to editorial changes in the manuscript. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work. Acknowledgements We express our sincere gratitude to all staff members for their hard work and dedication in implementing the intervention and evaluation components of this study. References Monteiro AR, Barbosa DJ, Remião F, Silva R (2023). Alzheimer’s disease: Insights and new prospects in disease pathophysiology, biomarkers and disease-modifying drugs. Biochem Pharmacol, 211:115522. Jucker M, Walker LC (2023). Alzheimer’s disease: From immunotherapy to immunoprevention. Cell, 186:4260–4270. Jucker M, Walker LC (2018). Propagation and spread of pathogenic protein assemblies in neurodegenerative diseases. Nat Neurosci, 21:1341–1349. Long JM, Holtzman DM (2019). Alzheimer Disease: An Update on Pathobiology and Treatment Strategies. Cell, 179:312–339. Liguori C, Chiaravalloti A, Sancesario G, Stefani A, Sancesario GM, Mercuri NB, et al. (2016). Cerebrospinal fluid lactate levels and brain [18F]FDG PET hypometabolism within the default mode network in Alzheimer’s disease. Eur J Nucl Med Mol Imaging, 43:2040–2049. Xiang X, Wind K, Wiedemann T, Blume T, Shi Y, Briel N, et al. (2021). Microglial activation states drive glucose uptake and FDG-PET alterations in neurodegenerative diseases. Sci Transl Med, 13(615):eabe5640. Pan R-Y, He L, Zhang J, Liu X, Liao Y, Gao J, et al. (2022). Positive feedback regulation of microglial glucose metabolism by histone H4 lysine 12 lactylation in Alzheimer’s disease. Cell Metab, 34:634-648.e6. Kuro-o M (2019). The Klotho proteins in health and disease. Nat Rev Nephrol, 15:27–44. Kuro-o M (2010). Klotho. Pflugers Arch, 459:333–343. Prud’homme GJ, Kurt M, Wang Q (2022). Pathobiology of the Klotho Antiaging Protein and Therapeutic Considerations. Front Aging, 3:931331. Cararo-Lopes MM, Mazucanti CHY, Scavone C, Kawamoto EM, Berwick DC (2017). The relevance of α-KLOTHO to the central nervous system: Some key questions. Ageing Res Rev, 36:137–148. Zhao Y, Zeng C, Li X, Yang T, Kuang X, Du J (2020). Klotho overexpression improves amyloid‐β clearance and cognition in the APP/PS1 mouse model of Alzheimer’s disease. Aging Cell, 19(10):e13239. Arking DE, Krebsova A, Macek M, Macek M, Arking A, Mian IS, et al. (2002). Association of human aging with a functional variant of klotho. Proc Natl Acad Sci USA 99(2):856–861. Ozdem S, Yılmaz VT, Ozdem SS, Donmez L, Cetinkaya R, Suleymanlar G, et al. (2015). Is Klotho F352V Polymorphism the Missing Piece of the Bone Loss Puzzle in Renal Transplant Recipients? Pharmacology, 95:271–278. Iyaswamy A, Krishnamoorthi SK, Song J-X, Yang C-B, Kaliyamoorthy V, Zhang H, et al. (2020). NeuroDefend, a novel Chinese medicine, attenuates amyloid-β and tau pathology in experimental Alzheimer’s disease models. J Food Drug Anal, 28:132–146. Ising C, Venegas C, Zhang S, Scheiblich H, Schmidt S V., Vieira-Saecker A, et al. (2019). NLRP3 inflammasome activation drives tau pathology. Nature, 575:669–673. Yang X, Chen Y-H, Liu L, Gu Z, You Y, Hao J-R, et al. (2024). Regulation of glycolysis-derived L-lactate production in astrocytes rescues the memory deficits and Aβ burden in early Alzheimer’s disease models. Pharmacol Res, 208:107357. Sierra A, Paolicelli RC, Kettenmann H (2019). Cien Años de Microglía: Milestones in a Century of Microglial Research. Trends Neurosci, 42:778–792. Andersson AK, Rönnbäck L, Hansson E (2005). Lactate induces tumour necrosis factor‐α, interleukin‐6 and interleukin‐1β release in microglial‐ and astroglial‐enriched primary cultures. J Neurochem, 93:1327–1333. Dias GP, Murphy T, Stangl D, Ahmet S, Morisse B, Nix A, et al. (2021). Intermittent fasting enhances long-term memory consolidation, adult hippocampal neurogenesis, and expression of longevity gene Klotho. Mol Psychiatry, 26:6365–6379. Mytych J, Sołek P, Będzińska A, Rusinek K, Warzybok A, Tabęcka-Łonczyńska A, et al. (2020). Towards Age-Related Anti-Inflammatory Therapy: Klotho Suppresses Activation of ER and Golgi Stress Response in Senescent Monocytes. Cells, 9:261. Chen K, Sun Z (2019). Autophagy plays a critical role in Klotho gene deficiency-induced arterial stiffening and hypertension. J Mol Med, 97:1615–1625. Li D, Jing D, Liu Z, Chen Y, Huang F, Behnisch T (2019). Enhanced Expression of Secreted α-Klotho in the Hippocampus Alters Nesting Behavior and Memory Formation in Mice. Front Cell Neurosci, 13:133. Fung T, Iyaswamy A, Sreenivasmurthy S, Krishnamoorthi S, Guan X-J, Zhu Z, et al. (2022). Klotho an Autophagy Stimulator as a Potential Therapeutic Target for Alzheimer’s Disease: A Review. Biomedicines, 10:705. Sarlus H, Heneka MT (2017). Microglia in Alzheimer’s disease. J Clin Invest, 127:3240–3249. Jimenez S, Baglietto-Vargas D, Caballero C, Moreno-Gonzalez I, Torres M, Sanchez-Varo R, et al. (2008). Inflammatory Response in the Hippocampus of PS1 M146L /APP 751SL Mouse Model of Alzheimer’s Disease: Age-Dependent Switch in the Microglial Phenotype from Alternative to Classic. J Neurosci, 28:11650–11661. Li Q, Wu Y, Chen J, Xuan A, Wang X (2022). Microglia and immunotherapy in Alzheimer’s disease. Acta Neurol Scand, 145:273–278. Yang S-H (2019). Cellular and Molecular Mediators of Neuroinflammation in Alzheimer Disease. Int Neurourol J, 23:S54-62. Combs CK, Karlo JC, Kao S-C, Landreth GE (2001). β-Amyloid Stimulation of Microglia and Monocytes Results in TNFα-Dependent Expression of Inducible Nitric Oxide Synthase and Neuronal Apoptosis. J Neurosci, 21:1179–1188. Blasko I, Veerhuis R, Stampfer-Kountchev M, Saurwein-Teissl M, Eikelenboom P, Grubeck-Loebenstein B (2000). Costimulatory Effects of Interferon-γ and Interleukin-1β or Tumor Necrosis Factor α on the Synthesis of Aβ1-40 and Aβ1-42 by Human Astrocytes. Neurobiol Dis, 7:682–689. Liao Y-F, Wang B-J, Cheng H-T, Kuo L-H, Wolfe MS (2004). Tumor Necrosis Factor-α, Interleukin-1β, and Interferon-γ Stimulate γ-Secretase-mediated Cleavage of Amyloid Precursor Protein through a JNK-dependent MAPK Pathway. J Biol Chem, 279:49523–49532. Koenigsknecht-Talboo J, Landreth GE (2005). Microglial Phagocytosis Induced by Fibrillar β-Amyloid and IgGs Are Differentially Regulated by Proinflammatory Cytokines. J Neurosci, 25:8240–8249. Yu H, Wang F, Wu J, Gong J, Bi S, Mao Y, et al. (2023). Integrated transcriptomics reveals the brain and blood biomarkers in Alzheimer’s disease. CNS Neurosci Ther, 29:3943–3951. Whelan CD, Mattsson N, Nagle MW, Vijayaraghavan S, Hyde C, Janelidze S, et al. (2019). Multiplex proteomics identifies novel CSF and plasma biomarkers of early Alzheimer’s disease. Acta Neuropathol Commun, 7:169. Moidunny S, Matos M, Wesseling E, Banerjee S, Volsky DJ, Cunha RA, et al. (2016). Oncostatin M promotes excitotoxicity by inhibiting glutamate uptake in astrocytes: implications in HIV-associated neurotoxicity. J Neuroinflammation, 13:144. Li W, Wang Y, Li X, Wu H, Jia L (2024). Dexmedetomidine hydrochloride plus sufentanil citrate inhibits glucose metabolism and epithelial‑mesenchymal transition in human esophageal squamous carcinoma KYSE30 cells by modulating the JAK/STAT3/HIF‑1α axis. Oncol Lett, 27:273. Flores A, Schell J, Krall AS, Jelinek D, Miranda M, Grigorian M, et al. (2017). Lactate dehydrogenase activity drives hair follicle stem cell activation. Nat Cell Biol, 19:1017–1026. Xiong J, He J, Zhu J, Pan J, Liao W, Ye H, et al. (2022). Lactylation-driven METTL3-mediated RNA m6A modification promotes immunosuppression of tumor-infiltrating myeloid cells. Mol Cell, 82:1660-1677.e10. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 09 Mar, 2026 Read the published version in Immunity & Ageing → Version 1 posted Editorial decision: Revision requested 30 Jan, 2026 Reviewers agreed at journal 23 Dec, 2025 Reviews received at journal 18 Nov, 2025 Reviewers agreed at journal 06 Nov, 2025 Reviews received at journal 29 Oct, 2025 Reviewers agreed at journal 16 Oct, 2025 Reviewers invited by journal 15 Oct, 2025 Editor assigned by journal 14 Oct, 2025 Submission checks completed at journal 14 Oct, 2025 First submitted to journal 03 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7770928","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":536245386,"identity":"96d17698-1c06-4469-a1c1-c31a5d3b9dc4","order_by":0,"name":"Yingying Cai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYBACNvbG5gcJFRL1jM3sB4GMGsJa+HgOHzP4cMYmgbmdJ9ngwZljhLXISaQlSM5sS0tg72cwk3zYwkyEw3jOGBjznDmcx9vMkFaR2MDGwN/enUDALz0Gj3kqDhdLNjMeu5G4Q4ZB4szZDUTZwrgRaMuNxDNsDAYSuQS0SOQYSPO2HWbcf5jBrCCxjZkYLRDvJzY2M5gxEKcFGsjGjM08yRIJZ47xEPSLfDskKuUY+48f/PijokaOv70XvxYMwEOa8lEwCkbBKBgFWAEAIsVNJbk7GIcAAAAASUVORK5CYII=","orcid":"","institution":"The First Affiliated Hospital of Chengdu Medical College","correspondingAuthor":true,"prefix":"","firstName":"Yingying","middleName":"","lastName":"Cai","suffix":""},{"id":536245388,"identity":"025add23-adac-4b9b-b524-fa311377055a","order_by":1,"name":"Ling Li","email":"","orcid":"","institution":"The First Affiliated Hospital of Chengdu Medical College","correspondingAuthor":false,"prefix":"","firstName":"Ling","middleName":"","lastName":"Li","suffix":""},{"id":536245390,"identity":"ca0d76ad-851d-436b-a3b5-26b40bd3046f","order_by":2,"name":"Zhuorong Li","email":"","orcid":"","institution":"The First Affiliated Hospital of Chengdu Medical College","correspondingAuthor":false,"prefix":"","firstName":"Zhuorong","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2025-10-03 06:53:31","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7770928/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7770928/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12979-026-00563-x","type":"published","date":"2026-03-09T15:58:16+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":94679268,"identity":"5168a864-eb85-4f4e-bdc9-1785fa0dab66","added_by":"auto","created_at":"2025-10-29 14:25:24","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7791305,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/d6b33ed86b213e79143ef78a.docx"},{"id":94679258,"identity":"a3d0dfdf-7d04-43d9-b237-83d621aa39e3","added_by":"auto","created_at":"2025-10-29 14:25:24","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":719654,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/7035aa4020e4ae31577d2255.tif"},{"id":94728191,"identity":"e23e7478-de0c-4473-bf5e-321cc62e0b1f","added_by":"auto","created_at":"2025-10-30 07:03:19","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":984082,"visible":true,"origin":"","legend":"","description":"","filename":"Fig10.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/cdd45e5c5cbf6ab494212789.tif"},{"id":94728583,"identity":"01e42ed9-da31-4937-80b8-4cfa4aff473e","added_by":"auto","created_at":"2025-10-30 07:04:02","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":707562,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/ae3b3a2687ad693bd09da1fa.tif"},{"id":94679263,"identity":"fea80fa9-3cc7-4f9b-bf4b-f2cc62fa2b43","added_by":"auto","created_at":"2025-10-29 14:25:24","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1193340,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/8fa054745854cacabf2e1e74.tif"},{"id":94728298,"identity":"445e61e7-f6cd-4b2c-be31-4ae43be34e0c","added_by":"auto","created_at":"2025-10-30 07:03:29","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":260148,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/733c7e6b5af524aa13d68f3c.tif"},{"id":94728482,"identity":"0a52af39-d975-41f6-a0dc-8c591f4704c2","added_by":"auto","created_at":"2025-10-30 07:03:54","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":750682,"visible":true,"origin":"","legend":"","description":"","filename":"Fig5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/fac2a6bd86fd968fc26891c1.tif"},{"id":94679266,"identity":"ab12ca90-99fa-496b-8be6-be8747a12289","added_by":"auto","created_at":"2025-10-29 14:25:24","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1642948,"visible":true,"origin":"","legend":"","description":"","filename":"Fig6.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/62df9eec44c88f05d288537a.tif"},{"id":94679275,"identity":"2b9a688a-9196-4702-9e70-53b561c49807","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":769194,"visible":true,"origin":"","legend":"","description":"","filename":"Fig7.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/e3eb06c7660c5783ad7d6770.tif"},{"id":94728597,"identity":"efa989d2-5987-4954-93f8-dd726acbb67f","added_by":"auto","created_at":"2025-10-30 07:04:03","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1342202,"visible":true,"origin":"","legend":"","description":"","filename":"Fig8.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/d9ca5bc9780da89f1e97cfed.tif"},{"id":94728226,"identity":"39912855-9eef-4dc1-87f2-c6ebed5e9290","added_by":"auto","created_at":"2025-10-30 07:03:21","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1775822,"visible":true,"origin":"","legend":"","description":"","filename":"Fig9.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/1a49886b594cc20d6defcef5.tif"},{"id":94728007,"identity":"f7254d95-6120-42a5-a65d-0becbaa98d30","added_by":"auto","created_at":"2025-10-30 07:02:46","extension":"json","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5324,"visible":true,"origin":"","legend":"","description":"","filename":"7c4baef4116a4539a74af8c2f768ef50.json","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/c30290f3e32457b1ef71217b.json"},{"id":94727965,"identity":"b5c3bce3-c3e0-4cea-a852-100c39321389","added_by":"auto","created_at":"2025-10-30 07:02:25","extension":"xml","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":116512,"visible":true,"origin":"","legend":"","description":"","filename":"7c4baef4116a4539a74af8c2f768ef501enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/5451c1c581cdc7e11a35b1f3.xml"},{"id":94679288,"identity":"0bacb1ca-294e-45e0-b5c3-85e31915db5d","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":719654,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/5ff4def15b499fdcffec9f8e.tif"},{"id":94679282,"identity":"a9e3f4e2-5ff4-4658-9d5b-4f98776a8d01","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"tif","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":984082,"visible":true,"origin":"","legend":"","description":"","filename":"Fig10.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/38aebe6f59d30ed4ce6b9488.tif"},{"id":94728448,"identity":"35c6bf38-2ebf-49d0-b46a-3ccca78a2ebe","added_by":"auto","created_at":"2025-10-30 07:03:49","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":707562,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/b28d5f2e46ad385c4297a4e5.tif"},{"id":94728387,"identity":"21e9c064-db54-4566-bfc1-5776bdf38c5a","added_by":"auto","created_at":"2025-10-30 07:03:42","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1193340,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/375bc71bf2f1b3f3edec4a34.tif"},{"id":94679294,"identity":"7dd7236c-d739-46d0-83c0-f4ff357764e5","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":260148,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/e8acfa05a1b4532ae09fcad5.tif"},{"id":94679281,"identity":"dce316d7-7e80-4d8a-8fdb-3e83618ae062","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":750682,"visible":true,"origin":"","legend":"","description":"","filename":"Fig5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/9ce6e82bddff3b6882a249da.tif"},{"id":94679319,"identity":"9c802765-73f6-4ebe-ac32-e641bfb6de2e","added_by":"auto","created_at":"2025-10-29 14:25:26","extension":"tif","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1642948,"visible":true,"origin":"","legend":"","description":"","filename":"Fig6.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/3fe43432f846b46427f817ae.tif"},{"id":94679279,"identity":"35fb1a69-7ce1-4933-ae40-e0a8cef061b5","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"tif","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":769194,"visible":true,"origin":"","legend":"","description":"","filename":"Fig7.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/2945dda32bfe7f37f7b19545.tif"},{"id":94728192,"identity":"b6eacea1-ddd1-4e1b-adee-d98156c0c8a4","added_by":"auto","created_at":"2025-10-30 07:03:19","extension":"tif","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1342202,"visible":true,"origin":"","legend":"","description":"","filename":"Fig8.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/482b8c5dd816d12aa8e63a47.tif"},{"id":94679277,"identity":"cde1c676-8703-4286-a997-350687a1450b","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"tif","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1775822,"visible":true,"origin":"","legend":"","description":"","filename":"Fig9.tif","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/6183f7c3399a14e267d7b31c.tif"},{"id":94728608,"identity":"f5a1926d-de95-4334-b1a9-22a22d23c28a","added_by":"auto","created_at":"2025-10-30 07:04:04","extension":"jpeg","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":497272,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/98c6af9ad76d7d8a9f785ac0.jpeg"},{"id":94728056,"identity":"d7fdd1a0-fa9b-4423-8489-6e8a388cfb70","added_by":"auto","created_at":"2025-10-30 07:02:57","extension":"jpeg","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":702004,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/9bc10cb711026520aeea78d7.jpeg"},{"id":94727956,"identity":"d0d6b527-a258-4b06-a016-f2622b79d1a1","added_by":"auto","created_at":"2025-10-30 07:02:15","extension":"jpeg","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":503786,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/35a9514459c1f4f9cd1582aa.jpeg"},{"id":94728679,"identity":"8e039263-594e-4932-a438-dbaaaf1d9b47","added_by":"auto","created_at":"2025-10-30 07:04:10","extension":"jpeg","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1006334,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/07cf1438eb48cb94426d5872.jpeg"},{"id":94679286,"identity":"390fead2-97c8-488d-ad7f-1910948fc17d","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"jpeg","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":178672,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/d293b8f19704a09191fa1a70.jpeg"},{"id":94679283,"identity":"9cbc3d25-085d-4b31-864b-a2b8280a9980","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"jpeg","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":534908,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/fe03f321fa016c221e650573.jpeg"},{"id":94679308,"identity":"57790cdb-a036-4318-9b6b-a9ad9b032b9e","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"jpeg","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1152116,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/9ea978c4df57d339e882b809.jpeg"},{"id":94728250,"identity":"6684f5e4-ee74-47db-939f-512964704aef","added_by":"auto","created_at":"2025-10-30 07:03:24","extension":"jpeg","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":529484,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/f28ce735c95d9da7338d1c43.jpeg"},{"id":94679290,"identity":"704ae5d8-2188-486e-b981-ff87512fbfbf","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"jpeg","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":908142,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/f6aa344b98eae36521463990.jpeg"},{"id":94727977,"identity":"ac22dada-9022-4657-ad3d-b55d9aa92dc4","added_by":"auto","created_at":"2025-10-30 07:02:36","extension":"jpeg","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1620256,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/3fcf85904f7a65dae9174c83.jpeg"},{"id":94728804,"identity":"da39c1f7-ba8e-418f-8a71-1c7118bdb098","added_by":"auto","created_at":"2025-10-30 07:04:17","extension":"png","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":66856,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig1.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/4d3cf5223dec45f74a996914.png"},{"id":94679299,"identity":"634a6b67-fb75-4155-a308-67e922826a12","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"png","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101709,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig10.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/7c528b858da5ff918caa7fc4.png"},{"id":94679304,"identity":"3d652cab-27bf-4c46-b6b6-c33dcaec3e62","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"png","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":68043,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/2c83eb1c75383415f2bd80dc.png"},{"id":94679315,"identity":"fe3d7550-84e9-4e14-bcc9-cdbf2aabcf2b","added_by":"auto","created_at":"2025-10-29 14:25:26","extension":"png","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":115012,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/c656c923cf3fa93e79a96f50.png"},{"id":94679285,"identity":"3fa076ef-4c15-41b3-a4d2-70dca680ed57","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"png","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":35881,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/fc2bc5d4ad9a796c7daecbb3.png"},{"id":94727973,"identity":"d9711a54-13aa-4325-8eae-1d1d451c405b","added_by":"auto","created_at":"2025-10-30 07:02:34","extension":"png","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":76082,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig5.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/7a262da76cd39c85c1a61d01.png"},{"id":94728099,"identity":"cacdc005-f058-4747-9c1a-793ba201882c","added_by":"auto","created_at":"2025-10-30 07:03:04","extension":"png","order_by":39,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":187043,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig6.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/d78f15636ff3f35208304558.png"},{"id":94679313,"identity":"762ca3b1-01e5-4fa3-8e73-d131d8887b8a","added_by":"auto","created_at":"2025-10-29 14:25:26","extension":"png","order_by":40,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":74913,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig7.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/3bf76ad2f9ad6c09fcb48b54.png"},{"id":94679317,"identity":"4b68c034-ad0f-4673-8ea3-860420982bc3","added_by":"auto","created_at":"2025-10-29 14:25:26","extension":"png","order_by":41,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":150676,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig8.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/a3e01dba8c47e5c94f4ac65c.png"},{"id":94679311,"identity":"94c07d06-ab2d-43fb-a02a-3a7fe40bc4cf","added_by":"auto","created_at":"2025-10-29 14:25:26","extension":"png","order_by":42,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":215978,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig9.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/57c2709206f33d9a65ef8b07.png"},{"id":94679307,"identity":"533796b4-5a6c-4921-b756-ee136d3a7bd1","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"png","order_by":43,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":60482,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/9f43595603a4031ca2be1599.png"},{"id":94679301,"identity":"e7e0aeae-a912-4f3e-9497-d46bf034ce64","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"png","order_by":44,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":93406,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/29c01e4cdc38de7b819627dd.png"},{"id":94728373,"identity":"bab0dbad-75df-422c-bcfc-a7b3102cd1f0","added_by":"auto","created_at":"2025-10-30 07:03:41","extension":"png","order_by":45,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":61919,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/bf5b0928f6952a5e8ea4c99b.png"},{"id":94728791,"identity":"a66ea9a6-d794-4308-b1a8-27bc4fb30823","added_by":"auto","created_at":"2025-10-30 07:04:17","extension":"png","order_by":46,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":123460,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/15ebca0ffc8333de57c56262.png"},{"id":94728132,"identity":"655aed21-93ed-4070-89fc-4df9ea56ea27","added_by":"auto","created_at":"2025-10-30 07:03:08","extension":"png","order_by":47,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":33057,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/72b0e0e483e2ebd44a41956c.png"},{"id":94728395,"identity":"a015cfad-707a-4a08-83fe-da364b54521d","added_by":"auto","created_at":"2025-10-30 07:03:44","extension":"png","order_by":48,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":68764,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/8d2c86cbced668912f4fa11b.png"},{"id":94727971,"identity":"16a5017c-a49a-4451-91ab-1bfdae089b50","added_by":"auto","created_at":"2025-10-30 07:02:32","extension":"png","order_by":49,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":177261,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/62b32bd41f1769e6a507f47c.png"},{"id":94679297,"identity":"44957198-3d8d-4a1f-b3ce-f4497ba3a498","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"png","order_by":50,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":69175,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/f18df95d132c15cda30f8077.png"},{"id":94679309,"identity":"31a97ea6-9b3e-4bd6-83de-b554c37d13b2","added_by":"auto","created_at":"2025-10-29 14:25:26","extension":"png","order_by":51,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":144088,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/c083a35d6f812799201454f2.png"},{"id":94679318,"identity":"e821be65-dd46-4287-b103-6ba741667b18","added_by":"auto","created_at":"2025-10-29 14:25:26","extension":"png","order_by":52,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":233023,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/905b0628b0d4699864f092d1.png"},{"id":94679292,"identity":"5e586fa7-8739-4930-adb1-1b029fa853b0","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"xml","order_by":53,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":119099,"visible":true,"origin":"","legend":"","description":"","filename":"7c4baef4116a4539a74af8c2f768ef501structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/f075f5a20981c79f0f10dc0a.xml"},{"id":94679322,"identity":"c73e0d6a-83e9-489f-b25e-fd94a73f8b03","added_by":"auto","created_at":"2025-10-29 14:25:26","extension":"html","order_by":54,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":129135,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/ea73bfd630c0e1a7bda541c9.html"},{"id":94679256,"identity":"1ae9babe-a558-4c7c-99fd-dee2afaf19a9","added_by":"auto","created_at":"2025-10-29 14:25:24","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":731458,"visible":true,"origin":"","legend":"\u003cp\u003eKlotho genotypes regulate lactylation and inflammation in Aβ/IBO−induced primary microglia. A mRNA expression levels of Klotho and Aβ measured by qRT−PCR. B Protein levels of Klotho, Aβ,, Aβ, L−Lactyl and H4K12la were detected by Western blot. C Concentrations of TNF−α, IL−1β, iNOS, and IL−10 assessed by ELISA. Data are presented as mean ± SD (n=3). Statistical significance: * \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; *** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; # \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; ## \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01; ###\u003cem\u003e p\u003c/em\u003e \u0026lt;0.001; \u0026amp; \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; \u0026amp;\u0026amp;\u003cem\u003ep\u003c/em\u003e \u0026lt;0.01; \u0026amp;\u0026amp;\u0026amp;\u003cem\u003e p\u003c/em\u003e \u0026lt;0.01; ^^\u003cem\u003e p\u003c/em\u003e \u0026lt;0.01; ^^^\u003cem\u003ep\u003c/em\u003e \u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/a9d1f68bf12bbe1112877366.png"},{"id":94679257,"identity":"42ceabf2-fd61-40cf-b207-528acc7831e6","added_by":"auto","created_at":"2025-10-29 14:25:24","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":758327,"visible":true,"origin":"","legend":"\u003cp\u003eKlotho genotypes regulate lactylation and inflammation in Aβ/IBO−induced BV−2 microglial cells. \u003cstrong\u003eA\u003c/strong\u003e mRNA expression levels of Klotho and Aβ measured by qRT−PCR. \u003cstrong\u003eB\u003c/strong\u003e Protein levels of Klotho, Aβ, L−Lactyl, and H4K12la detected by Western blot. \u003cstrong\u003eC\u003c/strong\u003e Concentrations of TNF−α, IL−1β, iNOS, and IL−10 assessed by ELISA. Data are presented as mean ± SD (n=3). Statistical significance: * \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; *** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; # \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; ## \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01; ###\u003cem\u003e p\u003c/em\u003e \u0026lt;0.001; \u0026amp; \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; \u0026amp;\u0026amp;\u003cem\u003ep\u003c/em\u003e \u0026lt;0.01; \u0026amp;\u0026amp;\u0026amp;\u003cem\u003e p\u003c/em\u003e \u0026lt;0.01; ^^\u003cem\u003e p\u003c/em\u003e \u0026lt;0.01; ^^^\u003cem\u003ep\u003c/em\u003e \u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/5b16bec21ade7fe3268147f5.png"},{"id":94728616,"identity":"eb384f48-d8c1-43a3-baec-d6420507be96","added_by":"auto","created_at":"2025-10-30 07:04:05","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1316677,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptomic profiling reveals genotype−specific responses to Klotho in Aβ/IBO−treated BV−2 cells. \u003cstrong\u003eA\u003c/strong\u003e Volcano plot of differentially expressed genes (DEGs) between Klotho WT and F352V groups, up−regulated genes are represented by red dots, down−regulated genes by blue dots, and indifferent genes by gray dots. \u003cstrong\u003eB\u003c/strong\u003e Heatmap showing hierarchical clustering of DEGs. \u003cstrong\u003eC\u003c/strong\u003e GO enrichment analysis of DEGs by biological process, cellular component, and molecular function. \u003cstrong\u003eD\u003c/strong\u003e KEGG pathway enrichment analysis. \u003cstrong\u003eE\u003c/strong\u003e Reactome pathway enrichment analysis. \u003cstrong\u003eF\u003c/strong\u003eDisease Ontology (DO) association analysis. \u003cstrong\u003eG\u003c/strong\u003e Protein–protein interaction (PPI) network of DEGs. DEGs were defined by |log₂FoldChange| \u0026gt; 1 and \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/4dde870300a88f8ebaa92326.png"},{"id":94728029,"identity":"43485435-febe-4066-a259-59982f25b10d","added_by":"auto","created_at":"2025-10-30 07:02:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":253029,"visible":true,"origin":"","legend":"\u003cp\u003eKlotho genotypes differentially regulate the OSM/JAK1/STAT3 pathway in BV−2 cells. A mRNA expression levels of OSM, JAK1, and STAT3 measured by qRT−PCR. B Protein levels of OSM, JAK1, STAT3, and phosphorylated STAT3 (p−STAT3) detected by Western blot. Data are presented as mean ± SD (n=3). Statistical significance: ** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01; *** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/de3235b4a987c758c4a792d7.png"},{"id":94728687,"identity":"8f9f3392-ac9e-41d7-bd06-859d124e8012","added_by":"auto","created_at":"2025-10-30 07:04:10","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":839906,"visible":true,"origin":"","legend":"\u003cp\u003eKlotho genotypes modulate OSM/JAK1/STAT3 signaling and lactylation in primary microglia. A mRNA expression levels of OSM, JAK1, STAT3 and Klotho detected by qRT−PCR. B Protein levels of OSM, JAK1, STAT3, p−STAT3, L−Lactyl and H4k12la detected by Western blot. Data are presented as mean ± SD (n=3). Statistical significance: * \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; *** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; #\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; ## \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01; ### \u003cem\u003ep\u003c/em\u003e \u0026lt;0.001; \u0026amp; \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; \u0026amp;\u0026amp; \u003cem\u003ep\u003c/em\u003e \u0026lt;0.01; \u0026amp;\u0026amp;\u0026amp; \u003cem\u003ep\u003c/em\u003e \u0026lt;0.01; ^^ \u003cem\u003ep\u003c/em\u003e \u0026lt;0.01; ^^^ \u003cem\u003ep\u003c/em\u003e \u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/3f677dc3d17c977fe9a7b350.png"},{"id":94728765,"identity":"6ee18270-ecd3-4b8f-b600-faf5cb8f1a56","added_by":"auto","created_at":"2025-10-30 07:04:15","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2118690,"visible":true,"origin":"","legend":"\u003cp\u003eKlotho genotypes affect Aβ accumulation and cytokine expression in primary microglia. \u003cstrong\u003eA\u003c/strong\u003e Immunofluorescence detection of Klotho and Aβ in primary microglia. \u003cstrong\u003eB\u003c/strong\u003e Concentrations of TNF−α, IL−1β, iNOS, and IL−10 assessed by ELISA. Data are presented as mean ± SD (n=3). Statistical significance: ** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01; *** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; ###\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; \u0026amp;\u0026amp;\u0026amp; \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; ^^^ \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/c3fde7a59e2057b4201ac0ab.png"},{"id":94679276,"identity":"5711edaa-e40e-40e2-b926-7bd528cadd71","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":829376,"visible":true,"origin":"","legend":"\u003cp\u003eKlotho genotypes influence OSM/JAK1/STAT3 signaling and lactylation in BV−2 cells. \u003cstrong\u003eA\u003c/strong\u003e mRNA expression levels of OSM, JAK1, STAT3 and Klotho detected by qRT−PCR. \u003cstrong\u003eB\u003c/strong\u003e Protein levels of OSM, JAK1, STAT3, p−STAT3, L−Lactyl and H4k12la detected by Western blot. Data are presented as mean ± SD (n=3). Statistical significance: * \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; *** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; ###\u003cem\u003e p\u003c/em\u003e \u0026lt;0.001; \u0026amp; \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; \u0026amp;\u0026amp;\u003cem\u003e p\u003c/em\u003e \u0026lt;0.01; \u0026amp;\u0026amp;\u0026amp;\u003cem\u003e p\u003c/em\u003e \u0026lt;0.01; ^ \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; ^^\u003cem\u003e p\u003c/em\u003e \u0026lt;0.01; ^^^\u003cem\u003e p\u003c/em\u003e \u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/9442edfb464269281663640a.png"},{"id":94679261,"identity":"ddf0b99e-006c-4ffb-b385-425f0a9eedf6","added_by":"auto","created_at":"2025-10-29 14:25:24","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1673638,"visible":true,"origin":"","legend":"\u003cp\u003eKlotho genotypes affect Aβ accumulation and cytokine release in BV−2 microglial cells. \u003cstrong\u003eA\u003c/strong\u003e Immunofluorescence detection of Klotho and Aβ expression in BV−2 cells. \u003cstrong\u003eB\u003c/strong\u003e, Concentrations of TNF−α, IL−1β, iNOS, and IL−10 assessed by ELISA. Data are presented as mean ± SD (n=3). Statistical significance: * \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; *** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; ### \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; \u0026amp;\u0026amp;\u0026amp; \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; ^ \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; ^^ \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01; ^^^ \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig8.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/9e618ba4c03c3c03193caf9e.png"},{"id":94679272,"identity":"9d928273-1220-450d-887c-4fbdb39dfe24","added_by":"auto","created_at":"2025-10-29 14:25:25","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":2762304,"visible":true,"origin":"","legend":"\u003cp\u003eOSM knockdown improves cognitive performance and pathology in APP/PS1 mice. \u003cstrong\u003eA\u003c/strong\u003eSpatial learning and memory assessed by Morris water maze before lentiviral injection. \u003cstrong\u003eB\u003c/strong\u003e Spatial learning and memory evaluated after injection of Klotho and/or sh−OSM lentivirus. \u003cstrong\u003eC\u003c/strong\u003e, Hematoxylin and eosin (H\u0026amp;E) staining of hippocampal sections. D Immunohistochemical detection of Klotho and Aβ expression in mouse brain. Data are presented as mean ± SD (n=3). Statistical significance: * \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; *** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; ### \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; \u0026amp;\u0026amp;\u0026amp; \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; ^ \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; ^^^ \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig9.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/72f8cf9ce210d6ccfd303a17.png"},{"id":94728479,"identity":"4423aa0a-cca8-4df6-90ad-7740b054ef76","added_by":"auto","created_at":"2025-10-30 07:03:54","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":1059171,"visible":true,"origin":"","legend":"\u003cp\u003eMolecular effects of OSM knockdown in APP/PS1 mouse brain. \u003cstrong\u003eA\u003c/strong\u003e mRNA expression levels of Klotho, OSM, JAK1, and STAT3 measured by qRT−PCR. \u003cstrong\u003eB\u003c/strong\u003e Protein levels of OSM, AK1, STAT3, p−STAT3, L−Lactyl and H4k12la detected by Western blot. \u003cstrong\u003eC\u003c/strong\u003e Concentrations of TNF−α, IL−1β, iNOS, and IL−10 assessed by ELISA. \u003cstrong\u003eC\u003c/strong\u003e Expression levels of were detected by ELISA. Data are presented as mean ± SD (n=3). Statistical significance: * \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; ***\u003cem\u003e p\u003c/em\u003e \u0026lt;0.001; ###\u003cem\u003e p\u003c/em\u003e \u0026lt;0.001; \u0026amp;\u0026amp;\u003cem\u003e p\u003c/em\u003e \u0026lt;0.01; \u0026amp;\u0026amp;\u0026amp;\u003cem\u003e p\u003c/em\u003e\u0026lt;0.001; ^\u003cem\u003e p\u003c/em\u003e \u0026lt;0.05; ^^\u003cem\u003e p\u003c/em\u003e \u0026lt;0.01; ^^^\u003cem\u003e p\u003c/em\u003e \u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig10.png","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/f13382b24bc96d0f2ee45776.png"},{"id":104739615,"identity":"1344627d-d1de-44a2-b4c4-59ff6247b24d","added_by":"auto","created_at":"2026-03-16 16:10:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":12564481,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7770928/v1/ce44eb45-84d1-4821-9412-ff6ba92e5af5.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Impact of Klotho Genotype on Lactylation in Alzheimer’s Disease and Mechanistic Insights","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAD is the most prevalent neurodegenerative condition, characterized by deterioration of cognitive faculties and memory loss [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. With advancements in medical science and public health, incidence of diagnosed AD is escalating globally [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Pathological hallmarks of AD encompass substantial accumulation of amyloid-beta (Aβ) plaques and neurofibrillary tangles (NFTs) in brain, notably in hippocampus, alongside synaptic dysfunction and neuronal demise [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Investigations revealed elevated lactate levels in cerebrospinal fluid (CSF) of individuals with AD and mild cognitive impairment, suggesting that aberrant glucose metabolism might be implicated in etiology and progression of AD [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Recent findings have uncovered an increase in lactylation of histone 4 at lysine 12 (H4K12lac) within microglia in the context of AD pathology, along with metabolic disruptions that could potentially modulate lactate levels, leading to neuroinflammation in cerebral milieu of AD patients [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Although the precise function and mechanism of lactylation in AD remain to be fully elucidated, targeting the lactylation process is likely to emerge as a promising therapeutic avenue for AD treatment.\u003c/p\u003e\u003cp\u003eKL is situated on chromosome 13\u0026rsquo;s q12 band, encoding a transmembrane protein instrumental in a multitude of physiological processes, including regulation of calcium homeostasis, modulation of phosphate metabolism, and retardation of aging [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. One of the most captivating aspects of KL is its association with lifespan extension and age-related diseases. Growing evidence has demonstrated that experimental mice deficient in Klotho manifest signs of premature aging, while over-expression of Klotho is correlated with an extended lifespan and enhanced healthspan in various organisms [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Furthermore, studies have confirmed the presence of Klotho in CSF, as evidenced in AD mouse models [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Over-expression of Klotho has been shown to ameliorate clearance of Aβ in AD mice models harboring amyloid precursor protein/presenilin 1 (APP/PS1) mutations, and to enhance their cognitive functions [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eKlotho F352V variant, also known as KL-VS allele, represents a missense mutation that substitutes valine for phenylalanine at the 352nd amino acid position. This genetic alteration tends to affect functionality of Klotho [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Research indicated that Klotho F352V variant has a capability to up-regulate expression of FGF23 coreceptors and decrease levels of calcitriol, potentially leading to bone loss in renal transplant recipients [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. While the KL is presumed to be crucial in mitigating AD pathology by modulating protein lactylation, its precise impacts and inherent mechanisms remain to be fully elucidated.\u003c/p\u003e\u003cp\u003eIn this study, we investigated the functional roles of the KL and its variant, Klotho F352V, in neuroinflammation and lactylation processes in AD. Our results demonstrate that Klotho alleviates microglial lactylation in AD by suppressing the OSM/JAK1/STAT3 signaling pathway, thereby mitigating the pathological activation of microglia. These findings provide a potential therapeutic strategy for the treatment of AD.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eCell Isolation and Culture\u003c/h2\u003e\u003cp\u003eNewborn C57BL/6 mice were disinfected with 75% ethanol and decapitated to isolate the brains. The cerebral cortices were dissected under a microscope, washed with PBS, and digested with trypsin. Digestion was stopped by adding complete mixed glial cell culture medium, and the tissue was triturated into a single-cell suspension. The suspension was filtered through a 40 \u0026micro;m strainer and seeded into culture flasks. Microglia, identified by their semi-suspended growth, were isolated by shaking the flasks at 37\u0026deg;C. The suspended microglia were collected, filtered, and centrifuged to obtain primary microglia.\u003c/p\u003e\u003cp\u003eBV-2 cells (CL-0493A, Procell, Wuhan, China) and microglia, were cultivated in DMEM medium (L110KJ, BasalMedia, Shanghai, China), supplemented with 10% fetal bovine serum (AC03L055, iLab, Shanghai, China) and 1% penicillin-streptomycin (C0009, Beyotime, Shanghai, China), under conditions of 37℃ and 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eCellular sample procession\u003c/h3\u003e\n\u003cp\u003eWe subjected microglia and BV-2 cells to the following treatments and group assignments: (1) Control group: Cells were transduced with lentivirus carrying an empty vector; (2) Model group: After 24 hours of transduction with lentivirus carrying an empty vector, cells were treated with 0.55 \u0026micro;M Aβ oligomers (S26139, Shanghai Yuanye Company) and 0.6 \u0026micro;M IBO for 24 hours; (3) Klotho WT group: Cells were transduced with lentivirus expressing WT Klotho for 24 hours; (4) Model\u0026thinsp;+\u0026thinsp;Klotho WT group: Following 24 hours of transduction with lentivirus expressing WT Klotho, cells were treated with 0.55 \u0026micro;M Aβ oligomers and 0.6 \u0026micro;M IBO for 24 hours; (5) Klotho F352V group: Cells were transduced with lentivirus expressing Klotho F352V for 24 hours; (6) Model\u0026thinsp;+\u0026thinsp;Klotho F352V group: After 24 hours of transduction with lentivirus expressing Klotho F352V, cells were treated with 0.55 \u0026micro;M Aβ oligomers and 0.6 \u0026micro;M IBO for 24 hours.\u003c/p\u003e\n\u003ch3\u003eTranscriptome sequencing and omics analysis\u003c/h3\u003e\n\u003cp\u003eWe fetched samples from Model\u0026thinsp;+\u0026thinsp;Klotho WT and Model\u0026thinsp;+\u0026thinsp;Klotho F352V groups, conducting transcriptome sequencing along with bioinformatic analysis on them. Initially, we extracted total RNA from the samples with Trizol reagent, assessing the RNA quality via agarose gel electrophoresis. Subsequently, we utilized NEBNext\u0026reg; Ultra\u0026trade; RNA Library Prep Kit (Illumina\u0026reg;, E7490, NEB, Beijing, China) to construct RNA libraries. We performed a preliminary quantification of the libraries with Qubit 2.0 and diluted them to a concentration of 1.5 ng/\u0026micro;L. Thereafter, we employed Agilent 2100 to examine distribution of insert fragments within the libraries. Once the quality was verified, we precisely quantified libraries through qRT-PCR method. Afterwards, we filtered raw data, removed adapters, and discarded reads containing ambiguous bases and low-quality sequences to obtain clean data. Subsequently, we aligned clean reads to reference genome via HISAT2 software, generating bam format files, and carried out analyses of genomic region distribution, gene expression quantification, and differential gene analysis. We screened for differential genes according to a criteria of |log2FoldChange|\u0026gt;1 and p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. We then employed ClusterProfiler to analyze enrichment of GO, KEGG, and DO terms within the set of differential genes. Finally, with the help of STRINGdb software package, we extracted interaction relationships of the differential gene list from databases, constructing a PPI network diagram.\u003c/p\u003e\n\u003ch3\u003eRNA extraction and qPCR\u003c/h3\u003e\n\u003cp\u003eWe utilized Trizol reagent to extract total RNA from cells or tissues, and adhered to manufacturer\u0026rsquo;s protocol to reverse transcribe RNA into cDNA through Goldenstar\u0026trade; RT6 cDNA Synthesis Kit (Tsingke, TSK302M, Beijing, China). Subsequently, we conducted qPCR analysis in accordance with instructions for the 2\u0026times;T5 Fast qPCR Mix (SYBR Green I) (Tsingke, TSE002). We harnessed housekeeping gene GAPDH to normalize mRNA expressions of each gene and applied 2-ΔΔCt method to calculate the fold change in gene expression. Primer sequences, synthesized by Sangon Biotech (Shanghai, China), were detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences used for quantitative PCR targeting genes related to Klotho signaling and inflammation.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward (5'\u0026minus;3')\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRverse (5'\u0026minus;3')\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eKlotho\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACGGGGTTGTAGCCAAGAAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGGTAGAAGTGCAGAACCGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAβ\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCCAGAATCAGCTACGGAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAACCTGGTCGAGTGGTCAGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eOSM\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCACGGTCCACTACAACACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGAAGACCCTCCCCACTGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eJAK1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCTGTCACAACCTCTTCGCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCATCAAGGAGTGGGGTTGCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSTAT3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAAGCCGACCCAGGTAGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCATCAATGAATGGTGTCACACAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGAGAGTGTTTCCTCGTCCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTTGCCGTGAGTGGAGTCAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eWestern Blot\u003c/h3\u003e\n\u003cp\u003eWe utilized a radioimmunoprecipitation assay lysis buffer containing protease inhibitors to extract total proteins from cells or tissues. Subsequently, we separated the proteins from different groups by SDS-PAGE, then transferring them onto PVDF membranes. Thereafter, we blocked the membranes with 5% skim milk for 1 h. Post-blocking, we incubated those membranes with primary antibodies targeting Aβ (A17911, Abclonal, Wuhan, China), Klotho (bs-2925R, Bioss, Beijing, China), L-lactyl (PTM-1401, PTM, Hangzhou, China), H4K12la (PTM-1401RM, PTM), OSM (A8705, Abclonal), JAK1 (A18323, Abclonal), STAT3 (A16975, Abclonal), p-STAT3 (AP0070, Abclonal), or GAPDH (A19056, Abclonal) overnight at 4℃. Following day, we incubated membranes with horseradish peroxidase (HRP)-conjugated secondary antibodies (AS014, Abclonal) at room temperature for 1 h. Ultimately, we developed protein bands via ECL reagent (34580, Thermo, Waltham, USA), performing quantitative analysis of the bands with Image J software.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eELISA\u003c/h2\u003e\u003cp\u003eWe harnessed a mouse TNF-α ELISA kit (FANKEW, F2132-B, Shanghai, China), a mouse IL-1β ELISA kit (FANKEW, F2040-B), a mouse iNOS ELISA kit (FANKEW, F2454-B), and a mouse IL-10 ELISA kit (FANKEW, F2176-B) to individually measure the levels of tumor necrosis factor-α (TNF-α), IL-1β, iNOS, and IL-10. All experimental procedures were carried out in strict accordance with protocols provided by manufacturers.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eImmunohistochemistry\u003c/h3\u003e\n\u003cp\u003eWe performed antigen retrieval on deparaffinized tissue sections with an antigen retrieval solution (Servicebio, G1201, Wuhan, China). Subsequently, we added 5% goat serum (Beyotime, C0265) dropwise and sealed those sections with cover slips, followed by incubation at room temperature for 30 min. Thereafter, we incubated the sections with cover slips overnight at 4℃ in a solution containing 5% goat serum and primary antibodies against Klotho (Bioss, bs-2925R), Aβ (ABclonal, A24949), H4K12la (Immunoway, YK0013, Plano, USA), and L-lactyl (PTM, PTM-1401RM). After incubation, we washed those sections and further incubated them at room temperature with a rabbit secondary antibody (ZENBIO, 511203, Research Triangle, USA) for 1.5 h. Next, we conducted DAB staining (ZSGB, ZLI-9019, Beijing, China) on the tissue sections and cell cover slips in the dark for 1 min, terminating the staining with tap water. Subsequently, we counterstained sections and cell cover slips with hematoxylin (Servicebio, G1004) for 1 min, dehydrated them through a graded series of alcohol, and mounted them with neutral resin (SINOPHARM, 10004160, Beijing, China). Finally, we captured images of sections and cover slips with an Mshot MF53 inverted microscope (MSHOT, Guangzhou, China).\u003c/p\u003e\n\u003ch3\u003eEstablishment of animal model\u003c/h3\u003e\n\u003cp\u003eWe procured 24 amyloid precursor protein APP/PS1 mice and 6 wild-type (WT) mice, all at 6 weeks of age, from Ensville Biotech (Chongqing, China). These mice were housed in a standard animal facility under pathogen-free conditions, maintaining a 12-h light-dark cycle for one week.\u003c/p\u003e\u003cp\u003eAll surgical procedures were conducted under stringent sterile conditions. Mice were anesthetized by intraperitoneal injection of pentobarbital sodium (0.1\u0026ndash;0.2 mL/10 g). After anesthesia, the heads of the mice were shaved, and the scalp was incised to expose the skull. The skull surface was cleaned with dry cotton swabs to ensure complete exposure. The lateral ventricle of the mice was located according to the mouse brain atlas, positioned 0.034 cm posterior to the sagittal suture and 0.09 cm lateral. Following the manufacturer\u0026rsquo;s instructions, lentiviral particles were prepared and slowly injected into the lateral ventricle using a cannula needle. The needle was left in place for 10 minutes post-injection before removal. This procedure was repeated every 48 hours, for a total of 4 injections. After the final injection, the mice\u0026rsquo;s learning and memory capabilities were assessed. The scalp was closed with surgical sutures, and the wound was disinfected with alcohol-soaked cotton swabs after each injection. Mice were continuously monitored until they regained consciousness.\u003c/p\u003e\u003cp\u003eOn account of the varying plasmids injected, we categorized those mice into five groups: (1) Control group: WT mice transfected with an empty vector plasmid; (2) Model group: APP/PS1 double transgenic mice transfected with an empty vector plasmid; (3) WT Klotho group: APP/PS1 mice transfected with a WT Klotho plasmid; (4) Klotho F352V group: APP/PS1 mice transfected with a Klotho F352V plasmid; (5) sh-OSM group: APP/PS1 mice transfected with a plasmid encoding Klotho F352V and shRNA-OSM.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eWater maze test\u003c/h2\u003e\u003cp\u003eIn this segment of our study, we applied Morris water maze test to assess the spatial learning and memory capabilities of mice, making suitable modifications to the testing protocol. We established a dark, circular pool filled with opaque water, typically dyed black to obscure mice\u0026rsquo;s vision. Pool was demarcated into four quadrants, and various visual cues were arranged around the room to assist mice in spatial orientation. Distinctive objects varying in shape and color were affixed to the walls of each quadrant, serving as reference points. During the training phase, we submerged a concealed platform beneath the water\u0026rsquo;s surface in one of the quadrants. Each mouse was subjected to four trials per day for a period of 5 consecutive days. On the 5th day, we removed the platform and initiated the spatial exploration experiment. For this experiment, mice were positioned at the midpoint of the quadrant opposite the former platform, with their backs facing the pool wall. We documented the time the mice spent in the area where the platform had been and the number of times they crossed the platform\u0026rsquo;s location within a 60-s interval, and then conducted a thorough analysis of this data with Ethovision video tracking software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eExperimental data were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error, and Comparisons between two groups are conducted using a t-test, while comparisons among multiple groups are performed using One-way ANOVA, and GraphPad Prism 8 software (GraphPad Software, Inc., San Diego, CA, USA) was used for data analysis and visualization. Differences were considered statistically significant at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eImpacts of various Klotho genotypes on lactate production induced by Aβ and IBO in microglia and BV-2 cells\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn this study, Klotho lentiviral vectors encoding empty vector, wild-type Klotho, and the F352V variant were constructed and transfected into microglial cells. An AD microglial cell model was established using Aβ oligomers and ibotenic acid (IBO) to evaluate the differential effects of KL on lactylation and inflammatory responses in AD.\u003c/p\u003e\u003cp\u003eThe results of the study demonstrated that the expression of Aβ protein and inflammatory factors was significantly elevated in the model group, consistent with the pathological features of AD, indicating the successful establishment of the AD model. Concurrently, it was observed that the mRNA expression level of Klotho was decreased, while the level of L-lactyl protein was markedly increased, suggesting that Klotho and protein lactylation may be involved in the pathological process of AD (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-C). Compared with the Model group, the Klotho\u0026thinsp;+\u0026thinsp;Model group exhibited an increase in Klotho expression levels, along with a significant reduction in L-lactyl, Aβ protein, and inflammatory factor levels. These findings demonstrate that Klotho has the ability to suppress protein lactylation and inflammation, thereby ameliorating AD pathology. However, compared with the Model group, the Klotho F352V\u0026thinsp;+\u0026thinsp;Model group showed a significant upregulation in Klotho expression levels, while no significant differences were observed in the expression of Aβ protein or inflammatory factor levels. This indicates that the mutation of Klotho to Klotho F352V abolishes its ability to suppress protein lactylation and inflammation in AD.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn contrast to the AD model group, the Klotho F352V\u0026thinsp;+\u0026thinsp;Model group exhibited significantly upregulated Klotho mRNA and protein levels, along with increased H4K12la expression. However, Aβ protein levels were unaltered, and pro-inflammatory cytokine levels showed no significant changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-C). These findings indicate that the Klotho F352V fails to suppress AD-associated lactylation and inflammatory responses via regulation of protein expression.\u003c/p\u003e\u003cp\u003eThe BV-2 cell line, an in vitro model for microglial studies, mimics many microglial functions and is a valuable tool for studying neuroinflammation and neurodegenerative diseases. However, BV-2 cells differ from primary microglia. Thus, both primary and BV-2 cells were used in the experimental design to ensure reliable and physiologically relevant findings. Results from BV-2 cells treated identically to primary microglia confirmed that Klotho suppresses AD-associated lactylation and inflammation by modulating specific protein expression, while the Klotho F352V variant lacks this ability (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-C).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eImpacts of Klotho WT and Klotho F352V on differential gene expression and enrichment analysis induced by Aβ and IBO in BV-2 cells\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn our investigation, we made volcano plots to visualize differentially expressed genes, providing a clear depiction of impacts of Klotho WT\u0026thinsp;+\u0026thinsp;Model group and Klotho F352V\u0026thinsp;+\u0026thinsp;Model group on expression and enrichment analyses of genes in BV-2 cells induced by Aβ and IBO (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Furthermore, we conducted hierarchical clustering analysis of expression profiles of differential genes to further verify the presence of distinct gene expression distribution patterns between two groups of samples. Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB distinctly illustrated conspicuous differences in expression patterns of differential genes across these two groups. We performed GO, KEGG, Reactome enrichment analyses, and DO disease association analysis on these differential genes. All our results indicated that these genes are most closely associated with systematic development at BP level, most significantly linked to endomembrane system and cellular protrusions at CC level, and most intimately related to cation binding and metal ion binding at MF level (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). These differential genes showed the most notable association with cancer-related pathways, neuroactive ligand-receptor interaction pathways, and calcium signaling pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Their association with neurological diseases, particularly AD and related syndromes, was the most evident (Fig s 3E, F). Additionally, proteins encoded by these differential genes represented interactions within biological systems (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eOur transcriptomic analysis revealed that the OSM gene exhibited significant differential expression between Klotho and Klotho F352V-treated cells. OSM is known to be associated with the JAK1/STAT3 signaling pathway, which is linked to glycolysis and has been implicated in the pathogenesis of AD. These findings underscore the importance of Klotho as a potential therapeutic target for AD, suggesting that Klotho may modulate AD progression through the OSM/JAK1/STAT3 signaling pathway. Using qPCR and Western blot (WB) analyses, we evaluated the expression changes of related genes and proteins, elucidating the effects of different Klotho genotypes on the OSM/JAK1/STAT3 signaling pathway. Our results demonstrated that the expression levels of OSM, JAK1, and STAT3 were significantly higher in the Klotho F352V group compared to the Klotho group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B). However, previous studies have shown that Klotho F352V does not promote AD progression. Combined with the current findings, these results suggest that Klotho may exert its therapeutic effects by suppressing the OSM/JAK1/STAT3 signaling pathway, thereby inhibiting microglial lactylation and contributing to the amelioration of AD pathology.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eInfluence of Klotho genotypes on OSM/JAK1/STAT3 pathway in BV-2 cells induced by Aβ and IBO\u003c/h2\u003e\u003cp\u003eTo further elucidate the underlying mechanisms, RNA interference (RNAi) technology was employed to investigate whether Klotho suppresses microglial lactylation and inflammation through the OSM/JAK1/STAT3 signaling pathway.\u003c/p\u003e\u003cp\u003eThe experimental results demonstrated that the OSM/JAK1/STAT3 signaling pathway was significantly activated in the Model group, accompanied by a marked upregulation of Aβ, L-lactyl, and inflammatory factor levels, as well as a decrease in Klotho protein expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B; Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, B). These findings indicate that activation of the OSM/JAK1/STAT3 signaling pathway promotes lactylation in microglia, contributing to the pathological progression of AD.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eCompared to the Model group, the Klotho\u0026thinsp;+\u0026thinsp;Model group exhibited significant inhibition of the OSM/JAK1/STAT3 signaling pathway, along with reduced levels of Aβ, L-lactyl protein, and inflammatory factors (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B; Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, B). These results further demonstrate that the KL reduces microglial lactylation by suppressing the OSM/JAK1/STAT3 signaling pathway. In contrast, the Klotho F352V\u0026thinsp;+\u0026thinsp;Model group showed no significant changes in the OSM/JAK1/STAT3 signaling pathway, L-lactyl protein levels, or Aβ and inflammatory factor levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B; Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, B), indicating that the Klotho F352V mutation loses its ability to inhibit the OSM/JAK1/STAT3 signaling pathway. Furthermore, compared to the Klotho F352V\u0026thinsp;+\u0026thinsp;Model group, the Klotho F352V\u0026thinsp;+\u0026thinsp;sh-OSM\u0026thinsp;+\u0026thinsp;Model group displayed decreased levels of Aβ, L-lactyl protein, and inflammatory factors, providing additional evidence that the OSM/JAK1/STAT3 signaling pathway promotes AD pathology by enhancing microglial lactylation.\u003c/p\u003e\u003cp\u003eConsistent with these findings, BV-2 cell data also corroborate the conclusions (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, B; Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA, B).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eKlotho genotypes\u0026rsquo; impacts on in vivo OSM/JAK1/STAT3 pathway\u003c/h2\u003e\u003cp\u003eUsing the APP/PS1 mouse model, we delivered different Klotho genotypes and OSM-specific shRNA vectors to demonstrate that Klotho suppresses microglial lactylation via inhibition of the OSM/JAK1/STAT3 signaling pathway.\u003c/p\u003e\u003cp\u003eCompared to wild-type mice, APP/PS1 mice prior to lentiviral vector injection exhibited significantly fewer platform crossings and reduced time spent in the target quadrant (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA). Following lentiviral vector injection, the Klotho\u0026thinsp;+\u0026thinsp;Model group demonstrated significantly increased platform crossings and prolonged time in the target quadrant compared to the Model group (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB). In contrast, the Klotho F352V\u0026thinsp;+\u0026thinsp;Model group showed no significant differences in platform crossings or time spent in the target quadrant relative to the Model group. However, the Klotho F352V\u0026thinsp;+\u0026thinsp;sh-OSM\u0026thinsp;+\u0026thinsp;Model group exhibited significantly increased platform crossings and longer time spent in the target quadrant.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eH\u0026amp;E staining results revealed that, compared to the NC group, the Model group exhibited significant pathological alterations in hippocampal neurons, including degeneration, somatic atrophy, and nuclear hyperchromasia. However, these pathological phenotypes were markedly alleviated in the Klotho\u0026thinsp;+\u0026thinsp;Model group. In contrast, the Klotho F352V\u0026thinsp;+\u0026thinsp;Model group showed no significant differences in neuronal pathology compared to the Model group. Notably, in the Klotho F352V\u0026thinsp;+\u0026thinsp;sh-OSM\u0026thinsp;+\u0026thinsp;Model group, the pathological phenotypes of neuronal cells were significantly improved again (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC). Immunohistochemical results similarly demonstrated that in Model group, Klotho protein levels were decreased, while Aβ levels were increased. Klotho overexpression reduced Aβ levels, whereas the Klotho F352V variant had no effect on Aβ accumulation. Notably, in the Klotho F352V\u0026thinsp;+\u0026thinsp;sh-OSM\u0026thinsp;+\u0026thinsp;Model group, Klotho levels remained unchanged, but Aβ levels were significantly reduced following OSM interference (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD). The results demonstrate that Klotho significantly ameliorates AD symptoms in APP/PS1 mice, including improvements in spatial memory and learning ability, alleviation of hippocampal neuronal pathological damage, and reduction of Aβ deposition. These therapeutic effects are consistent with those achieved by inhibition of the OSM/JAK1/STAT3 signaling pathway. However, the Klotho F352V mutant loses this protective effect, while suppression of OSM expression through sh-OSM interference significantly improves AD pathological phenotypes once again. These findings indicate that Klotho exerts its therapeutic effects in AD by inhibiting the OSM/JAK1/STAT3 signaling pathway, further underscoring the importance of Klotho as a potential therapeutic target for AD.\u003c/p\u003e\u003cp\u003eqRT-PCR, Western blot, and ELISA results showed significant activation of the OSM signaling pathway in the Model group, along with elevated levels of L-lactyl, and pro-inflammatory cytokines. Transduction with Klotho inhibited the OSM pathway and reduced L-lactyl, and pro-inflammatory cytokine levels. In contrast, Klotho F352V transduction had no significant effects. However, in the Klotho F352V\u0026thinsp;+\u0026thinsp;sh-OSM\u0026thinsp;+\u0026thinsp;Model group, OSM interference led to a significant reduction in L-lactyl, and pro-inflammatory cytokine levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA-C).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTaken together, these results demonstrate that Klotho alleviates AD-associated lactylation and inflammatory responses through suppression of the OSM/JAK1/STAT3 signaling pathway.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAD is the most prevalent neurodegenerative condition globally, which is considered a leading cause of dementia [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The increase in global life expectancy is a contributing factor to the rising incidence of AD [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. From a neurological perspective, AD is characterized by neuroinflammation, the formation of Aβ plaques, and the accumulation of intracellular NFTs, which are closely associated with the progressive decline in cognitive function and the onset of neurodegeneration in patients [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Recent research has suggested that lactate produced by microglia might be a crucial factor in pathology of AD [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Consequently, elucidating regulatory mechanisms of microglial lactoylation could potentially offer a novel therapeutic approach for AD treatment.\u003c/p\u003e\u003cp\u003eMicroglia, the resident immune cells of the central nervous system (CNS), is known as an indispensable factor in pathological conditions[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Upon our establishment of AD microglial and animal models, we conducted a comprehensive investigation to the functions of protein lactylation in AD. According to our findings, a notable escalation in the concentrations of Aβ and L-lactate (l-lactyl) across both AD cellular and animal models, thereby underscoring the heightened protein lactylation associated with AD pathology. Moreover, studies have shown that lactate derived from aerobic glycolysis strongly promotes the release of pro-inflammatory cytokines, such as TNF-α, IL-6, and IL-1β, from microglia [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Furthermore, our experimental results indicated an increase in secretion of various inflammatory factors in AD models. These findings suggest that protein lactylation and neuroinflammation are key features of AD. Therefore, targeting protein lactylation and neuroinflammation inhibition may represent a promising therapeutic strategy for AD.\u003c/p\u003e\u003cp\u003eKlotho is a protein encoded by the KL, predominantly expressed in the kidneys and the choroid plexus of the brain [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Klotho is implicated in various age-related pathological processes [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], including cardiovascular diseases, chronic kidney disease, cancer, and neurodegenerative disorders [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Klotho expression is significantly reduced in the aging brain and in the brains of patients with early AD [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Furthermore, research in elderly amyloid mouse models has demonstrated that overexpression of Klotho protein in the brain can ameliorate AD-like pathology and cognitive deficits, and reverse neuronal damage. Additionally, Klotho can mitigate Aβ accumulation in mouse models by regulating Aβ-related transport proteins and the transformation of microglia [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Therefore, we believe that Klotho protein holds promise as a therapeutic target for AD. However, the role of Klotho in regulating protein lactylation in the context of AD pathology remains unclear. To investigate this further, we explored the impact of Klotho genotype on lactylation in AD and examined potential mechanisms, aiming to identify novel therapeutic targets. Our results demonstrated that, relative to the Model group, the Klotho\u0026thinsp;+\u0026thinsp;Model group exhibited significantly reduced levels of Klotho, Aβ, L-lactyl and pro-inflammatory cytokines, along with increased levels of anti-inflammatory factors. In contrast, the Klotho F352V\u0026thinsp;+\u0026thinsp;Model group showed markedly elevated Klotho levels but no significant changes in Aβ, L-lactyl, or pro-inflammatory cytokine levels. These findings suggest that Klotho may alleviate AD progression by inhibiting protein lactylation and neuroinflammation.\u003c/p\u003e\u003cp\u003eThese findings may be attributed to long-term microglia activation. Microglia activation plays a dual role in AD pathogenesis. On one hand, Aβ binding to pattern recognition receptors (PRRs) triggers acute activation of resting microglia, leading to cytokine expression and promoting Aβ phagocytosis, uptake, and clearance [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], thereby preventing Aβ deposition and amyloid plaque formation. Microglia that phagocytose Aβ and aggregate around plaques are characterized by an M2 activation phenotype [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. On the other hand, long-term microglia activation can result in proliferation and a chronic inflammatory state, contributing to neurotoxicity and neurodegeneration [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. This is because chronic exposure to Aβ induces microglia to release pro-inflammatory cytokines and neurotoxic substances, including TNF-α, IL-1, IL-6, IFN-γ, and reactive oxygen species [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Specifically, TNF-α is one of the most important pro-inflammatory cytokines in AD [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. \u003cem\u003eIn vitro\u003c/em\u003e studies have shown that Aβ directly stimulates TNF-α production in microglia through activation of the transcription factor NF-κB [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. TNF-α increases the expression of β- and γ-secretases, which generate Aβ from APP \u003cem\u003ein vitro\u003c/em\u003e [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Therefore, pro-inflammatory cytokines, such as IFN-γ, IL-1β, and TNF-α, can reduce microglial phagocytic activity and promote a pro-inflammatory M1 phenotype [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], leading to elevated levels of Aβ and inflammatory factors.\u003c/p\u003e\u003cp\u003eTo further elucidate the mechanism by which Klotho F352V regulates AD protein lactylation, we conducted transcriptome analysis and identified OSM as a key mediator linking Klotho genotype to AD. Notably, Haitao Y et al.[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] found a significant correlation between OSM gene expression and the hallmark pathological markers of AD, Aβ and Tau. Studies have also reported elevated plasma OSM protein levels in both AD and Aβ-negative MCI patients [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Therefore, the Klotho may regulate OSM expression, potentially impacting the lactylation of AD proteins.\u003c/p\u003e\u003cp\u003eOur findings that Klotho regulates protein lactylation via the OSM/JAK1/STAT3 pathway are further supported by studies in cancer metabolism. Previous research has identified OSM as an upstream signaling molecule in the JAK/STAT pathway [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], which has been shown to regulate glycolysis in lung cancer, renal cell carcinoma, and breast cancer cells [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The JAK/STAT pathway promotes Myc gene expression, which in turn enhances the expression of lactate dehydrogenase (LDH) and increases lactate production through HIF-1α-mediated transcription [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Lactate further activates the JAK/STAT pathway by promoting STAT3 phosphorylation and enhancing JAK1 protein translation, thereby promoting proliferation and metastasis in breast and colon cancer cells [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. These findings highlight the conserved nature of this inflammatory metabolic circuit, supporting our hypothesis that Klotho modulates microglial lactylation in AD via the same OSM/JAK1/STAT3 axis.\u003c/p\u003e\u003cp\u003eRecognizing the established links between microglial lactylation, Klotho, and the OSM/JAK/STAT signaling pathway in AD, we aim to elucidate how Klotho genotype proteins regulate lactylation via the OSM/JAK/STAT pathway, ultimately identifying novel therapeutic targets for AD treatment. Thus, we conducted both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e experiments to explore the functional link between Klotho and the OSM/JAK1/STAT3 signaling pathway. These results revealed a significant increase in the expression of OSM, JAK1, and STAT3 in the Klotho group, but not in the Klotho F352V group.\u003c/p\u003e\u003cp\u003eRNAi-mediated OSM downregulation significantly reduced OSM expression without altering Klotho levels, while also decreasing Aβ, L-lactyl, and pro-inflammatory cytokine levels. Klotho suppresses microglial protein lactylation and neuroinflammation through inhibition of the OSM/JAK1/STAT3 pathway, ultimately offering potential for AD prevention and treatment. Our study thus highlights the changes in lactylation during AD progression and elucidates the role of Klotho in regulating lactylation and its underlying mechanisms. These findings identify novel therapeutic targets for AD.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eKlotho suppresses microglial protein lactylation and neuroinflammation through inhibition of the OSM/JAK1/STAT3 pathway, ultimately offering potential for AD prevention and treatment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval and Consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were conducted in accordance with the guidelines of the Ethics Committee of Chengdu Medical College (Approval No. 2023-047). All procedures were performed in compliance with the relevant ethical standards for the care and use of laboratory animals.\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eAll participants provided written consent for the publication of their data and any accompanying images.\u003c/p\u003e\n\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eThe results of RNA-seq are available in the National Genomics Data Center (GSA: CRA021092), which are publicly accessible at https://ngdc.cncb.ac.cn/gsa. The datasets generated during the current study will be available form the corresponding author upon a reasonable request.\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis study was supported by Sichuan Applied Psychology Research Center (CSXL-22210) and the Sichuan Provincial Department of Science and Technology (2020YJ0175).\u003c/p\u003e\n\u003cp\u003eAuthors\u0026apos; contributions\u003c/p\u003e\n\u003cp\u003eYingying Cai: Conceived and designed the study, supervised the experiments, wrote the manuscript; Ling Li: Performed the in vitro experiments, analyzed the data, and contributed to manuscript writing; Zhuorong Li: Performed the in vivo experiments, contributed to data analysis, and revised the manuscript. All authors contributed to and approved the final manuscript. All authors contributed to editorial changes in the manuscript. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work.\u003c/p\u003e\n\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eWe express our sincere gratitude to all staff members for their hard work and dedication in implementing the intervention and evaluation components of this study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMonteiro AR, Barbosa DJ, Remi\u0026atilde;o F, Silva R (2023). Alzheimer\u0026rsquo;s disease: Insights and new prospects in disease pathophysiology, biomarkers and disease-modifying drugs. Biochem Pharmacol, 211:115522.\u003c/li\u003e\n\u003cli\u003eJucker M, Walker LC (2023). Alzheimer\u0026rsquo;s disease: From immunotherapy to immunoprevention. Cell, 186:4260\u0026ndash;4270.\u003c/li\u003e\n\u003cli\u003eJucker M, Walker LC (2018). Propagation and spread of pathogenic protein assemblies in neurodegenerative diseases. Nat Neurosci, 21:1341\u0026ndash;1349.\u003c/li\u003e\n\u003cli\u003eLong JM, Holtzman DM (2019). Alzheimer Disease: An Update on Pathobiology and Treatment Strategies. Cell, 179:312\u0026ndash;339.\u003c/li\u003e\n\u003cli\u003eLiguori C, Chiaravalloti A, Sancesario G, Stefani A, Sancesario GM, Mercuri NB, et al. (2016). Cerebrospinal fluid lactate levels and brain [18F]FDG PET hypometabolism within the default mode network in Alzheimer\u0026rsquo;s disease. Eur J Nucl Med Mol Imaging, 43:2040\u0026ndash;2049.\u003c/li\u003e\n\u003cli\u003eXiang X, Wind K, Wiedemann T, Blume T, Shi Y, Briel N, et al. (2021). Microglial activation states drive glucose uptake and FDG-PET alterations in neurodegenerative diseases. Sci Transl Med, 13(615):eabe5640.\u003c/li\u003e\n\u003cli\u003ePan R-Y, He L, Zhang J, Liu X, Liao Y, Gao J, et al. (2022). Positive feedback regulation of microglial glucose metabolism by histone H4 lysine 12 lactylation in Alzheimer\u0026rsquo;s disease. Cell Metab, 34:634-648.e6.\u003c/li\u003e\n\u003cli\u003eKuro-o M (2019). The Klotho proteins in health and disease. Nat Rev Nephrol, 15:27\u0026ndash;44.\u003c/li\u003e\n\u003cli\u003eKuro-o M (2010). Klotho. Pflugers Arch, 459:333\u0026ndash;343.\u003c/li\u003e\n\u003cli\u003ePrud\u0026rsquo;homme GJ, Kurt M, Wang Q (2022). Pathobiology of the Klotho Antiaging Protein and Therapeutic Considerations. Front Aging, 3:931331.\u003c/li\u003e\n\u003cli\u003eCararo-Lopes MM, Mazucanti CHY, Scavone C, Kawamoto EM, Berwick DC (2017). The relevance of \u0026alpha;-KLOTHO to the central nervous system: Some key questions. Ageing Res Rev, 36:137\u0026ndash;148.\u003c/li\u003e\n\u003cli\u003eZhao Y, Zeng C, Li X, Yang T, Kuang X, Du J (2020). Klotho overexpression improves amyloid‐\u0026beta; clearance and cognition in the APP/PS1 mouse model of Alzheimer\u0026rsquo;s disease. Aging Cell, 19(10):e13239.\u003c/li\u003e\n\u003cli\u003eArking DE, Krebsova A, Macek M, Macek M, Arking A, Mian IS, et al. (2002). Association of human aging with a functional variant of klotho. Proc Natl Acad Sci USA 99(2):856\u0026ndash;861.\u003c/li\u003e\n\u003cli\u003eOzdem S, Yılmaz VT, Ozdem SS, Donmez L, Cetinkaya R, Suleymanlar G, et al. (2015). Is Klotho F352V Polymorphism the Missing Piece of the Bone Loss Puzzle in Renal Transplant Recipients? Pharmacology, 95:271\u0026ndash;278.\u003c/li\u003e\n\u003cli\u003eIyaswamy A, Krishnamoorthi SK, Song J-X, Yang C-B, Kaliyamoorthy V, Zhang H, et al. (2020). NeuroDefend, a novel Chinese medicine, attenuates amyloid-\u0026beta; and tau pathology in experimental Alzheimer\u0026rsquo;s disease models. J Food Drug Anal, 28:132\u0026ndash;146.\u003c/li\u003e\n\u003cli\u003eIsing C, Venegas C, Zhang S, Scheiblich H, Schmidt S V., Vieira-Saecker A, et al. (2019). NLRP3 inflammasome activation drives tau pathology. Nature, 575:669\u0026ndash;673.\u003c/li\u003e\n\u003cli\u003eYang X, Chen Y-H, Liu L, Gu Z, You Y, Hao J-R, et al. (2024). Regulation of glycolysis-derived L-lactate production in astrocytes rescues the memory deficits and A\u0026beta; burden in early Alzheimer\u0026rsquo;s disease models. Pharmacol Res, 208:107357.\u003c/li\u003e\n\u003cli\u003eSierra A, Paolicelli RC, Kettenmann H (2019). Cien A\u0026ntilde;os de Microgl\u0026iacute;a: Milestones in a Century of Microglial Research. Trends Neurosci, 42:778\u0026ndash;792.\u003c/li\u003e\n\u003cli\u003eAndersson AK, R\u0026ouml;nnb\u0026auml;ck L, Hansson E (2005). Lactate induces tumour necrosis factor‐\u0026alpha;, interleukin‐6 and interleukin‐1\u0026beta; release in microglial‐ and astroglial‐enriched primary cultures. J Neurochem, 93:1327\u0026ndash;1333.\u003c/li\u003e\n\u003cli\u003eDias GP, Murphy T, Stangl D, Ahmet S, Morisse B, Nix A, et al. (2021). Intermittent fasting enhances long-term memory consolidation, adult hippocampal neurogenesis, and expression of longevity gene Klotho. Mol Psychiatry, 26:6365\u0026ndash;6379.\u003c/li\u003e\n\u003cli\u003eMytych J, Sołek P, Będzińska A, Rusinek K, Warzybok A, Tabęcka-Łonczyńska A, et al. (2020). Towards Age-Related Anti-Inflammatory Therapy: Klotho Suppresses Activation of ER and Golgi Stress Response in Senescent Monocytes. Cells, 9:261.\u003c/li\u003e\n\u003cli\u003eChen K, Sun Z (2019). Autophagy plays a critical role in Klotho gene deficiency-induced arterial stiffening and hypertension. J Mol Med, 97:1615\u0026ndash;1625.\u003c/li\u003e\n\u003cli\u003eLi D, Jing D, Liu Z, Chen Y, Huang F, Behnisch T (2019). Enhanced Expression of Secreted \u0026alpha;-Klotho in the Hippocampus Alters Nesting Behavior and Memory Formation in Mice. Front Cell Neurosci, 13:133.\u003c/li\u003e\n\u003cli\u003eFung T, Iyaswamy A, Sreenivasmurthy S, Krishnamoorthi S, Guan X-J, Zhu Z, et al. (2022). Klotho an Autophagy Stimulator as a Potential Therapeutic Target for Alzheimer\u0026rsquo;s Disease: A Review. Biomedicines, 10:705.\u003c/li\u003e\n\u003cli\u003eSarlus H, Heneka MT (2017). Microglia in Alzheimer\u0026rsquo;s disease. J Clin Invest, 127:3240\u0026ndash;3249.\u003c/li\u003e\n\u003cli\u003eJimenez S, Baglietto-Vargas D, Caballero C, Moreno-Gonzalez I, Torres M, Sanchez-Varo R, et al. (2008). Inflammatory Response in the Hippocampus of PS1 \u003csub\u003eM146L\u003c/sub\u003e /APP \u003csub\u003e751SL\u003c/sub\u003e Mouse Model of Alzheimer\u0026rsquo;s Disease: Age-Dependent Switch in the Microglial Phenotype from Alternative to Classic. J Neurosci, 28:11650\u0026ndash;11661.\u003c/li\u003e\n\u003cli\u003eLi Q, Wu Y, Chen J, Xuan A, Wang X (2022). Microglia and immunotherapy in Alzheimer\u0026rsquo;s disease. Acta Neurol Scand, 145:273\u0026ndash;278.\u003c/li\u003e\n\u003cli\u003eYang S-H (2019). Cellular and Molecular Mediators of Neuroinflammation in Alzheimer Disease. Int Neurourol J, 23:S54-62.\u003c/li\u003e\n\u003cli\u003eCombs CK, Karlo JC, Kao S-C, Landreth GE (2001). \u0026beta;-Amyloid Stimulation of Microglia and Monocytes Results in TNF\u0026alpha;-Dependent Expression of Inducible Nitric Oxide Synthase and Neuronal Apoptosis. J Neurosci, 21:1179\u0026ndash;1188.\u003c/li\u003e\n\u003cli\u003eBlasko I, Veerhuis R, Stampfer-Kountchev M, Saurwein-Teissl M, Eikelenboom P, Grubeck-Loebenstein B (2000). Costimulatory Effects of Interferon-\u0026gamma; and Interleukin-1\u0026beta; or Tumor Necrosis Factor \u0026alpha; on the Synthesis of A\u0026beta;1-40 and A\u0026beta;1-42 by Human Astrocytes. Neurobiol Dis, 7:682\u0026ndash;689.\u003c/li\u003e\n\u003cli\u003eLiao Y-F, Wang B-J, Cheng H-T, Kuo L-H, Wolfe MS (2004). Tumor Necrosis Factor-\u0026alpha;, Interleukin-1\u0026beta;, and Interferon-\u0026gamma; Stimulate \u0026gamma;-Secretase-mediated Cleavage of Amyloid Precursor Protein through a JNK-dependent MAPK Pathway. J Biol Chem, 279:49523\u0026ndash;49532.\u003c/li\u003e\n\u003cli\u003eKoenigsknecht-Talboo J, Landreth GE (2005). Microglial Phagocytosis Induced by Fibrillar \u0026beta;-Amyloid and IgGs Are Differentially Regulated by Proinflammatory Cytokines. J Neurosci, 25:8240\u0026ndash;8249.\u003c/li\u003e\n\u003cli\u003eYu H, Wang F, Wu J, Gong J, Bi S, Mao Y, et al. (2023). Integrated transcriptomics reveals the brain and blood biomarkers in Alzheimer\u0026rsquo;s disease. CNS Neurosci Ther, 29:3943\u0026ndash;3951.\u003c/li\u003e\n\u003cli\u003eWhelan CD, Mattsson N, Nagle MW, Vijayaraghavan S, Hyde C, Janelidze S, et al. (2019). Multiplex proteomics identifies novel CSF and plasma biomarkers of early Alzheimer\u0026rsquo;s disease. Acta Neuropathol Commun, 7:169.\u003c/li\u003e\n\u003cli\u003eMoidunny S, Matos M, Wesseling E, Banerjee S, Volsky DJ, Cunha RA, et al. (2016). Oncostatin M promotes excitotoxicity by inhibiting glutamate uptake in astrocytes: implications in HIV-associated neurotoxicity. J Neuroinflammation, 13:144.\u003c/li\u003e\n\u003cli\u003eLi W, Wang Y, Li X, Wu H, Jia L (2024). Dexmedetomidine hydrochloride plus sufentanil citrate inhibits glucose metabolism and epithelial‑mesenchymal transition in human esophageal squamous carcinoma KYSE30 cells by modulating the JAK/STAT3/HIF‑1\u0026alpha; axis. Oncol Lett, 27:273.\u003c/li\u003e\n\u003cli\u003eFlores A, Schell J, Krall AS, Jelinek D, Miranda M, Grigorian M, et al. (2017). Lactate dehydrogenase activity drives hair follicle stem cell activation. Nat Cell Biol, 19:1017\u0026ndash;1026.\u003c/li\u003e\n\u003cli\u003eXiong J, He J, Zhu J, Pan J, Liao W, Ye H, et al. (2022). Lactylation-driven METTL3-mediated RNA m6A modification promotes immunosuppression of tumor-infiltrating myeloid cells. Mol Cell, 82:1660-1677.e10. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"immunity-and-ageing","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"iage","sideBox":"Learn more about [Immunity \u0026 Ageing](http://immunityageing.biomedcentral.com/)","snPcode":"12979","submissionUrl":"https://submission.nature.com/new-submission/12979/3","title":"Immunity \u0026 Ageing","twitterHandle":"@ImmunAllergyBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"AD, Klotho, Microglia, BV-2 cells, Protein lactylation","lastPublishedDoi":"10.21203/rs.3.rs-7770928/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7770928/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eProtein lactylation has emerged as a crucial regulator in the pathogenesis of Alzheimer\u0026rsquo;s disease (AD). Although the Klotho gene (KL) has been clinically linked to AD, its role in lactylation remains unclear. Here, we investigated the influence of Klotho genotype on lactylation and related inflammatory responses. Wild-type KL and the KL F352V variant were transfected into microglia and BV-2 cells of an AD model to assess effects on protein lactylation and cytokine release, followed by transcriptome sequencing to identify downstream mediators. Functional validation using qPCR, ELISA, Western blotting, and immunohistochemistry confirmed that KL expression markedly reduced lactylated protein levels and pro-inflammatory factors, while ameliorating pathological features in AD model mice. Transcriptomic analysis highlighted oncostatin M (OSM) as a key gene suppressed by KL, and OSM knockdown decreased both protein lactylation and inflammation, improving AD pathology in vivo. These findings demonstrate that KL protects against AD progression by inhibiting OSM-mediated signaling, thereby attenuating lactylation and neuroinflammation, and provide novel mechanistic insight into the genetic regulation of lactylation in neurodegeneration.\u003c/p\u003e","manuscriptTitle":"Impact of Klotho Genotype on Lactylation in Alzheimer’s Disease and Mechanistic Insights","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-29 14:25:19","doi":"10.21203/rs.3.rs-7770928/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-30T15:40:32+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"217723497714146005768066685547435849222","date":"2025-12-23T10:44:48+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-18T09:41:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"291103088397119186346918165491981437186","date":"2025-11-07T02:24:48+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-30T02:29:10+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"60672274494739491011574071009221058597","date":"2025-10-16T13:53:02+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-15T07:51:45+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-14T09:42:04+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-14T09:39:48+00:00","index":"","fulltext":""},{"type":"submitted","content":"Immunity \u0026 Ageing","date":"2025-10-03T06:47:39+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"immunity-and-ageing","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"iage","sideBox":"Learn more about [Immunity \u0026 Ageing](http://immunityageing.biomedcentral.com/)","snPcode":"12979","submissionUrl":"https://submission.nature.com/new-submission/12979/3","title":"Immunity \u0026 Ageing","twitterHandle":"@ImmunAllergyBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d9afbe47-bd2b-436c-8ac2-8b10dd129470","owner":[],"postedDate":"October 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-16T16:05:11+00:00","versionOfRecord":{"articleIdentity":"rs-7770928","link":"https://doi.org/10.1186/s12979-026-00563-x","journal":{"identity":"immunity-and-ageing","isVorOnly":false,"title":"Immunity \u0026 Ageing"},"publishedOn":"2026-03-09 15:58:16","publishedOnDateReadable":"March 9th, 2026"},"versionCreatedAt":"2025-10-29 14:25:19","video":"","vorDoi":"10.1186/s12979-026-00563-x","vorDoiUrl":"https://doi.org/10.1186/s12979-026-00563-x","workflowStages":[]},"version":"v1","identity":"rs-7770928","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7770928","identity":"rs-7770928","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.