Engineering N-acyl-homoserine lactone-based quorum-sensing circuit for dynamic regulatory control in Saccharomyces cerevisiae

Engineering N-acyl-homoserine lactone-based quorum-sensing circuit for dynamic regulatory control in Saccharomyces cerevisiae | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Engineering N-acyl-homoserine lactone-based quorum-sensing circuit for dynamic regulatory control in Saccharomyces cerevisiae Aafke van Aalst, Maxence Holtz, Mikkel Lyskjær Jensen, Tabea Schröder, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6620198/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 27 Nov, 2025 Read the published version in Communications Biology → Version 1 posted You are reading this latest preprint version Abstract The yeast Saccharomyces cerevisiae is widely employed in industrial biotechnology for chemical and pharmaceutical production. However, engineering yeast for high product titers remains challenging due to metabolic imbalances and competition for cellular resources. To address this, we developed an orthogonal quorum sensing (QS) system based on N -acyl-homoserine lactones (AHLs) for cell density-dependent regulation in yeast. Using metabolic engineering, we established AHL production in yeast. Next, we improved AHL-biosensors via directed evolution and a novel growth-based screening strategy with amdS as a counter-selectable marker. We identified LuxR variants with enhanced sensitivity, which were engineered for QS-controlled expression of a reporter gene. Additionally, we engineered LuxR to function as a repressor, achieving QS-dependent repression. The QS system was applied to enhance aloesone production, a plant-derived metabolite with cosmetic and pharmaceutical applications. The established system showed 51% increased production through QS-controlled repression of FAS1 . This work establishes a versatile QS-based regulatory platform to support dynamic pathway regulation for metabolic engineering in yeast. Biological sciences/Biotechnology/Metabolic engineering Biological sciences/Systems biology/Genetic circuit engineering Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Main Nowadays, microorganisms such as the yeast Saccharomyces cerevisiae can be readily adapted to synthesize products of interest 1 . Engineering yeast for product formation typically involves the introduction of non-native biosynthetic pathways alongside rewiring or deletion of endogenous metabolic pathways 1 , 2 . However, optimizing these engineered strains for high product titers remains a significant challenge due to metabolic imbalances and increased energy expenditure associated with product biosynthesis. Specifically, anabolic product pathways compete with native metabolism for essential cellular resources, including carbon, energy, and cofactors. Consequently, engineered strains often exhibit suboptimal product titers and reduced growth rates, conferring an evolutionary disadvantage relative to non-engineered strains which can result in genetically unstable yeast strains that lose productivity over time 3 . Developing generic strategies for dynamic regulation of cellular resources to balance growth and product formation is therefore a critical challenge in microbial biotechnology 4 . Transcription factors are natural proteins that have evolved to regulate gene expression in response to key intracellular signals or environmental changes, and have been applied for engineered dynamic pathway regulation 4 , 5 . The first synthetic network constructed in yeast, based on the bacterial Tet Repressor, enabled timed induction of gene expression by addition of tetracycline or derivatives 6 . Since then, systems for inducible gene expression based on nutrient composition 7 temperature 8 or light 9 , 10 have been reported. Studies using these inducers showed that delayed expression of genes encoding enzymes of biosynthetic pathways could improve product titers 11 , 12 . However, inducers are often costly and/or require process-specific medium or cultivation conditions that, for economic, technological and/or safety reasons can be unsuitable for large-scale fermentations. These complications contribute to a growing interest in inducer-free systems such as two-stage processes linking expression of genes encoding enzymes of biosynthetic pathways to cell-population density 13 . In nature, microbial populations can regulate gene expression in response to cell density through quorum sensing (QS), a cell-cell communication mechanism mediated by small signaling molecules known as autoinducers (AIs) 14 , 15 . In Gram-negative bacteria, the most common AIs are N -acyl-homoserine lactones (AHLs), which consist of a homoserine lactone ring attached to an acyl chain of varying length and oxidation state 16 , 17 . AHLs are synthesized by LuxI-family synthases using S -adenosylmethionine and acyl carrier protein (ACP)-bound acyl groups as substrates 16 . In general, each AHL synthase predominantly synthesizes a single type of AHL and can produce additional AHLs in smaller amounts 18 . The acyl group preference is defined by the substrate specificity of the enzyme rather than by the supply of acyl substrates available in the cytoplasm. Once synthesized, AHLs diffuse into the extracellular environment, where they accumulate in a density-dependent manner. Upon reaching a critical concentration, AHLs can diffuse into the cells and bind to LuxR-type transcriptional regulators, which undergo a conformational change. The regulator dimerizes and binds to a regulator-specific operator sequence (eg. luxO ) within target promoters (Fig. 1 A), thereby modulating the expression of various genes involved in processes such as bioluminescence 19 , pathogenesis 20 and biofilm formation 21 , illustrating the powerful role of QS in coordinating population-wide behaviors. AHL-based QS systems have been extensively adapted for synthetic biology applications, primarily in bacterial systems 13 , 14 , 22 – 24 . However, their implementation in eukaryotic hosts such as S. cerevisiae remains underexplored. To date, only a limited number of QS-based circuits have been successfully engineered in yeast, including a plant hormone-responsive system 25 and a rewired pheromone signaling pathway 26 – 28 . However, since these systems consist of eukaryotic elements, their implementation is inherently linked to off-target effects such as growth arrest or morphological changes, challenging their utility in biotechnological applications. Prokaryotic QS systems offer a potentially orthogonal regulatory strategy that minimizes crosstalk with native eukaryotic signaling networks. Moreover, the biochemical diversity of AHL-based QS systems enables the construction of multiple, independently regulated circuits 14 , providing a versatile framework for dynamic control of metabolic pathways in yeast. In this study, we aimed to develop a fully orthogonal, AHL-based QS system for autonomous and tunable regulation of metabolic pathways in S. cerevisiae . To achieve this, we here present the rational and evolution-guided engineering of AHL sensing and a first demonstration of AHL production in yeast. Based on the engineered production and sensing systems, we demonstrate dynamic regulation of a reporter gene, as well as improved aloesone production using the engineered QS-based regulatory platform, thus demonstrating a novel broadly utilizable tool for yeast metabolic engineering. Results Establishing acylated homoserine lactone production and sensing in yeast In many proteobacteria, acyl-HSLs are produced by synthases from the LuxI protein family. From this family, we selected LuxI (from Vibrio fischeri , 24 ) LasI (from Pseudomonas aeruginosa , 29 ) and EsaI (from Pantoea stewartia , 29 ) as these are well-characterized and are already successfully used in synthetic QS-circuits in bacterial sytems 13,23,24,29 . LuxI and EsaI predominantly catalyze the formation of 3-oxo-C6-HSL, while 3-oxo-C12-HSL is the predominant product of LasI 24,29 . We expressed them in S. cerevisiae (native and codon-optimized version). When genomically integrating a single copy of each of these enzymes driven by the strong Sc.TDH3 promoter in yeast (strains AAA021; luxI , AAA022; lasI , AAA023; esaI , AAA079; luxI _co, AAA081; lasI _co, AAA083; esaI _co), we were not able to detect any acyl-HSL-compounds in the supernatant of the yeast cultures. This indicated that these enzymes were not expressed or directly functionally transferrable between bacteria and yeast. In addition to these 3 synthases, we decided to express a codon-optimized version of cepI ( Burkholderia cenocepacia ) as well, which, in contrast to the previously tested synthases, catalyzes the formation of the straight-chain acyl-HSL C8-HSL. When integrating the expression cassette of Bc.cepI in yeast (strain AAA063), production of C8-HSL was observed of 7 nM (Figure 1C, Figure S1). As the substrates of LuxI-type synthases are S -adenosyl-L-methionine (SAM) and an acyl-donor (Figure 1B), we tried to further increase the production by boosting the precursor supply of SAM, using methionine feeding as well as overexpression of S. cerevisiae’s SAM2 and MET6 30 . For the upregulation of SAM2 and MET6 , an expression cassette with weak constitutive promoters driven by p ACT1 and p PGI1 (indicated by +) as well as an expression cassette with strong constitutive promoters driven by p TEF1 and p PGK1 (indicated by ++) were introduced into yeast (strains AAA111; CepI (++) and AAA113, CepI (+)). Sole introduction of cepI did not affect the growth performance (Figure S2A). However, in line with literature 30 , introduction of an additional copy of SAM2 and MET6 resulted in a reduction in growth rate of approximately 11% and 20%, for the weak and high constitutive promoters respectively, and a 19% reduction in final optical density (OD 660 ) for high constitutive promoters, under microplate conditions (Figure S2B). Using strong constitutive promoters in addition to methionine feeding resulted in 3.4-fold increase (26 ± 2 nM) in C8-HSL production (Figure 1C). To minimize any additional fitness trade-offs, we chose not to pursue further improvements of C8-HSL production. In order to establish a heterologous QS-system based on acyl-HSL, we next focused on establishing an acyl-HSL biosensor. Recently, Tominaga et al. (2021) have successfully implemented LuxR as a transcriptional activator upon detection of 3-oxo-C6-HSL in S. cerevisiae 31 . However, this system has not been tested for C8-HSL. LuxR-type regulators are known to bind different acyl-HSLs with different specificities 17 , and therefore this system 31 was used as a starting point. As a prototypic design based on the work by Tominaga et al . (2021), we first expressed a variant LuxR with two mutations S116Y and W201R, described to be essential for functionality in yeast 31 , fused with a VP48 activation domain and a nuclear localisation signal (NLS). This reading frame was integrated into the genome, together with the GAL core-promoter (p GAL _core) equipped with 5 LuxR-specific operator sequences ( luxO ) driving the expression of yeGFP (yeast strains AAA019; p GAL _core-5x luxO -yeGFP, AAA036; p GAL _core-5x luxO -yeGFP + VP48-NLS- luxR ). From this design, we confirmed induction of yeGFP expression by 3-oxo-C6-HSL, and also observed this biosensor to respond to different chain lengths 3-oxo acyl-HSLs as well as to straight-chain acyl-HSLs of various lengths, including C8-HSL, with biosensor-dependent fold-changes in yeGFP expression reaching up to 155-fold (Figure 1D). However, the operational range of the biosensor (≥500 nM) (Figure 1E) did not correspond with our established C8-HSL production (5-30 nM) (Figure 1C) and would by design therefore not be useful to complete the quorum-sensing circuit. Acetamidase can be used for growth-based (counter-) selection of biosensors To make a QS system based on prokaryotic LuxR in yeast, the sensitivity of the transcriptional activator would need to be improved. In allosterically regulated proteins, directed evolution is often used for developing transcriptional regulation based on prokaryotic regulators including optimization of sensitivity 5,31,32 . While several studies have used fluorescence-assisted cell sorting (FACS) to select specific phenotypes out of a pool of mutants 5,32 , we decided to test whether the Aspergillus nidulans amdS gene (encoding an acetamidase (AmdS)) could be employed as a (counter-) selectable marker for growth-based screening. Briefly, AmdS converts acetamide to acetate and ammonia, thereby allowing the host for growth on acetamide as sole nitrogen (or carbon) source 33 . In contrast to auxotrophic markers, amdS is a dominant gain-of-function marker requiring higher abundance of the enzyme for fast growth rate, therefore allowing for a greater dynamic range to be covered by the marker. Additionally, the acetamide homologue fluoroacetamide can be used for counter-selection since its product is the toxic fluoroacetate. If functional, such a system allows for ease of use and cost-reduction in terms of instrumentation. As the counter-selection and the selection can be performed using the same marker, enrichment for loss-of-function mutations (which can potentially occur during the counter-selection) would be limited since these mutants would not be enriched during the selection round. While AmdS is already routinely applied to facilitate screening of genetic modifications 34–37 , its application for high-throughput growth-based directed evolution has to the best of our knowledge not been demonstrated before. At first, amdS was fused to yeGFP with a (G 4 S) 3 -linker, to allow for growth-based selection and simultaneous phenotype analysis. The TEF1 -promoter (p TEF1 ) was used to simulate the maximum ON-state of a biosensor and the minimal GAL core- promoter equipped with 5 luxO operator sites (p GAL _core) as the OFF-state. SMD medium supplemented with fluoro-acetamide (F-Ac) was used as counter selection, while SMD without nitrogen source (SMD -N) supplemented with acetamide was used as selection medium (which will be supplemented with the ligand). Importantly, the medium cannot be supplemented with amino acids to complement auxotrophies of your yeast, since these can be used as alternative nitrogen source. We therefore switched to CEN.PK110-10C derived yeast strains (containing Cas9-casette on a plasmid carrying a HIS3 -marker) when using amdS . To be able to enrich for functional biosensors, there needed to be a substantial difference in growth rate between the ON and OFF-state on both counter-selection medium as well as the selection medium. We therefore started by testing the strains (ACA007; p GAL _core- amdS -yeGFP, ACA013; p TEF1 - amdS -yeGFP) in a plate reader, to have an estimation of the relative growth rates. Using 5 g L -1 F-Ac, an approximate 1.5 to 2-fold reduction of the growth rate was observed for the always ON-state compared to the always OFF-state (Figure S3). Increasing the concentration to 10 and 20 g L -1 F- Ac did not further reduce the growth rate. In parallel, a mdS without the yeGFP fusion was also tested (strains ACA002; p TEF1 - amdS , ACA004; p GAL _core- amdS ), and displayed a 4.5, 5 and 5.5-fold reduction in growth rate at 5, 10 and 20 g L -1 F-Ac, respectively (Figure 2A and Figure S3). The fusion of amdS with yeGFP appears to interfere with the activity of AmdS. This is corroborated by the growth curves obtained by growing the strains on SMD -N + acetamide, which displayed an approximately 20% reduction in growth rate for the AmdS-yeGFP fusion, compared to AmdS (Figure S4A). Importantly, for both AmdS-yeGFP fusion as well as AmdS, on the selection medium we observed an approximate 2.2 and 2.6-fold difference in growth rate between the ON-state and the OFF-state, and the OFF-state strains are virtually non-growing (Figure 2B and Figure S4A). To get a better understanding about cross-feeding 38,39 using amdS as selection marker, we cultured the ON and OFF-state together and tracked the abundance of each strain (ACA013; pTEF1- amdS -yeGFP and ACA008; pGAL_core- amdS -mKate2) during two consecutive transfers (Figure S4B). Based on this data, we concluded that amdS can be used as selection marker with minimal cross-feeding. Since the counter-selection is slightly more stringent when amdS is expressed as a single cassette compared to the fusion version (5.5-fold reduction compared to 2-fold reduction in growth rate), we decided to move forward by expressing amdS as a single cassette. We started with testing the complete workflow, by sequentially growing a mixture of strains on the counter-selection medium, followed by the selection medium (Figure 2C). The mixture consisted of the yeast strain mimicking the always OFF-state (ACA004: p GAL _core), the always ON-state (ACA002: p TEF1 ) and a yeast with a functional biosensor which can toggle between the ON and OFF-state (ACA019: VP48-LuxR). No ligand was added to the counter-selection medium, while 5 µM 3-oxo-C6-HSL was added to the selection medium. The abundance of each strain was tracked by plating the culture before each transfer and quantified genotypically. Indeed, we were able to enrich for a functional variant out of a pool which mimics non-functional biosensors (Figure 2D), while there was no enrichment when growing for 3 consecutive transfers on non-selective medium (Figure S5). For application in library screening, we decided to integrate yeGFP driven by the hybrid promoter in a separate locus, to be able to directly verify biosensor behaviour in the population during the different transfers (Figure 3B). Increasing sensitivity of LuxR by directed evolution strategies After establishing a workflow for screening mutant libraries, we tested different activation domains in combination with LuxR and found that, consistent with previous studies 40 , VP48 and Med2 were the most potent activators (Figure S6). In this specific case, VP16 did not induce any detectable expression, while Gal4 activation domain (AD) resulted in the mildest activation (Figure S6). Given that overly strong activation could lead to unintended effects, such as system saturation, we chose to proceed with Gal4_AD to allow for more controlled and tunable gene expression in our system. To allow for any synergistic effects between variant regulator and activation domains, the whole open reading frame of luxR as well as the GAL4 _AD were subjected to error-prone PCR (epPCR) (Figure 3A). After optimizing the transformation protocol (see Methods), a mutant library of approximately 2.7 million mutants was obtained. The library was grown on counter-selective medium (SMD 20 F-Ac) followed by two transfers on selective medium (SMD-N + acetamide) supplemented with 5 nM or 50 nM C8-HSL. On the second transfer on selective medium, no growth was observed after 3 days on the selective medium supplemented with 5 nM C8-HSL, but mutants were able to grow on the selective medium supplemented with 50 nM C8-HSL. Analysing the population (T1) on the flow cytometer, indicated a subpopulation which was more fluorescent (Figure 3C, Figure S7A), corresponding to 32% of the total culture. We decided to perform three more transfers on the selective medium, obtaining population T2, T3 and T4. For each population T1-4, we analysed the population as a whole as well as 48 single colonies, using flow cytometer. Using consecutive transfers on the selection medium, the abundance of the more fluorescent subpopulation could be increased to 88%, with 94% of the randomly picked colonies displaying an improved phenotype (Figure 3C, T4) and no false-positives. Alternatively, we found that this 32% subpopulation in T1 could also be easily enriched using FACS-selection (Figure S7B) as well as by manually picking the most fluorescent colonies when plating on YPD supplemented with ligand (Figure S7C), resulting in 98% and 65% of the picked colonies displaying an improved phenotype, respectively. The best performing mutants (fold change >10) were genotyped by sequencing. Identification of Gal4-LuxR-variants with increased sensitivity for acyl-HSLs Analysing the genotypes of the best performing mutants, we identified 3 unique genotypes (Table 1). Regardless of the method for further selection, all 3 genotypes were found in the selected colonies. Notably, all selected mutants are mutated in residue N86 (ie. N86I, N86K and N86Y). The N86K mutation has also been reported to increase sensitivity in E. coli , where it was suggested to play a role in changing conformation upon ligand binding 41 . Table 1 : Overview of mutations found in Gal4-NLS-luxR Location gen1 gen2 gen3 Gal4_AD N24K, P41 (CCA→CCG), N46D, T92S, V98 (GTA→GTT), K114E G8V F51 (TTC→TTT), G88E NLS K120N LuxR N5D, V36 (GTT→GTC), N86I, S164Y, D182 (GAT→GAC) N86K, K104E, M135V K53E, N86Y, I119V We integrated the mutant regulators into strain AAA019 (p GAL _core-5x luxO -yeGFP) for phenotypic analysis. Since N86K mutation specifically has been reported previously in E. coli 41 , additionally a biosensor strain carrying LuxR_N86K was constructed to assess the effect of this specific mutation. To evaluate the impact of these mutations, we performed dose-response assays using C8-HSL as well as C4-HSL, C6-HSL, C10-HSL, 3-oxo-C6-HSL, 3-oxo-C8-HSL and 3-oxo-C12-HSL (Figure 4; Figure S8). Analysis of the dose-response curves showed that N86K mutation led to a notable increase in sensitivity for C8-HSL compared to the control regulator (Figure 4B). However, the three mutants identified from the mutant library displayed even greater sensitivity, with genotypes gen1 and gen2 displaying the highest sensitivity. These findings suggest that while N86K mutation improves sensitivity, additional mutations present in the other 3 mutants further amplify this effect. Moreover, this effect is not specific for C8-HSL, since all mutants displayed increased sensitivity towards other acyl-HSLs as well (Figure S8). Lastly, genotypes gen1 and gen2 displayed a 2 and 3.5-fold increase in fluorescence in the presence of 10 nM C8-HSL, respectively, indicating induction in the range of C8-HSL production previously established in yeast in this study (Figure 1C). Implementing orthogonal quorum-sensing circuits in Saccharomyces cerevisiae QS-circuits typically consist of a sender module, responsible for acyl-HSL production, and a sensor module, responsible for acyl-HSL detection. With C8-HSL production established and the identification of sensitive mutants completed, we finalized the construction of QS-circuits. To achieve this, we integrated the luxR -variants together with the hybrid promoter (QS-sensor module) into strain AAA111 (CepI (++)), which already contained expression cassettes for Bc.CepI , Sc.SAM2 and Sc.MET6 (QS-sender module) (Figure 4C). Biomass and fluorescence were measured over time in a plate reader for quadruplicate cultures of the resulting strains grown in fed-batch EnPump medium supplemented with methionine. Our results confirmed that combining both modules resulted in the first successful implementation of an AHL-based QS-controlled yeGFP expression system in yeast, characterized by delayed self-induced yeGFP expression (Figure 4D). For comparisons between the different circuits, induction was defined as a 1.8-fold increase in fluorescence normalized to OD and activity was defined as the time required to reach this induction level, further normalized to the exact induction level at that timepoint (see Methods). Consistent with the dose-response curves (Figure 4B), strains carrying gen1 and gen2 genotypes (Table 1) induced yeGFP expression earlier in the cultivation (at 14.5 and 13.6 h, respectively) than genotype gen3 and N86K (at 17.8 and 20.4 h, respectively) (Figure 4D). Circuits based on gen1 and gen2 thereby showed 50±2% and 57±1% greater activity, and reached 3.6- and 2.2-fold higher maximum induction levels (induction levels of 6.7±0.2 and 4.1±0.1, for gen1 and gen2 respectively) than N86K, while gen3 exhibited 19±2% increase in activity relative to N86K and reached a 1.5-fold higher level of induction (induction level of 2.7±0.1) (Figure 4D). To further investigate the impact of C8-HSL production levels, we integrated luxR _gen1 into strains AAA063 (CepI) and AAA113 (CepI (+)), which were previously shown to produce 1.9-fold and 1.5-fold less C8-HSL than AAA111 (CepI (++)), respectively (Figure 1C). Strains AAA151 (CepI (++) + Gal4-LuxR_gen1), AAA169 (CepI (+) + Gal4-LuxR_gen1) and AAA168 (CepI + Gal4-LuxR_gen1) were grown in medium supplemented with and without methionine. As expected, activity was lower for the QS-circuits in which less C8-HSL was produced, with a marginal 30% higher level of induction reached for strain AAA168 compared to AAA169 (2.8±0.1 and 2.2±0.1, respectively) (Figure S9A). Moreover, the addition of methionine did not significantly influence the timing of yeGFP induction and or activity of the QS-circuit (Figure S9B), and it was therefore omitted in subsequent experiments. Removing activation domain from LuxR inverses mode-of-action of regulator In this study, LuxR has been implemented for transcriptional activation, by fusing it with an activation domain. In its native context, LuxR usually activates gene expression by recruiting the RNA polymerase to the promoter, but can also repress expression by either preventing RNA polymerase binding or blocking its progression along the promoter, depending on the location of the operator sequence 43,44 . To expand the versatility of QS-controlled regulatory systems in yeast, we decided to test whether LuxR can be engineered as repressor in yeast as well. Enabling both QS-controlled activation as well as repression allows for greater flexibility in designing various logic gates and provides more modularity. We therefore inserted the operator sequence downstream of the TATA-box in the TEF1 -promoter (Figure 5A) as is common when engineering biosensors using prokaryotic repressors 45 , resulting in strain AAA096. Additionally, we removed the activation domain and integrated luxR (AAA170), luxR _gen1 (AAA203) and luxR _N86K (AAA171) into this strain. In the presence of the ligand, indeed a 2 to 3-fold reduction of yeGFP expression was observed (Figure 5B). Moreover, synergistic effect of the gen1-mutations, as well as the effect of N86K alone increased sensitivity towards C8-HSL in this new context. We tried to further improve the dynamic range by increasing the operator binding sites from 1 to 2, which enhanced LuxR-dependent repression in studies performed in E. coli 44 , but did not further increase the dynamic range in yeast (Figure S10). QS-controlled repression of FAS1 improves aloesone production QS-controlled regulation can be very powerful to autonomously divert metabolic fluxes towards a specific pathway, later in the production process. This can be beneficial in systems where biosynthesis and production compete for the same precursors. To illustrate this, we decided to regulate an anabolic production pathway using our established QS-tools. As a testbed, we decided on the production of aloesone, a bioactive compound known for its pharmaceutical properties 46 . This compound is produced from malonyl-CoA and acetyl-CoA by a polyketide synthase 47 . Malonyl-CoA and acetyl-CoA are also precursors required in the fatty acid synthesis (FAS) as well, which is therefore in direct competition with aloesone production (Figure 5C). Previous studies have established that regulation of FAS1 48 can be targeted to improve malonyl-coA-derived products 49–52 . Building on these strategies, we replaced p FAS1 with p TEF1 _ luxO , to allow for QS-controlled FAS1 gene expression. We further introduced Aa . PKS3 from Aloe vera (strain AAA135; PKS3), QS-sender module (strain AAA206; PKS3, CepI (++)), QS-sensor module (strain AAA200; PKS3, LuxR-gen1) and finally the complete QS-circuit (strain AAA202; PKS3, LuxR-gen1, CepI (++)). Strains were tested in Biolector plates in glucose fedbatch mode, with exponential feeding and pH controlled to stay above 5.6. Endpoint measurements were performed to obtain the relative estimated abundance of aloesone (Figure S11) and C8-HSL in each of the strains. Production of signalling molecule C8-HSL did not change the production of aloesone, indicating that the metabolic burden from production of the autoinducer is neglectable (Figure 5D; PKS3+ CepI (++)). Introduction of only luxR -gen1 marginally increased production in strain (Figure 5D; PKS3 + LuxR-gen1), likely by lowering the basal expression of FAS1 . Introduction of the full QS-circuit significantly increased production of aloesone by 51% reaching 24.4 ± 1.7 nM, likely by enhancing the supply of malonyl-CoA for aloesone production (Figure 5D; PKS3 + LuxR-gen1 + CepI (++)). Discussion The AHL-based QS-system is a widely studied mechanism of cell-cell communication in Gram-negative bacteria 24 and this study represents the first successful engineering of an AHL-based QS-system in yeast. A major challenge in implementing such a system in yeast is the functional expression of an AHL synthase. Most LuxI-family AHL synthases utilize acyl-ACPs as acyl donors, and acyl-CoA to a much lesser extent 16 , 18 , 53 . However, unlike many prokaryotes, yeast does not have freely available acyl-ACP, as it exists only as part of the multifunctional fatty acid synthase type 1 (FAS I) complex 54 – 56 . We hypothesize that this difference prevents direct donation of an acyl-group to LuxI-type enzymes, potentially limiting their activity in yeast. However, exceptions have been reported of synthases that are more efficient in utilizing an acyl-CoA as the acyl-group donor 57 – 61 . Based on the functionality of CepI in yeast, we therefore suggest that CepI has evolved to be more receptive towards acyl-CoA than other LuxI-members. A second challenge was posed by the low concentration of C8-HSL, requiring a highly sensitive detection system. From the Alphafold3 42 structures of all 3 mutants compared to wildtype (WT) no change was seen in the ligand binding mode of C8-HSL after docking (Figure S12). However, for gen 2 (K120N, N86K, K104E, M135V) we found that M135 and K104 are in the loop in front of the entrance of the tunnel (Figure S13). Possibly, these mutations could have an effect on ligand binding, especially for 3-oxo-AHLs. In line with this observation, while gen2 displays the highest sensitivity for all tested straight-chain AHLs, gen1 and 3 are more sensitive for the tested 3-oxo-AHLs. Further experimental work and molecular dynamics simulations would be needed in the future to fully deconvolute the individual role of each mutation identified, and any mechanistic effects associated. The implementation of an AHL-based quorum sensing system establishes a truly orthogonal QS system in yeast. Such a system enables cell density-dependent regulatory control, as demonstrated by its application in aloesone production. Additionally, it can facilitate synthetic microbial consortia by coordinating interactions between different yeast strains, allowing for division of labor in metabolic processes. This key application could be extended to cross-species communication as well, enabling engineered yeast to interact with bacteria in co-cultures for improved bioproduction or cooperative behaviors. The application of AHL-based QS-circuits could be envisioned in interspecies co-cultures to, for example, help optimize microbial production of plant secondary metabolites 62 . Precursors derived from aromatic amino acids, phenylanaline and tyrosine, are efficiently synthesized in prokaryotes 63 – 65 . On the other hand, P450 enzymes, catalyzing the crucial steps in the synthesis of bioactive compounds, are poorly expressed in hosts like E. coli but highly functional in yeast 64 , 66 . With such cross-species corporation, challenges related to differences in growth rate, as well as required precursors that compete with biosynthesis, could be addressed by applying AHL-based QS regulatory circuits. This could prove instrumental in developing bioprocesses. Methods Strains and growth media The Saccharomyces cerevisiae strains used in this study are listed in table S1 and are derived from the CEN.PK-lineage 67 . CEN.PK110-10C (MAT-a URA3 LEU2 TRP1 his3) was used to construct all strains for the screening work (using amdS ), while all other strains were derived from CEN.PK2-1C (MAT-a ura3 his3 leu2 trp1). The yeast strains were routinely cultivated at 30°C in synthetic complete medium (SC) (6.7 g L − 1 yeast nitrogen base without amino acids, 1.62 g L − 1 yeast synthetic drop-out medium supplement without leucine, 0.2 g L − 1 leucine, 20 g L − 1 glucose, pH set to 5.6 with 2M KOH). Selection was performed in synthetic complete medium lacking histidine (SC -HIS) or lacking both histidine and uracil (SC -HIS -URA) (6.7 g L − 1 yeast nitrogen base without amino acids, 1.92 g L − 1 yeast synthetic drop-out medium supplement without histidine or 1.39 g L − 1 yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil supplemented with 0.2 g L − 1 leucine and 0.07 g L − 1 tryptophan, 20 g L − 1 glucose, pH set to 5.6 with 2M KOH, 2% (w/v) agar in case of plates). Selective cultivation using 100 mg L − 1 nourseothricin (clonNAT, Werner BioAgents) was done using synthetic media containing monosodium glutamate (SMG) (1.7 g L − 1 yeast nitrogen base without amino acids and ammonium sulfate, 1 g L − 1 monosodium glutamate, 1.92 g L − 1 yeast synthetic drop-out medium supplement without histidine or 1.39 g L − 1 yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil supplemented with 0.2 g L − 1 leucine and 0.07 g L − 1 tryptophan, 20 g L − 1 glucose, pH set to 5.6 with 2M KOH, 2% (w/v) agar in case of plates). Synthetic minimal medium (3.0 g L − 1 KH 2 PO 4 , 0.5 g L − 1 MgSO 4 ·7H 2 O, 5.0 g L − 1 (NH 4 ) 2 SO 4 , trace elements and vitamins was prepared as described previously (ref), supplemented with 20 g L − 1 glucose (SMD) was used for screening the libraries. Fluoroacetamide (final concentration of 20 g L − 1 ) was added to SMD for the OFF-selection, while (NH 4 ) 2 SO 4 was replaced by 6.6 g L − 1 K 2 SO 4 and 0.6 g L − 1 filter-sterilized acetamide for the ON-selection. Extra-buffered fed-batch medium contained 5.0 g L − 1 KH 2 PO 4 , 0.5 g L − 1 MgSO 4 ·7H 2 O, 14.4 g L − 1 (NH 4 ) 2 SO 4 , 1 ml L − 1 trace elements, 1 ml L − 1 vitamins, 0.125 g L − 1 histidine, 0.5 g L − 1 leucine, 0.075 g L − 1 tryptophan, 0.15 g L − 1 uracil, 20 g L − 1 glucose and 40 g L − 1 EnPump 200 substrate (Enpresso, Berlin, Germany). Where mentioned, methionine was added to a final concentration of 1 g L − 1 . Fed-batch was started with 8 mL L − 1 of enzyme mix. Feed medium for Biolector fed-batch cultivations contained 18 g L − 1 KH 2 PO 4 , 3 g L − 1 MgSO 4 ·7H 2 O, 45 g L − 1 (NH 4 ) 2 SO 4 , 12 ml L − 1 trace elements, 6 ml L − 1 vitamins, 1.0 g L − 1 histidine, 5.0 g L − 1 leucine, 0.8 g L − 1 tryptophan, 1.5 g L − 1 uracil, 160 g L − 1 glucose. Start medium was prepared by diluting feed medium 4 times in sterile Milli-Q. For cloning and plasmid propagation, Escherichia coli strain DH5 was used, in Luria-Bertani (LB) medium containing 100 µg mL − 1 ampicillin or 25 µg mL − 1 chloramphenicol. Chemicals Fluoroacetamide (Sigma-Aldrich, 128341-5G) was dissolved in dH 2 O to a final concentration of 200 gL − 1 and stored at 4°C. Acylated homoserine-lactones C4-HSL (SML3427-10MG), C6-HSL (56395-10MG), C8-HSL (44558-10MG), C10-HSL (07028-10MG), 3-oxo-C6-HSL (K3007-10MG and K3255-25MG), 3-oxo-C8-HSL (O1764-10MG) and 3-oxo-C12-HSL (O9139-10MG) were purchased from Sigma-Aldrich and dissolved in 100% DMSO to a final concentration of 10 mM, aliquoted and stored at -20°C. Final working concentrations in cultivations were 100 µM and lower, resulting in DMSO concentrations of below 1%. Plasmid construction The plasmids used in this study are listed in table S3 and relevant primers for plasmid construction in table S2. The coding sequences of luxR, esaI, luxI and lasI were obtained from Addgene (Plasmids #165971, #47660, #73445, #73444) as well as the core promoter with 5 operator sequences p GAL1 _5x luxO (plasmid #165977). Codon-optimized versions of cepI, esaI, luxI and lasI as well as p TEF1 _ luxO _105 were synthesized by GeneArt Thermo Scientific (sequences are shown in Table S5). Plasmid construction for integration fragments was performed by USER-cloning, using fragment-specific primers listed (Table S2) and Phusion U High-Fidelity DNA Polymerase (New England Biolabs) according to manufacturer's instructions, to obtain overhangs suitable for USER-cloning. To obtain the p TEF1 _2x luxO fragment with USER-overhangs, pAvA098 was amplified with AA34/AA201 and AA202/AA35. For construction of single ORF cassettes, the backbone was PCR-amplified with MAD3/MAD4 68 . For construction of plasmids with two ORFs, the backbone was linearized using SfaAI FD and BsmI FD (Thermo Scientific) 69 . Linearized backbone, promoter(s), ORF(s), terminator(s) and where indicated activation domain, were added in equimolar amounts with cutsmart buffer and USER-enzyme and handled according to supplier’s protocol. 2 µL of this mixture was used in the subsequent transformation with E. coli and the whole mixture was plated on selective medium. Plasmid encoding p FAS1 gRNA was constructed following the steps as described previously 70 using the manually identified GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC as gRNA sequence. Yeast strains construction Yeast strains were constructed using CRISPR-Cas9-mediated genome editing. A plasmid carrying Cas9, using HIS3 as selection marker, was introduced into CEN.PK110-10C and CEN.PK2-1C and were stocked as ACA001 and AAA001 respectively and were used for all subsequent yeast transformations. In general, for each transformation one or two gRNA-plasmids were introduced alongside NotI-digested plasmids containing the integration cassette according to EasyClone protolcol 69 and as described in table S4. Exceptions include the introduction of p PGK1 - GAL4 _AD- luxR _N86K-t ADH1 and p PGK1 - luxR _N86K-t ADH1 , which were introduced as two linear PCR-amplified fragments introducing the N85K mutation, and assembled using homologous recombination into the yeast genome. Fragments were obtained by PCR using pAvA103 and pAvA027 as template and AA76/AA153 and AA80/AA154 as primers (table S1 ). Moreover, replacement of p FAS1 with p TEF1 - luxO _105 was performed by transforming yeast with pAvA125 and one linear PCR-amplified fragment of p TEF1 _ luxO -105 with 60 bp homology flanks to the up and downstream sequences of p FAS1 . Linear fragment was made by PCR using pAvA109 as template and AA164/AA167 as primers. Transformants were obtained using heat-shock transformation protocol based on the Gietz and Schiest 71 , 72 . Transformations were plated on SMG -HIS + NAT, SC -HIS -URA or SMG -HIS -URA + NAT depending on the selection markers used. Colonies were restreaked at least once on selective medium. Correct integration was determined by colony PCR using RedTaq MM. After confirmation of correct integration, plasmids were removed from the yeast by growing on non-selective medium overnight and plating dilutions on YPD to obtain single colonies. Verification of removal of each plasmid was performed by transferring all colonies to filter paper (Whatman, grade 1 round filter paper, 150 mm) and subsequently stamping these colonies on new plates on YPD and on each individual selection (ie. SC-HIS, SC-URA, SC + NAT). For subsequent transformation rounds, strains still containing the Cas9-plasmid were stocked in addition to the plasmid-free constructed yeast strain. Library generation Error-prone PCR (epPCR) was carried out using the Agilent GeneMorph mutagenesis II kit, with 750 ng as template DNA, aiming for 0-4.5 mutations/kb, according to manufacturer’s instructions. One round of error-prone PCR was carried out using primers AA73/AA77 and pAvA103 as template, followed by a regular PCR with primers AA74/AA78 with the PCR product as template, to amplify the library and to obtain a homology flank on each side of the mutated fragment of 120 bp. Homology arms for integration in X-4, including the promoter sequence or the terminator sequence were amplified using AA757/AA76 and AA79/AA80 respectively, with pAvA103 as template. Yeast libraries were obtained using a heat-shock transformation protocol based on the Gietz and Schiest 71 , 72 , with the following adaptations: 25 mL of exponentially growing yeast cells (OD 600 of 2.0) were harvested and used in one transformation. Cells were washed in 0.1 M LiAc prior to addition of the transformation mixture. For the DNA mixture, equimolar amounts of the three linear fragments were used, adding 800 ng of the largest fragment and 1 µg of the gRNA plasmid per transformation. After resuspending the cells in the transformation mixture, the cells were incubated for 15 minutes at 30°C, prior to 30-minute heat-shock at 42°C. The total biomass of 16 transformations (corresponding to 400 mL yeast culture of OD 600 = 2) were pooled together after the recovery step and added to 48 mL of SMG -HIS + clonNAT as one library. By plating for single colonies on SMG -HIS + clonNAT right after the transformation, it was determined that the library contained 2.7 * 10 6 possible variants. Multiple aliquots of the library were stocked after 2–3 days, when single colonies appeared on the SMG -HIS + clonNAT plates. Growth-based OFF and ON selection After transformation, the yeast library was grown for 2–3 days on SMG -HIS + clonNAT. 1 mL of this culture (or from a cryostock vial) was transferred to fresh 50 mL SMG -HIS + NAT and grown for another 24 hours. This culture was diluted 1:50 in 5 mL SMD F-Ac medium and grown for 24 hours (OFF-selection) in 50 mL CELLSTAR® CELLREACTOR tubes (Greiner Bio-One). Then, the culture was transferred (1:50) to 5 mL SMD -N + acetamide + ligand and grown for 24 hours or till growth was observed (ON-selection), and this step was repeated at least one more time. Each subsequent culture was stocked, analysed by flow cytometer and where indicated plated for single colonies on YPD or YPD + ligand. Mutant genotypes were determined by sanger sequencing of GAL4 _AD-NLS- luxR . FACS-based selection After sequential transfers on counter-selective and selective medium as described above, S. cerevisiae cells containing the GAL4 _AD-NLS- luxR library were grown in 1 mL of SC + 50 nM C8-HSL for 6 hours. The cells were analysed on Sony fluorescence-assisted cell sorting (FACS) instrument with blue laser (488 nm) to detect yeGFP fluorescence. 10.000 events were recorded and used to gate the 7% most fluorescent population. Cells were sorted in FITC-A versus FSC-A and collected in 5 mL SC. After recovery overnight, the cells were stored at -70°C in aliquots by adding 25% (v/v) glycerol and plated for single colonies on YPD. Flow cytometry A 1 mL aliquot of glycerol − 70°C freezer stock was used to inoculate 50 mL of SC medium or a single colony from the screened library was inoculated into 200 µL of SC medium and grown for 16 hours. For analysis of ligand-dependent activation, the culture was diluted 1:20 in 200 µL SC medium ± inducer in 96-deep-well culture plates and grown for 6 hours at 30°C. For analysis of ligand-dependent repression, the culture was diluted 1:50 and grown for 24 hours prior to being diluted 1:20 in 200 µL SC medium ± inducer in 96-deep-well culture plates and grown for 6 hours. Cells were washed and diluted 1:4 in PBS prior to analysis by flow cytometer. Flow cytometry analysis was performed on the NovoCyte Quanteon™ (Agilent). 20.000 events were recorded for each well, with a threshold for event detection at > 150,000 FSC-H and a core diameter of 10.1 µm. For yeGFP, excitation was performed with a blue laser (488 nm) and emission detection with a 530/30 nm BP filter (471 V). Subsequent analysis was performed using FlowJo licensed software. FSC-A was plotted against FSC-H to gate for singlets events. Gated events were used to determine the median fluorescence of the population. Fluorescence plate reader cultivation Growth and fluorescence were analused using a BioTek Synergy H1 microplate reader. Inocula were prepared as follows: 1 mL aliquot of glycerol − 70°C freezer stock was grown for 16 hours in 50 mL of SC medium (pH 5.6) in baffled 250 mL shake flasks and transferred to 5 mL fresh SC-medium in 50 mL CELLSTAR® CELLREACTOR tubes (Greiner Bio-One) and exponentially growing cells (OD 600 = 5–6) were used to inoculate the plate at a starting OD 660 of 0.25–0.3. Black clear-bottom 96-well plates (Greiner Bio-one, catalog nr. 655090) were used, with a total volume of 150 µL per well. OD 660 and yeGFP fluorescence (588/633, gain 80) were recorded every 20 minutes and temperature was set to 30°C with double orbital continuous shaking. Structural mapping of mutations The structures of LuxR and Gal4_AD-NLS-LuxR dimerized and bound to C8-HSL and DNA binding sites were generated using Boltz1. Figures indicating the mutated residues were created using PyMol. Statistical and data analysis Analysis of flow cytometric data was performed using FlowJo licensed software. FSC-A was plotted against FSC-H to gate for singlets events. Gated events were used to determine the median fluorescence of the population. Graphs were plotted and statistical analysis were performed using GraphPad Prism V10.4.0 (GraphPad software). Significance of aloesone production (Fig. 5 ) was analysed by one-way ANOVA, with strain type as independent variable. Post hoc analysis was performed using Tukey’s HSD test to evaluate pairwise comparisons between strains. Comparison of the different QS-circuits (Fig. 4 ) was performed by averaging the fluorescence/OD over the first 2–4 hour time window, to establish a baseline. Subsequent fluorescence/OD measurements were then normalized to this baseline average. A circuit was considered induced when four consecutive measurements showed at least a 1.8-fold increase relative to the baseline. The threshold of 1.8-fold was chosen because it represents the maximum average fold-change observed in the least active circuit (N86K). AHL and aloesone analysis by LC-MS/MS By TripleQuad LC-MS/MS Detection and quantification of acylated homoserine lactones and aloesone was determined from yeast supernatant samples. Samples for AHL quantification were undiluted and samples for aloesone determination were 25-fold diluted with deionized water and subjected to analysis by liquid chromatography coupled to tandem mass spectrometry. Briefly, chromatography was performed on a 1290 Infinity II UHPLC system (Agilent Technologies, Germany). Separation was achieved on a Zorbax Eclipse-Plus C18 column (50 x 3.0, 1.8 µm, Agilent Technologies). Formic acid (0.05%, v/v) in water and acetonitrile (supplied with 0.05% formic acid, v/v) were employed as mobile phases A and B respectively. The elution profile for detection of AHLs and aloesone was: 0-0.3 min, 10% B; 0.3-4.0 min, 10–98% B; 4.0–5.0 min 98% B; 5.0-5.10 min, 98 − 10% B and 5.1-6.0 min 10% B. The mobile phase flow rate was 400 µL min − 1 . The column temperature was maintained at 40°C. The liquid chromatography was coupled to an Ultivo Triplequadrupole mass spectrometer (Agilent Technologies) equipped with a Jetstream electrospray ion source (ESI) operated in positive ion mode. The instrument parameters were optimized by infusion experiments with pure standards. The ion spray voltage was set to 3000 V. Dry gas temperature was set to 325°C and dry gas flow to 10 L min − 1 . Sheath gas temperature was set to 400°C and sheath gas flow to 12 L min − 1 . Nebulizing gas was set to 45 psi. Nitrogen was used as dry gas, nebulizing gas and collision gas. Multiple reaction monitoring (MRM) was used to monitor precursor ion → fragment ion transitions. MRM transitions were determined by direct infusion experiments of reference standards. Detailed values for mass transitions can be found in supplemental Table S6. Both Q1 and Q3 quadrupoles were maintained at unit resolution. Mass Hunter Quantitation Analysis for QQQ software (Version 10, Agilent Technologies) was used for data processing. Linearity in ionization efficiency was verified by analyzing dilution series that were also used for quantification of AHLs in the samples. By Quadrupole-time-of-fligt (Q-TOF) LC-MS/MS Samples for Q-TOF analysis were prepared similarly to the TripleQuad using the same 25-fold dilution in deionized water. The chromatographic separation was done on a 1290 Infinity II UHPLC system (Agilent Technologies) equipped with Zorbax Eclipse XDB-C18 column (100 x 3.0 mm, 1.8µm, Agilent Technologies). Formic acid (0.05%, v/v) in water was used as mobile phase A and acetonitrile (supplied with 0.05% formic acid, v/v) as mobile phase B. The 15 min gradient was as follows: 0.0–2.0 min, 3% B; 2.0–11.0 min, 3–75% B; 11.0-12.5min 75–100% B, 12.5–13.5 min 100% B, 13.5–13.6 min 100-3% B and 13.6–15.0 3% B. The mobile phase flow rate was 400 µl/min. The column temperature was maintained at 30°C. The liquid chromatography was coupled to a Bruker timsToF Pro mass spectrometer (Bruker, Bremen, Germany) equipped with an electrospray ion source (ESI) operated in positive. The ion spray voltage was maintained at + 4200 V, dry temperature was set to 200°C, and the dry gas flow was set to 8 L/min. Nitrogen was used as the dry gas, nebulizing gas, and collision gas. The nebulizing gas was set to 2.5 bar and collision energy to 10 eV. MS spectra were acquired in an m/z range from 50 to 1500 amu and MS/MS spectra in a range from 50-1500 amu. Sampling rate was 5 Hz in both ion modes. Na-formate clusters were used for mass calibration. All files were calibrated by postprocessing Shakeflask cultivation Aerobic shakeflasks cultivation were performed in baffled 250 mL shake flasks, with a working volume of 50 mL. 1 mL aliquot of glycerol − 70°C freezer stock was used to inoculate 50 mL of SC medium (pH 5.6) in baffled 250 mL shake flasks. After 16 hours of growths, this culture was used to prepare the preculture in 50 mL fresh SC-medium. Exponentially growing cells (OD 600 = 5–6) were used to inoculate shakeflasks at a starting OD 660 of 0.3–0.4. OD 600 measurements were performed by sampling from the shakeflasks and measuring on DS-C Cuvette Spectrophotometer (DeNovix). BioLector cultivation pH-controlled fed-batch cultivation was performed in Microfluidic FlowerPlates (m2plabs, Beckman Coulter Life Sciences; Lot nr. 2309221) in the BioLector Pro II system (Beckman Coulter Life Sciences). An exponential feed profile was used of 0.48 µL h − 1 * e 0.0125 * t , triggered after 16–20 hours. 2 M KOH was used to ensure the pH would not drop below 5.6. The temperature was set to 30°C and shaking to 1000 rpm. The relative humidity in the growth chamber was maintained at 85% using distilled water to minimize evaporation of the media. Measurements of biomass and pH were performed every 4 minutes. A starting volume of 800 µL start medium was added in each well and 1800 µL in each well designated for feed and base control. Calibration values corresponding to the Lot nr. were used for pH. Pre-cultures were prepared by inoculating 1 mL aliquot of glycerol − 70°C freezer stock in 50 mL of SC medium (pH 5.6) in baffled 250 mL shake flasks and cells were grown for 16 hours before being diluted in 5 mL fresh SC-medium in 50 mL CELLSTAR® CELLREACTOR tubes (Greiner Bio-One) and exponentially growing cells (OD 600 = 5–6) were used to inoculate the plate at a starting OD 600 of 0.25–0.3. Declarations Competing interests The authors declare no competing interests Author contributions AA : Conceptualization, Funding acquisition, Investigation, Visualization, Formal analysis, Methodology, Project administration, Writing – original draft, Writing – review & editing. MH : Formal analysis, Visualization, Writing – review & editing. MLJ : Investigation. TS : Investigation. CC : Resources, Investigation MP : Resources, Investigation. CA-R : Resources. EDJ : Resources, Writing – review & editing. MKJ : Supervision, Writing – review & editing Acknowledgements This study is part of the project Orthogonal quorum-sensing systems in yeast cell factories with file number 019.231EN.007 of the Rubicon research programme which is financed by the Dutch research council (NWO) and awarded to AA. MH is funded by Novo Nordisk Foundation, grant number NNF22SA0078231 (Copenhagen Bioscience PhD Programme). This project has received funding from the Novo Nordisk Foundation, grant number NNF20CC0035580. We thank Robert Mans for fruitful discussions about the screening workflow. We thank Emma Hoch-Schneider for support during laboratory onboarding. We thank Arsenios Vlassis with technical support on the flow cytometer. We thank Divya Dharshini and Beata Lehka for technical support on the biolector. We thank Ditte Hededam Welner for kindly supplying us with aloesone standard. Data availability All data shown in figures are available in the Source data provided with this paper. There are no restrictions on data availability. References Keasling, J. D. Manufacturing molecules through metabolic engineering. Science (1979) 330 , 1355–1358 (2010). Lee, J. W. et al. Systems metabolic engineering of microorganisms for natural and non-natural chemicals. Nat Chem Biol 8 , 536–546 (2012). Mans, R., Daran, J.-M. G. & Pronk, J. T. Under pressure: evolutionary engineering of yeast strains for improved performance in fuels and chemicals production. Curr Opin Biotechnol 50 , 47–56 (2018). Tan, S. Z. & Prather, K. L. J. Dynamic pathway regulation: recent advances and methods of construction. Curr Opin Chem Biol 41 , 28–35 (2017). Skjoedt, M. L. et al. Engineering prokaryotic transcriptional activators as metabolite biosensors in yeast. Nat Chem Biol 12 , 951–958 (2016). Garí, E., Piedrafita, L., Aldea, M. & Herrero, E. A set of vectors with a tetracycline‐regulatable promoter system for modulated gene expression in Saccharomyces cerevisiae. Yeast 13 , 837–848 (1997). Labbe, S. & Thiele, D. J. [8] Copper ion inducible and repressible promoter systems in yeast. in Methods in enzymology vol. 306 145–153 (Elsevier, 1999). Sievi, E., Hänninen, A., Salo, H., Kumar, V. & Makarow, M. Validation of the Hsp150 Polypeptide Carrier and HSP150 Promoter in Expression of Rat α2, 3‐Sialyltransferase in Yeasts. Biotechnol Prog 19 , 1368–1371 (2003). Rojas, V. & Larrondo, L. F. Coupling cell communication and optogenetics: implementation of a light-inducible intercellular system in yeast. ACS Synth Biol 12 , 71–82 (2022). Shimizu-Sato, S., Huq, E., Tepperman, J. M. & Quail, P. H. A light-switchable gene promoter system. Nat Biotechnol 20 , 1041–1044 (2002). Parschat, K., Schreiber, S., Wartenberg, D., Engels, B. & Jennewein, S. High-titer de novo biosynthesis of the predominant human milk oligosaccharide 2′-fucosyllactose from sucrose in Escherichia coli. ACS Synth Biol 9 , 2784–2796 (2020). Bothfeld, W., Kapov, G. & Tyo, K. E. J. A glucose-sensing toggle switch for autonomous, high productivity genetic control. ACS Synth Biol 6 , 1296–1304 (2017). Tekel, S. J. et al. Engineered orthogonal quorum sensing systems for synthetic gene regulation in Escherichia coli. Front Bioeng Biotechnol 7 , 80 (2019). Davis, R. M., Muller, R. Y. & Haynes, K. A. Can the natural diversity of quorum-sensing advance synthetic biology? Front Bioeng Biotechnol 3 , 30 (2015). Reading, N. C. & Sperandio, V. Quorum sensing: the many languages of bacteria. FEMS Microbiol Lett 254 , 1–11 (2006). Dong, S.-H. et al. Molecular basis for the substrate specificity of quorum signal synthases. Proceedings of the National Academy of Sciences 114 , 9092–9097 (2017). Davis, R. M., Muller, R. Y. & Haynes, K. A. Can the Natural Diversity of Quorum-Sensing Advance Synthetic Biology? Front Bioeng Biotechnol 3 , (2015). Parsek, M. R., Val, D. L., Hanzelka, B. L., Cronan, J. E. & Greenberg, E. P. Acyl homoserine-lactone quorum-sensing signal generation. Proceedings of the National Academy of Sciences 96 , 4360–4365 (1999). Nealson, K. H., Platt, T. & Hastings, J. W. Cellular control of the synthesis and activity of the bacterial luminescent system. J Bacteriol 104 , 313–322 (1970). R, de K. T. & H, I. B. Bacterial Quorum Sensing in Pathogenic Relationships. Infect Immun 68 , 4839–4849 (2000). Davies, D. G. et al. The Involvement of Cell-to-Cell Signals in the Development of a Bacterial Biofilm. Science (1979) 280 , 295–298 (1998). Scott, S. R. & Hasty, J. Quorum sensing communication modules for microbial consortia. ACS Synth Biol 5 , 969–977 (2016). Jiang, W. et al. Two completely orthogonal quorum sensing systems with self-produced autoinducers enable automatic delayed cascade control. ACS Synth Biol 9 , 2588–2599 (2020). Grant, P. K. et al. Orthogonal intercellular signaling for programmed spatial behavior. Mol Syst Biol 12 , 849 (2016). Chen, M.-T. & Weiss, R. Artificial cell-cell communication in yeast Saccharomyces cerevisiae using signaling elements from Arabidopsis thaliana. Nat Biotechnol 23 , 1551–1555 (2005). Yang, X. et al. Quorum sensing-mediated protein degradation for dynamic metabolic pathway control in Saccharomyces cerevisiae. Metab Eng 64 , 85–94 (2021). Xu, M. et al. Engineering pheromone-mediated quorum sensing with enhanced response output increases fucosyllactose production in Saccharomyces cerevisiae. ACS Synth Biol 12 , 238–248 (2022). Williams, T. C., Nielsen, L. K. & Vickers, C. E. Engineered quorum sensing using pheromone-mediated cell-to-cell communication in Saccharomyces cerevisiae. ACS Synth Biol 2 , 136–149 (2013). Shong, J. & Collins, C. H. Engineering the esaR Promoter for Tunable Quorum Sensing-Dependent Gene Expression. ACS Synth Biol 2 , 568–575 (2013). Chen, H., Wang, Z., Wang, Z., Dou, J. & Zhou, C. Improving methionine and ATP availability by MET6 and SAM2 co-expression combined with sodium citrate feeding enhanced SAM accumulation in Saccharomyces cerevisiae. World J Microbiol Biotechnol 32 , 56 (2016). Tominaga, M., Nozaki, K., Umeno, D., Ishii, J. & Kondo, A. Robust and flexible platform for directed evolution of yeast genetic switches. Nat Commun 12 , 1846 (2021). Snoek, T. et al. Evolution-guided engineering of small-molecule biosensors. Nucleic Acids Res 48 , e3–e3 (2020). Solis-Escalante, D. et al. amdSYM, a new dominant recyclable marker cassette for Saccharomyces cerevisiae. FEMS Yeast Res 13 , 126–139 (2013). van Aalst, A. C. A., Geraats, E. H., Jansen, M. L. A., Mans, R. & Pronk, J. T. Optimizing the balance between heterologous acetate-and CO2-reduction pathways in anaerobic cultures of Saccharomyces cerevisiae strains engineered for low-glycerol production. FEMS Yeast Res 23 , foad048 (2023). Wang, Y. et al. Expression of antibody fragments in Saccharomyces cerevisiae strains evolved for enhanced protein secretion. Microb Cell Fact 20 , 134 (2021). Duperray, M., Delvenne, M., François, J. M., Delvigne, F. & Capp, J.-P. Genomic and metabolic instability during long-term fermentation of an industrial Saccharomyces cerevisiae strain engineered for C5 sugar utilization. Front Bioeng Biotechnol 12 , 1357671 (2024). Karaca, H. et al. Metabolic engineering of Saccharomyces cerevisiae for enhanced taxadiene production. Microb Cell Fact 23 , 241 (2024). Meinander, N. Q. & Hahn‐Hägerdal, B. Fed‐batch xylitol production with two recombinant Saccharomyces cerevisiae strains expressing XYL1 at different levels, using glucose as a cosubstrate: a comparison of production parameters and strain stability. Biotechnol Bioeng 54 , 391–399 (1997). Hu, K. K. Y., Suri, A., Dumsday, G. & Haritos, V. S. Cross-feeding promotes heterogeneity within yeast cell populations. Nat Commun 15 , 418 (2024). Qiu, C. et al. Engineering transcription factor-based biosensors for repressive regulation through transcriptional deactivation design in Saccharomyces cerevisiae. Microb Cell Fact 19 , 1–10 (2020). Kimura, Y., Tashiro, Y., Saito, K., Kawai-Noma, S. & Umeno, D. Directed evolution of Vibrio fischeri LuxR signal sensitivity. J Biosci Bioeng 122 , 533–538 (2016). Abramson, J. et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630 , 493–500 (2024). Zhang, J. et al. Binding site profiles and N-terminal minor groove interactions of the master quorum-sensing regulator LuxR enable flexible control of gene activation and repression. Nucleic Acids Res 49 , 3274–3293 (2021). Egland, K. A. & Greenberg, E. P. Conversion of the Vibrio fischeriTranscriptional Activator, LuxR, to a Repressor. J Bacteriol 182 , 805–811 (2000). Ambri, F. et al. High-resolution scanning of optimal biosensor reporter promoters in yeast. ACS Synth Biol 9 , 218–226 (2020). Wang, Y. et al. Multiple beneficial effects of aloesone from aloe vera on LPS-induced RAW264. 7 cells, including the inhibition of oxidative stress, inflammation, M1 polarization, and apoptosis. Molecules 28 , 1617 (2023). Putkaradze, N., Dato, L., Kırtel, O., Hansen, J. & Welner, D. H. Enzymatic glycosylation of aloesone performed by plant UDP-dependent glycosyltransferases. Glycobiology 34 , cwae050 (2024). Wenz, P., Schwank, S., Hoja, U. & Schüller, H.-J. A downstream regulatory element located within the coding sequence mediates autoregulated expression of the yeast fatty acid synthase gene FAS2 by the FAS1 gene product. Nucleic Acids Res 29 , 4625–4632 (2001). Chen, X., Yang, X., Shen, Y., Hou, J. & Bao, X. Increasing Malonyl-CoA Derived Product through Controlling the Transcription Regulators of Phospholipid Synthesis in Saccharomyces cerevisiae. ACS Synth Biol 6 , 905–912 (2017). Wen, J., Tian, L., Liu, Q., Zhang, Y. & Cai, M. Engineered dynamic distribution of malonyl-CoA flux for improving polyketide biosynthesis in Komagataella phaffii. J Biotechnol 320 , 80–85 (2020). Yu, W., Cao, X., Gao, J. & Zhou, Y. J. Overproduction of 3-hydroxypropionate in a super yeast chassis. Bioresour Technol 361 , 127690 (2022). David, F., Nielsen, J. & Siewers, V. Flux Control at the Malonyl-CoA Node through Hierarchical Dynamic Pathway Regulation in Saccharomyces cerevisiae. ACS Synth Biol 5 , 224–233 (2016). Gould, T. A., Schweizer, H. P. & Churchill, M. E. A. Structure of the Pseudomonas aeruginosa acyl‐homoserinelactone synthase LasI. Mol Microbiol 53 , 1135–1146 (2004). Eckhart, S. & Jörg, H. Microbial Type I Fatty Acid Synthases (FAS): Major Players in a Network of Cellular FAS Systems. Microbiology and Molecular Biology Reviews 68 , 501–517 (2004). Rock, C. O. & Cronan, J. E. Escherichia coli as a model for the regulation of dissociable (type II) fatty acid biosynthesis. Biochimica et Biophysica Acta (BBA) - Lipids and Lipid Metabolism 1302 , 1–16 (1996). Lynen, F. et al. On the structure of fatty acid synthetase of yeast. Eur J Biochem 112 , 431–442 (1980). Christensen, Q. H., Brecht, R. M., Dudekula, D., Greenberg, E. P. & Nagarajan, R. Evolution of acyl-substrate recognition by a family of acyl-homoserine lactone synthases. PLoS One 9 , e112464 (2014). Lindemann, A. et al. Isovaleryl-homoserine lactone, an unusual branched-chain quorum-sensing signal from the soybean symbiont Bradyrhizobium japonicum. Proceedings of the National Academy of Sciences 108 , 16765–16770 (2011). Ahlgren, N. A., Harwood, C. S., Schaefer, A. L., Giraud, E. & Greenberg, E. P. Aryl-homoserine lactone quorum sensing in stem-nodulating photosynthetic bradyrhizobia. Proceedings of the National Academy of Sciences 108 , 7183–7188 (2011). Schaefer, A. L., Val, D. L., Hanzelka, B. L., Cronan Jr, J. E. & Greenberg, E. P. Generation of cell-to-cell signals in quorum sensing: acyl homoserine lactone synthase activity of a purified Vibrio fischeri LuxI protein. Proceedings of the National Academy of Sciences 93 , 9505–9509 (1996). Daer, R. et al. Characterization of diverse homoserine lactone synthases in Escherichia coli. PLoS One 13 , e0202294 (2018). Zhou, K., Qiao, K., Edgar, S. & Stephanopoulos, G. Distributing a metabolic pathway among a microbial consortium enhances production of natural products. Nat Biotechnol 33 , 377–383 (2015). Patnaik, R., Zolandz, R. R., Green, D. A. & Kraynie, D. F. L‐tyrosine production by recombinant Escherichia coli: fermentation optimization and recovery. Biotechnol Bioeng 99 , 741–752 (2008). Pyne, M. E., Narcross, L. & Martin, V. J. J. Engineering Plant Secondary Metabolism in Microbial Systems. Plant Physiol 179 , 844–861 (2019). Ajikumar, P. K. et al. Isoprenoid pathway optimization for Taxol precursor overproduction in Escherichia coli. Science (1979) 330 , 70–74 (2010). Galanie, S., Thodey, K., Trenchard, I. J., Filsinger Interrante, M. & Smolke, C. D. Complete biosynthesis of opioids in yeast. Science (1979) 349 , 1095–1100 (2015). Entian, K.-D. & Kötter, P. 25 yeast genetic strain and plasmid collections. Methods in microbiology 36 , 629–666 (2007). Deichmann, M. et al. Engineered yeast cells simulating CD19+ cancers to control CAR T cell activation. BioRxiv 2010–2023 (2023). Jessop‐Fabre, M. M. et al. EasyClone‐MarkerFree: A vector toolkit for marker‐less integration of genes into Saccharomyces cerevisiae via CRISPR‐Cas9. Biotechnol J 11 , 1110–1117 (2016). Jakočiūnas, T. et al. Multiplex metabolic pathway engineering using CRISPR/Cas9 in Saccharomyces cerevisiae. Metab Eng 28 , 213–222 (2015). Mans, R. et al. CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. FEMS Yeast Res 15 , fov004 (2015). Gietz, R. D. & Woods, R. A. Genetic transformation of yeast. Biotechniques 30 , 816–831 (2001). Additional Declarations There is NO Competing Interest. Supplementary Files QSsupplementaryNatureCommunicationsvanAalst.docx Supplementary materials Cite Share Download PDF Status: Published Journal Publication published 27 Nov, 2025 Read the published version in Communications Biology → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6620198","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":457129597,"identity":"91bf0202-e2e0-4a96-9088-0ecfd6c9ae2e","order_by":0,"name":"Aafke van Aalst","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAl0lEQVRIiWNgGAWjYNCCCmYQaUyKljPMEiRqYWwjRQt/++FnEj/nWdcZHGDebECUFokzaWaSvdvSJQwOsBUnEGfNDQZjA95th4FaeIwPEKVD/gb7Z8O/c0jRYnCDx/AxbwNEC3EOMzyTU/hY5li65MzDbMXEeV/u+PENB9/UWPPzHW/eLEGUFgRgJlH9KBgFo2AUjAI8AADEfivEgc6qRQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0009-0008-7417-7438","institution":"TECHNICAL UNIVERSITY OF DENMARK","correspondingAuthor":true,"prefix":"","firstName":"Aafke","middleName":"van","lastName":"Aalst","suffix":""},{"id":457129598,"identity":"88c411db-51ae-4fce-8aa6-d6208e49f444","order_by":1,"name":"Maxence Holtz","email":"","orcid":"","institution":"TECHNICAL UNIVERSITY OF DENMARK","correspondingAuthor":false,"prefix":"","firstName":"Maxence","middleName":"","lastName":"Holtz","suffix":""},{"id":457129599,"identity":"96d43b96-acbf-4a45-9e3e-c0eaa1aa82ee","order_by":2,"name":"Mikkel Lyskjær Jensen","email":"","orcid":"","institution":"TECHNICAL UNIVERSITY OF DENMARK","correspondingAuthor":false,"prefix":"","firstName":"Mikkel","middleName":"Lyskjær","lastName":"Jensen","suffix":""},{"id":457129600,"identity":"a105c538-8a82-4ea0-8fa7-ce01fd3ff01f","order_by":3,"name":"Tabea Schröder","email":"","orcid":"","institution":"TECHNICAL UNIVERSITY OF DENMARK","correspondingAuthor":false,"prefix":"","firstName":"Tabea","middleName":"","lastName":"Schröder","suffix":""},{"id":457129601,"identity":"0e9bd0f3-79fb-4317-b132-ce9def1787b5","order_by":4,"name":"Christoph Crocoll","email":"","orcid":"https://orcid.org/0000-0003-2754-3518","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Christoph","middleName":"","lastName":"Crocoll","suffix":""},{"id":457129602,"identity":"dd53812f-cdc6-444f-ba20-dc10a2f084a2","order_by":5,"name":"Michal Poborsky","email":"","orcid":"https://orcid.org/0000-0002-7105-3316","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Michal","middleName":"","lastName":"Poborsky","suffix":""},{"id":457129603,"identity":"e86b0b03-8099-4e50-8fc5-e90ce1805816","order_by":6,"name":"Emil Jensen","email":"","orcid":"https://orcid.org/0000-0002-8280-0946","institution":"Technical University of Denmark","correspondingAuthor":false,"prefix":"","firstName":"Emil","middleName":"","lastName":"Jensen","suffix":""},{"id":457129604,"identity":"41531084-97a5-44b6-af67-9ffd1d1d8b85","order_by":7,"name":"Michael Jensen","email":"","orcid":"https://orcid.org/0000-0001-7574-4707","institution":"Technical University of Denmark","correspondingAuthor":false,"prefix":"","firstName":"Michael","middleName":"","lastName":"Jensen","suffix":""}],"badges":[],"createdAt":"2025-05-08 11:35:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6620198/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6620198/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s42003-025-09163-9","type":"published","date":"2025-11-27T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":83760960,"identity":"69b2d5f7-1163-4fd3-8764-b19b22c39aaa","added_by":"auto","created_at":"2025-06-02 09:37:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":188348,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDevelopment of acylated homoserine lactone (AHL)-induced expression system in yeast. \u003c/strong\u003e(A)\u003cstrong\u003e \u003c/strong\u003eSchematic overview of AHL-dependent – QS-controlled regulation. The concentration of AHLs increases with an increase in biomass. After a certain threshold biomass concentration (ie. AHL concentration) is reached (indicated by the arbitrary dashed line), it modulates gene expression via interaction with a LuxR-type regulator and operator sequence (\u003cem\u003eluxO\u003c/em\u003e). In this example, the expression of a fluorescent protein (yeGFP) is controlled. (B) Overview of the metabolic pathway involved in the formation of AHLs. (C) Production of C8-HSL established in yeast strains (AAA063; CepI, AAA113; CepI (+), AAA111; CepI (++)) expressing a \u003cem\u003eBc.cepI\u003c/em\u003e expression cassette alone (indicated by CepI) or with an overexpression cassette for \u003cem\u003eSc.SAM2\u003c/em\u003e and \u003cem\u003eSc.MET6\u003c/em\u003e. For the upregulation of \u003cem\u003eSAM2\u003c/em\u003e and \u003cem\u003eMET6\u003c/em\u003e, either an expression cassette was introduced driven by p\u003cem\u003eACT1\u003c/em\u003e and p\u003cem\u003ePGI1\u003c/em\u003e (indicated by (+)) or an expression cassette driven by p\u003cem\u003eTEF1\u003c/em\u003e and p\u003cem\u003ePGK1\u003c/em\u003e(indicated by (++)). Yeast strains were grown for 48 hours in duplicate aerobic shakeflasks on fed-batch EnPump medium, error bars indicate standard deviation from the mean. (D) yeGFP fluorescence levels 6 hours following supplementation of 0 or 100 µM ligand tested for strains AAA019 (-regulator) and AAA036 (+regulator) in duplicate cultures. (E) Dose-response curve of yeGFP fluorescence levels 6 hours following supplementation of 0-100,000 nM C8-HSL, tested for strains AAA019 (-regulator) and AAA036 (+regulator) in duplicate cultures.\u003cem\u003e \u003c/em\u003eA.U.: arbitrary units. \u003cem\u003eBc: Burkholderia cenocepacia.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6620198/v1/a93493570fbe2983e9c7d38b.png"},{"id":83760640,"identity":"12bf3cd9-2b21-4eb8-bcb1-5fb2e52fc7bf","added_by":"auto","created_at":"2025-06-02 09:29:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":129747,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDevelopment of growth-based screening using AmdS as (counter-) selectable marker.\u003c/strong\u003e Growth curves of batch cultures of \u003cem\u003eS. cerevisiae\u003c/em\u003e strains expressing \u003cem\u003eNd.amdS\u003c/em\u003efrom a minimal \u003cem\u003eGAL\u003c/em\u003e-core promoter equipped with 5x\u003cem\u003eluxO\u003c/em\u003e (red) (ACA004), from the strong p\u003cem\u003eTEF1\u003c/em\u003e (green) (ACA002) and from a minimal \u003cem\u003eGAL\u003c/em\u003e-core promoter equipped with 5x\u003cem\u003eluxO\u003c/em\u003e controlled by VP48-LuxR (yellow) (ACA019) (A) on counter-selection medium (SMD supplemented with fluoro-acetamide (F-Ac), (B) and selection medium (SMD without nitrogen source supplemented with acetamide) supplemented with 5 µM 3-oxo-C6-HSL were obtained by a plate reader. Representative data of duplicate cultures are shown. (C) The pipeline workflow for enrichment of functional biosensors from a mixture of genetically different yeast strains consists of growing consecutively on counter- followed by (at least) two transfers on selection medium. (D) This workflow was tested in duplicate using the same three strains and using 5 µM 3-oxo-C6-HSL as ligand. The abundance of each strain was tracked using colony PCR of 24-32 single colonies after each transfer. \u003cem\u003eNd.\u003c/em\u003e: \u003cem\u003eAspergillus nidulans\u003c/em\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6620198/v1/4b0573ccebadcb0a9cf5e1c2.png"},{"id":83760643,"identity":"7adf6e0a-d4a5-46c8-a24e-afb25716abe6","added_by":"auto","created_at":"2025-06-02 09:29:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":247583,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eConstruction and screening of a mutant library of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eGAL4\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e_AD-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eluxR\u003c/strong\u003e\u003c/em\u003e. (A) Error-prone PCR (epPCR) was used to target \u003cem\u003eGAL4\u003c/em\u003e_AD-\u003cem\u003eluxR\u003c/em\u003e. A second round of regular high fidelity PCR was used to amplify the mutants while prolonging the overhanging sequence to 120 bp homologous to the promoter and terminator sequence. The promoter and terminator sequence -including a 400 bp homologous sequence to the integration site- was amplified using regular high fidelity PCR. The mutant library was integrated used CRISPR-Cas9 into X-4 integration site via homologous recombination of the 3 fragments, (B) into a yeast strain that already contained \u003cem\u003eamdS\u003c/em\u003e and yeGFP controlled by p\u003cem\u003eGAL\u003c/em\u003e_core_5x\u003cem\u003eluxO\u003c/em\u003e. (C) Mutant library was grown on transformation selection media SC -HIS +NAT for 3 days, after which cells were transferred to counter-selection media and grown for 1 day. Subsequently, cells were transferred up to 5 times on selection media, containing 50 nM C8-HSL. Cultures T1-T4 were analysed on the flow cytometer and plated for single colonies. 48 single colonies from each culture were analysed on the flow cytometer after 6 hours growth with or without ligand, to determine the dynamic range. A.U.: arbitrary units.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6620198/v1/c7d9ccd08e2294baa4b435ec.png"},{"id":83760646,"identity":"6ee18171-cadd-4c20-8f5c-1f6accf4f228","added_by":"auto","created_at":"2025-06-02 09:29:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":236352,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCharacterization of Gal4-LuxR-mutants and implementation into QS-circuits.\u003c/strong\u003e (A) Structural mapping of mutations found in gen1 (green), gen2 (pink) and gen 3 (blue) in LuxR. The structure of LuxR was obtained via Alphafold3 \u003csup\u003e42\u003c/sup\u003e prediction. (B) Dose-response curves of yeGFP fluorescence levels 6 hours following supplementation of 0-10,000 nM C8-HSL. Tested for \u003cem\u003eS. cerevisiae\u003c/em\u003e strains AAA036 (- regulator), AAA101 (+ regulator), AAA156 (+ gen1), AAA157 (+ gen2), AAA158 (+ gen3), AAA107 (+ N86K). (C) Improved biosensors were implemented into C8-HSL producing strains consisting of an overexpression module of \u003cem\u003eSc.SAM2\u003c/em\u003e and \u003cem\u003eSc.MET6\u003c/em\u003e and \u003cem\u003ecepI \u003c/em\u003e(CepI (++)). (D) Fluorescence and OD were monitored in fluorescence plate reader of \u003cem\u003eS. cerevisiae\u003c/em\u003e strains AAA148 (CepI (++) + N86K), AAA149 (CepI (++) + gen3), AAA150 (CepI (++) + gen2), AAA151 (CepI (++) + gen1) and control strain AAA189 (CepI (++) – regulator). Cultures were grown on fed-batch medium to analyse the autonomous delayed induction of GFP. A.U.: arbitrary units. \u003cem\u003eBc: Burkholderia cenocepacia\u003c/em\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6620198/v1/9dbb1d38a154f33925848e0c.png"},{"id":83760644,"identity":"71300190-19b7-4415-bd47-193d4ac38dcf","added_by":"auto","created_at":"2025-06-02 09:29:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":180418,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEstablishing of repressive behaviour of LuxR-based biosensor and implementation into a QS-controlled circuit to increase production of aloesone.\u003c/strong\u003e (A) Removal of activation domain and insertion of \u003cem\u003eluxO\u003c/em\u003e sequence downstream of TATA-box in p\u003cem\u003eTEF1\u003c/em\u003e (p\u003cem\u003eTEF1\u003c/em\u003e_luxO) to convert LuxR into transcriptional repressor in the presence of ligand. (B) Dose-response curves of yeGFP fluorescence levels following a 24 hours pre-incubation with 5-10,000 nM C8-HSL prior to transfer to fresh medium with supplementation for 6 hours with 5-10,000 nM C8-HSL with \u003cem\u003eS. cerevisiae\u003c/em\u003e strains AAA097 (-LuxR), AAA170 (+LuxR), AAA171 (+LuxR-N86K) and AAA203 (+LuxR-gen1). (C) Schematic overview of the production of aloesone by\u003cem\u003eAa.PKS3\u003c/em\u003e from acetyl-CoA and malonyl-CoA, emphasizing the resource competition with fatty acid synthesis. p\u003cem\u003eFAS1\u003c/em\u003e is replaced with p\u003cem\u003eTEF1_luxO\u003c/em\u003e. (D) End-point determination of C8-HSL production and aloesone production from aerobic fed-batch cultivation performed in flowerplates analysed by biolector (n=4-5) with strains AAA135 (PKS3), AAA206 (PKS3, CepI (++)), AAA200 (PKS3, LuxR-gen1) and AAA202 (PKS3, LuxR-gen1, CepI (++)). A.U.: arbitrary units. \u003cem\u003eAa.\u003c/em\u003e: \u003cem\u003eAloe vera\u003c/em\u003e. \u003cem\u003eBc.: Burkholderia cenocepacia. \u003c/em\u003e*** indicates p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6620198/v1/e3bdb1754402a6cc3dde3d14.png"},{"id":98664077,"identity":"612b95d5-33e5-4ee8-b133-2d32c8e92da6","added_by":"auto","created_at":"2025-12-20 08:10:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2367391,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6620198/v1/38b603b2-be44-454d-be05-37401960a075.pdf"},{"id":83760662,"identity":"8a76b519-389d-4d2f-b6c9-5db10cd32b07","added_by":"auto","created_at":"2025-06-02 09:29:49","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2141637,"visible":true,"origin":"","legend":"Supplementary materials","description":"","filename":"QSsupplementaryNatureCommunicationsvanAalst.docx","url":"https://assets-eu.researchsquare.com/files/rs-6620198/v1/b7173b126046dd3de08c8050.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Engineering N-acyl-homoserine lactone-based quorum-sensing circuit for dynamic regulatory control in Saccharomyces cerevisiae","fulltext":[{"header":"Main","content":"\u003cp\u003eNowadays, microorganisms such as the yeast \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e can be readily adapted to synthesize products of interest \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Engineering yeast for product formation typically involves the introduction of non-native biosynthetic pathways alongside rewiring or deletion of endogenous metabolic pathways \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. However, optimizing these engineered strains for high product titers remains a significant challenge due to metabolic imbalances and increased energy expenditure associated with product biosynthesis. Specifically, anabolic product pathways compete with native metabolism for essential cellular resources, including carbon, energy, and cofactors. Consequently, engineered strains often exhibit suboptimal product titers and reduced growth rates, conferring an evolutionary disadvantage relative to non-engineered strains which can result in genetically unstable yeast strains that lose productivity over time \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Developing generic strategies for dynamic regulation of cellular resources to balance growth and product formation is therefore a critical challenge in microbial biotechnology \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTranscription factors are natural proteins that have evolved to regulate gene expression in response to key intracellular signals or environmental changes, and have been applied for engineered dynamic pathway regulation \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. The first synthetic network constructed in yeast, based on the bacterial Tet Repressor, enabled timed induction of gene expression by addition of tetracycline or derivatives \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Since then, systems for inducible gene expression based on nutrient composition \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e temperature \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e or light \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e have been reported. Studies using these inducers showed that delayed expression of genes encoding enzymes of biosynthetic pathways could improve product titers \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. However, inducers are often costly and/or require process-specific medium or cultivation conditions that, for economic, technological and/or safety reasons can be unsuitable for large-scale fermentations. These complications contribute to a growing interest in inducer-free systems such as two-stage processes linking expression of genes encoding enzymes of biosynthetic pathways to cell-population density \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn nature, microbial populations can regulate gene expression in response to cell density through quorum sensing (QS), a cell-cell communication mechanism mediated by small signaling molecules known as autoinducers (AIs) \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. In Gram-negative bacteria, the most common AIs are \u003cem\u003eN\u003c/em\u003e-acyl-homoserine lactones (AHLs), which consist of a homoserine lactone ring attached to an acyl chain of varying length and oxidation state \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. AHLs are synthesized by LuxI-family synthases using \u003cem\u003eS\u003c/em\u003e-adenosylmethionine and acyl carrier protein (ACP)-bound acyl groups as substrates \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. In general, each AHL synthase predominantly synthesizes a single type of AHL and can produce additional AHLs in smaller amounts \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. The acyl group preference is defined by the substrate specificity of the enzyme rather than by the supply of acyl substrates available in the cytoplasm. Once synthesized, AHLs diffuse into the extracellular environment, where they accumulate in a density-dependent manner. Upon reaching a critical concentration, AHLs can diffuse into the cells and bind to LuxR-type transcriptional regulators, which undergo a conformational change. The regulator dimerizes and binds to a regulator-specific operator sequence (eg. \u003cem\u003eluxO\u003c/em\u003e) within target promoters (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), thereby modulating the expression of various genes involved in processes such as bioluminescence \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e, pathogenesis \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e and biofilm formation \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, illustrating the powerful role of QS in coordinating population-wide behaviors.\u003c/p\u003e \u003cp\u003eAHL-based QS systems have been extensively adapted for synthetic biology applications, primarily in bacterial systems \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. However, their implementation in eukaryotic hosts such as \u003cem\u003eS. cerevisiae\u003c/em\u003e remains underexplored. To date, only a limited number of QS-based circuits have been successfully engineered in yeast, including a plant hormone-responsive system \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e and a rewired pheromone signaling pathway \u003csup\u003e\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. However, since these systems consist of eukaryotic elements, their implementation is inherently linked to off-target effects such as growth arrest or morphological changes, challenging their utility in biotechnological applications. Prokaryotic QS systems offer a potentially orthogonal regulatory strategy that minimizes crosstalk with native eukaryotic signaling networks. Moreover, the biochemical diversity of AHL-based QS systems enables the construction of multiple, independently regulated circuits \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e, providing a versatile framework for dynamic control of metabolic pathways in yeast.\u003c/p\u003e \u003cp\u003eIn this study, we aimed to develop a fully orthogonal, AHL-based QS system for autonomous and tunable regulation of metabolic pathways in \u003cem\u003eS. cerevisiae\u003c/em\u003e. To achieve this, we here present the rational and evolution-guided engineering of AHL sensing and a first demonstration of AHL production in yeast. Based on the engineered production and sensing systems, we demonstrate dynamic regulation of a reporter gene, as well as improved aloesone production using the engineered QS-based regulatory platform, thus demonstrating a novel broadly utilizable tool for yeast metabolic engineering.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eEstablishing acylated homoserine lactone production and sensing in yeast\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn many proteobacteria, acyl-HSLs are produced by synthases from the LuxI protein family. From this family, we selected LuxI (from \u003cem\u003eVibrio fischeri\u003c/em\u003e, \u003csup\u003e24\u003c/sup\u003e) LasI (from \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e, \u003csup\u003e29\u003c/sup\u003e) and EsaI (from \u003cem\u003ePantoea stewartia\u003c/em\u003e, \u003csup\u003e29\u003c/sup\u003e) as these are well-characterized and are already successfully used in synthetic QS-circuits in bacterial sytems \u003csup\u003e13,23,24,29\u003c/sup\u003e. LuxI and EsaI\u003cem\u003e\u0026nbsp;\u003c/em\u003epredominantly catalyze the formation of 3-oxo-C6-HSL, while 3-oxo-C12-HSL is the predominant product of LasI \u003csup\u003e24,29\u003c/sup\u003e. We expressed them in \u003cem\u003eS. cerevisiae\u003c/em\u003e (native and codon-optimized version). When genomically integrating a single copy of each of these enzymes driven by the strong \u003cem\u003eSc.TDH3\u003c/em\u003e promoter in yeast (strains AAA021; \u003cem\u003eluxI\u003c/em\u003e, AAA022; \u003cem\u003elasI\u003c/em\u003e, \u0026nbsp;AAA023; \u003cem\u003eesaI\u003c/em\u003e, AAA079; \u003cem\u003eluxI\u003c/em\u003e_co, AAA081; \u003cem\u003elasI\u003c/em\u003e_co, AAA083; \u003cem\u003eesaI\u003c/em\u003e_co), we were not able to detect any acyl-HSL-compounds in the supernatant of the yeast cultures. This indicated that these enzymes were not expressed or directly functionally transferrable between bacteria and yeast. In addition to these 3 synthases, we decided to express a codon-optimized version of \u003cem\u003ecepI\u003c/em\u003e (\u003cem\u003eBurkholderia cenocepacia\u003c/em\u003e) as well, which, in contrast to the previously tested synthases, catalyzes the formation of the straight-chain acyl-HSL C8-HSL. When integrating the expression cassette of \u003cem\u003eBc.cepI\u0026nbsp;\u003c/em\u003ein yeast (strain AAA063), production of C8-HSL was observed of 7 nM (Figure 1C, Figure S1). As the substrates of LuxI-type synthases are \u003cem\u003eS\u003c/em\u003e-adenosyl-L-methionine (SAM) and an acyl-donor (Figure 1B), we tried to further increase the production by boosting the precursor supply of SAM, using methionine feeding as well as overexpression of \u003cem\u003eS. cerevisiae\u0026rsquo;s SAM2\u003c/em\u003e and \u003cem\u003eMET6\u0026nbsp;\u003c/em\u003e\u003csup\u003e30\u003c/sup\u003e. For the upregulation of \u003cem\u003eSAM2\u003c/em\u003e and \u003cem\u003eMET6\u003c/em\u003e, an expression cassette with weak constitutive promoters driven by p\u003cem\u003eACT1\u003c/em\u003e and p\u003cem\u003ePGI1\u003c/em\u003e (indicated by +) as well as an expression cassette with strong constitutive promoters driven by p\u003cem\u003eTEF1\u003c/em\u003e and p\u003cem\u003ePGK1\u003c/em\u003e (indicated by ++) were introduced into yeast (strains AAA111; CepI (++) and AAA113, CepI (+)). Sole introduction of \u003cem\u003ecepI\u003c/em\u003e did not affect the growth performance (Figure S2A). However, in line with literature \u003csup\u003e30\u003c/sup\u003e, introduction of an additional copy of \u003cem\u003eSAM2\u003c/em\u003e and \u003cem\u003eMET6\u003c/em\u003e resulted in a reduction in growth rate of approximately 11% \u0026nbsp; and 20%, for the weak and high constitutive promoters respectively, and a 19% reduction in final optical density (OD\u003csub\u003e660\u003c/sub\u003e) for high constitutive promoters, under microplate conditions (Figure S2B). Using strong constitutive promoters in addition to methionine feeding resulted in 3.4-fold increase (26 \u0026plusmn; 2 nM) in C8-HSL production (Figure 1C). To minimize any additional fitness trade-offs, we chose not to pursue further improvements of C8-HSL production.\u003c/p\u003e\n\u003cp\u003eIn order to establish a heterologous QS-system based on acyl-HSL, we next focused on establishing an acyl-HSL biosensor. Recently, Tominaga \u003cem\u003eet al.\u003c/em\u003e (2021) have successfully implemented LuxR as a transcriptional activator upon detection of 3-oxo-C6-HSL in \u003cem\u003eS. cerevisiae\u0026nbsp;\u003c/em\u003e\u003csup\u003e31\u003c/sup\u003e. However, this system has not been tested for C8-HSL. LuxR-type regulators are known to bind different acyl-HSLs with different specificities \u003csup\u003e17\u003c/sup\u003e, and therefore this system \u003csup\u003e31\u003c/sup\u003e was used as a starting point. As a prototypic design based on the work by Tominaga \u003cem\u003eet al\u003c/em\u003e. (2021), we first expressed a variant LuxR with two mutations S116Y and W201R, described to be essential for functionality in yeast \u003csup\u003e31\u003c/sup\u003e, fused with a VP48 activation domain and a nuclear localisation signal (NLS). This reading frame was integrated into the genome, together with the \u003cem\u003eGAL\u003c/em\u003e core-promoter (p\u003cem\u003eGAL\u003c/em\u003e_core) equipped with 5 LuxR-specific operator sequences (\u003cem\u003eluxO\u003c/em\u003e) driving the expression of yeGFP (yeast strains AAA019; p\u003cem\u003eGAL\u003c/em\u003e_core-5x\u003cem\u003eluxO\u003c/em\u003e-yeGFP, AAA036; p\u003cem\u003eGAL\u003c/em\u003e_core-5x\u003cem\u003eluxO\u003c/em\u003e-yeGFP + VP48-NLS-\u003cem\u003eluxR\u003c/em\u003e). From this design, we confirmed induction of yeGFP expression by 3-oxo-C6-HSL, and also observed this biosensor to respond to different chain lengths 3-oxo acyl-HSLs as well as to straight-chain acyl-HSLs of various lengths, including C8-HSL, with biosensor-dependent fold-changes in yeGFP expression reaching up to 155-fold (Figure 1D). However, the operational range of the biosensor (\u0026ge;500 nM) (Figure 1E) did not correspond with our established C8-HSL production (5-30 nM) (Figure 1C) and would by design therefore not be useful to complete the quorum-sensing circuit.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcetamidase can be used for growth-based (counter-) selection of biosensors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo make a QS system based on prokaryotic LuxR in yeast, the sensitivity of the transcriptional activator would need to be improved. In allosterically regulated proteins, directed evolution is often used for developing transcriptional regulation based on prokaryotic regulators including optimization of sensitivity \u003csup\u003e5,31,32\u003c/sup\u003e. While several studies have used fluorescence-assisted cell sorting (FACS) to select specific phenotypes out of a pool of mutants \u003csup\u003e5,32\u003c/sup\u003e, we decided to test whether the \u003cem\u003eAspergillus nidulans\u003c/em\u003e \u003cem\u003eamdS\u003c/em\u003e gene (encoding an acetamidase (AmdS)) could be employed as a (counter-) selectable marker for growth-based screening. Briefly, AmdS converts acetamide to acetate and ammonia, thereby allowing the host for growth on acetamide as sole nitrogen (or carbon) source \u003csup\u003e33\u003c/sup\u003e. In contrast to auxotrophic markers, \u003cem\u003eamdS\u003c/em\u003e is a dominant gain-of-function marker requiring higher abundance of the enzyme for fast growth rate, therefore allowing for a greater dynamic range to be covered by the marker. Additionally, the acetamide homologue fluoroacetamide can be used for counter-selection since its product is the toxic fluoroacetate. If functional, such a system allows for ease of use and cost-reduction in terms of instrumentation. As the counter-selection and the selection can be performed using the same marker, enrichment for loss-of-function mutations (which can potentially occur during the counter-selection) would be limited since these mutants would not be enriched during the selection round. While AmdS is already routinely applied to facilitate screening of genetic modifications \u003csup\u003e34\u0026ndash;37\u003c/sup\u003e, its application for high-throughput growth-based directed evolution has to the best of our knowledge not been demonstrated before.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAt first, \u003cem\u003eamdS\u003c/em\u003e was fused to yeGFP with a (G\u003csub\u003e4\u003c/sub\u003eS)\u003csub\u003e3\u003c/sub\u003e-linker, to allow for growth-based selection and simultaneous phenotype analysis. The \u003cem\u003eTEF1\u003c/em\u003e-promoter (p\u003cem\u003eTEF1\u003c/em\u003e) was used to simulate the maximum ON-state of a biosensor and the minimal \u003cem\u003eGAL\u003c/em\u003e core- promoter equipped with 5 \u003cem\u003eluxO\u003c/em\u003e operator sites (p\u003cem\u003eGAL\u003c/em\u003e_core) as the OFF-state. SMD medium supplemented with fluoro-acetamide (F-Ac) was used as counter selection, while SMD without nitrogen source (SMD -N) supplemented with acetamide was used as selection medium (which will be supplemented with the ligand). Importantly, the medium cannot be supplemented with amino acids to complement auxotrophies of your yeast, since these can be used as alternative nitrogen source. We therefore switched to CEN.PK110-10C derived yeast strains (containing Cas9-casette on a plasmid carrying a \u003cem\u003eHIS3\u003c/em\u003e-marker) when using \u003cem\u003eamdS\u003c/em\u003e. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo be able to enrich for functional biosensors, there needed to be a substantial difference in growth rate between the ON and OFF-state on both counter-selection medium as well as the selection medium. We therefore started by testing the strains (ACA007; p\u003cem\u003eGAL\u003c/em\u003e_core-\u003cem\u003eamdS\u003c/em\u003e-yeGFP, ACA013; p\u003cem\u003eTEF1\u003c/em\u003e-\u003cem\u003eamdS\u003c/em\u003e-yeGFP) in a plate reader, to have an estimation of the relative growth rates. Using 5 g L\u003csup\u003e-1\u003c/sup\u003e F-Ac, an approximate 1.5 to 2-fold reduction of the growth rate was observed for the always ON-state compared to the always OFF-state (Figure S3). Increasing the concentration to 10 and 20 g L\u003csup\u003e-1\u003c/sup\u003e F- Ac did not further reduce the growth rate. In parallel, a\u003cem\u003emdS\u003c/em\u003e without the yeGFP fusion was also tested (strains ACA002; p\u003cem\u003eTEF1\u003c/em\u003e-\u003cem\u003eamdS\u003c/em\u003e, ACA004; p\u003cem\u003eGAL\u003c/em\u003e_core-\u003cem\u003eamdS\u003c/em\u003e), and displayed a 4.5, 5 and 5.5-fold reduction in growth rate at 5, 10 and 20 g L\u003csup\u003e-1\u003c/sup\u003e F-Ac, respectively (Figure 2A and Figure S3). The fusion of \u003cem\u003eamdS\u003c/em\u003e with yeGFP appears to interfere with the activity of AmdS. This is corroborated by the growth curves obtained by growing the strains on SMD -N + acetamide, which displayed an approximately 20% reduction in growth rate for the AmdS-yeGFP fusion, compared to AmdS (Figure S4A).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eImportantly, for both AmdS-yeGFP fusion\u003cem\u003e\u0026nbsp;\u003c/em\u003eas well as AmdS, on the selection medium we observed an approximate 2.2 and 2.6-fold difference in growth rate between the ON-state and the OFF-state, and the OFF-state strains are virtually non-growing (Figure 2B and Figure S4A). To get a better understanding about cross-feeding \u003csup\u003e38,39\u003c/sup\u003e using \u003cem\u003eamdS\u003c/em\u003e as selection marker, we cultured the ON and OFF-state together and tracked the abundance of each strain (ACA013; pTEF1-\u003cem\u003eamdS\u003c/em\u003e-yeGFP and ACA008; pGAL_core-\u003cem\u003eamdS\u003c/em\u003e-mKate2) during two consecutive transfers (Figure S4B). Based on this data, we concluded that \u003cem\u003eamdS\u003c/em\u003e can be used as selection marker with minimal cross-feeding. Since the counter-selection is slightly more stringent when \u003cem\u003eamdS\u003c/em\u003e is expressed as a single cassette compared to the fusion version (5.5-fold reduction compared to 2-fold reduction in growth rate), we decided to move forward by expressing \u003cem\u003eamdS\u003c/em\u003e as a single cassette.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe started with testing the complete workflow, by sequentially growing a mixture of strains on the counter-selection medium, followed by the selection medium (Figure 2C). The mixture consisted of the yeast strain mimicking the always OFF-state (ACA004: p\u003cem\u003eGAL\u003c/em\u003e_core), the always ON-state (ACA002: p\u003cem\u003eTEF1\u003c/em\u003e) and a yeast with a functional biosensor which can toggle between the ON and OFF-state (ACA019: VP48-LuxR). No ligand was added to the counter-selection medium, while 5 \u0026micro;M 3-oxo-C6-HSL was added to the selection medium. The abundance of each strain was tracked by plating the culture before each transfer and quantified genotypically. Indeed, we were able to enrich for a functional variant out of a pool which mimics non-functional biosensors (Figure 2D), while there was no enrichment when growing for 3 consecutive transfers on non-selective medium (Figure S5). For application in library screening, we decided to integrate yeGFP driven by the hybrid promoter in a separate locus, to be able to directly verify biosensor behaviour in the population during the different transfers (Figure 3B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIncreasing sensitivity of LuxR by directed evolution strategies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter establishing a workflow for screening mutant libraries, we tested different activation domains in combination with LuxR and found that, consistent with previous studies \u003csup\u003e40\u003c/sup\u003e, VP48 and Med2 were the most potent activators (Figure S6). In this specific case, VP16 did not induce any detectable expression, while Gal4 activation domain (AD) resulted in the mildest activation (Figure S6). Given that overly strong activation could lead to unintended effects, such as system saturation, we chose to proceed with Gal4_AD to allow for more controlled and tunable gene expression in our system. To allow for any synergistic effects between variant regulator and activation domains, the whole open reading frame of \u003cem\u003eluxR\u003c/em\u003e as well as the \u003cem\u003eGAL4\u003c/em\u003e_AD were subjected to error-prone PCR (epPCR) (Figure 3A). After optimizing the transformation protocol (see Methods), a mutant library of approximately 2.7 million mutants was obtained.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe library was grown on counter-selective medium (SMD 20 F-Ac) followed by two transfers on selective medium (SMD-N + acetamide) supplemented with 5 nM or 50 nM C8-HSL. On the second transfer on selective medium, no growth was observed after 3 days on the selective medium supplemented with 5 nM C8-HSL, but mutants were able to grow on the selective medium supplemented with 50 nM C8-HSL. Analysing the population (T1) on the flow cytometer, indicated a subpopulation which was more fluorescent (Figure 3C, Figure S7A), corresponding to 32% of the total culture. We decided to perform three more transfers on the selective medium, obtaining population T2, T3 and T4. For each population T1-4, we analysed the population as a whole as well as 48 single colonies, using flow cytometer. Using consecutive transfers on the selection medium, the abundance of the more fluorescent subpopulation could be increased to 88%, with 94% of the randomly picked colonies displaying an improved phenotype (Figure 3C, T4) and no false-positives. Alternatively, we found that this 32% subpopulation in T1 could also be easily enriched using FACS-selection (Figure S7B) as well as by manually picking the most fluorescent colonies when plating on YPD supplemented with ligand (Figure S7C), resulting in 98% and 65% of the picked colonies displaying an improved phenotype, respectively. The best performing mutants (fold change \u0026gt;10) were genotyped by sequencing.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIdentification of Gal4-LuxR-variants with increased sensitivity for acyl-HSLs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnalysing the genotypes of the best performing mutants, we identified 3 unique genotypes (Table 1). Regardless of the method for further selection, all 3 genotypes were found in the selected colonies. Notably, all selected mutants are mutated in residue N86 (ie. N86I, N86K and N86Y). The N86K mutation has also been reported to increase sensitivity in \u003cem\u003eE. coli\u003c/em\u003e, where it was suggested to play a role in changing conformation upon ligand binding \u003csup\u003e41\u003c/sup\u003e.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e: \u003cstrong\u003eOverview of mutations found in Gal4-NLS-luxR\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLocation\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 192px;\"\u003e\n \u003cp\u003e\u003cstrong\u003egen1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp\u003e\u003cstrong\u003egen2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 163px;\"\u003e\n \u003cp\u003e\u003cstrong\u003egen3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGal4_AD\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 192px;\"\u003e\n \u003cp\u003eN24K, P41 (CCA\u0026rarr;CCG), N46D, T92S, V98 (GTA\u0026rarr;GTT), K114E\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp\u003eG8V\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 163px;\"\u003e\n \u003cp\u003eF51 (TTC\u0026rarr;TTT), G88E\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNLS\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 192px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp\u003eK120N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 163px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLuxR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 192px;\"\u003e\n \u003cp\u003eN5D, V36 (GTT\u0026rarr;GTC), N86I, S164Y, D182 (GAT\u0026rarr;GAC)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp\u003eN86K, K104E, M135V\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 163px;\"\u003e\n \u003cp\u003eK53E, N86Y, I119V\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eWe integrated the mutant regulators into strain AAA019 (p\u003cem\u003eGAL\u003c/em\u003e_core-5x\u003cem\u003eluxO\u003c/em\u003e-yeGFP) for phenotypic analysis. Since N86K mutation specifically has been reported previously in \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003e\u003csup\u003e41\u003c/sup\u003e, additionally a biosensor strain carrying LuxR_N86K was constructed to assess the effect of this specific mutation. To evaluate the impact of these mutations, we performed dose-response assays using C8-HSL as well as C4-HSL, C6-HSL, C10-HSL, 3-oxo-C6-HSL, 3-oxo-C8-HSL and 3-oxo-C12-HSL (Figure 4; Figure S8).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAnalysis of the dose-response curves showed that N86K mutation led to a notable increase in sensitivity for C8-HSL compared to the control regulator (Figure 4B). However, the three mutants identified from the mutant library displayed even greater sensitivity, with genotypes gen1 and gen2 displaying the highest sensitivity. These findings suggest that while N86K mutation improves sensitivity, additional mutations present in the other 3 mutants further amplify this effect. Moreover, this effect is not specific for C8-HSL, since all mutants displayed increased sensitivity towards other acyl-HSLs as well (Figure S8). Lastly, genotypes gen1 and gen2 displayed a 2 and 3.5-fold increase in fluorescence in the presence of 10 nM C8-HSL, respectively, indicating induction in the range of C8-HSL production previously established in yeast in this study (Figure 1C). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImplementing orthogonal quorum-sensing circuits in \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQS-circuits typically consist of a sender module, responsible for acyl-HSL production, and a sensor module, responsible for acyl-HSL detection. With C8-HSL production established and the identification of sensitive mutants completed, we finalized the construction of QS-circuits. To achieve this, we integrated the \u003cem\u003eluxR\u003c/em\u003e-variants together with the hybrid promoter (QS-sensor module) into strain AAA111 (CepI (++)), which already contained expression cassettes for \u003cem\u003eBc.CepI\u003c/em\u003e,\u003cem\u003e\u0026nbsp;Sc.SAM2\u003c/em\u003e and \u003cem\u003eSc.MET6\u0026nbsp;\u003c/em\u003e(QS-sender module) (Figure 4C). Biomass and fluorescence were measured over time in a plate reader for quadruplicate cultures of the resulting strains grown in fed-batch EnPump medium supplemented with methionine. Our results confirmed that combining both modules resulted in the first successful implementation of an AHL-based QS-controlled yeGFP expression system in yeast, characterized by delayed self-induced yeGFP expression (Figure 4D). For comparisons between the different circuits, induction was defined as a 1.8-fold increase in fluorescence normalized to OD and activity was defined as the time required to reach this induction level, further normalized to the exact induction level at that timepoint (see Methods). Consistent with the dose-response curves (Figure 4B), strains carrying gen1 and gen2 genotypes (Table 1) induced yeGFP expression earlier in the cultivation (at 14.5 and 13.6 h, respectively) than genotype gen3 and N86K (at 17.8 and 20.4 h, respectively) (Figure 4D). Circuits based on gen1 and gen2 thereby showed 50\u0026plusmn;2% and 57\u0026plusmn;1% greater activity, and reached 3.6- and 2.2-fold higher maximum induction levels (induction levels of 6.7\u0026plusmn;0.2 and 4.1\u0026plusmn;0.1, for gen1 and gen2 respectively) than N86K, while gen3 exhibited 19\u0026plusmn;2% increase in activity relative to N86K and reached a 1.5-fold higher level of induction (induction level of 2.7\u0026plusmn;0.1) (Figure 4D). To further investigate the impact of C8-HSL production levels, we integrated \u003cem\u003eluxR\u003c/em\u003e_gen1 into strains AAA063 (CepI) and AAA113 (CepI (+)), which were previously shown to produce 1.9-fold and 1.5-fold less C8-HSL than AAA111 (CepI (++)), respectively (Figure 1C). Strains AAA151 (CepI (++) + Gal4-LuxR_gen1), AAA169 (CepI (+) + Gal4-LuxR_gen1) and AAA168 (CepI + Gal4-LuxR_gen1) were grown in medium supplemented with and without methionine. As expected, activity was lower for the QS-circuits in which less C8-HSL was produced, with a marginal 30% higher level of induction reached for strain AAA168 compared to AAA169 (2.8\u0026plusmn;0.1 and 2.2\u0026plusmn;0.1, respectively) (Figure S9A). Moreover, the addition of methionine did not significantly influence the timing of yeGFP induction and or activity of the QS-circuit (Figure S9B), and it was therefore omitted in subsequent experiments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRemoving activation domain from LuxR inverses mode-of-action of regulator\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, LuxR has been implemented for transcriptional activation, by fusing it with an activation domain. In its native context, LuxR usually activates gene expression by recruiting the RNA polymerase to the promoter, but can also repress expression by either preventing RNA polymerase binding or blocking its progression along the promoter, depending on the location of the operator sequence \u003csup\u003e43,44\u003c/sup\u003e. To expand the versatility of QS-controlled regulatory systems in yeast, we decided to test whether LuxR can be engineered as repressor in yeast as well. Enabling both QS-controlled activation as well as repression allows for greater flexibility in designing various logic gates and provides more modularity. We therefore inserted the operator sequence downstream of the TATA-box in the \u003cem\u003eTEF1\u003c/em\u003e-promoter (Figure 5A) as is common when engineering biosensors using prokaryotic repressors \u003csup\u003e45\u003c/sup\u003e, resulting in strain AAA096. Additionally, we removed the activation domain and integrated \u003cem\u003eluxR\u0026nbsp;\u003c/em\u003e(AAA170), \u003cem\u003eluxR\u003c/em\u003e_gen1 (AAA203) and \u003cem\u003eluxR\u003c/em\u003e_N86K (AAA171) into this strain. In the presence of the ligand, indeed a 2 to 3-fold reduction of yeGFP expression was observed (Figure 5B). Moreover, synergistic effect of the gen1-mutations, as well as the effect of N86K alone increased sensitivity towards C8-HSL in this new context. We tried to further improve the dynamic range by increasing the operator binding sites from 1 to 2, which enhanced LuxR-dependent repression in studies performed in \u003cem\u003eE. coli\u003c/em\u003e \u003csup\u003e44\u003c/sup\u003e, but did not further increase the dynamic range in yeast (Figure S10). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQS-controlled repression of \u003cem\u003eFAS1\u003c/em\u003e improves aloesone production\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQS-controlled regulation can be very powerful to autonomously divert metabolic fluxes towards a specific pathway, later in the production process. This can be beneficial in systems where biosynthesis and production compete for the same precursors. To illustrate this, we decided to regulate an anabolic production pathway using our established QS-tools. As a testbed, we decided on the production of aloesone, a bioactive compound known for its pharmaceutical properties \u003csup\u003e46\u003c/sup\u003e. This compound is produced from malonyl-CoA and acetyl-CoA by a polyketide synthase \u003csup\u003e47\u003c/sup\u003e. Malonyl-CoA and acetyl-CoA are also precursors required in the fatty acid synthesis (FAS) as well, which is therefore in direct competition with aloesone production (Figure 5C). Previous studies have established that regulation of \u003cem\u003eFAS1\u003c/em\u003e \u003csup\u003e48\u003c/sup\u003e can be targeted to improve malonyl-coA-derived products \u003csup\u003e49\u0026ndash;52\u003c/sup\u003e. Building on these strategies, we replaced p\u003cem\u003eFAS1\u003c/em\u003e with p\u003cem\u003eTEF1\u003c/em\u003e_\u003cem\u003eluxO\u003c/em\u003e, to allow for QS-controlled \u003cem\u003eFAS1\u003c/em\u003e gene expression. We further introduced \u003cem\u003eAa\u003c/em\u003e.\u003cem\u003ePKS3\u0026nbsp;\u003c/em\u003efrom \u003cem\u003eAloe vera\u003c/em\u003e (strain AAA135; PKS3), QS-sender module (strain AAA206; PKS3, CepI (++)), QS-sensor module (strain AAA200; PKS3, LuxR-gen1) and finally the complete QS-circuit (strain AAA202; PKS3, LuxR-gen1, CepI (++)). Strains were tested in Biolector plates in glucose fedbatch mode, with exponential feeding and pH controlled to stay above 5.6. Endpoint measurements were performed to obtain the relative estimated abundance of aloesone (Figure S11) and C8-HSL in each of the strains. Production of signalling molecule C8-HSL did not change the production of aloesone, indicating that the metabolic burden from production of the autoinducer is neglectable (Figure 5D; PKS3+ CepI (++)). Introduction of only \u003cem\u003eluxR\u003c/em\u003e-gen1 marginally increased production in strain (Figure 5D; PKS3 + LuxR-gen1), likely by lowering the basal expression of \u003cem\u003eFAS1\u003c/em\u003e. Introduction of the full QS-circuit significantly increased production of aloesone by 51% reaching 24.4 \u0026plusmn; 1.7 nM, likely by enhancing the supply of malonyl-CoA for aloesone production (Figure 5D; PKS3 + LuxR-gen1 + CepI (++)).\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe AHL-based QS-system is a widely studied mechanism of cell-cell communication in Gram-negative bacteria \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e and this study represents the first successful engineering of an AHL-based QS-system in yeast. A major challenge in implementing such a system in yeast is the functional expression of an AHL synthase. Most LuxI-family AHL synthases utilize acyl-ACPs as acyl donors, and acyl-CoA to a much lesser extent \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. However, unlike many prokaryotes, yeast does not have freely available acyl-ACP, as it exists only as part of the multifunctional fatty acid synthase type 1 (FAS I) complex \u003csup\u003e\u003cspan additionalcitationids=\"CR55\" citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. We hypothesize that this difference prevents direct donation of an acyl-group to LuxI-type enzymes, potentially limiting their activity in yeast. However, exceptions have been reported of synthases that are more efficient in utilizing an acyl-CoA as the acyl-group donor \u003csup\u003e\u003cspan additionalcitationids=\"CR58 CR59 CR60\" citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u003c/sup\u003e. Based on the functionality of CepI in yeast, we therefore suggest that CepI has evolved to be more receptive towards acyl-CoA than other LuxI-members.\u003c/p\u003e \u003cp\u003eA second challenge was posed by the low concentration of C8-HSL, requiring a highly sensitive detection system. From the Alphafold3 \u003csup\u003e42\u003c/sup\u003e structures of all 3 mutants compared to wildtype (WT) no change was seen in the ligand binding mode of C8-HSL after docking (Figure S12). However, for gen 2 (K120N, N86K, K104E, M135V) we found that M135 and K104 are in the loop in front of the entrance of the tunnel (Figure S13). Possibly, these mutations could have an effect on ligand binding, especially for 3-oxo-AHLs. In line with this observation, while gen2 displays the highest sensitivity for all tested straight-chain AHLs, gen1 and 3 are more sensitive for the tested 3-oxo-AHLs. Further experimental work and molecular dynamics simulations would be needed in the future to fully deconvolute the individual role of each mutation identified, and any mechanistic effects associated.\u003c/p\u003e \u003cp\u003eThe implementation of an AHL-based quorum sensing system establishes a truly orthogonal QS system in yeast. Such a system enables cell density-dependent regulatory control, as demonstrated by its application in aloesone production. Additionally, it can facilitate synthetic microbial consortia by coordinating interactions between different yeast strains, allowing for division of labor in metabolic processes. This key application could be extended to cross-species communication as well, enabling engineered yeast to interact with bacteria in co-cultures for improved bioproduction or cooperative behaviors. The application of AHL-based QS-circuits could be envisioned in interspecies co-cultures to, for example, help optimize microbial production of plant secondary metabolites \u003csup\u003e\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u003c/sup\u003e. Precursors derived from aromatic amino acids, phenylanaline and tyrosine, are efficiently synthesized in prokaryotes \u003csup\u003e\u003cspan additionalcitationids=\"CR64\" citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u003c/sup\u003e. On the other hand, P450 enzymes, catalyzing the crucial steps in the synthesis of bioactive compounds, are poorly expressed in hosts like \u003cem\u003eE. coli\u003c/em\u003e but highly functional in yeast \u003csup\u003e\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e,\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e\u003c/sup\u003e. With such cross-species corporation, challenges related to differences in growth rate, as well as required precursors that compete with biosynthesis, could be addressed by applying AHL-based QS regulatory circuits. This could prove instrumental in developing bioprocesses.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStrains and growth media\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e strains used in this study are listed in table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e and are derived from the CEN.PK-lineage \u003csup\u003e\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u003c/sup\u003e. CEN.PK110-10C (MAT-a URA3 LEU2 TRP1 his3) was used to construct all strains for the screening work (using \u003cem\u003eamdS\u003c/em\u003e), while all other strains were derived from CEN.PK2-1C (MAT-a ura3 his3 leu2 trp1). The yeast strains were routinely cultivated at 30\u0026deg;C in synthetic complete medium (SC) (6.7 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e yeast nitrogen base without amino acids, 1.62 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e yeast synthetic drop-out medium supplement without leucine, 0.2 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e leucine, 20 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e glucose, pH set to 5.6 with 2M KOH). Selection was performed in synthetic complete medium lacking histidine (SC -HIS) or lacking both histidine and uracil (SC -HIS -URA) (6.7 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e yeast nitrogen base without amino acids, 1.92 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e yeast synthetic drop-out medium supplement without histidine or 1.39 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil supplemented with 0.2 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e leucine and 0.07 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e tryptophan, 20 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e glucose, pH set to 5.6 with 2M KOH, 2% (w/v) agar in case of plates). Selective cultivation using 100 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e nourseothricin (clonNAT, Werner BioAgents) was done using synthetic media containing monosodium glutamate (SMG) (1.7 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e yeast nitrogen base without amino acids and ammonium sulfate, 1 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e monosodium glutamate, 1.92 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e yeast synthetic drop-out medium supplement without histidine or 1.39 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil supplemented with 0.2 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e leucine and 0.07 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e tryptophan, 20 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e glucose, pH set to 5.6 with 2M KOH, 2% (w/v) agar in case of plates). Synthetic minimal medium (3.0 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 0.5 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e MgSO\u003csub\u003e4\u003c/sub\u003e\u0026middot;7H\u003csub\u003e2\u003c/sub\u003eO, 5.0 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, trace elements and vitamins was prepared as described previously (ref), supplemented with 20 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e glucose (SMD) was used for screening the libraries. Fluoroacetamide (final concentration of 20 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) was added to SMD for the OFF-selection, while (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e was replaced by 6.6 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e K\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e and 0.6 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e filter-sterilized acetamide for the ON-selection. Extra-buffered fed-batch medium contained 5.0 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 0.5 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e MgSO\u003csub\u003e4\u003c/sub\u003e\u0026middot;7H\u003csub\u003e2\u003c/sub\u003eO, 14.4 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, 1 ml L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e trace elements, 1 ml L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e vitamins, 0.125 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e histidine, 0.5 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e leucine, 0.075 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e tryptophan, 0.15 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e uracil, 20 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e glucose and 40 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e EnPump 200 substrate (Enpresso, Berlin, Germany). Where mentioned, methionine was added to a final concentration of 1 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. Fed-batch was started with 8 mL L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e of enzyme mix. Feed medium for Biolector fed-batch cultivations contained 18 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 3 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e MgSO\u003csub\u003e4\u003c/sub\u003e\u0026middot;7H\u003csub\u003e2\u003c/sub\u003eO, 45 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, 12 ml L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e trace elements, 6 ml L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e vitamins, 1.0 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e histidine, 5.0 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e leucine, 0.8 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e tryptophan, 1.5 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e uracil, 160 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e glucose. Start medium was prepared by diluting feed medium 4 times in sterile Milli-Q.\u003c/p\u003e \u003cp\u003eFor cloning and plasmid propagation, \u003cem\u003eEscherichia coli\u003c/em\u003e strain DH5 was used, in Luria-Bertani (LB) medium containing 100 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e ampicillin or 25 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e chloramphenicol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eChemicals\u003c/h2\u003e \u003cp\u003eFluoroacetamide (Sigma-Aldrich, 128341-5G) was dissolved in dH\u003csub\u003e2\u003c/sub\u003eO to a final concentration of 200 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and stored at 4\u0026deg;C. Acylated homoserine-lactones C4-HSL (SML3427-10MG), C6-HSL (56395-10MG), C8-HSL (44558-10MG), C10-HSL (07028-10MG), 3-oxo-C6-HSL (K3007-10MG and K3255-25MG), 3-oxo-C8-HSL (O1764-10MG) and 3-oxo-C12-HSL (O9139-10MG) were purchased from Sigma-Aldrich and dissolved in 100% DMSO to a final concentration of 10 mM, aliquoted and stored at -20\u0026deg;C. Final working concentrations in cultivations were 100 \u0026micro;M and lower, resulting in DMSO concentrations of below 1%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003ePlasmid construction\u003c/h2\u003e \u003cp\u003eThe plasmids used in this study are listed in table S3 and relevant primers for plasmid construction in table S2. The coding sequences of luxR, esaI, luxI and lasI were obtained from Addgene (Plasmids #165971, #47660, #73445, #73444) as well as the core promoter with 5 operator sequences p\u003cem\u003eGAL1\u003c/em\u003e_5x\u003cem\u003eluxO\u003c/em\u003e (plasmid #165977). Codon-optimized versions of cepI, esaI, luxI and lasI as well as p\u003cem\u003eTEF1\u003c/em\u003e_\u003cem\u003eluxO\u003c/em\u003e_105 were synthesized by GeneArt Thermo Scientific (sequences are shown in Table S5). Plasmid construction for integration fragments was performed by USER-cloning, using fragment-specific primers listed (Table S2) and Phusion U High-Fidelity DNA Polymerase (New England Biolabs) according to manufacturer's instructions, to obtain overhangs suitable for USER-cloning. To obtain the p\u003cem\u003eTEF1\u003c/em\u003e_2x\u003cem\u003eluxO\u003c/em\u003e fragment with USER-overhangs, pAvA098 was amplified with AA34/AA201 and AA202/AA35. For construction of single ORF cassettes, the backbone was PCR-amplified with MAD3/MAD4 \u003csup\u003e68\u003c/sup\u003e. For construction of plasmids with two ORFs, the backbone was linearized using SfaAI FD and BsmI FD (Thermo Scientific) \u003csup\u003e\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u003c/sup\u003e. Linearized backbone, promoter(s), ORF(s), terminator(s) and where indicated activation domain, were added in equimolar amounts with cutsmart buffer and USER-enzyme and handled according to supplier\u0026rsquo;s protocol. 2 \u0026micro;L of this mixture was used in the subsequent transformation with \u003cem\u003eE. coli\u003c/em\u003e and the whole mixture was plated on selective medium. Plasmid encoding p\u003cem\u003eFAS1\u003c/em\u003e gRNA was constructed following the steps as described previously\u003csup\u003e\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e\u003c/sup\u003e using the manually identified GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC as gRNA sequence.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eYeast strains construction\u003c/h2\u003e \u003cp\u003eYeast strains were constructed using CRISPR-Cas9-mediated genome editing. A plasmid carrying Cas9, using HIS3 as selection marker, was introduced into CEN.PK110-10C and CEN.PK2-1C and were stocked as ACA001 and AAA001 respectively and were used for all subsequent yeast transformations. In general, for each transformation one or two gRNA-plasmids were introduced alongside NotI-digested plasmids containing the integration cassette according to EasyClone protolcol \u003csup\u003e\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u003c/sup\u003e and as described in table S4. Exceptions include the introduction of p\u003cem\u003ePGK1\u003c/em\u003e-\u003cem\u003eGAL4\u003c/em\u003e_AD-\u003cem\u003eluxR\u003c/em\u003e_N86K-t\u003cem\u003eADH1\u003c/em\u003e and p\u003cem\u003ePGK1\u003c/em\u003e-\u003cem\u003eluxR\u003c/em\u003e_N86K-t\u003cem\u003eADH1\u003c/em\u003e, which were introduced as two linear PCR-amplified fragments introducing the N85K mutation, and assembled using homologous recombination into the yeast genome. Fragments were obtained by PCR using pAvA103 and pAvA027 as template and AA76/AA153 and AA80/AA154 as primers (table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Moreover, replacement of p\u003cem\u003eFAS1\u003c/em\u003e with p\u003cem\u003eTEF1\u003c/em\u003e-\u003cem\u003eluxO\u003c/em\u003e_105 was performed by transforming yeast with pAvA125 and one linear PCR-amplified fragment of p\u003cem\u003eTEF1\u003c/em\u003e_\u003cem\u003eluxO\u003c/em\u003e-105 with 60 bp homology flanks to the up and downstream sequences of p\u003cem\u003eFAS1\u003c/em\u003e. Linear fragment was made by PCR using pAvA109 as template and AA164/AA167 as primers. Transformants were obtained using heat-shock transformation protocol based on the Gietz and Schiest \u003csup\u003e\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e,\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e\u003c/sup\u003e. Transformations were plated on SMG -HIS\u0026thinsp;+\u0026thinsp;NAT, SC -HIS -URA or SMG -HIS -URA\u0026thinsp;+\u0026thinsp;NAT depending on the selection markers used. Colonies were restreaked at least once on selective medium. Correct integration was determined by colony PCR using RedTaq MM. After confirmation of correct integration, plasmids were removed from the yeast by growing on non-selective medium overnight and plating dilutions on YPD to obtain single colonies. Verification of removal of each plasmid was performed by transferring all colonies to filter paper (Whatman, grade 1 round filter paper, 150 mm) and subsequently stamping these colonies on new plates on YPD and on each individual selection (ie. SC-HIS, SC-URA, SC\u0026thinsp;+\u0026thinsp;NAT). For subsequent transformation rounds, strains still containing the Cas9-plasmid were stocked in addition to the plasmid-free constructed yeast strain.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eLibrary generation\u003c/h2\u003e \u003cp\u003eError-prone PCR (epPCR) was carried out using the Agilent GeneMorph mutagenesis II kit, with 750 ng as template DNA, aiming for 0-4.5 mutations/kb, according to manufacturer\u0026rsquo;s instructions. One round of error-prone PCR was carried out using primers AA73/AA77 and pAvA103 as template, followed by a regular PCR with primers AA74/AA78 with the PCR product as template, to amplify the library and to obtain a homology flank on each side of the mutated fragment of 120 bp. Homology arms for integration in X-4, including the promoter sequence or the terminator sequence were amplified using AA757/AA76 and AA79/AA80 respectively, with pAvA103 as template. Yeast libraries were obtained using a heat-shock transformation protocol based on the Gietz and Schiest \u003csup\u003e\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e,\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e\u003c/sup\u003e, with the following adaptations: 25 mL of exponentially growing yeast cells (OD\u003csub\u003e600\u003c/sub\u003e of 2.0) were harvested and used in one transformation. Cells were washed in 0.1 M LiAc prior to addition of the transformation mixture. For the DNA mixture, equimolar amounts of the three linear fragments were used, adding 800 ng of the largest fragment and 1 \u0026micro;g of the gRNA plasmid per transformation. After resuspending the cells in the transformation mixture, the cells were incubated for 15 minutes at 30\u0026deg;C, prior to 30-minute heat-shock at 42\u0026deg;C. The total biomass of 16 transformations (corresponding to 400 mL yeast culture of OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;2) were pooled together after the recovery step and added to 48 mL of SMG -HIS\u0026thinsp;+\u0026thinsp;clonNAT as one library. By plating for single colonies on SMG -HIS\u0026thinsp;+\u0026thinsp;clonNAT right after the transformation, it was determined that the library contained 2.7 * 10\u003csup\u003e6\u003c/sup\u003e possible variants. Multiple aliquots of the library were stocked after 2\u0026ndash;3 days, when single colonies appeared on the SMG -HIS\u0026thinsp;+\u0026thinsp;clonNAT plates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eGrowth-based OFF and ON selection\u003c/h2\u003e \u003cp\u003eAfter transformation, the yeast library was grown for 2\u0026ndash;3 days on SMG -HIS\u0026thinsp;+\u0026thinsp;clonNAT. 1 mL of this culture (or from a cryostock vial) was transferred to fresh 50 mL SMG -HIS\u0026thinsp;+\u0026thinsp;NAT and grown for another 24 hours. This culture was diluted 1:50 in 5 mL SMD F-Ac medium and grown for 24 hours (OFF-selection) in 50 mL CELLSTAR\u0026reg; CELLREACTOR tubes (Greiner Bio-One). Then, the culture was transferred (1:50) to 5 mL SMD -N\u0026thinsp;+\u0026thinsp;acetamide\u0026thinsp;+\u0026thinsp;ligand and grown for 24 hours or till growth was observed (ON-selection), and this step was repeated at least one more time. Each subsequent culture was stocked, analysed by flow cytometer and where indicated plated for single colonies on YPD or YPD\u0026thinsp;+\u0026thinsp;ligand. Mutant genotypes were determined by sanger sequencing of \u003cem\u003eGAL4\u003c/em\u003e_AD-NLS-\u003cem\u003eluxR\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eFACS-based selection\u003c/h2\u003e \u003cp\u003eAfter sequential transfers on counter-selective and selective medium as described above, \u003cem\u003eS. cerevisiae\u003c/em\u003e cells containing the \u003cem\u003eGAL4\u003c/em\u003e_AD-NLS-\u003cem\u003eluxR\u003c/em\u003e library were grown in 1 mL of SC\u0026thinsp;+\u0026thinsp;50 nM C8-HSL for 6 hours. The cells were analysed on Sony fluorescence-assisted cell sorting (FACS) instrument with blue laser (488 nm) to detect yeGFP fluorescence. 10.000 events were recorded and used to gate the 7% most fluorescent population. Cells were sorted in FITC-A versus FSC-A and collected in 5 mL SC. After recovery overnight, the cells were stored at -70\u0026deg;C in aliquots by adding 25% (v/v) glycerol and plated for single colonies on YPD.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry\u003c/h2\u003e \u003cp\u003eA 1 mL aliquot of glycerol \u0026minus;\u0026thinsp;70\u0026deg;C freezer stock was used to inoculate 50 mL of SC medium or a single colony from the screened library was inoculated into 200 \u0026micro;L of SC medium and grown for 16 hours. For analysis of ligand-dependent activation, the culture was diluted 1:20 in 200 \u0026micro;L SC medium\u0026thinsp;\u0026plusmn;\u0026thinsp;inducer in 96-deep-well culture plates and grown for 6 hours at 30\u0026deg;C. For analysis of ligand-dependent repression, the culture was diluted 1:50 and grown for 24 hours prior to being diluted 1:20 in 200 \u0026micro;L SC medium\u0026thinsp;\u0026plusmn;\u0026thinsp;inducer in 96-deep-well culture plates and grown for 6 hours. Cells were washed and diluted 1:4 in PBS prior to analysis by flow cytometer. Flow cytometry analysis was performed on the NovoCyte Quanteon\u0026trade; (Agilent). 20.000 events were recorded for each well, with a threshold for event detection at \u0026gt;\u0026thinsp;150,000 FSC-H and a core diameter of 10.1 \u0026micro;m. For yeGFP, excitation was performed with a blue laser (488 nm) and emission detection with a 530/30 nm BP filter (471 V). Subsequent analysis was performed using FlowJo licensed software. FSC-A was plotted against FSC-H to gate for singlets events. Gated events were used to determine the median fluorescence of the population.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eFluorescence plate reader cultivation\u003c/h2\u003e \u003cp\u003eGrowth and fluorescence were analused using a BioTek Synergy H1 microplate reader. Inocula were prepared as follows: 1 mL aliquot of glycerol \u0026minus;\u0026thinsp;70\u0026deg;C freezer stock was grown for 16 hours in 50 mL of SC medium (pH 5.6) in baffled 250 mL shake flasks and transferred to 5 mL fresh SC-medium in 50 mL CELLSTAR\u0026reg; CELLREACTOR tubes (Greiner Bio-One) and exponentially growing cells (OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;5\u0026ndash;6) were used to inoculate the plate at a starting OD\u003csub\u003e660\u003c/sub\u003e of 0.25\u0026ndash;0.3. Black clear-bottom 96-well plates (Greiner Bio-one, catalog nr. 655090) were used, with a total volume of 150 \u0026micro;L per well. OD\u003csub\u003e660\u003c/sub\u003e and yeGFP fluorescence (588/633, gain 80) were recorded every 20 minutes and temperature was set to 30\u0026deg;C with double orbital continuous shaking.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eStructural mapping of mutations\u003c/h2\u003e \u003cp\u003eThe structures of LuxR and Gal4_AD-NLS-LuxR dimerized and bound to C8-HSL and DNA binding sites were generated using Boltz1. Figures indicating the mutated residues were created using PyMol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eStatistical and data analysis\u003c/h2\u003e \u003cp\u003eAnalysis of flow cytometric data was performed using FlowJo licensed software. FSC-A was plotted against FSC-H to gate for singlets events. Gated events were used to determine the median fluorescence of the population. Graphs were plotted and statistical analysis were performed using GraphPad Prism V10.4.0 (GraphPad software). Significance of aloesone production (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) was analysed by one-way ANOVA, with strain type as independent variable. Post hoc analysis was performed using Tukey\u0026rsquo;s HSD test to evaluate pairwise comparisons between strains. Comparison of the different QS-circuits (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) was performed by averaging the fluorescence/OD over the first 2\u0026ndash;4 hour time window, to establish a baseline. Subsequent fluorescence/OD measurements were then normalized to this baseline average. A circuit was considered induced when four consecutive measurements showed at least a 1.8-fold increase relative to the baseline. The threshold of 1.8-fold was chosen because it represents the maximum average fold-change observed in the least active circuit (N86K).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eAHL and aloesone analysis by LC-MS/MS\u003c/h2\u003e \u003cdiv id=\"Sec22\" class=\"Section3\"\u003e \u003ch2\u003eBy TripleQuad LC-MS/MS\u003c/h2\u003e \u003cp\u003eDetection and quantification of acylated homoserine lactones and aloesone was determined from yeast supernatant samples. Samples for AHL quantification were undiluted and samples for aloesone determination were 25-fold diluted with deionized water and subjected to analysis by liquid chromatography coupled to tandem mass spectrometry. Briefly, chromatography was performed on a 1290 Infinity II UHPLC system (Agilent Technologies, Germany). Separation was achieved on a Zorbax Eclipse-Plus C18 column (50 x 3.0, 1.8 \u0026micro;m, Agilent Technologies). Formic acid (0.05%, v/v) in water and acetonitrile (supplied with 0.05% formic acid, v/v) were employed as mobile phases A and B respectively. The elution profile for detection of AHLs and aloesone was: 0-0.3 min, 10% B; 0.3-4.0 min, 10\u0026ndash;98% B; 4.0\u0026ndash;5.0 min 98% B; 5.0-5.10 min, 98\u0026thinsp;\u0026minus;\u0026thinsp;10% B and 5.1-6.0 min 10% B. The mobile phase flow rate was 400 \u0026micro;L min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. The column temperature was maintained at 40\u0026deg;C. The liquid chromatography was coupled to an Ultivo Triplequadrupole mass spectrometer (Agilent Technologies) equipped with a Jetstream electrospray ion source (ESI) operated in positive ion mode. The instrument parameters were optimized by infusion experiments with pure standards. The ion spray voltage was set to 3000 V. Dry gas temperature was set to 325\u0026deg;C and dry gas flow to 10 L min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. Sheath gas temperature was set to 400\u0026deg;C and sheath gas flow to 12 L min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. Nebulizing gas was set to 45 psi. Nitrogen was used as dry gas, nebulizing gas and collision gas. Multiple reaction monitoring (MRM) was used to monitor precursor ion \u0026rarr; fragment ion transitions. MRM transitions were determined by direct infusion experiments of reference standards. Detailed values for mass transitions can be found in supplemental Table S6. Both Q1 and Q3 quadrupoles were maintained at unit resolution. Mass Hunter Quantitation Analysis for QQQ software (Version 10, Agilent Technologies) was used for data processing. Linearity in ionization efficiency was verified by analyzing dilution series that were also used for quantification of AHLs in the samples.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eBy Quadrupole-time-of-fligt (Q-TOF) LC-MS/MS\u003c/h2\u003e \u003cp\u003eSamples for Q-TOF analysis were prepared similarly to the TripleQuad using the same 25-fold dilution in deionized water. The chromatographic separation was done on a 1290 Infinity II UHPLC system (Agilent Technologies) equipped with Zorbax Eclipse XDB-C18 column (100 x 3.0 mm, 1.8\u0026micro;m, Agilent Technologies). Formic acid (0.05%, v/v) in water was used as mobile phase A and acetonitrile (supplied with 0.05% formic acid, v/v) as mobile phase B. The 15 min gradient was as follows: 0.0\u0026ndash;2.0 min, 3% B; 2.0\u0026ndash;11.0 min, 3\u0026ndash;75% B; 11.0-12.5min 75\u0026ndash;100% B, 12.5\u0026ndash;13.5 min 100% B, 13.5\u0026ndash;13.6 min 100-3% B and 13.6\u0026ndash;15.0 3% B. The mobile phase flow rate was 400 \u0026micro;l/min. The column temperature was maintained at 30\u0026deg;C. The liquid chromatography was coupled to a Bruker timsToF Pro mass spectrometer (Bruker, Bremen, Germany) equipped with an electrospray ion source (ESI) operated in positive. The ion spray voltage was maintained at +\u0026thinsp;4200 V, dry temperature was set to 200\u0026deg;C, and the dry gas flow was set to 8 L/min. Nitrogen was used as the dry gas, nebulizing gas, and collision gas. The nebulizing gas was set to 2.5 bar and collision energy to 10 eV. MS spectra were acquired in an \u003cem\u003em/z\u003c/em\u003e range from 50 to 1500 amu and MS/MS spectra in a range from 50-1500 amu. Sampling rate was 5 Hz in both ion modes. Na-formate clusters were used for mass calibration. All files were calibrated by postprocessing\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eShakeflask cultivation\u003c/h2\u003e \u003cp\u003eAerobic shakeflasks cultivation were performed in baffled 250 mL shake flasks, with a working volume of 50 mL. 1 mL aliquot of glycerol \u0026minus;\u0026thinsp;70\u0026deg;C freezer stock was used to inoculate 50 mL of SC medium (pH 5.6) in baffled 250 mL shake flasks. After 16 hours of growths, this culture was used to prepare the preculture in 50 mL fresh SC-medium. Exponentially growing cells (OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;5\u0026ndash;6) were used to inoculate shakeflasks at a starting OD\u003csub\u003e660\u003c/sub\u003e of 0.3\u0026ndash;0.4. OD\u003csub\u003e600\u003c/sub\u003e measurements were performed by sampling from the shakeflasks and measuring on DS-C Cuvette Spectrophotometer (DeNovix).\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eBioLector cultivation\u003c/h2\u003e \u003cp\u003epH-controlled fed-batch cultivation was performed in Microfluidic FlowerPlates (m2plabs, Beckman Coulter Life Sciences; Lot nr. 2309221) in the BioLector Pro II system (Beckman Coulter Life Sciences). An exponential feed profile was used of 0.48 \u0026micro;L h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e * e\u003csup\u003e0.0125 * t\u003c/sup\u003e, triggered after 16\u0026ndash;20 hours. 2 M KOH was used to ensure the pH would not drop below 5.6. The temperature was set to 30\u0026deg;C and shaking to 1000 rpm. The relative humidity in the growth chamber was maintained at 85% using distilled water to minimize evaporation of the media. Measurements of biomass and pH were performed every 4 minutes. A starting volume of 800 \u0026micro;L start medium was added in each well and 1800 \u0026micro;L in each well designated for feed and base control. Calibration values corresponding to the Lot nr. were used for pH. Pre-cultures were prepared by inoculating 1 mL aliquot of glycerol \u0026minus;\u0026thinsp;70\u0026deg;C freezer stock in 50 mL of SC medium (pH 5.6) in baffled 250 mL shake flasks and cells were grown for 16 hours before being diluted in 5 mL fresh SC-medium in 50 mL CELLSTAR\u0026reg; CELLREACTOR tubes (Greiner Bio-One) and exponentially growing cells (OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;5\u0026ndash;6) were used to inoculate the plate at a starting OD\u003csub\u003e600\u003c/sub\u003e of 0.25\u0026ndash;0.3.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e \u003cp\u003e \u003cb\u003eAA\u003c/b\u003e: Conceptualization, Funding acquisition, Investigation, Visualization, Formal analysis, Methodology, Project administration, Writing \u0026ndash; original draft, Writing \u0026ndash; review \u0026amp; editing. \u003cb\u003eMH\u003c/b\u003e: Formal analysis, Visualization, Writing \u0026ndash; review \u0026amp; editing. \u003cb\u003eMLJ\u003c/b\u003e: Investigation. \u003cb\u003eTS\u003c/b\u003e: Investigation. \u003cb\u003eCC\u003c/b\u003e: Resources, Investigation \u003cb\u003eMP\u003c/b\u003e: Resources, Investigation. \u003cb\u003eCA-R\u003c/b\u003e: Resources. \u003cb\u003eEDJ\u003c/b\u003e: Resources, Writing \u0026ndash; review \u0026amp; editing. \u003cb\u003eMKJ\u003c/b\u003e: Supervision, Writing \u0026ndash; review \u0026amp; editing\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eThis study is part of the project \u003cem\u003eOrthogonal quorum-sensing systems in yeast cell factories\u003c/em\u003e with file number 019.231EN.007 of the Rubicon research programme which is financed by the Dutch research council (NWO) and awarded to AA. MH is funded by Novo Nordisk Foundation, grant number NNF22SA0078231 (Copenhagen Bioscience PhD Programme). This project has received funding from the Novo Nordisk Foundation, grant number NNF20CC0035580. We thank Robert Mans for fruitful discussions about the screening workflow. We thank Emma Hoch-Schneider for support during laboratory onboarding. We thank Arsenios Vlassis with technical support on the flow cytometer. We thank Divya Dharshini and Beata Lehka for technical support on the biolector. We thank Ditte Hededam Welner for kindly supplying us with aloesone standard.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eAll data shown in figures are available in the Source data provided with this paper. There are no restrictions on data availability.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKeasling, J. D. Manufacturing molecules through metabolic engineering. \u003cem\u003eScience (1979)\u003c/em\u003e \u003cstrong\u003e330\u003c/strong\u003e, 1355\u0026ndash;1358 (2010).\u003c/li\u003e\n\u003cli\u003eLee, J. W. \u003cem\u003eet al.\u003c/em\u003e Systems metabolic engineering of microorganisms for natural and non-natural chemicals. \u003cem\u003eNat Chem Biol\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 536\u0026ndash;546 (2012).\u003c/li\u003e\n\u003cli\u003eMans, R., Daran, J.-M. G. \u0026amp; Pronk, J. T. Under pressure: evolutionary engineering of yeast strains for improved performance in fuels and chemicals production. \u003cem\u003eCurr Opin Biotechnol\u003c/em\u003e \u003cstrong\u003e50\u003c/strong\u003e, 47\u0026ndash;56 (2018).\u003c/li\u003e\n\u003cli\u003eTan, S. Z. \u0026amp; Prather, K. L. J. Dynamic pathway regulation: recent advances and methods of construction. \u003cem\u003eCurr Opin Chem Biol\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 28\u0026ndash;35 (2017).\u003c/li\u003e\n\u003cli\u003eSkjoedt, M. L. \u003cem\u003eet al.\u003c/em\u003e Engineering prokaryotic transcriptional activators as metabolite biosensors in yeast. \u003cem\u003eNat Chem Biol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 951\u0026ndash;958 (2016).\u003c/li\u003e\n\u003cli\u003eGar\u0026iacute;, E., Piedrafita, L., Aldea, M. \u0026amp; Herrero, E. A set of vectors with a tetracycline‐regulatable promoter system for modulated gene expression in Saccharomyces cerevisiae. \u003cem\u003eYeast\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 837\u0026ndash;848 (1997).\u003c/li\u003e\n\u003cli\u003eLabbe, S. \u0026amp; Thiele, D. J. [8] Copper ion inducible and repressible promoter systems in yeast. in \u003cem\u003eMethods in enzymology\u003c/em\u003e vol. 306 145\u0026ndash;153 (Elsevier, 1999).\u003c/li\u003e\n\u003cli\u003eSievi, E., H\u0026auml;nninen, A., Salo, H., Kumar, V. \u0026amp; Makarow, M. Validation of the Hsp150 Polypeptide Carrier and HSP150 Promoter in Expression of Rat \u0026alpha;2, 3‐Sialyltransferase in Yeasts. \u003cem\u003eBiotechnol Prog\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 1368\u0026ndash;1371 (2003).\u003c/li\u003e\n\u003cli\u003eRojas, V. \u0026amp; Larrondo, L. F. Coupling cell communication and optogenetics: implementation of a light-inducible intercellular system in yeast. \u003cem\u003eACS Synth Biol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 71\u0026ndash;82 (2022).\u003c/li\u003e\n\u003cli\u003eShimizu-Sato, S., Huq, E., Tepperman, J. M. \u0026amp; Quail, P. H. A light-switchable gene promoter system. \u003cem\u003eNat Biotechnol\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 1041\u0026ndash;1044 (2002).\u003c/li\u003e\n\u003cli\u003eParschat, K., Schreiber, S., Wartenberg, D., Engels, B. \u0026amp; Jennewein, S. High-titer de novo biosynthesis of the predominant human milk oligosaccharide 2\u0026prime;-fucosyllactose from sucrose in Escherichia coli. \u003cem\u003eACS Synth Biol\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 2784\u0026ndash;2796 (2020).\u003c/li\u003e\n\u003cli\u003eBothfeld, W., Kapov, G. \u0026amp; Tyo, K. E. J. A glucose-sensing toggle switch for autonomous, high productivity genetic control. \u003cem\u003eACS Synth Biol\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 1296\u0026ndash;1304 (2017).\u003c/li\u003e\n\u003cli\u003eTekel, S. J. \u003cem\u003eet al.\u003c/em\u003e Engineered orthogonal quorum sensing systems for synthetic gene regulation in Escherichia coli. \u003cem\u003eFront Bioeng Biotechnol\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 80 (2019).\u003c/li\u003e\n\u003cli\u003eDavis, R. M., Muller, R. Y. \u0026amp; Haynes, K. A. Can the natural diversity of quorum-sensing advance synthetic biology? \u003cem\u003eFront Bioeng Biotechnol\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 30 (2015).\u003c/li\u003e\n\u003cli\u003eReading, N. C. \u0026amp; Sperandio, V. Quorum sensing: the many languages of bacteria. \u003cem\u003eFEMS Microbiol Lett\u003c/em\u003e \u003cstrong\u003e254\u003c/strong\u003e, 1\u0026ndash;11 (2006).\u003c/li\u003e\n\u003cli\u003eDong, S.-H. \u003cem\u003eet al.\u003c/em\u003e Molecular basis for the substrate specificity of quorum signal synthases. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e114\u003c/strong\u003e, 9092\u0026ndash;9097 (2017).\u003c/li\u003e\n\u003cli\u003eDavis, R. M., Muller, R. Y. \u0026amp; Haynes, K. A. Can the Natural Diversity of Quorum-Sensing Advance Synthetic Biology? \u003cem\u003eFront Bioeng Biotechnol\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, (2015).\u003c/li\u003e\n\u003cli\u003eParsek, M. R., Val, D. L., Hanzelka, B. L., Cronan, J. E. \u0026amp; Greenberg, E. P. Acyl homoserine-lactone quorum-sensing signal generation. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e96\u003c/strong\u003e, 4360\u0026ndash;4365 (1999).\u003c/li\u003e\n\u003cli\u003eNealson, K. H., Platt, T. \u0026amp; Hastings, J. W. Cellular control of the synthesis and activity of the bacterial luminescent system. \u003cem\u003eJ Bacteriol\u003c/em\u003e \u003cstrong\u003e104\u003c/strong\u003e, 313\u0026ndash;322 (1970).\u003c/li\u003e\n\u003cli\u003eR, de K. T. \u0026amp; H, I. B. Bacterial Quorum Sensing in Pathogenic Relationships. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e68\u003c/strong\u003e, 4839\u0026ndash;4849 (2000).\u003c/li\u003e\n\u003cli\u003eDavies, D. G. \u003cem\u003eet al.\u003c/em\u003e The Involvement of Cell-to-Cell Signals in the Development of a Bacterial Biofilm. \u003cem\u003eScience (1979)\u003c/em\u003e \u003cstrong\u003e280\u003c/strong\u003e, 295\u0026ndash;298 (1998).\u003c/li\u003e\n\u003cli\u003eScott, S. R. \u0026amp; Hasty, J. Quorum sensing communication modules for microbial consortia. \u003cem\u003eACS Synth Biol\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 969\u0026ndash;977 (2016).\u003c/li\u003e\n\u003cli\u003eJiang, W. \u003cem\u003eet al.\u003c/em\u003e Two completely orthogonal quorum sensing systems with self-produced autoinducers enable automatic delayed cascade control. \u003cem\u003eACS Synth Biol\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 2588\u0026ndash;2599 (2020).\u003c/li\u003e\n\u003cli\u003eGrant, P. K. \u003cem\u003eet al.\u003c/em\u003e Orthogonal intercellular signaling for programmed spatial behavior. \u003cem\u003eMol Syst Biol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 849 (2016).\u003c/li\u003e\n\u003cli\u003eChen, M.-T. \u0026amp; Weiss, R. Artificial cell-cell communication in yeast Saccharomyces cerevisiae using signaling elements from Arabidopsis thaliana. \u003cem\u003eNat Biotechnol\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 1551\u0026ndash;1555 (2005).\u003c/li\u003e\n\u003cli\u003eYang, X. \u003cem\u003eet al.\u003c/em\u003e Quorum sensing-mediated protein degradation for dynamic metabolic pathway control in Saccharomyces cerevisiae. \u003cem\u003eMetab Eng\u003c/em\u003e \u003cstrong\u003e64\u003c/strong\u003e, 85\u0026ndash;94 (2021).\u003c/li\u003e\n\u003cli\u003eXu, M. \u003cem\u003eet al.\u003c/em\u003e Engineering pheromone-mediated quorum sensing with enhanced response output increases fucosyllactose production in Saccharomyces cerevisiae. \u003cem\u003eACS Synth Biol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 238\u0026ndash;248 (2022).\u003c/li\u003e\n\u003cli\u003eWilliams, T. C., Nielsen, L. K. \u0026amp; Vickers, C. E. Engineered quorum sensing using pheromone-mediated cell-to-cell communication in Saccharomyces cerevisiae. \u003cem\u003eACS Synth Biol\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 136\u0026ndash;149 (2013).\u003c/li\u003e\n\u003cli\u003eShong, J. \u0026amp; Collins, C. H. Engineering the esaR Promoter for Tunable Quorum Sensing-Dependent Gene Expression. \u003cem\u003eACS Synth Biol\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 568\u0026ndash;575 (2013).\u003c/li\u003e\n\u003cli\u003eChen, H., Wang, Z., Wang, Z., Dou, J. \u0026amp; Zhou, C. Improving methionine and ATP availability by MET6 and SAM2 co-expression combined with sodium citrate feeding enhanced SAM accumulation in Saccharomyces cerevisiae. \u003cem\u003eWorld J Microbiol Biotechnol\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e, 56 (2016).\u003c/li\u003e\n\u003cli\u003eTominaga, M., Nozaki, K., Umeno, D., Ishii, J. \u0026amp; Kondo, A. Robust and flexible platform for directed evolution of yeast genetic switches. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 1846 (2021).\u003c/li\u003e\n\u003cli\u003eSnoek, T. \u003cem\u003eet al.\u003c/em\u003e Evolution-guided engineering of small-molecule biosensors. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, e3\u0026ndash;e3 (2020).\u003c/li\u003e\n\u003cli\u003eSolis-Escalante, D. \u003cem\u003eet al.\u003c/em\u003e amdSYM, a new dominant recyclable marker cassette for Saccharomyces cerevisiae. \u003cem\u003eFEMS Yeast Res\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 126\u0026ndash;139 (2013).\u003c/li\u003e\n\u003cli\u003evan Aalst, A. C. A., Geraats, E. H., Jansen, M. L. A., Mans, R. \u0026amp; Pronk, J. T. Optimizing the balance between heterologous acetate-and CO2-reduction pathways in anaerobic cultures of Saccharomyces cerevisiae strains engineered for low-glycerol production. \u003cem\u003eFEMS Yeast Res\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, foad048 (2023).\u003c/li\u003e\n\u003cli\u003eWang, Y. \u003cem\u003eet al.\u003c/em\u003e Expression of antibody fragments in Saccharomyces cerevisiae strains evolved for enhanced protein secretion. \u003cem\u003eMicrob Cell Fact\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 134 (2021).\u003c/li\u003e\n\u003cli\u003eDuperray, M., Delvenne, M., Fran\u0026ccedil;ois, J. M., Delvigne, F. \u0026amp; Capp, J.-P. Genomic and metabolic instability during long-term fermentation of an industrial Saccharomyces cerevisiae strain engineered for C5 sugar utilization. \u003cem\u003eFront Bioeng Biotechnol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 1357671 (2024).\u003c/li\u003e\n\u003cli\u003eKaraca, H. \u003cem\u003eet al.\u003c/em\u003e Metabolic engineering of Saccharomyces cerevisiae for enhanced taxadiene production. \u003cem\u003eMicrob Cell Fact\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 241 (2024).\u003c/li\u003e\n\u003cli\u003eMeinander, N. Q. \u0026amp; Hahn‐H\u0026auml;gerdal, B. Fed‐batch xylitol production with two recombinant Saccharomyces cerevisiae strains expressing XYL1 at different levels, using glucose as a cosubstrate: a comparison of production parameters and strain stability. \u003cem\u003eBiotechnol Bioeng\u003c/em\u003e \u003cstrong\u003e54\u003c/strong\u003e, 391\u0026ndash;399 (1997).\u003c/li\u003e\n\u003cli\u003eHu, K. K. Y., Suri, A., Dumsday, G. \u0026amp; Haritos, V. S. Cross-feeding promotes heterogeneity within yeast cell populations. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 418 (2024).\u003c/li\u003e\n\u003cli\u003eQiu, C. \u003cem\u003eet al.\u003c/em\u003e Engineering transcription factor-based biosensors for repressive regulation through transcriptional deactivation design in Saccharomyces cerevisiae. \u003cem\u003eMicrob Cell Fact\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 1\u0026ndash;10 (2020).\u003c/li\u003e\n\u003cli\u003eKimura, Y., Tashiro, Y., Saito, K., Kawai-Noma, S. \u0026amp; Umeno, D. Directed evolution of Vibrio fischeri LuxR signal sensitivity. \u003cem\u003eJ Biosci Bioeng\u003c/em\u003e \u003cstrong\u003e122\u003c/strong\u003e, 533\u0026ndash;538 (2016).\u003c/li\u003e\n\u003cli\u003eAbramson, J. \u003cem\u003eet al.\u003c/em\u003e Accurate structure prediction of biomolecular interactions with AlphaFold 3. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e630\u003c/strong\u003e, 493\u0026ndash;500 (2024).\u003c/li\u003e\n\u003cli\u003eZhang, J. \u003cem\u003eet al.\u003c/em\u003e Binding site profiles and N-terminal minor groove interactions of the master quorum-sensing regulator LuxR enable flexible control of gene activation and repression. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 3274\u0026ndash;3293 (2021).\u003c/li\u003e\n\u003cli\u003eEgland, K. A. \u0026amp; Greenberg, E. P. Conversion of the Vibrio fischeriTranscriptional Activator, LuxR, to a Repressor. \u003cem\u003eJ Bacteriol\u003c/em\u003e \u003cstrong\u003e182\u003c/strong\u003e, 805\u0026ndash;811 (2000).\u003c/li\u003e\n\u003cli\u003eAmbri, F. \u003cem\u003eet al.\u003c/em\u003e High-resolution scanning of optimal biosensor reporter promoters in yeast. \u003cem\u003eACS Synth Biol\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 218\u0026ndash;226 (2020).\u003c/li\u003e\n\u003cli\u003eWang, Y. \u003cem\u003eet al.\u003c/em\u003e Multiple beneficial effects of aloesone from aloe vera on LPS-induced RAW264. 7 cells, including the inhibition of oxidative stress, inflammation, M1 polarization, and apoptosis. \u003cem\u003eMolecules\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 1617 (2023).\u003c/li\u003e\n\u003cli\u003ePutkaradze, N., Dato, L., Kırtel, O., Hansen, J. \u0026amp; Welner, D. H. Enzymatic glycosylation of aloesone performed by plant UDP-dependent glycosyltransferases. \u003cem\u003eGlycobiology\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, cwae050 (2024).\u003c/li\u003e\n\u003cli\u003eWenz, P., Schwank, S., Hoja, U. \u0026amp; Sch\u0026uuml;ller, H.-J. A downstream regulatory element located within the coding sequence mediates autoregulated expression of the yeast fatty acid synthase gene FAS2 by the FAS1 gene product. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 4625\u0026ndash;4632 (2001).\u003c/li\u003e\n\u003cli\u003eChen, X., Yang, X., Shen, Y., Hou, J. \u0026amp; Bao, X. Increasing Malonyl-CoA Derived Product through Controlling the Transcription Regulators of Phospholipid Synthesis in Saccharomyces cerevisiae. \u003cem\u003eACS Synth Biol\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 905\u0026ndash;912 (2017).\u003c/li\u003e\n\u003cli\u003eWen, J., Tian, L., Liu, Q., Zhang, Y. \u0026amp; Cai, M. Engineered dynamic distribution of malonyl-CoA flux for improving polyketide biosynthesis in Komagataella phaffii. \u003cem\u003eJ Biotechnol\u003c/em\u003e \u003cstrong\u003e320\u003c/strong\u003e, 80\u0026ndash;85 (2020).\u003c/li\u003e\n\u003cli\u003eYu, W., Cao, X., Gao, J. \u0026amp; Zhou, Y. J. Overproduction of 3-hydroxypropionate in a super yeast chassis. \u003cem\u003eBioresour Technol\u003c/em\u003e \u003cstrong\u003e361\u003c/strong\u003e, 127690 (2022).\u003c/li\u003e\n\u003cli\u003eDavid, F., Nielsen, J. \u0026amp; Siewers, V. Flux Control at the Malonyl-CoA Node through Hierarchical Dynamic Pathway Regulation in Saccharomyces cerevisiae. \u003cem\u003eACS Synth Biol\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 224\u0026ndash;233 (2016).\u003c/li\u003e\n\u003cli\u003eGould, T. A., Schweizer, H. P. \u0026amp; Churchill, M. E. A. Structure of the Pseudomonas aeruginosa acyl‐homoserinelactone synthase LasI. \u003cem\u003eMol Microbiol\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, 1135\u0026ndash;1146 (2004).\u003c/li\u003e\n\u003cli\u003eEckhart, S. \u0026amp; J\u0026ouml;rg, H. Microbial Type I Fatty Acid Synthases (FAS): Major Players in a Network of Cellular FAS Systems. \u003cem\u003eMicrobiology and Molecular Biology Reviews\u003c/em\u003e \u003cstrong\u003e68\u003c/strong\u003e, 501\u0026ndash;517 (2004).\u003c/li\u003e\n\u003cli\u003eRock, C. O. \u0026amp; Cronan, J. E. Escherichia coli as a model for the regulation of dissociable (type II) fatty acid biosynthesis. \u003cem\u003eBiochimica et Biophysica Acta (BBA) - Lipids and Lipid Metabolism\u003c/em\u003e \u003cstrong\u003e1302\u003c/strong\u003e, 1\u0026ndash;16 (1996).\u003c/li\u003e\n\u003cli\u003eLynen, F. \u003cem\u003eet al.\u003c/em\u003e On the structure of fatty acid synthetase of yeast. \u003cem\u003eEur J Biochem\u003c/em\u003e \u003cstrong\u003e112\u003c/strong\u003e, 431\u0026ndash;442 (1980).\u003c/li\u003e\n\u003cli\u003eChristensen, Q. H., Brecht, R. M., Dudekula, D., Greenberg, E. P. \u0026amp; Nagarajan, R. Evolution of acyl-substrate recognition by a family of acyl-homoserine lactone synthases. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, e112464 (2014).\u003c/li\u003e\n\u003cli\u003eLindemann, A. \u003cem\u003eet al.\u003c/em\u003e Isovaleryl-homoserine lactone, an unusual branched-chain quorum-sensing signal from the soybean symbiont Bradyrhizobium japonicum. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e108\u003c/strong\u003e, 16765\u0026ndash;16770 (2011).\u003c/li\u003e\n\u003cli\u003eAhlgren, N. A., Harwood, C. S., Schaefer, A. L., Giraud, E. \u0026amp; Greenberg, E. P. Aryl-homoserine lactone quorum sensing in stem-nodulating photosynthetic bradyrhizobia. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e108\u003c/strong\u003e, 7183\u0026ndash;7188 (2011).\u003c/li\u003e\n\u003cli\u003eSchaefer, A. L., Val, D. L., Hanzelka, B. L., Cronan Jr, J. E. \u0026amp; Greenberg, E. P. Generation of cell-to-cell signals in quorum sensing: acyl homoserine lactone synthase activity of a purified Vibrio fischeri LuxI protein. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e93\u003c/strong\u003e, 9505\u0026ndash;9509 (1996).\u003c/li\u003e\n\u003cli\u003eDaer, R. \u003cem\u003eet al.\u003c/em\u003e Characterization of diverse homoserine lactone synthases in Escherichia coli. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, e0202294 (2018).\u003c/li\u003e\n\u003cli\u003eZhou, K., Qiao, K., Edgar, S. \u0026amp; Stephanopoulos, G. Distributing a metabolic pathway among a microbial consortium enhances production of natural products. \u003cem\u003eNat Biotechnol\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 377\u0026ndash;383 (2015).\u003c/li\u003e\n\u003cli\u003ePatnaik, R., Zolandz, R. R., Green, D. A. \u0026amp; Kraynie, D. F. L‐tyrosine production by recombinant Escherichia coli: fermentation optimization and recovery. \u003cem\u003eBiotechnol Bioeng\u003c/em\u003e \u003cstrong\u003e99\u003c/strong\u003e, 741\u0026ndash;752 (2008).\u003c/li\u003e\n\u003cli\u003ePyne, M. E., Narcross, L. \u0026amp; Martin, V. J. J. Engineering Plant Secondary Metabolism in Microbial Systems. \u003cem\u003ePlant Physiol\u003c/em\u003e \u003cstrong\u003e179\u003c/strong\u003e, 844\u0026ndash;861 (2019).\u003c/li\u003e\n\u003cli\u003eAjikumar, P. K. \u003cem\u003eet al.\u003c/em\u003e Isoprenoid pathway optimization for Taxol precursor overproduction in Escherichia coli. \u003cem\u003eScience (1979)\u003c/em\u003e \u003cstrong\u003e330\u003c/strong\u003e, 70\u0026ndash;74 (2010).\u003c/li\u003e\n\u003cli\u003eGalanie, S., Thodey, K., Trenchard, I. J., Filsinger Interrante, M. \u0026amp; Smolke, C. D. Complete biosynthesis of opioids in yeast. \u003cem\u003eScience (1979)\u003c/em\u003e \u003cstrong\u003e349\u003c/strong\u003e, 1095\u0026ndash;1100 (2015).\u003c/li\u003e\n\u003cli\u003eEntian, K.-D. \u0026amp; K\u0026ouml;tter, P. 25 yeast genetic strain and plasmid collections. \u003cem\u003eMethods in microbiology\u003c/em\u003e \u003cstrong\u003e36\u003c/strong\u003e, 629\u0026ndash;666 (2007).\u003c/li\u003e\n\u003cli\u003eDeichmann, M. \u003cem\u003eet al.\u003c/em\u003e Engineered yeast cells simulating CD19+ cancers to control CAR T cell activation. \u003cem\u003eBioRxiv\u003c/em\u003e 2010\u0026ndash;2023 (2023).\u003c/li\u003e\n\u003cli\u003eJessop‐Fabre, M. M. \u003cem\u003eet al.\u003c/em\u003e EasyClone‐MarkerFree: A vector toolkit for marker‐less integration of genes into Saccharomyces cerevisiae via CRISPR‐Cas9. \u003cem\u003eBiotechnol J\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1110\u0026ndash;1117 (2016).\u003c/li\u003e\n\u003cli\u003eJakočiūnas, T. \u003cem\u003eet al.\u003c/em\u003e Multiplex metabolic pathway engineering using CRISPR/Cas9 in Saccharomyces cerevisiae. \u003cem\u003eMetab Eng\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 213\u0026ndash;222 (2015).\u003c/li\u003e\n\u003cli\u003eMans, R. \u003cem\u003eet al.\u003c/em\u003e CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. \u003cem\u003eFEMS Yeast Res\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, fov004 (2015).\u003c/li\u003e\n\u003cli\u003eGietz, R. D. \u0026amp; Woods, R. A. Genetic transformation of yeast. \u003cem\u003eBiotechniques\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 816\u0026ndash;831 (2001).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6620198/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6620198/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe yeast \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e is widely employed in industrial biotechnology for chemical and pharmaceutical production. However, engineering yeast for high product titers remains challenging due to metabolic imbalances and competition for cellular resources. To address this, we developed an orthogonal quorum sensing (QS) system based on \u003cem\u003eN\u003c/em\u003e-acyl-homoserine lactones (AHLs) for cell density-dependent regulation in yeast. Using metabolic engineering, we established AHL production in yeast. Next, we improved AHL-biosensors via directed evolution and a novel growth-based screening strategy with \u003cem\u003eamdS\u003c/em\u003e as a counter-selectable marker. We identified LuxR variants with enhanced sensitivity, which were engineered for QS-controlled expression of a reporter gene. Additionally, we engineered LuxR to function as a repressor, achieving QS-dependent repression. The QS system was applied to enhance aloesone production, a plant-derived metabolite with cosmetic and pharmaceutical applications. The established system showed 51% increased production through QS-controlled repression of \u003cem\u003eFAS1\u003c/em\u003e. This work establishes a versatile QS-based regulatory platform to support dynamic pathway regulation for metabolic engineering in yeast.\u003c/p\u003e","manuscriptTitle":"Engineering N-acyl-homoserine lactone-based quorum-sensing circuit for dynamic regulatory control in Saccharomyces cerevisiae","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-02 09:29:44","doi":"10.21203/rs.3.rs-6620198/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"communications-biology","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"commsbio","sideBox":"Learn more about [Communications Biology](http://www.nature.com/commsbio/)","snPcode":"","submissionUrl":"","title":"Communications Biology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Communications Series","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"f61bb351-b304-4a46-a3b4-a3d7e6384635","owner":[],"postedDate":"June 2nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":48585003,"name":"Biological sciences/Biotechnology/Metabolic engineering"},{"id":48585004,"name":"Biological sciences/Systems biology/Genetic circuit engineering"}],"tags":[],"updatedAt":"2025-12-20T08:10:15+00:00","versionOfRecord":{"articleIdentity":"rs-6620198","link":"https://doi.org/10.1038/s42003-025-09163-9","journal":{"identity":"communications-biology","isVorOnly":false,"title":"Communications Biology"},"publishedOn":"2025-11-27 05:00:00","publishedOnDateReadable":"November 27th, 2025"},"versionCreatedAt":"2025-06-02 09:29:44","video":"","vorDoi":"10.1038/s42003-025-09163-9","vorDoiUrl":"https://doi.org/10.1038/s42003-025-09163-9","workflowStages":[]},"version":"v1","identity":"rs-6620198","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6620198","identity":"rs-6620198","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}