A novel recombinant adenovirus expressing apoptin and MEL genes kills hepatocellular carcinoma cells and inhibits the growth and metastasis of ectopic tumors

A novel recombinant adenovirus expressing apoptin and MEL genes kills hepatocellular carcinoma cells and inhibits the growth and metastasis of ectopic tumors | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article A novel recombinant adenovirus expressing apoptin and MEL genes kills hepatocellular carcinoma cells and inhibits the growth and metastasis of ectopic tumors Jingqiao Wu, Zhaoyu Lan, Xin Li, Jinling He, Dongchao Zhang, Tianming Jin This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4301482/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract HCC is the most common fatal malignancy. Although surgical resection is the primary treatment strategy, most patients are not eligible for resection due to tumor heterogeneity, underlying liver disease, or comorbidities. Therefore, this study explores the possibility of multi-molecular targeted drug delivery in treating HCC. In this study, we constructed the recombinant adenovirus co-expressing apoptin and melittin (MEL) genes. The inhibitory effect of recombinant adenovirus on hepatocellular carcinoma cells was detected through experiments on cell apoptosis, migration, invasion, and other factors. The tumor inhibitory effect in vivo was assessed using subcutaneous HCC mice. Results showed that recombinant adenovirus co-expressing anti-tumor genes TAT and apoptin, RGD and MEL can significantly inhibit the proliferation, migration, and invasion of HCC cells by inducing an increase in reactive oxygen species (ROS) levels, upregulation of apoptotic proteins such as Bax, caspase-3, and caspase-9, and downregulation of the anti-apoptotic protein Bcl2. In subcutaneous HCC mice, recombinant adenovirus induced significant apoptosis in tumor cells, inhibited tumor growth. In conclusion, recombinant adenovirus co-expressing apoptin and MEL can inhibit the growth and proliferation of tumor cells both in vivo and in vitro. recombinant adenovirus melittin apoptin hepatocellular carcinoma Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Hepatocellular carcinoma (HCC) is the leading cause of primary liver cancer cases [1], with incidence rates increasing annually. More than 70% of the 16 million reported cancer cases each year originate from low- and middle-income countries [2]. Cancer affects the health and well-being of humans and animals. Surgery, radiation therapy, chemotherapy, and immunotherapy are the conventional treatment modalities for HCC. However, there are various limitations, including an increased risk of postoperative complications, incomplete partial tumor resection [3], and the heterogeneity of the patient's immune environment. Nowadays, from systematic chemotherapy to molecular targeted therapy to immunotherapy, as well as various combinations at different stages and in various ways, the treatment of HCC has made significant progress. The treatment of HCC will increasingly emphasize multidisciplinary cooperation and comprehensive care through various approaches. Among them, targeted therapy for tumors has shown promising results in certain types of tumors, indicating potential advancements in the future. Apoptin, a 13.6 kDa serine-threonine-rich protein, is a 121-amino-acid chicken anemia virus VP3 protein that selectively induces apoptosis in cancer cells [4]. Apoptin has few secondary, tertiary, or quaternary structures and is localized in the cytoplasm in filamentous form. Each apoptin monomer contains two structural domains: the C-terminal and the N-terminal. Different combinations of these domains and their substructural domains can bind DNA and induce apoptosis independently to varying degrees [5]. Apoptin protein has great potential for tumor treatment, and researchers have been continuously studying its mechanism of killing tumor cells. In previous studies, apoptin released Cytochrome C(Cyt-c) and apoptosis-inducing factor(AIF) by regulating Bcl2 and Apaf-1 apoptotic vesicles and activating apoptotic vesicles and Bcl2-regulated death pathways [6]. Apoptin also induces elevated levels of the tumor suppressor lipid ceramides and activates caspase-3 to execute apoptosis prior to Cyt-c release [7]. In cancer cells, anaphase-promoting complex/cyclosome (APC/C) by associating with the APC1 subunit, inducing cell cycle arrest and inhibiting cell proliferation. In normal cells, the protein is located in the cytoplasm and aggregates at the cell edge, where it is degraded by the proteasome without damaging normal cells. In contrast, in tumor cells, apoptin accumulates in the nucleus to form multimers. These multimers prevent dividing cancer cells from repairing their DNA damage and also induce apoptosis through autophagy and mitochondrial apoptosis pathways [8]. Recent studies have identified apoptin as a protein precursor drug that is selectively activated in cancer cells through phosphorylation, thereby disrupting the cytoskeleton and promoting cell death [9]. It has also been found that apoptin induces apoptosis in HepG-2 cells via calcium ions, causing an imbalance and activating their mitochondrial apoptotic pathway [10]. The human immunodeficiency virus (HIV) trans-activated transcription (TAT) protein, the first cell-penetrating peptides discovered in 1998 [11], is derived from the human HIV viral TAT protein. It penetrates the cell membrane and facilitates the entry of macromolecules into the cytoplasm. TAT proteins derived from human immunodeficiency virus (HIV)-1 protein residue 48-60, mainly through the α-helical structural domain of basic amino acids, and play a key role in internalization and nuclear translocation [12]. In this research, TAT will be co-expressed with apoptin protein to enhance the penetration of apoptin into tumor cells. MEL acts as a non-selective cytolytic peptide that disrupts all prokaryotic and eukaryotic cell membranes. It exhibits biological activities such as antibacterial, antiviral, and anti-inflammatory effects [13]. MEL disrupts the cell membrane by binding to it and forming transmembrane ring pores [14]. This process causes the leakage of substances from the cell and increases the permeability of the cell membrane, ultimately leading to cell lysis. It also allows various other molecular substances with oncogenic activity to enter the tumor cells through the pores, synergistically exerting therapeutic effects [15]. Although many studies have reported the anticancer activity of bee venom peptides in vitro and in vivo , their clinical application has been controversial due to their non-specific cytotoxic and hemolytic activities, which limit their potential in cancer therapy. The Tumor neovascularization targeting peptide RGD peptide is one of the most studied peptides that binds to the integral protein αvβ3 and acts as a targeting ligand [16]. The emergence of targeting peptides that specifically target tumors has brought new opportunities for the application of bee venom peptides. This allows for the exploration of their diverse cell-damaging abilities under the guidance of targeting peptides to develop novel and promising cancer treatment strategies. Although a large number of target genes have been identified in HCC, the scope of drug therapy solely targeting a single gene is narrow and prone to the emergence of immune escape and drug resistance in tumor cells. Adenovirus, as the most commonly used gene delivery system, offers several advantages and can efficiently express the target protein after inserting exogenous genes. Recombinant viral systems are more efficient at gene delivery than non-viral physicochemical methods of gene delivery. They have larger genomes, higher packaging titers, and are simpler to prepare than other viral vectors, reducing the risk of insertional mutagenesis in the host genome [17]. Therefore, in this experiment, a type 5 recombinant adenovirus capable of expressing TAT, apoptin, RGD and MEL gene sequences will be constructed. The recombinant adenovirus is highly accumulated in tumor tissues by intratumoral injection, leading to the synergistic effect of the dual oncogenes. As a typical tumor with abundant blood perfusion, angiogenesis plays a crucial role in the growth and metastasis of HCC. The tumor-targeting peptide RGD selected for this experiment can specifically target αvβ3 integrin receptors highly expressed in tumor vasculature. MEL can induce apoptosis and lysis of adenovirus-infected tumor cells through non-specific cell membrane lysis, allowing the fusion protein TAT-apoptin to be released into the cytoplasm to exert secondary killing effects. The peptide TAT promotes the internalization of apoptin protein into adjacent cells, triggering tumor cell death through autophagy and mitochondrial apoptosis. Additionally, the RGD targeting peptide guides the specific secondary targeting of MEL to tumor cells, leading to cytolytic effects. 2. Materials and Methods 2.1. Cell culture The human cell lines HEK293A and SMMC-7721 were obtained as a gift from Jilin University, while the Huh7 cell line was maintained in the Prevention Laboratory of Tianjin Agricultural College. The HEK293A cell line was cultured in dulbeccos modified eagle medium (DMEM) medium (Hyclone, China) supplemented with 10% fetal bovine serum (Gibco, China), 100 U/mL penicillin, and 100 mg/mL streptomycin (Gibco). SMMC-7721 and L-02 cells were cultured in 1640 medium (Hyclone, China) supplemented with 10% fetal bovine serum (Gibco, China), 100 U/mL penicillin, and 100 mg/mL streptomycin (Gibco, China). All cells were maintained in a 37℃, 5% CO 2 incubator. 2.2. Construction of a recombinant adenovirus shuttle vector and recombinant adenovirus packaging The adenovirus shuttle plasmid GV314-EGFP was linearized by Age Ⅰ and Nhe Ⅰ for adenovirus packaging and amplification. The target genes were seamlessly cloned, transferred to a linearized adenovirus shuttle vector, and identified through Polymerase Chain Reaction (PCR) and sequencing. The constructed adenovirus shuttle plasmid was co-transfected with the AdGloxde13cre plasmid into HEK 293A cells respectively. The cells were then incubated until a large number of them showed the cytopathic effect (CPE) phenomenon, and 50% of the cells were detached. Briefly, HEK 293A cells were seeded at 2 × 10 5 cells into 6 cm culture plates (Corning, United States) in DMEM medium containing 10% Fetal Bovine Serum (FBS). After HEK293A cells adhered to the dish, 2 µg of adenovirus shuttle plasmid, 4 µg of AdGloxde13cre plasmid, and 8 µl of lipofectine were added to the culture media. The mixture was then incubated for 24 h at 37°C. Following incubation, the culture media were changed every 2–3 d. The infected HEK 293A cells exhibited a significant CPE on day 14. The cells were collected and cracked by repeated freezing and thawing between 37°C and -80°C three times to release the viral particles. The recovered virus was inoculated into HEK 293A cells with a 90% fusion. The CPE was observed and recorded three days post-incubation, and median tissue culture infective dose (TCID50) was calculated using the Karber method. The four recombinant adenoviruses constructed in this study were named Ad-TAT-apoptin, Ad-RGD-MEL, and Ad-TAT-Apoptin-RGD-MEL. The viruses were then collected and stored at -80°C for future use. 2.3. Reverse transcription-polymerase chain reaction To confirm successful transcription of the target protein, RNA was extracted from SMMC-7721 cells infected with recombinant adenovirus and then reverted to cDNA. Using cDNA as a template, TAT-apoptin and RGD-MEL were amplified by PCR for validation (TAKARA, Japan). The primers were designed using the gene sequences provided in the National Center for Biotechnology Information Gene Bank and synthesized by Beijing Aoko Biological Engineering Co., Ltd. The sequence of primers is shown in Table 1. 2.4. Western Blot SMMC-7721 cells were seeded in 24-well plates, and various recombinant adenoviruses were added for 36 h. Cellular proteins were extracted from the cell lysate, and the protein concentration was determined. Subsequently, the proteins were separated by electrophoresis using a 20% separating gel. Polyvinylidene fluoride (PVDF) membranes were blocked for 2 h and then incubated overnight at 4°C with anti-rabbit monoclonal antibody against Flag (1:5000, Abcam, USA) and goat anti-mouse monoclonal antibody against MYC (1:5000, Abcam, USA) . After washing with phosphate buffered saline（PBS）, the cells were detected with either an anti-goat IgG secondary antibody or an anti-mouse IgG secondary antibody (1:5000, ZEN BIO, China) and exposed using a gel imaging system. 2.5. Indirect immunofluorescence SMMC-7721 cells were seeded into 24-well plates until they reached 70% confluence. Subsequently, various recombinant adenoviruses were separately added and incubated for 36 h. After fixation with 4% paraformaldehyde and permeabilization with 0.5% Triton X-100, the cells were treated with 5% Bovine Serum Albumin Solution (BSA) (Solarbio, China) for 60 min at room temperature to block non-specific binding sites. Cells were incubated with anti-rabbit monoclonal antibody Flag (1:200, Abcam, United States) and goat anti-mouse monoclonal antibody MYC (1:200, Abcam, United States) overnight at 4°C in a humidified chamber. After being washed with PBS, cells were incubated with an anti-goat IgG secondary antibody or an anti-mouse IgG secondary antibody (1:250, ZEN BIO, China) at 37°C for 2 h in the dark. Cells were imaged using a fluorescence microscope (Revolve, Echo-Labs, United States). 2.6. Cell proliferation assays A cell proliferation reagent kit (Beyotime, China) was used to determine the cell proliferation capacity of various cell lines. Cells were seeded in 96-well plates with a density of 5 × 10 3 cells/well. 0–1000 multiplicity of infection (MOI) of different recombinant adenoviruses were treated, and cell viability was assessed at 24 h, 48 h, and 72 h according to the manufacturer's instructions and compared between the different groups. 2.7. Wound healing assay Cells were seeded in a 6-well plate. When cells reached confluency, each well was scratched with a 200 μl pipette tip, creating three lines across each well. The cells were infected with 1000 MOI of recombinant adenovirus, and images were captured using a microscope (Echo Revolve, United States) at 0 h, 3 h, 6 h, 9 h, 12 h, and 24 h after treatment. 2.8. Transwell invasion and cell migration test The Matrixgel thawed slowly on the ice and was diluted with a serum-free medium at a ratio of 1:8. Transwell chambers, which contained a polycarbonate membrane with 8.0 μm pores (Corning, United States), were placed in a 24-well plate. An amount of 200 μl of diluted Matrixgel was added to the transwell chamber and incubated at 37℃ for 2 h. Then, the residual medium was removed. The cell concentration was diluted with RPMI-1640 medium without FBS. Subsequently, 150 μl of cell suspension was added to each transwell chamber with the BD Matrigel Basement Membrance Matrix, and 600 μl of RPMI-1640 medium containing 10% FBS was added under the 24-well plate. The cells were then cultured in the incubator for 48 h. Then, the cells in the upper compartment were wiped with cotton swabs, fixed with methanol for 30 min, and stained with 0.1% crystal violet dye for 10 min. The membrane was removed, fixed on a slide, and randomly photographed under a microscope. In the cell migration experiment, all other conditions were identical to those in the invasion experiment, except for the absence of BD Matrigel Basement Membrance Matrix. 2.9. Scanning electron microscopy (SEM) Cells grown on slides were washed with a PBS buffer and fixed with 2.5% glutaraldehyde at 4°C overnight. The sample was dehydrated using a gradient of ethanol concentrations (50%, 70%, 80%, 95%, and 100%). The sample was then sputter-coated with gold-palladium and imaged using a scanning electron microscope (Gemini 300, ZEISS, Germany). 2.10. Flow cytometry analysis SMMC-7721 cells were infected with different recombinant adenoviruses. After 36 h of infection, each group of cells was digested with 0.25% trypsin. The digestion process was terminated by adding a culture medium, and the cells were washed twice with PBS. Cells were collected by centrifugation and suspended in 500 μl of binding buffer. An amount of 5 μl of Annexin APC and 5 μl of 7AAD (Annexin V-APC/7-AAD double-stained apoptosis detection kit, Key GEN Bio Tech, China) were added to the mixture, and cells from each group were incubated in the dark for 15 min. Uninfected SMMC-7721 cells were used as a blank control. The apoptosis rate was determined by flow cytometry (Verse, BD, United States). 2.11. Reactive oxygen species staining The reactive oxygen species (ROS) was detected using a ROS assay kit (Key GEN Bio Tech, China) according to the manufacturer's protocol. The cells were collected and suspended in DCFH-DA. After incubation at 37℃ for 20 min, the cells were observed under a fluorescence microscope (Revolve, Echo-Labs, United States). 2.12. TdT-mediated dUTP nick end labeling TdT-mediated dUTP nick end labeling (TUNEL) staining of SMMC-7721 cells began by seeding the cells on a 6-well plate and treating them with 1000 MOI recombinant adenovirus for 48 h. After the cells were fixed in 4% paraformaldehyde for 30 min, a 1% Triton X-100 permeable solution was promoted at room temperature for 3–5 min. The endogenous peroxidase-blocking solution was incubated at room temperature for 10 min. Terminal nucleotidyl transferase (TdT )enzyme reaction solution was added and incubated in the dark at 37℃ for 1 h, followed by the addition of Streptavidin-Horseradish Peroxidase working solution, which was also incubated in the dark at 37℃ for 30 min. The Diaminobenzidine (DAB) working solution was color-developed at room temperature for 0.5–5 min. After washing with PBS, the sample was observed under the microscope and photographed. TUNEL staining of tumor tissues was performed by dewaxing tumor sections in water, washing with PBS, adding Proteinase K working solution, and incubating at 37℃ for 30 min. Equilibration buffer was added to the 1 × equilibration buffer and incubated at room temperature for 10–30 min. An amount of 50 μL of TdT solution was added to the slices, incubated at 37℃ for 1 h, and washed with PBS three times for 5 min each time. After DAPI staining, the film was sealed and observed under a fluorescence microscope. 2.13. Animal xenograft model SMMC-7721 cells (1 × 10 7 /100 μl) were injected subcutaneously into the right axilla of BALB/c nude mice (Charles River, Beijing, China). When the tumors grew to an average diameter of 5 mm, the animals were randomized into five groups and received intratumoral injections of either PBS (100μl), Ad TA (2 × 10 8 pfu/100μl), Ad RD (2 × 10 8 pfu/100μl), Ad TARD (2 × 10 8 pfu/100μl), or Cisplatin (DDP) (60μg/kg), respectively, every two days. The tumor size was measured with a Vernier caliper every two days. Tumor volume was calculated using the formula: V = length × width 2 ÷ 2. All experiments were approved by the Ethics Committee of the Institute of Radiation Medicine, Chinese Academy of Medical Sciences. All manipulations were carried out in accordance with the requirements of the Regulations of the Experimental Animal Administration of China. 2.14. Hematoxylin-eosin staining The samples were fixed with 10% formalin, dehydrated through a graded series of alcohol (50%, 70%, 80%, 95%, and 3 × 100%), embedded in paraffin, and cut at a thickness of 5 µm using a microtome. The slides were stained with hematoxylin and eosin (H&E). The HE-stained slides were visualized under a light microscope (Echo Revolve, United States) at 400× magnification. Cell nuclei in the HE stain appeared to be blue. 2.15. Statistical analyses GraphPad Prism 6 (GraphPad, San Diego, United States) was used to generate figures. All quantitative experiments were performed in triplicate and/or repeated three times. Data were expressed as mean ± standard deviation (SD). The statistical significance between groups was determined by a t-test of variance. A value of P < 0.05 was considered statistically significant, while a value of P < 0.01 was considered highly statistically significant. 3. Result 3.1. Construction of adenovirus vectors The DNA fragments of the TAT, apoptin gene, and RGD, MEL genes were separately inserted into the vector pMD-19T. In addition, the MYC tag was fused with the TAT-apoptin gene, and the Flag tag was fused with the RGD-MEL gene for the detection of target gene expression. Subsequently, the desired DNA fragments were transferred to the adenovirus shuttle vector GV314-CMV-EGFP, yielding the vectors GV314-TAT-apoptin, GV314-RGD-MEL, and GV314-TAT-apoptin-RGD-MEL (Figure 1a). The positive clones were identified through PCR and sequencing. Three bands for the adenovirus shuttle vector were obtained by electrophoresis, with molecular weights of 492 bp, 1424 bp, and 1875 bp, respectively, which were consistent with the theoretical molecular weight of the shuttle vector. This indicates the successful construction of the adenovirus shuttle vectors GV314-TAT-apoptin, GV314-RGD-MEL, and GV314-TAT-apoptin-RGD-MEL (Figure 1b). 3.2. Packaging and titer determination of recombinant adenovirus The successfully constructed recombinant adenovirus plasmids, identified by PCR and DNA sequencing, were selected and transfected into HEK293A cells for packaging with GloxdelE13cre plasmids, respectively. Following conventional culture for 14 d, infected HEK293A cells show a significant CPE and clear fluorescence (Supplementary Figure 1). Following four rounds of amplification, the titers of the successfully packaged Ad TA , Ad RM , Ad TARM , and Ad were 10 10.75 pfu/mL, 10 10.35 pfu/mL, 10 10.25 pfu/mL, and 10 11 pfu/mL, respectively. 3.3. Successful transcription and expression of recombinant adenovirus in SMMC-7721 cells Reverse transcription-polymerase chain reaction (RT-PC), Western Blot (WB), and Immunofluorescence (IF) were used to determine the successful transcription and expression of the recombinant adenovirus target gene in SMMC-7721 cells. Four recombinant adenovirus-infected SMMC7721 cells were collected for RNA extraction and reverse transcription. The TAT-apoptin gene (492 bp), RGD-MEL (1424 bp), and TAT-apoptin-RGD-MEL (1875 bp) were amplified by PCR using specific primers (Figure 1c). The expression of TAT-apoptin and RGD-MEL genes in SMMC-7721 cells infected with recombinant adenovirus was detected using the MYC label expressed through fusion with TAT-apoptin and the Flag label expressed through fusion with RGD-MEL. WB showed that Ad TA , Ad RM , and Ad TARM targeted bands at 7 kDa and 16 kDa, respectively (Figure 1e). IF showed that specific blue and red fluorescence was observed for TAT-apoptin and RGD-MEL, respectively, which was not detected in the negative control Ad. These results demonstrate that the recombinant genes could be expressed in vitro following recombinant adenovirus infection in SMMC-7721 cells and that the protein could retain its antigenic reactivity (Figure 1d). 3.4. Inhibition of hepatocellular carcinoma cell proliferation by recombinant adenovirus in vitro To investigate the effect of recombinant adenovirus on SMMC-7721, Huh 7, and L-02 cells, the cells were individually treated with Ad TA , Ad RM , Ad TARM , and Ad. After treating Huh7 and SMMC-7721 cells with the recombinant adenoviruses Ad TA , Ad RM , and Ad TARM for 48 h, the cell survival rate decreased as the virus dose increased. The Ad TARM group significantly decreased cell survival in Huh7 cells at 200 MOI ( P < 0.01) and in SMMC-7721 cells at 500 MOI ( P < 0.01), while the same dose had no significant inhibitory effect on L-02 cells (Figure 2a). As shown in Supplementary Figures 2A and 2B, recombinant adenoviruses Ad TA , Ad RM , and Ad TARM showed a time-dependent dependence on Huh7 and SMMC-7721 cells. Overall, Ad TARM exhibited the highest inhibitory effects, followed by Ad TA and Ad RM ( P < 0.01). There was no significant difference between the Ad group and the control group. Overall, the inhibitory effects of Ad TA , Ad RM , and Ad TARM on SMMC-7721 and Huh7 cells increased in a dose-dependent and time-dependent manner throughout the experiment, demonstrating significant differences from the Ad control group. 3.5. Recombinant adenovirus inhibits migration and invasion of SMMC-7721 cells in vitro The effects of recombinant adenoviruses Ad, Ad TA , Ad RM , Ad TARM , and PBS on SMMC-7721 cell migration were analyzed using transwell. SMMC-7721 cells infected with recombinant adenovirus were added to the upper chamber of the transwell chamber, and the chamber was removed 24 h later and stained with crystal violet. After statistical analysis, the results showed that the number of cell migrations in the recombinant adenovirus treatment group was significantly reduced compared to that in the Ad and control groups ( P < 0.01), Ad TARM had the most significant effect on FBS-mediated cell chemotactic, and the number of cell migrations was significantly different compared to the recombinant adenovirus Ad TA and Ad RM treatment groups ( P < 0.01). In the cell migration experiment, we pre-coated Matrigel in a transwell chamber and incubated it at 37℃ for 2 h. After discarding any excess unsolidified Matrigel glue, we added SMMC-7721 cells infected with recombinant adenovirus to the upper chamber of the transwell chamber. The chamber was removed 48 h later, followed by crystal violet staining. The results of the statistical analysis revealed a significant reduction in the number of cell migrations in the recombinant adenovirus treatment group compared to the Ad and control groups ( P < 0.01). Moreover, the cell migration number in the co-expression group was notably lower than that in the recombinant adenovirus Ad TA and Ad RM treatment groups ( P < 0.01). The co-expression group exhibited the most effective inhibition of invasion in SMMC-7721 cells (Figure 2b). In addition, we evaluated the effect of recombinant adenovirus on SMMC-7721 cell migration. In the cell scratch experiment, SMMC-7721 cells were infected with recombinant adenoviruses Ad, Ad TA , Ad RM , and Ad TARM . The changes in the scratch area at different time points were compared and analyzed. The results showed that, compared with the control group, recombinant adenoviruses Ad TA , Ad RM , and Ad TARM significantly inhibited cell migration in SMMC-7721 cells after 12 h ( P < 0.01). The recombinant adenovirus Ad TARM treatment group exhibited a lower degree of wound healing and significantly inhibited the migration of SMMC-7721 cells compared to all other treatment groups (Figure 2c, P < 0.01). The Annexin V flow cytometry method was used to further analyze the apoptosis of SMMC-7721 cells induced by recombinant adenovirus. We found that Ad TA , Ad RM , and Ad TARM all induced apoptosis of SMMC-7721 cells at 36 h (Figure 2d, P < 0.01). In conclusion, compared with the control group, Ad TA , Ad RM , and Ad TARM can induce apoptosis in SMMC-7721 cells. 3.6. Recombinant adenovirus induces apoptosis in SMMC-7721 cells by increasing ROS content Subsequently, to study the changes in oxidative stress in SMMC-7721 cells, those infected with 1000 MOI of Ad TA , Ad RM , Ad TARM , and Ad, respectively, were stained with a DHE probe staining solution at 36 h. Compared with the Ad and control groups, ROS content was significantly increased in all recombinant adenovirus treatment groups ( P > 0.05), especially in the Ad TARM treatment group (Figure 3a). In summary, the recombinant adenoviruses tested showed a significant increase in DHE-specific ROS in SMMC-7721 cells. An apoptosis-activated endonuclease cleaved nuclear DNA. The TUNEL reagent was used to detect nuclear DNA breakage in SMMC 7721 cells treated with recombinant adenovirus and the PBS control group. The nuclei of the PBS and Ad control groups were almost unstained, while the recombinant adenovirus treatment group showed different degrees of nuclear staining post-administration. The recombinant adenovirus treatment group induced the production of DNA fragments in SMMC-7721 cells (Figure 3b). Scanning electron microscopy (SEM) results showed that after recombinant adenovirus infected SMMC-7721 cells for 48 h, the cell folds became rounded, and the pseudopodia microvilli disappeared in the Ad TA treatment group. The cells in the Ad RM -treated group were slightly atrophic, while those in the Ad TARM -treated group exhibited the two deformations mentioned above (Figure 3c). WB was used to detect the expression of apoptotic proteins in SMMC-7721 cells treated with the recombinant adenoviruses Ad TA , Ad RM , and Ad TARM . Results showed that, compared with PBS and Ad controls, the Ad TA , Ad RM , and Ad TARM groups all induced activation of cleaved caspase-3 protein, increased Bax expression, and decreased Bcl-2 protein (Figure 3d). 3.7. Recombinant adenovirus inhibits ectopic tumor growth in vivo Ad TA , Ad RM , Ad TARM , and Ad were administered via intra-tumor injection at a dose of 2 × 10 8 pfu/100 μl/mouse once every two days. As shown in Figures 4A and 4B, after five doses, the tumor volume and weight of the recombinant adenovirus-treated group were smaller and lighter than those of the PBS group, indicating that the recombinant adenovirus significantly inhibited the growth of xenografted tumors in mice ( P < 0.01). However, there was no difference between the recombinant adenovirus groups, possibly because of the effect of low-dose administration. The tumor growth rate, final tumor volume, and tumor weight in the DDP group were significantly lower than those in other groups. However, the weight of nude mice was significantly lower than that in other groups, indicating serious side effects (Figure 4a-c). The tumors from the recombinant adenoviruses Ad TA , Ad RM , Ad TARM , PBS, and cisplatin groups were selected for immunohistochemical staining and TUNEL assay. The TUNEL experiment showed that the apoptosis rate of tumor tissue cells in the Ad TARM group was 77.92 ± 2.86%, which was higher than that in the Ad TA group (74.42 ± 3.14%) and the Ad RM group (59.38 ± 9.03%). The apoptotic cells were distributed in a flaky pattern, indicating that DNA damage was induced in the tumor tissue after treatment (Figure 4d). Immunohistochemical staining results showed that the expressions of caspase-3, caspase-9, and P53 were increased in tumor tissues treated with recombinant adenovirus. Compared with the Ad TA and Ad RM treatment groups, the expression of caspase-9 protein was the highest in the Ad TARM treatment group (Figure 4f). H&E results showed that there were no obvious heart lesions in the administration groups. Pulmonary congestion was worse than that in the PBS control group, but the symptoms of alveolar wall thickening were alleviated. Mild renal edema was observed in the cisplatin group, but no obvious abnormalities were observed in the other groups. A large number of neutrophils infiltrated the liver in the cisplatin group, while the liver lobular structure was destroyed in the PBS group. No significant abnormalities were observed in the other groups. These results indicate that the recombinant adenovirus can inhibit liver metastasis caused by subcutaneous HCC mice. The boundary of the white medulla of the spleen in the recombinant adenovirus group was clearer and healthier than that in the PBS and cisplatin groups. Tumor tissues in all groups were grade II heterozygous. The tumor cells exhibited moderate aberrations, were susceptible to nucleolar division, and were arranged in ring, or block formations (Supplementary Figure 2d). 4. Discussion In this study, recombinant adenovirus was used to co-express the apoptin and MEL genes. The transmembrane peptide TAT was fused with apoptin to promote the second internalization of apoptin protein into cancer cells in HCC cells. The targeting peptide RGD was used to target the integrin receptor in HCC vessels and fused with MEL to instruct MEL to specifically kill tumor cells. The non-specific damage to normal tissue was reduced. In conclusion, apoptin was used to specifically induce apoptosis and kill tumor cells through mitochondrial pathways and autophagy. At the same time, apoptin was combined with MEL to lyse the cell membrane of cancer cells and disrupt the complete structural characteristics of the cells, aiming to achieve tumor inhibition through dual-gene coordination. Apoptin protein has been widely studied in colorectal cancer [18], HCC [19], lung cancer [20], and other types of cancer. Its potential applications are vast. The process of purifying the obtained protein is complex, expensive, unstable, and not easily absorbed by cells, which limits the direct use of the apoptin protein. Delivery of adenovirus vectors can be highly expressed in tumor cells without the risk of gene integration, and it is simpler than exosomes or self-assembled nanomaterials. This study evaluated the inhibitory effect of recombinant adenovirus on SMMC-7721 cells in vitro . In vitro experiments involved inflecting SMMC-7721 cells with 1000 MOI for 72 h, resulting in a 40% inhibitory effect. In the cell migration and invasion experiment, migration and invasion were significantly inhibited by 50% compared to the control group. In the ectopic mouse models of HCC, tumor tissue growth was inhibited, DNA damage occurred in cells, and the levels of apoptotic proteins caspase-9, caspase-3, and P53 increased. Similar to our results, Yiquan Li et al. constructed apoptin into a recombinant type 5 adenovirus vector to achieve stable and effective protein expression in cells. The results showed a significant increase in the apoptosis and autophagy of HCC cells. Additionally, there was a notable elevation in the level of cell ROS, which mediated autophagy and apoptosis in HCC cells. The apoptosis induced by apoptosis at 24 h was about 30% [21]. Xiaoyang Yu et al. found that after incubating HepG-2 cells with apoptin for 72 h, 25% apoptosis was observed. The expression levels of cleaved-PARP and cleaved-caspase-3 were significantly higher, and the ROS levels in HepG-2 cells were significantly increased [22]. The above studies confirm the great potential and application value of apoptin in the treatment of HCC. MEL has been regarded as a promising broad-spectrum antitumor drug, but it still shows obvious toxic side effects in the treatment process, such as non-specific cytolytic activity, hemolytic toxicity, coagulation dysfunction, and allergic reactions, which seriously hinder its wide clinical application [13]. In recent years, the anti-tumor mechanism and targeted delivery strategy of MEL have made great progress, providing the possibility for clinical application. There have been attempts to alter the sequence of MEL or fine-tune the conformation of MEL [23]. Studies have also been conducted on the delivery of MEL using smart nanocarrier strategies to achieve passive or active targeting for the treatment of recurrent and refractory malignancies [24]. The tumor-homing peptide RGD recognizes global proteins present on the surface of cancer cells and specifically targets the vascular region of tumors. In this study, RGD and MEL were fused to reduce the toxic side effects of MEL by leveraging the targeting effect of RGD. Studies have shown that melittin nanoparticles induce apoptosis and necrosis of B16F10 cells in vitro , inhibit liver metastasis of B16F10, 4T-1, and CT26, prevent metastasis to other organs, and extend the survival of multiple tumor models [25]. In addition, similar to our results, Mao Jie et al. found that melittin nanoliposomes can significantly induce apoptosis, with IC50 ranges of 1.44 to 2.1 μM for five HCC cell lines (Bel-7402, SMMC-7721, HepG2, LM-3, and Hepa 1-6 cells). Melittin nano-liposomes (2μM) increased the expression levels of pro-apoptotic proteins (such as Bax and cleaved caspase-3) and decreased the expression levels of anti-apoptotic proteins (including Bcl-2 and PARP) in HepG2 cells. Significant inhibition of HCC growth was also shown in the HepG2 cell ectopic mouse models and the LM-3 cell orthotopic model in nude mouse models [26]. This project investigated the inhibitory effect of recombinant adenovirus on SMMC-7721 cells and an HCC ectopic tumor model in vitro , elaborated on the expression pattern of the recombinant adenovirus in tumor animal models, and confirmed the targeted therapeutic effect of the recombinant adenovirus on HCC. The results provide ideas and methods for comparative medicine and tumor-targeted gene therapy. In the future, we will increase the dose of subcutaneous ectopic tumors to explore the optimal therapeutic effect of the co-expression treatment group. In addition, we will also perform experiments on orthotopic HCC mouse models and other tumor models. 5. Conclusion In summary, we designed and packaged a recombinant adenovirus that co-expresses apoptin and MEL therapeutic genes. We verified its ability to induce HCC cell death through in vitro and in vivo experiments. Through multi-level studies, we found that the recombinant adenovirus co-expressing apoptin and MEL therapeutic genes could inhibit the invasion and migration of tumor cells, increase the production of ROS in tumor cells, up-regulate the tumor cell apoptosis-related proteins Bax, caspase-3, and caspase-9, induce tumor cell apoptosis, and inhibit the growth of ectopic hepatocellular carcinoma. Our design utilized two different mechanisms of cytotoxic proteins to synergistically treat tumors, allowing for the possibility of treating multiple tumors regardless of tumor type and heterogeneity. Declaration Author Contributions T.M.J., J.Q.W., and D.C.Z. conceived and designed the study. Z.Y.L., X.L., and H.J.L. analyzed the data. J.Q.W. drafted the manuscript. T.M.J. and D.C.Z. revised the manuscript. Funding were provided by D.C.Z. and J.Q.W. All authors reviewed and approved the submitted version of the manuscript. Funding This work was supported by the Youth Program of the National Natural Science Foundation of China [grant number 32202760]; the Key Program of Postgraduate Research Innovation of Tianjin [grant number 2019YJSS093]; the Open Fund of Key Laboratory of Smart Breeding (Co-construction by Ministry and Province), Ministry of Agriculture and Rural Affairs [grant number 2023-TJAUKLSBF-2103]; the Research Project of Tianjin Education Commission [grant number 2019KJ032]. Institutional Review Board Statement The study protocol has been reviewed and approved by the Animal Ethical and Welfare Committee of Tianjin Agricultural University (Approval number 2022LLSC25) on 16 March 2022. Declarations Conflict of interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. References Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin . 2021;71(3):209-249. doi:10.3322/caac.21660 Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin . 2019;69(1):7-34. doi:10.3322/caac.21551 Andreozzi A, Brunese L, Iasiello M, Tucci C, Vanoli GP. Modeling Heat Transfer in Tumors: A Review of Thermal Therapies. Ann Biomed Eng . 2019;47(3):676-693. doi:10.1007/s10439-018-02177-x Singh PK, Tiwari AK, Rajmani RS, et al. Apoptin as a Potential Viral Gene Oncotherapeutic Agent. Appl Biochem Biotechnol . 2015;176(1):196-212. doi:10.1007/s12010-015-1567-5 Wang Y, Song X, Gao H, et al. C-terminal region of apoptin affects chicken anemia virus replication and virulence. Virol J . 2017;14(1):38. doi:10.1186/s12985-017-0713-9 Maddika S. Cancer-specific toxicity of apoptin is independent of death receptors but involves the loss of mitochondrial membrane potential and the release of mitochondrial cell-death mediators by a Nur77-dependent pathway. J Cell Sci . 2005;118(19):4485-4493. doi:10.1242/jcs.02580 Liu X, Elojeimy S, El-Zawahry AM, et al. Modulation of Ceramide Metabolism Enhances Viral Protein Apoptin’s Cytotoxicity in Prostate Cancer. Mol Ther . 2006;14(5):637-646. doi:10.1016/j.ymthe.2006.06.005 Malla WA, Arora R, Khan RIN, Mahajan S, Tiwari AK. Apoptin as a Tumor-Specific Therapeutic Agent: Current Perspective on Mechanism of Action and Delivery Systems. Front Cell Dev Biol . 2020;8(June):1-15. doi:10.3389/fcell.2020.00524 Wyatt J, Chan YK, Hess M, Tavassoli M, Müller MM. Semisynthesis reveals apoptin as a tumour-selective protein prodrug that causes cytoskeletal collapse. Chem Sci . 2023;14(14):3881-3892. doi:10.1039/d2sc04481a Yu X, Wang T, Li Y, et al. Apoptin causes apoptosis in HepG-2 cells via Ca2+ imbalance and activation of the mitochondrial apoptotic pathway. Cancer Med . 2023;12(7):8306-8318. doi:10.1002/cam4.5528 Wagstaff K, Jans D. Protein Transduction: Cell Penetrating Peptides and Their Therapeutic Applications. Curr Med Chem . 2006;13(12):1371-1387. doi:10.2174/092986706776872871 Ruben S, Perkins A, Purcell R, et al. Structural and functional characterization of human immunodeficiency virus tat protein. J Virol . 1989;63(1):1-8. doi:10.1128/JVI.63.1.1-8.1989 Lyu C, Fang F, Li B. Anti-Tumor Effects of Melittin and Its Potential Applications in Clinic. Curr Protein Pept Sci . 2019;20(3):240-250. doi:10.2174/1389203719666180612084615 Rady I, Siddiqui IA, Rady M, Mukhtar H. Melittin, a major peptide component of bee venom, and its conjugates in cancer therapy. Cancer Lett . 2017;402:16-31. doi:10.1016/j.canlet.2017.05.010 Jamasbi E, Mularski A, Separovic F. Model Membrane and Cell Studies of Antimicrobial Activity of Melittin Analogues. Curr Top Med Chem . 2015;16(1):40-45. doi:10.2174/1568026615666150703115919 Lv X, Zhang C, Shuaizhen Q, Yu R, Zheng Y. Design of integrin αvβ3 targeting self-assembled protein nanoparticles with RGD peptide. Biomed Pharmacother . 2020;128(February):110236. doi:10.1016/j.biopha.2020.110236 Zhang C, Zhou D. Adenoviral vector-based strategies against infectious disease and cancer. Hum Vaccin Immunother . 2016;12(8):2064-2074. doi:10.1080/21645515.2016.1165908 Liu Z, Li Y, Zhu Y, et al. Apoptin induces pyroptosis of colorectal cancer cells via the GSDME-dependent pathway. Int J Biol Sci . 2022;18(2):717-730. doi:10.7150/ijbs.64350 Li Y, Shang C, Liu Z, et al. Apoptin mediates mitophagy and endogenous apoptosis by regulating the level of ROS in hepatocellular carcinoma. Cell Commun Signal . 2022;20(1):1-15. doi:10.1186/s12964-022-00940-1 Song G, Shang C, Zhu Y, et al. Apoptin inhibits glycolysis and regulates autophagy by targeting pyruvate kinase M2 (PKM2) in lung cancer A549 cells. Curr Cancer Drug Targets . 2022;23:1-14. doi:10.2174/1568009623666221025150239 Li Y, Shang C, Liu Z, et al. Apoptin mediates mitophagy and endogenous apoptosis by regulating the level of ROS in hepatocellular carcinoma. Cell Commun Signal . 2022;20(1):134. doi:10.1186/s12964-022-00940-1 Yu X, Wang T, Li Y, et al. Apoptin causes apoptosis in HepG ‐2 cells via Ca 2+ imbalance and activation of the mitochondrial apoptotic pathway. Cancer Med . 2023;12(7):8306-8318. doi:10.1002/cam4.5528 Lv Y, Chen X, Chen Z, et al. Melittin Tryptophan Substitution with a Fluorescent Amino Acid Reveals the Structural Basis of Selective Antitumor Effect and Subcellular Localization in Tumor Cells. Toxins (Basel) . 2022;14(7). doi:10.3390/toxins14070428 Yu X, Jia S, Yu S, et al. Recent advances in melittin-based nanoparticles for antitumor treatment: from mechanisms to targeted delivery strategies. J Nanobiotechnology . 2023;21(1):1-22. doi:10.1186/s12951-023-02223-4 Yu X, Chen L, Liu J, et al. Immune modulation of liver sinusoidal endothelial cells by melittin nanoparticles suppresses liver metastasis. Nat Commun . 2019;10(1):574. doi:10.1038/s41467-019-08538-x Mao J, Liu S, Ai M, et al. A novel melittin nano-liposome exerted excellent anti-hepatocellular carcinoma efficacy with better biological safety. J Hematol Oncol . 2017;10(1):71. doi:10.1186/s13045-017-0442-y Table 1 Table1 Primer sequence of target gene Name Sequence TAT-Apoptin F GGAGGTGGAGGATCAATG TAT-Apoptin R CCTCTTCTGAGATGAGTTT RGD-MEL F GACTGCTTCTGCGGTATT RGD-MEL R TTGTCGTCATCATCCTTATAGT Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure1.tif Supplementary Figure 1: Packaging of recombinant adenovirus vectors containing the TAT-apoptin gene, UBI-RGD-MEL, and TAT-apoptin gene + UBI-RGD-MEL. SupplementaryFigure2.tif Supplementary Figure 2 A, B, and C. Cell survival rate of L-02 cells, SMMC-7721 and Huh7, after treatment with recombinant adenovirus for 24 h and 48 h. D. HE staining of tissue sections of a mouse model of a subcutaneous tumor of HCC. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 22 May, 2024 Reviews received at journal 22 May, 2024 Reviewers agreed at journal 09 May, 2024 Reviewers invited by journal 25 Apr, 2024 Submission checks completed at journal 24 Apr, 2024 Editor assigned by journal 24 Apr, 2024 First submitted to journal 21 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4301482","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":296125556,"identity":"95a226ab-36fc-4218-b3ef-47696e48ff38","order_by":0,"name":"Jingqiao Wu","email":"","orcid":"","institution":"Tianjin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jingqiao","middleName":"","lastName":"Wu","suffix":""},{"id":296125558,"identity":"26035f65-29ca-417c-a1da-3a4620c8dcb8","order_by":1,"name":"Zhaoyu Lan","email":"","orcid":"","institution":"Tianjin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhaoyu","middleName":"","lastName":"Lan","suffix":""},{"id":296125559,"identity":"88328d9e-2122-40d3-8bf8-d3f7ce357787","order_by":2,"name":"Xin Li","email":"","orcid":"","institution":"Tianjin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Li","suffix":""},{"id":296125565,"identity":"2b33f477-80e7-4ef2-b3e3-5ab3250b0ebc","order_by":3,"name":"Jinling He","email":"","orcid":"","institution":"Tianjin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jinling","middleName":"","lastName":"He","suffix":""},{"id":296125566,"identity":"96528e1d-07a4-4871-8135-e62e235b35cc","order_by":4,"name":"Dongchao Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuUlEQVRIie3QIQ7CMBTG8TZLiinol4ywK2yZQXKURxAzw5IqkpnW7AAThGOgO99wAczUMIjJSmoRZA+H6F+/n3gfY7HYX4Z8mBRsxMJYMkmKzm3LlXRIJiJdarW/wi6ngcwchkCg0sCQeXWbJ7wd8+Jyh6NOG8tb95gnCdQMX6dA1hYTrglEBGKlgEoA5jQioeaN1IB0AnIseeeg0GHknvRLWOzpJ3XOMmP6wSsC+cj+eB+LxWKxb70BS/05eANlytoAAAAASUVORK5CYII=","orcid":"","institution":"Tianjin Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Dongchao","middleName":"","lastName":"Zhang","suffix":""},{"id":296125567,"identity":"4558dd37-d542-4171-84dd-8edfcdfa6b68","order_by":5,"name":"Tianming Jin","email":"","orcid":"","institution":"Tianjin Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Tianming","middleName":"","lastName":"Jin","suffix":""}],"badges":[],"createdAt":"2024-04-21 16:10:55","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4301482/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4301482/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55639242,"identity":"18c50a70-2046-42f8-9fe9-96e71c3881a5","added_by":"auto","created_at":"2024-04-30 22:08:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":315573,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of target gene expression in recombinant adenovirus.\u003c/p\u003e\n\u003cp\u003eA. Construction of a vector containing the TAT-apoptin gene (UBI-RGD-MEL) and the TAT-apoptin gene (UBI-RGD-MEL).\u003c/p\u003e\n\u003cp\u003eB. PCR amplification verified the successful construction of the vector containing the target gene.\u003c/p\u003e\n\u003cp\u003eC. The genes of recombinant adenoviruses containing the TAT-apoptin gene, UBI-RGD-MEL, and TAT-apoptin gene + UBI-RGD-MEL were successfully transcribed.\u003c/p\u003e\n\u003cp\u003eD. Gene expression of TAT-apoptin gene (MYC), UBI-RGD-MEL (Flag), and TAT-apoptin gene + UBI-RGD-MEL recombinant adenovirus was detected successfully by MYC and Flag tags. The second antibody corresponding to the MYC-labeled antibody is Alexa Fluor 350-labeled goat anti-mouse IgG (H+L), and the second antibody corresponding to the Flag-labeled antibody is Alexa Fluor 647-labeled goat anti-rabbit IgG (H+L).\u003c/p\u003e\n\u003cp\u003eE. WB assay for protein expression of recombinant adenovirus in SMMC-7721 cells.\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4301482/v1/195987e1c54000a2435756d5.png"},{"id":55639243,"identity":"59d6b483-4971-49e1-b774-ebd56e056f4f","added_by":"auto","created_at":"2024-04-30 22:08:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":662946,"visible":true,"origin":"","legend":"\u003cp\u003eThe killing effect of recombinant adenovirus on hepatocellular carcinoma cell lines and the inhibition of the migration and invasion abilities of SMMC-7721 cells.\u003c/p\u003e\n\u003cp\u003eA. Cell survival rate of 0–1000 MOI recombinant adenovirus infected L-02, Huh7, and SMMC-7721 for 48 h.\u003c/p\u003e\n\u003cp\u003eB. Transwell assay was used to detect the invasion and migration of SMMC-7721 cells by recombinant adenovirus.\u003c/p\u003e\n\u003cp\u003eC. Cell scratch assay was used to detect the migration ability of SMMC-7721 cells after recombinant adenovirus.\u003c/p\u003e","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4301482/v1/a7d896d6f7f36f206f9acc10.png"},{"id":55639244,"identity":"1ea84b82-77d6-4741-bbfe-431923820063","added_by":"auto","created_at":"2024-04-30 22:08:54","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":879255,"visible":true,"origin":"","legend":"\u003cp\u003eRecombinant adenovirus-induced apoptosis and increased reactive oxygen species in SMMC-7721 cells.\u003c/p\u003e\n\u003cp\u003eA. Reactive oxygen species (ROS) were detected by DHE probes after the recombinant adenovirus acted on SMMC-7721 cells, and the quantitative result.\u003c/p\u003e\n\u003cp\u003eB. Recombinant adenovirus induced activation of cleaved caspase-3 protein, increased Bax expression, and decreased Bcl-2 protein in SMMC7721 cells.\u003c/p\u003e\n\u003cp\u003eC. Electron microscopic image of SMMC-7721 cells infected by recombinant adenovirus.\u003c/p\u003e\n\u003cp\u003eD. Recombinant adenovirus induced DNA damage in SMMC-7721 cells.\u003c/p\u003e\n\u003cp\u003eE. SMMC-7721 cell apoptosis was analyzed by flow cytometry after Annexin V APC/7AAD staining after 1000 MOI recombinant adenovirus-infected SMMC-7721 cells for 36 h, and the quantitative result of apoptosis.\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4301482/v1/e5563272f066f52a07bc3899.png"},{"id":55639245,"identity":"1c03dc33-611a-412e-9deb-412052e4b70e","added_by":"auto","created_at":"2024-04-30 22:08:54","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1232250,"visible":true,"origin":"","legend":"\u003cp\u003eRecombinant adenovirus inhibits ectopic tumor growth \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eA. Tissue of mice after five intratumoral injections.\u003c/p\u003e\n\u003cp\u003eB and C. Quantitative results for tumors and tumor/body weight ratios.\u003c/p\u003e\n\u003cp\u003eD. TUNEL staining was used to detect apoptosis of tumor cells in each group after treatment and is the quantitative result of apoptosis.\u003c/p\u003e\n\u003cp\u003eE. The expressions of caspase-3, caspase-9, and P53 were increased in the tumor tissue of the recombinant adenovirus treatment group.\u003c/p\u003e","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4301482/v1/b03191ac27b4d734961f50af.png"},{"id":55693864,"identity":"e277a122-295a-49d8-9eed-c6d75907380d","added_by":"auto","created_at":"2024-05-02 00:38:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3985735,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4301482/v1/0d435b90-35ee-4ee1-94c5-710661c7bc1c.pdf"},{"id":55639246,"identity":"e7549b54-c6cf-49cd-bd1a-210350b3905c","added_by":"auto","created_at":"2024-04-30 22:08:55","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":19745052,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Figure 1: Packaging of recombinant adenovirus vectors containing the TAT-apoptin gene, UBI-RGD-MEL, and TAT-apoptin gene + UBI-RGD-MEL.\u003c/p\u003e","description":"","filename":"SupplementaryFigure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-4301482/v1/b3ed5a58009b6a4a12799972.tif"},{"id":55639247,"identity":"862f6f53-5968-4cae-870e-1db9b57f3d9f","added_by":"auto","created_at":"2024-04-30 22:08:57","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":48083120,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Figure 2\u003c/p\u003e\n\u003cp\u003eA, B, and C. Cell survival rate of L-02 cells, SMMC-7721 and Huh7, after treatment with recombinant adenovirus for 24 h and 48 h.\u003c/p\u003e\n\u003cp\u003eD. HE staining of tissue sections of a mouse model of a subcutaneous tumor of HCC.\u003c/p\u003e","description":"","filename":"SupplementaryFigure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-4301482/v1/350efc51a9b3d59cab8242e1.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"A novel recombinant adenovirus expressing apoptin and MEL genes kills hepatocellular carcinoma cells and inhibits the growth and metastasis of ectopic tumors","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eHepatocellular carcinoma (HCC) is the leading cause of primary liver cancer cases\u0026nbsp;[1], with incidence rates increasing annually. More than 70% of the 16 million reported cancer cases each year originate from low- and middle-income countries\u0026nbsp;[2]. Cancer affects the health and well-being of humans and animals. Surgery, radiation therapy, chemotherapy, and immunotherapy are the conventional treatment modalities for HCC. However, there are various limitations, including an increased risk of postoperative complications, incomplete partial tumor resection\u0026nbsp;[3], and the heterogeneity of the patient\u0026apos;s immune environment. Nowadays, from systematic chemotherapy to molecular targeted therapy to immunotherapy, as well as various combinations at different stages and in various ways, the treatment of HCC has made significant progress. The treatment of HCC will increasingly emphasize multidisciplinary cooperation and comprehensive care through various approaches. Among them, targeted therapy for tumors has shown promising results in certain types of tumors, indicating potential advancements in the future.\u003c/p\u003e\n\u003cp\u003eApoptin, a 13.6 kDa serine-threonine-rich protein, is a 121-amino-acid chicken anemia virus VP3 protein that selectively induces apoptosis in cancer cells\u0026nbsp;[4]. Apoptin has few secondary, tertiary, or quaternary structures and is localized in the cytoplasm in filamentous form. Each apoptin monomer contains two structural domains: the C-terminal and the N-terminal. Different combinations of these domains and their substructural domains can bind DNA and induce apoptosis independently to varying degrees\u0026nbsp;[5].\u0026nbsp;Apoptin protein has great potential for tumor treatment, and researchers have been continuously studying its mechanism of killing tumor cells. In previous studies, apoptin released Cytochrome C(Cyt-c) and apoptosis-inducing factor(AIF) by regulating Bcl2 and Apaf-1 apoptotic vesicles and activating apoptotic vesicles and Bcl2-regulated death pathways\u0026nbsp;[6]. Apoptin also induces elevated levels of the tumor suppressor lipid ceramides and activates caspase-3 to execute apoptosis prior to Cyt-c release\u0026nbsp;[7]. In cancer cells, anaphase-promoting complex/cyclosome (APC/C) by associating with the APC1 subunit, inducing cell cycle arrest and inhibiting cell proliferation. In normal cells, the protein is located in the cytoplasm and aggregates at the cell edge, where it is degraded by the proteasome without damaging normal cells. In contrast, in tumor cells, apoptin accumulates in the nucleus to form multimers. These multimers prevent dividing cancer cells from repairing their DNA damage and also induce apoptosis through autophagy and mitochondrial apoptosis pathways\u0026nbsp;[8].\u0026nbsp;Recent studies have identified apoptin as a protein precursor drug that is selectively activated in cancer cells through phosphorylation, thereby disrupting the cytoskeleton and promoting cell death\u0026nbsp;[9]. It\u0026nbsp;has also been found that apoptin induces apoptosis in HepG-2 cells via calcium ions, causing an imbalance and activating their mitochondrial apoptotic pathway\u0026nbsp;[10].\u0026nbsp;The human immunodeficiency virus (HIV) trans-activated transcription (TAT) protein, the first cell-penetrating peptides discovered in 1998\u0026nbsp;[11],\u0026nbsp;is derived from the human HIV viral TAT protein. It penetrates the cell membrane and facilitates the entry of macromolecules into the cytoplasm. TAT proteins derived from human immunodeficiency virus (HIV)-1 protein residue 48-60, mainly through the \u0026alpha;-helical structural domain of basic amino acids, and play a key role in internalization and nuclear translocation\u0026nbsp;[12].\u0026nbsp;In this research, TAT will be co-expressed with apoptin protein to enhance the penetration of apoptin into tumor cells.\u003c/p\u003e\n\u003cp\u003eMEL acts as a non-selective cytolytic peptide that disrupts all prokaryotic and eukaryotic cell membranes. It exhibits biological activities such as antibacterial, antiviral, and anti-inflammatory effects\u0026nbsp;[13]. MEL disrupts the cell membrane by binding to it and forming transmembrane ring pores\u0026nbsp;[14]. This process causes the leakage of substances from the cell and increases the permeability of the cell membrane, ultimately leading to cell lysis. It also allows various other molecular substances with oncogenic activity to enter the tumor cells through the pores, synergistically exerting therapeutic effects\u0026nbsp;[15]. Although many studies have reported the anticancer activity of bee venom peptides\u0026nbsp;\u003cem\u003ein vitro\u003c/em\u003e and\u0026nbsp;\u003cem\u003ein vivo\u003c/em\u003e, their clinical application has been controversial due to their non-specific cytotoxic and hemolytic activities, which limit their potential in cancer therapy. The Tumor neovascularization targeting peptide RGD peptide is one of the most studied peptides that binds to the integral protein \u0026alpha;v\u0026beta;3 and acts as a targeting ligand\u0026nbsp;[16]. The emergence of targeting peptides that specifically target tumors has brought new opportunities for the application of bee venom peptides. This allows for the exploration of their diverse cell-damaging abilities under the guidance of targeting peptides to develop novel and promising cancer treatment strategies.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAlthough a large number of target genes have been identified in HCC, the scope of drug therapy solely targeting a single gene is narrow and prone to the emergence of immune escape and drug resistance in tumor cells. Adenovirus, as the most commonly used gene delivery system, offers several advantages and can efficiently express the target protein after inserting exogenous genes. Recombinant viral systems are more efficient at gene delivery than non-viral physicochemical methods of gene delivery. They have larger genomes, higher packaging titers, and are simpler to prepare than other viral vectors, reducing the risk of insertional mutagenesis in the host genome [17]. Therefore, in this experiment, a type 5 recombinant adenovirus capable of expressing TAT, apoptin, RGD and MEL gene sequences will be constructed. The recombinant adenovirus is highly accumulated in tumor tissues by intratumoral injection, leading to the synergistic effect of the dual oncogenes. As a typical tumor with abundant blood perfusion, angiogenesis plays a crucial role in the growth and metastasis of HCC. The tumor-targeting peptide RGD selected for this experiment can specifically target \u0026alpha;v\u0026beta;3 integrin receptors highly expressed in tumor vasculature. MEL can induce apoptosis and lysis of adenovirus-infected tumor cells through non-specific cell membrane lysis, allowing the fusion protein TAT-apoptin to be released into the cytoplasm to exert secondary killing effects. The peptide TAT promotes the internalization of apoptin protein into adjacent cells, triggering tumor cell death through autophagy and mitochondrial apoptosis. Additionally, the RGD targeting peptide guides the specific secondary targeting of MEL to tumor cells, leading to cytolytic effects.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1. Cell culture\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe human cell lines HEK293A and SMMC-7721 were obtained as a gift from Jilin University, while the Huh7 cell line was maintained in the Prevention Laboratory of Tianjin Agricultural College. The HEK293A cell line was cultured in dulbeccos modified eagle medium (DMEM) medium (Hyclone, China) supplemented with 10% fetal bovine serum (Gibco, China), 100 U/mL penicillin, and 100 mg/mL streptomycin (Gibco). SMMC-7721 and L-02 cells were cultured in 1640 medium (Hyclone, China) supplemented with 10% fetal bovine serum (Gibco, China), 100 U/mL penicillin, and 100 mg/mL streptomycin (Gibco, China). All cells were maintained in a 37℃, 5% CO\u003csub\u003e2\u003c/sub\u003e incubator.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2. Construction of a recombinant adenovirus shuttle vector and recombinant adenovirus packaging\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe adenovirus shuttle plasmid GV314-EGFP was linearized by \u003cem\u003eAge\u003c/em\u003eⅠ and \u003cem\u003eNhe\u003c/em\u003eⅠ for adenovirus packaging and amplification. The target genes were seamlessly cloned, transferred to a linearized adenovirus shuttle vector, and identified through Polymerase Chain Reaction (PCR) and sequencing. The constructed adenovirus shuttle plasmid was co-transfected with the\u0026nbsp;AdGloxde13cre plasmid into HEK 293A cells respectively. The cells were then incubated until a large number of them showed the\u0026nbsp;cytopathic effect (CPE) phenomenon, and 50% of the cells were detached.\u003c/p\u003e\n\u003cp\u003eBriefly, HEK 293A cells were seeded at 2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells into 6 cm culture plates (Corning, United States) in DMEM medium containing 10% Fetal Bovine Serum (FBS). After HEK293A cells adhered to the dish, 2 \u0026micro;g of adenovirus shuttle plasmid, 4 \u0026micro;g of AdGloxde13cre plasmid, and\u0026nbsp;8 \u0026micro;l of lipofectine were added to the culture media. The mixture was then incubated for 24 h at 37\u0026deg;C. Following incubation, the culture media were changed every 2\u0026ndash;3 d. The infected HEK 293A cells exhibited a significant CPE on day 14. The cells were collected and cracked by repeated freezing and thawing between 37\u0026deg;C and -80\u0026deg;C three times to release the viral particles.\u0026nbsp;The recovered virus was inoculated into HEK 293A cells with a 90% fusion. The CPE was observed and recorded three days post-incubation, and median tissue culture infective dose (TCID50) was calculated using the\u0026nbsp;Karber\u0026nbsp;method. The four recombinant adenoviruses constructed in this study were named Ad-TAT-apoptin, Ad-RGD-MEL, and Ad-TAT-Apoptin-RGD-MEL.\u0026nbsp;The viruses were then collected and stored at -80\u0026deg;C for future use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3. Reverse transcription-polymerase chain reaction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo confirm successful transcription of the target protein, RNA was extracted from SMMC-7721 cells infected with recombinant adenovirus and then reverted to cDNA. Using cDNA as a template, TAT-apoptin and RGD-MEL were amplified by PCR for validation (TAKARA, Japan). The primers were designed using the gene sequences provided in the National Center for Biotechnology Information Gene Bank and synthesized by Beijing Aoko Biological Engineering Co., Ltd. The sequence of primers is shown in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4. Western Blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSMMC-7721 cells were seeded in 24-well plates, and various recombinant adenoviruses were added for 36 h. Cellular proteins were extracted from the cell lysate, and the protein concentration was determined. Subsequently, the proteins were separated by electrophoresis using a 20% separating gel. Polyvinylidene fluoride (PVDF) membranes were blocked for 2 h and then incubated overnight at 4\u0026deg;C with anti-rabbit monoclonal antibody against Flag (1:5000, Abcam, USA) and goat anti-mouse monoclonal antibody against MYC (1:5000, Abcam, USA) . After washing with phosphate buffered saline（PBS）, the cells were detected with either an anti-goat IgG secondary antibody or an anti-mouse IgG secondary antibody (1:5000, ZEN BIO, China) and exposed using a gel imaging system.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5. Indirect immunofluorescence\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSMMC-7721 cells were seeded into 24-well plates until they reached 70% confluence. Subsequently, various recombinant adenoviruses were separately added and incubated for 36 h. After fixation with 4% paraformaldehyde and permeabilization with 0.5% Triton X-100, the cells were treated with 5% Bovine Serum Albumin Solution (BSA) (Solarbio, China) for 60 min at room temperature to block non-specific binding sites. Cells were incubated with anti-rabbit monoclonal antibody Flag\u0026nbsp;(1:200, Abcam, United States) and goat anti-mouse monoclonal antibody MYC (1:200, Abcam, United States)\u0026nbsp;overnight at 4\u0026deg;C in a humidified chamber. After being washed with PBS, cells were incubated with an anti-goat IgG secondary antibody or an anti-mouse IgG secondary antibody\u0026nbsp;(1:250, ZEN BIO, China) at 37\u0026deg;C for 2 h in the dark. Cells were imaged using a fluorescence microscope\u0026nbsp;(Revolve, Echo-Labs, United States).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6. Cell proliferation assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA cell proliferation reagent kit (Beyotime, China) was used to determine the cell proliferation capacity of various cell lines. Cells were seeded in 96-well plates with a density of 5 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells/well. 0\u0026ndash;1000 multiplicity of infection (MOI) of different recombinant adenoviruses were treated, and cell viability was assessed at 24 h, 48 h, and 72 h according to the manufacturer\u0026apos;s instructions and compared between the different groups.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7. Wound healing assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were seeded in a 6-well plate. When cells reached confluency, each well was scratched with a 200\u0026nbsp;\u0026mu;l pipette tip, creating three lines across each well. The cells were infected with 1000 MOI of recombinant adenovirus, and images were captured using a microscope (Echo Revolve,\u0026nbsp;United States) at 0 h, 3 h, 6 h, 9 h, 12 h, and 24 h after treatment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8. Transwell invasion and cell migration test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Matrixgel thawed slowly on the ice and was diluted with a serum-free medium at a ratio of 1:8. Transwell chambers, which contained a polycarbonate membrane with\u0026nbsp;8.0 \u0026mu;m pores (Corning, United States), were placed in a 24-well plate. An amount of 200 \u0026mu;l of diluted Matrixgel was added to the transwell chamber and incubated at 37℃ for 2 h. Then, the residual medium was removed. The cell concentration was diluted with RPMI-1640 medium without FBS. Subsequently, 150 \u0026mu;l of cell suspension was added to each transwell chamber with the BD Matrigel Basement Membrance Matrix, and 600 \u0026mu;l of\u0026nbsp;RPMI-1640 medium containing 10%\u0026nbsp;FBS was added under the 24-well plate. The cells were then cultured in the incubator for 48 h. Then, the cells in the upper compartment were wiped with cotton swabs, fixed with methanol for 30 min, and stained with 0.1% crystal violet dye for 10 min. The membrane was removed, fixed on a slide, and randomly photographed under a microscope.\u0026nbsp;In the cell migration experiment, all other conditions were identical to those in the invasion experiment, except for the absence of BD Matrigel Basement Membrance Matrix.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9. Scanning electron microscopy (SEM)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells grown on slides were washed with a PBS buffer and fixed with 2.5% glutaraldehyde at 4\u0026deg;C overnight. The sample was dehydrated using a gradient of ethanol concentrations (50%, 70%, 80%, 95%, and 100%). The sample was then sputter-coated with gold-palladium and imaged using a scanning electron microscope (Gemini 300, ZEISS, Germany).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10. Flow cytometry analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSMMC-7721 cells were infected with different recombinant adenoviruses. After 36 h of infection, each group of cells was digested with 0.25% trypsin. The digestion process was terminated by adding a culture medium, and the cells were washed twice with PBS. Cells were collected by centrifugation and suspended in 500 \u0026mu;l of binding buffer. An amount of 5 \u0026mu;l of Annexin APC and 5 \u0026mu;l of 7AAD (Annexin V-APC/7-AAD double-stained apoptosis detection kit, Key GEN Bio Tech, China) were added to the mixture, and cells from each group were incubated in the dark for 15 min. Uninfected SMMC-7721 cells were used as a blank control. The apoptosis rate was determined by flow cytometry (Verse, BD,\u0026nbsp;United States).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.11. Reactive oxygen species staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe\u0026nbsp;reactive oxygen species\u0026nbsp;(ROS) was detected using a ROS assay kit (Key GEN Bio Tech, China) according to the manufacturer\u0026apos;s protocol. The cells were collected and suspended in DCFH-DA. After incubation at 37℃ for 20 min, the cells were observed under a fluorescence microscope (Revolve, Echo-Labs, United States).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.12. TdT-mediated dUTP nick end labeling\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTdT-mediated dUTP nick end labeling (TUNEL) staining of SMMC-7721 cells began by seeding the cells on a 6-well plate and treating them with 1000 MOI recombinant adenovirus for 48 h. After the cells were fixed in 4% paraformaldehyde for 30 min, a 1% Triton X-100 permeable solution was promoted at room temperature for 3\u0026ndash;5 min.\u0026nbsp;The endogenous peroxidase-blocking solution was incubated at room temperature for 10 min. Terminal nucleotidyl transferase (TdT )enzyme reaction solution was added and incubated in the dark at 37℃ for 1 h, followed by the addition of Streptavidin-Horseradish Peroxidase working solution, which was also incubated in the dark at 37℃ for 30 min. The Diaminobenzidine (DAB) working solution was color-developed at room temperature for 0.5\u0026ndash;5 min. After washing with PBS, the sample was observed under the microscope and photographed.\u003c/p\u003e\n\u003cp\u003eTUNEL staining of tumor tissues was performed by dewaxing tumor sections in water, washing with PBS, adding Proteinase K working solution, and incubating at 37℃ for 30 min. Equilibration buffer was added to the 1 \u0026times; equilibration buffer and incubated at room temperature for 10\u0026ndash;30 min. An amount of 50 \u0026mu;L of TdT solution was added to the slices, incubated at 37℃ for 1 h, and washed with PBS three times for 5 min each time. After DAPI staining, the film was sealed and observed under a fluorescence microscope.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.13. Animal xenograft model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSMMC-7721 cells (1 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e/100 \u0026mu;l) were injected subcutaneously into the right axilla of\u0026nbsp;BALB/c nude mice\u0026nbsp;(Charles River, Beijing, China). When the tumors grew to an average diameter of 5 mm, the animals were randomized into five groups and received intratumoral injections of either PBS (100\u0026mu;l), Ad\u003csub\u003eTA\u0026nbsp;\u003c/sub\u003e(2 \u0026times; 10\u003csup\u003e8\u003c/sup\u003epfu/100\u0026mu;l), Ad\u003csub\u003eRD\u0026nbsp;\u003c/sub\u003e(2 \u0026times; 10\u003csup\u003e8\u003c/sup\u003epfu/100\u0026mu;l), Ad\u003csub\u003eTARD\u0026nbsp;\u003c/sub\u003e(2 \u0026times; 10\u003csup\u003e8\u003c/sup\u003epfu/100\u0026mu;l), or Cisplatin (DDP) (60\u0026mu;g/kg), respectively, every two days. The tumor size was measured with a Vernier caliper every two days. Tumor volume was calculated using the formula: V = length \u0026times; width\u003csup\u003e2\u003c/sup\u003e \u0026divide; 2. All experiments were approved by the Ethics Committee of the Institute of Radiation Medicine, Chinese Academy of Medical Sciences. All manipulations were carried out in accordance with the requirements of the Regulations of the Experimental Animal Administration of China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.14. Hematoxylin-eosin staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe samples were fixed with 10% formalin, dehydrated through a graded series of alcohol (50%, 70%, 80%, 95%, and 3\u0026thinsp;\u0026times;\u0026thinsp;100%), embedded in paraffin, and cut at a thickness of 5\u0026thinsp;\u0026micro;m using a microtome. The slides were stained with hematoxylin and eosin (H\u0026amp;E). The HE-stained slides were visualized under a light microscope (Echo Revolve, United States) at 400\u0026times; magnification. Cell nuclei in the HE stain appeared to be blue.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.15. Statistical analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGraphPad Prism 6 (GraphPad, San Diego, United States) was used to generate figures. All quantitative experiments were performed in triplicate and/or repeated three times. Data were expressed as mean \u0026plusmn; standard deviation (SD). The statistical significance between groups was determined by a t-test of variance. A value of \u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05 was considered statistically significant, while a value of \u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01 was considered highly statistically significant.\u003c/p\u003e"},{"header":"3. Result","content":"\u003cp\u003e\u003cstrong\u003e3.1. Construction of adenovirus vectors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe DNA fragments of the TAT, apoptin gene, and RGD, MEL genes were separately inserted into the vector pMD-19T.\u0026nbsp;In addition, the MYC tag was fused with the TAT-apoptin gene, and the Flag tag was fused with the RGD-MEL gene for the detection of target gene expression. Subsequently, the desired DNA fragments were transferred to the adenovirus shuttle vector GV314-CMV-EGFP, yielding the vectors GV314-TAT-apoptin, GV314-RGD-MEL, and GV314-TAT-apoptin-RGD-MEL (Figure 1a). The positive clones were identified through PCR and sequencing. Three bands for the adenovirus shuttle vector were obtained by electrophoresis, with molecular weights of 492 bp, 1424 bp, and 1875 bp, respectively, which were consistent with the theoretical molecular weight of the shuttle vector. This indicates the successful construction of the adenovirus shuttle vectors GV314-TAT-apoptin, GV314-RGD-MEL, and GV314-TAT-apoptin-RGD-MEL (Figure 1b).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2. Packaging and titer determination of recombinant adenovirus\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe successfully constructed recombinant adenovirus plasmids, identified by PCR and DNA sequencing, were selected and transfected into HEK293A cells for packaging with GloxdelE13cre plasmids, respectively. Following conventional culture for 14 d, infected HEK293A cells show a significant CPE and clear fluorescence (Supplementary Figure 1). Following four rounds of amplification, the titers of the successfully packaged Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, Ad\u003csub\u003eTARM\u003c/sub\u003e, and Ad were 10\u003csup\u003e10.75\u003c/sup\u003e pfu/mL, 10\u003csup\u003e10.35\u003c/sup\u003e pfu/mL, 10\u003csup\u003e10.25\u003c/sup\u003e pfu/mL, and 10\u003csup\u003e11\u003c/sup\u003e pfu/mL, respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3. Successful transcription and expression of recombinant adenovirus in SMMC-7721 cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eReverse transcription-polymerase chain reaction (RT-PC), Western Blot (WB), and Immunofluorescence (IF) were used to determine the successful transcription and expression of the recombinant adenovirus target gene in SMMC-7721 cells. Four recombinant adenovirus-infected SMMC7721 cells were collected for RNA extraction and reverse transcription. The TAT-apoptin gene (492 bp), RGD-MEL (1424 bp), and TAT-apoptin-RGD-MEL (1875 bp) were amplified by PCR using specific primers (Figure 1c). The expression of TAT-apoptin and RGD-MEL genes in SMMC-7721 cells infected with recombinant adenovirus was detected using the MYC label expressed through fusion with TAT-apoptin and the Flag label expressed through fusion with RGD-MEL. WB showed that Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, and Ad\u003csub\u003eTARM\u003c/sub\u003e targeted bands at 7 kDa and 16 kDa, respectively (Figure 1e). IF showed that specific blue and red fluorescence was observed for TAT-apoptin and RGD-MEL, respectively, which was not detected in the negative control Ad. These results demonstrate that the recombinant genes could be expressed\u0026nbsp;\u003cem\u003ein\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003evitro\u003c/em\u003e following recombinant adenovirus infection in SMMC-7721 cells and that the protein could retain its antigenic reactivity (Figure 1d).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4. Inhibition of hepatocellular carcinoma cell proliferation by recombinant adenovirus\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ein vitro\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the effect of recombinant adenovirus on SMMC-7721, Huh 7, and L-02 cells, the cells were individually treated with Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, Ad\u003csub\u003eTARM\u003c/sub\u003e, and Ad. After treating Huh7 and SMMC-7721 cells with the recombinant adenoviruses Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, and Ad\u003csub\u003eTARM\u003c/sub\u003e for 48 h, the cell survival rate decreased as the virus dose increased. The Ad\u003csub\u003eTARM\u003c/sub\u003e group significantly decreased cell survival in Huh7 cells at 200 MOI (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01) and in SMMC-7721 cells at 500 MOI (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01), while the same dose had no significant inhibitory effect on L-02 cells (Figure 2a).\u003c/p\u003e\n\u003cp\u003eAs shown in Supplementary Figures 2A and 2B, recombinant adenoviruses Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, and Ad\u003csub\u003eTARM\u003c/sub\u003e showed a time-dependent dependence on Huh7 and SMMC-7721 cells. Overall, Ad\u003csub\u003eTARM\u003c/sub\u003e exhibited the highest inhibitory effects, followed by Ad\u003csub\u003eTA\u003c/sub\u003e and Ad\u003csub\u003eRM\u003c/sub\u003e (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). There was no significant difference between the Ad group and the control group. Overall, the inhibitory effects of Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, and Ad\u003csub\u003eTARM\u003c/sub\u003e on SMMC-7721 and Huh7 cells increased in a dose-dependent and time-dependent manner throughout the experiment, demonstrating significant differences from the Ad control group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5. Recombinant adenovirus inhibits migration and invasion of SMMC-7721 cells\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;in vitro\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effects of recombinant adenoviruses Ad, Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, Ad\u003csub\u003eTARM\u003c/sub\u003e, and PBS on SMMC-7721 cell migration were analyzed using transwell. SMMC-7721 cells infected with recombinant adenovirus were added to the upper chamber of the transwell chamber, and the chamber was removed 24 h later and stained with crystal violet. After statistical analysis, the results showed that the number of cell migrations in the recombinant adenovirus treatment group was significantly reduced compared to that in the Ad and control groups (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01), Ad\u003csub\u003eTARM\u003c/sub\u003e had the most significant effect on FBS-mediated cell chemotactic, and the number of cell migrations was significantly different compared to the recombinant adenovirus Ad\u003csub\u003eTA\u003c/sub\u003e and Ad\u003csub\u003eRM\u003c/sub\u003e treatment groups (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). In the cell migration experiment, we pre-coated Matrigel in a transwell chamber and incubated it at 37℃ for 2 h. After discarding any excess unsolidified Matrigel glue, we added SMMC-7721 cells infected with recombinant adenovirus to the upper chamber of the transwell chamber. The chamber was removed 48 h later, followed by crystal violet staining. The results of the statistical analysis revealed a significant reduction in the number of cell migrations in the recombinant adenovirus treatment group compared to the Ad and control groups (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). Moreover, the cell migration number in the co-expression group was notably lower than that in the recombinant adenovirus Ad\u003csub\u003eTA\u003c/sub\u003e and Ad\u003csub\u003eRM\u003c/sub\u003e treatment groups (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). The co-expression group exhibited the most effective inhibition of invasion in SMMC-7721 cells (Figure 2b).\u003c/p\u003e\n\u003cp\u003eIn addition, we evaluated the effect of recombinant adenovirus on SMMC-7721 cell migration. In the cell scratch experiment, SMMC-7721 cells were infected with recombinant adenoviruses Ad, Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, and Ad\u003csub\u003eTARM\u003c/sub\u003e. The changes in the scratch area at different time points were compared and analyzed. The results showed that, compared with the control group, recombinant adenoviruses Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, and Ad\u003csub\u003eTARM\u003c/sub\u003e significantly inhibited cell migration in SMMC-7721 cells after 12 h (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). The recombinant adenovirus Ad\u003csub\u003eTARM\u003c/sub\u003e treatment group exhibited a lower degree of wound healing and significantly inhibited the migration of SMMC-7721 cells compared to all other treatment groups (Figure 2c,\u0026nbsp;\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01).\u003c/p\u003e\n\u003cp\u003eThe Annexin V flow cytometry method was used to further analyze the apoptosis of SMMC-7721 cells induced by recombinant adenovirus. We found that Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, and Ad\u003csub\u003eTARM\u003c/sub\u003e all induced apoptosis of SMMC-7721 cells at 36 h (Figure 2d, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). In conclusion, compared with the control group, Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, and Ad\u003csub\u003eTARM\u003c/sub\u003e can induce apoptosis in SMMC-7721 cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6. Recombinant adenovirus induces apoptosis in SMMC-7721 cells by increasing ROS content\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSubsequently, to study the changes in oxidative stress in SMMC-7721 cells, those infected with 1000 MOI of Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, Ad\u003csub\u003eTARM\u003c/sub\u003e, and Ad, respectively, were stained with a DHE probe staining solution at\u0026nbsp;36 h. Compared with the Ad and control groups, ROS content was significantly increased in all recombinant adenovirus treatment groups (\u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05), especially in the Ad\u003csub\u003eTARM\u003c/sub\u003e treatment group (Figure 3a). In summary, the recombinant adenoviruses tested showed a significant increase in DHE-specific ROS in SMMC-7721 cells.\u003c/p\u003e\n\u003cp\u003eAn apoptosis-activated endonuclease cleaved nuclear DNA. The TUNEL reagent was used to detect nuclear DNA breakage in SMMC 7721 cells treated with recombinant adenovirus and the PBS control group. The nuclei of the PBS and Ad control groups were almost unstained, while the recombinant adenovirus treatment group showed different degrees of nuclear staining post-administration. The recombinant adenovirus treatment group induced the production of DNA fragments in SMMC-7721 cells (Figure 3b).\u003c/p\u003e\n\u003cp\u003eScanning electron microscopy (SEM) results showed that after recombinant adenovirus infected SMMC-7721 cells for 48 h, the cell folds became rounded, and the pseudopodia microvilli disappeared in the Ad\u003csub\u003eTA\u003c/sub\u003e treatment group. The cells in the Ad\u003csub\u003eRM\u003c/sub\u003e-treated group were slightly atrophic, while those in the Ad\u003csub\u003eTARM\u003c/sub\u003e-treated group exhibited the two deformations mentioned above (Figure 3c).\u003c/p\u003e\n\u003cp\u003eWB was used to detect the expression of apoptotic proteins in SMMC-7721 cells treated with the recombinant adenoviruses Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, and Ad\u003csub\u003eTARM\u003c/sub\u003e. Results showed that, compared with PBS and Ad controls, the Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, and Ad\u003csub\u003eTARM\u003c/sub\u003e groups all induced activation of cleaved caspase-3 protein, increased Bax expression, and decreased Bcl-2 protein (Figure 3d).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.7. Recombinant adenovirus inhibits ectopic tumor growth\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ein vivo\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAd\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, Ad\u003csub\u003eTARM\u003c/sub\u003e, and Ad were administered via intra-tumor injection at a dose of 2 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e pfu/100 \u0026mu;l/mouse once every two days. As shown in Figures 4A and 4B, after five doses, the tumor volume and weight of the recombinant adenovirus-treated group were smaller and lighter than those of the PBS group, indicating that the recombinant adenovirus significantly inhibited the growth of xenografted tumors in mice (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). However, there was no difference between the recombinant adenovirus groups, possibly because of the effect of low-dose administration. The tumor growth rate, final tumor volume, and tumor weight in the DDP group were significantly lower than those in other groups. However, the weight of nude mice was significantly lower than that in other groups, indicating serious side effects (Figure 4a-c).\u003c/p\u003e\n\u003cp\u003eThe tumors from the recombinant adenoviruses Ad\u003csub\u003eTA\u003c/sub\u003e, Ad\u003csub\u003eRM\u003c/sub\u003e, Ad\u003csub\u003eTARM\u003c/sub\u003e, PBS, and cisplatin groups were selected for immunohistochemical staining and TUNEL assay. The TUNEL experiment showed that the apoptosis rate of tumor tissue cells in the Ad\u003csub\u003eTARM\u003c/sub\u003e group was 77.92 \u0026plusmn; 2.86%, which was higher than that in the Ad\u003csub\u003eTA\u0026nbsp;\u003c/sub\u003egroup (74.42 \u0026plusmn; 3.14%) and the Ad\u003csub\u003eRM\u003c/sub\u003e group (59.38 \u0026plusmn; 9.03%). The apoptotic cells were distributed in a flaky pattern, indicating that DNA damage was induced in the tumor tissue after treatment (Figure 4d).\u0026nbsp;Immunohistochemical staining results showed that the expressions of caspase-3, caspase-9, and P53 were increased in tumor tissues treated with recombinant adenovirus. Compared with the Ad\u003csub\u003eTA\u003c/sub\u003e and Ad\u003csub\u003eRM\u003c/sub\u003e treatment groups, the expression of caspase-9 protein was the highest in the Ad\u003csub\u003eTARM\u003c/sub\u003e treatment group (Figure 4f). H\u0026amp;E results showed that there were no obvious heart lesions in the administration groups. Pulmonary congestion was worse than that in the PBS control group, but the symptoms of alveolar wall thickening were alleviated. Mild renal edema was observed in the cisplatin group, but no obvious abnormalities were observed in the other groups. A large number of neutrophils infiltrated the liver in the cisplatin group, while the liver lobular structure was destroyed in the PBS group. No significant abnormalities were observed in the other groups. These results indicate that the recombinant adenovirus can inhibit liver metastasis caused by subcutaneous HCC mice. The boundary of the white medulla of the spleen in the recombinant adenovirus group was clearer and healthier than that in the PBS and cisplatin groups. Tumor tissues in all groups were grade II heterozygous. The tumor cells exhibited moderate aberrations, were susceptible to nucleolar division, and were arranged in ring, or block formations (Supplementary Figure 2d).\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn this study, recombinant adenovirus was used to co-express the apoptin and MEL genes. The transmembrane peptide TAT was fused with apoptin to promote the second internalization of apoptin protein into cancer cells in HCC cells. The targeting peptide RGD was used to target the integrin receptor in HCC vessels and fused with MEL to instruct MEL to specifically kill tumor cells. The non-specific damage to normal tissue was reduced. In conclusion, apoptin was used to specifically induce apoptosis and kill tumor cells through mitochondrial pathways and autophagy. At the same time, apoptin was combined with MEL to lyse the cell membrane of cancer cells and disrupt the complete structural characteristics of the cells, aiming to achieve tumor inhibition through dual-gene coordination.\u003c/p\u003e\n\u003cp\u003eApoptin protein has been widely studied in colorectal cancer\u0026nbsp;[18], HCC\u0026nbsp;[19], lung cancer\u0026nbsp;[20], and other types of cancer. Its potential applications are vast. The process of purifying the obtained protein is complex, expensive, unstable, and not easily absorbed by cells, which limits the direct use of the apoptin protein. Delivery of adenovirus vectors can be highly expressed in tumor cells without the risk of gene integration, and it is simpler than exosomes or self-assembled nanomaterials. This study evaluated the inhibitory effect of recombinant adenovirus on SMMC-7721 cells\u0026nbsp;\u003cem\u003ein vitro\u003c/em\u003e.\u0026nbsp;\u003cem\u003eIn vitro\u003c/em\u003e experiments involved inflecting SMMC-7721 cells with 1000 MOI for 72 h, resulting in a 40% inhibitory effect. In the cell migration and invasion experiment, migration and invasion were significantly inhibited by 50% compared to the control group.\u0026nbsp;In the ectopic mouse models of HCC, tumor tissue growth was inhibited, DNA damage occurred in cells, and the levels of apoptotic proteins caspase-9, caspase-3, and P53 increased.\u0026nbsp;Similar to our results, Yiquan Li et al. constructed apoptin into a recombinant type 5 adenovirus vector to achieve stable and effective protein expression in cells. The results showed a significant increase in the apoptosis and autophagy of HCC cells. Additionally, there was a notable elevation in the level of cell ROS, which mediated autophagy and apoptosis in HCC cells. The apoptosis induced by apoptosis at 24 h was about 30%\u0026nbsp;[21].\u0026nbsp;Xiaoyang Yu et al. found that after incubating HepG-2 cells with apoptin for 72 h, 25% apoptosis was observed. The expression levels of cleaved-PARP and cleaved-caspase-3 were significantly higher, and the ROS levels in HepG-2 cells were significantly increased\u0026nbsp;[22]. The above studies confirm the great potential and application value of apoptin in the treatment of HCC.\u003c/p\u003e\n\u003cp\u003eMEL has been regarded as a promising broad-spectrum antitumor drug, but it still shows obvious toxic side effects in the treatment process, such as non-specific cytolytic activity, hemolytic toxicity, coagulation dysfunction, and allergic reactions, which seriously hinder its wide clinical application\u0026nbsp;[13]. In recent years, the anti-tumor mechanism and targeted delivery strategy of MEL have made great progress, providing the possibility for clinical application. There have been attempts to alter the sequence of MEL or fine-tune the conformation of MEL\u0026nbsp;[23]. Studies have also been conducted on the delivery of MEL using smart nanocarrier strategies to achieve passive or active targeting for the treatment of recurrent and refractory malignancies\u0026nbsp;[24]. The tumor-homing peptide RGD recognizes global proteins present on the surface of cancer cells and specifically targets the vascular region of tumors. In this study, RGD and MEL were fused to reduce the toxic side effects of MEL by leveraging the targeting effect of RGD.\u0026nbsp;Studies have shown that melittin nanoparticles induce apoptosis and necrosis of B16F10 cells\u0026nbsp;\u003cem\u003ein vitro\u003c/em\u003e, inhibit liver metastasis of B16F10, 4T-1, and CT26, prevent metastasis to other organs, and extend the survival of multiple tumor models\u0026nbsp;[25].\u0026nbsp;In addition, similar to our results, Mao Jie et al. found that melittin nanoliposomes can significantly induce apoptosis, with IC50 ranges of 1.44 to 2.1 \u0026mu;M for five HCC cell lines (Bel-7402, SMMC-7721, HepG2, LM-3, and Hepa 1-6 cells). Melittin nano-liposomes (2\u0026mu;M) increased the expression levels of pro-apoptotic proteins (such as Bax and cleaved caspase-3) and decreased the expression levels of anti-apoptotic proteins (including Bcl-2 and PARP) in HepG2 cells. Significant inhibition of HCC growth was also shown in the HepG2 cell ectopic mouse models and the LM-3 cell orthotopic model in nude mouse models\u0026nbsp;[26].\u003c/p\u003e\n\u003cp\u003eThis project investigated the inhibitory effect of recombinant adenovirus on SMMC-7721 cells and an HCC ectopic tumor model\u0026nbsp;\u003cem\u003ein vitro\u003c/em\u003e, elaborated on the expression pattern of the recombinant adenovirus in tumor animal models, and confirmed the targeted therapeutic effect of the recombinant adenovirus on HCC. The results provide ideas and methods for comparative medicine and tumor-targeted gene therapy. In the future, we will increase the dose of subcutaneous ectopic tumors to explore the optimal therapeutic effect of the co-expression treatment group. In addition, we will also perform experiments on orthotopic HCC mouse models and other tumor models.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn summary, we designed and packaged a recombinant adenovirus that co-expresses apoptin and MEL therapeutic genes. We verified its ability to induce HCC cell death through\u0026nbsp;\u003cem\u003ein vitro\u003c/em\u003e and\u0026nbsp;\u003cem\u003ein vivo\u003c/em\u003e experiments. Through multi-level studies, we found that the recombinant adenovirus co-expressing apoptin and MEL therapeutic genes could inhibit the invasion and migration of tumor cells, increase the production of ROS in tumor cells, up-regulate the tumor cell apoptosis-related proteins Bax, caspase-3, and caspase-9, induce tumor cell apoptosis, and inhibit the growth of ectopic hepatocellular carcinoma. Our design utilized two different mechanisms of cytotoxic proteins to synergistically treat tumors, allowing for the possibility of treating multiple tumors regardless of tumor type and heterogeneity.\u003c/p\u003e"},{"header":"Declaration","content":"\u003cp\u003eAuthor Contributions\u003c/p\u003e\n\u003cp\u003eT.M.J., J.Q.W., and D.C.Z. conceived and designed the study. Z.Y.L., X.L., and H.J.L. analyzed the data. J.Q.W. drafted the manuscript. T.M.J. and D.C.Z. revised the manuscript. Funding were provided by D.C.Z. and J.Q.W. All authors reviewed and approved the submitted version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Youth Program of the National Natural Science Foundation of China [grant number 32202760]; the Key Program of Postgraduate Research Innovation of Tianjin [grant number 2019YJSS093]; the Open Fund of Key Laboratory of Smart Breeding (Co-construction by Ministry and Province), Ministry of Agriculture and Rural Affairs [grant number 2023-TJAUKLSBF-2103]; the Research Project of Tianjin Education Commission [grant number 2019KJ032].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eInstitutional Review Board Statement\u003c/p\u003e\n\u003cp\u003eThe study protocol has been reviewed and approved by the Animal Ethical and Welfare Committee of Tianjin Agricultural University (Approval number 2022LLSC25) on 16 March 2022.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations\u0026ensp;Conflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. \u003cem\u003eCA Cancer J Clin\u003c/em\u003e. 2021;71(3):209-249. doi:10.3322/caac.21660\u003c/li\u003e\n\u003cli\u003eSiegel RL, Miller KD, Jemal A. Cancer statistics, 2019. \u003cem\u003eCA Cancer J Clin\u003c/em\u003e. 2019;69(1):7-34. doi:10.3322/caac.21551\u003c/li\u003e\n\u003cli\u003eAndreozzi A, Brunese L, Iasiello M, Tucci C, Vanoli GP. Modeling Heat Transfer in Tumors: A Review of Thermal Therapies. \u003cem\u003eAnn Biomed Eng\u003c/em\u003e. 2019;47(3):676-693. doi:10.1007/s10439-018-02177-x\u003c/li\u003e\n\u003cli\u003eSingh PK, Tiwari AK, Rajmani RS, et al. Apoptin as a Potential Viral Gene Oncotherapeutic Agent. \u003cem\u003eAppl Biochem Biotechnol\u003c/em\u003e. 2015;176(1):196-212. doi:10.1007/s12010-015-1567-5\u003c/li\u003e\n\u003cli\u003eWang Y, Song X, Gao H, et al. C-terminal region of apoptin affects chicken anemia virus replication and virulence. \u003cem\u003eVirol J\u003c/em\u003e. 2017;14(1):38. doi:10.1186/s12985-017-0713-9\u003c/li\u003e\n\u003cli\u003eMaddika S. Cancer-specific toxicity of apoptin is independent of death receptors but involves the loss of mitochondrial membrane potential and the release of mitochondrial cell-death mediators by a Nur77-dependent pathway. \u003cem\u003eJ Cell Sci\u003c/em\u003e. 2005;118(19):4485-4493. doi:10.1242/jcs.02580\u003c/li\u003e\n\u003cli\u003eLiu X, Elojeimy S, El-Zawahry AM, et al. Modulation of Ceramide Metabolism Enhances Viral Protein Apoptin\u0026rsquo;s Cytotoxicity in Prostate Cancer. \u003cem\u003eMol Ther\u003c/em\u003e. 2006;14(5):637-646. doi:10.1016/j.ymthe.2006.06.005\u003c/li\u003e\n\u003cli\u003eMalla WA, Arora R, Khan RIN, Mahajan S, Tiwari AK. Apoptin as a Tumor-Specific Therapeutic Agent: Current Perspective on Mechanism of Action and Delivery Systems. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e. 2020;8(June):1-15. doi:10.3389/fcell.2020.00524\u003c/li\u003e\n\u003cli\u003eWyatt J, Chan YK, Hess M, Tavassoli M, M\u0026uuml;ller MM. Semisynthesis reveals apoptin as a tumour-selective protein prodrug that causes cytoskeletal collapse. \u003cem\u003eChem Sci\u003c/em\u003e. 2023;14(14):3881-3892. doi:10.1039/d2sc04481a\u003c/li\u003e\n\u003cli\u003eYu X, Wang T, Li Y, et al. Apoptin causes apoptosis in HepG-2 cells via Ca2+ imbalance and activation of the mitochondrial apoptotic pathway. \u003cem\u003eCancer Med\u003c/em\u003e. 2023;12(7):8306-8318. doi:10.1002/cam4.5528\u003c/li\u003e\n\u003cli\u003eWagstaff K, Jans D. Protein Transduction: Cell Penetrating Peptides and Their Therapeutic Applications. \u003cem\u003eCurr Med Chem\u003c/em\u003e. 2006;13(12):1371-1387. doi:10.2174/092986706776872871\u003c/li\u003e\n\u003cli\u003eRuben S, Perkins A, Purcell R, et al. Structural and functional characterization of human immunodeficiency virus tat protein. \u003cem\u003eJ Virol\u003c/em\u003e. 1989;63(1):1-8. doi:10.1128/JVI.63.1.1-8.1989\u003c/li\u003e\n\u003cli\u003eLyu C, Fang F, Li B. Anti-Tumor Effects of Melittin and Its Potential Applications in Clinic. \u003cem\u003eCurr Protein Pept Sci\u003c/em\u003e. 2019;20(3):240-250. doi:10.2174/1389203719666180612084615\u003c/li\u003e\n\u003cli\u003eRady I, Siddiqui IA, Rady M, Mukhtar H. Melittin, a major peptide component of bee venom, and its conjugates in cancer therapy. \u003cem\u003eCancer Lett\u003c/em\u003e. 2017;402:16-31. doi:10.1016/j.canlet.2017.05.010\u003c/li\u003e\n\u003cli\u003eJamasbi E, Mularski A, Separovic F. Model Membrane and Cell Studies of Antimicrobial Activity of Melittin Analogues. \u003cem\u003eCurr Top Med Chem\u003c/em\u003e. 2015;16(1):40-45. doi:10.2174/1568026615666150703115919\u003c/li\u003e\n\u003cli\u003eLv X, Zhang C, Shuaizhen Q, Yu R, Zheng Y. Design of integrin \u0026alpha;v\u0026beta;3 targeting self-assembled protein nanoparticles with RGD peptide. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e. 2020;128(February):110236. doi:10.1016/j.biopha.2020.110236\u003c/li\u003e\n\u003cli\u003eZhang C, Zhou D. Adenoviral vector-based strategies against infectious disease and cancer. \u003cem\u003eHum Vaccin Immunother\u003c/em\u003e. 2016;12(8):2064-2074. doi:10.1080/21645515.2016.1165908\u003c/li\u003e\n\u003cli\u003eLiu Z, Li Y, Zhu Y, et al. Apoptin induces pyroptosis of colorectal cancer cells via the GSDME-dependent pathway. \u003cem\u003eInt J Biol Sci\u003c/em\u003e. 2022;18(2):717-730. doi:10.7150/ijbs.64350\u003c/li\u003e\n\u003cli\u003eLi Y, Shang C, Liu Z, et al. Apoptin mediates mitophagy and endogenous apoptosis by regulating the level of ROS in hepatocellular carcinoma. \u003cem\u003eCell Commun Signal\u003c/em\u003e. 2022;20(1):1-15. doi:10.1186/s12964-022-00940-1\u003c/li\u003e\n\u003cli\u003eSong G, Shang C, Zhu Y, et al. Apoptin inhibits glycolysis and regulates autophagy by targeting pyruvate kinase M2 (PKM2) in lung cancer A549 cells. \u003cem\u003eCurr Cancer Drug Targets\u003c/em\u003e. 2022;23:1-14. doi:10.2174/1568009623666221025150239\u003c/li\u003e\n\u003cli\u003eLi Y, Shang C, Liu Z, et al. Apoptin mediates mitophagy and endogenous apoptosis by regulating the level of ROS in hepatocellular carcinoma. \u003cem\u003eCell Commun Signal\u003c/em\u003e. 2022;20(1):134. doi:10.1186/s12964-022-00940-1\u003c/li\u003e\n\u003cli\u003eYu X, Wang T, Li Y, et al. Apoptin causes apoptosis in \u0026lt;scp\u0026gt;HepG\u0026lt;/scp\u0026gt; ‐2 cells via Ca \u003csup\u003e2+\u003c/sup\u003e imbalance and activation of the mitochondrial apoptotic pathway. \u003cem\u003eCancer Med\u003c/em\u003e. 2023;12(7):8306-8318. doi:10.1002/cam4.5528\u003c/li\u003e\n\u003cli\u003eLv Y, Chen X, Chen Z, et al. Melittin Tryptophan Substitution with a Fluorescent Amino Acid Reveals the Structural Basis of Selective Antitumor Effect and Subcellular Localization in Tumor Cells. \u003cem\u003eToxins (Basel)\u003c/em\u003e. 2022;14(7). doi:10.3390/toxins14070428\u003c/li\u003e\n\u003cli\u003eYu X, Jia S, Yu S, et al. Recent advances in melittin-based nanoparticles for antitumor treatment: from mechanisms to targeted delivery strategies. \u003cem\u003eJ Nanobiotechnology\u003c/em\u003e. 2023;21(1):1-22. doi:10.1186/s12951-023-02223-4\u003c/li\u003e\n\u003cli\u003eYu X, Chen L, Liu J, et al. Immune modulation of liver sinusoidal endothelial cells by melittin nanoparticles suppresses liver metastasis. \u003cem\u003eNat Commun\u003c/em\u003e. 2019;10(1):574. doi:10.1038/s41467-019-08538-x\u003c/li\u003e\n\u003cli\u003eMao J, Liu S, Ai M, et al. A novel melittin nano-liposome exerted excellent anti-hepatocellular carcinoma efficacy with better biological safety. \u003cem\u003eJ Hematol Oncol\u003c/em\u003e. 2017;10(1):71. doi:10.1186/s13045-017-0442-y\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table 1","content":"\u003cp\u003eTable1 Primer sequence of target gene\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eTAT-Apoptin F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eGGAGGTGGAGGATCAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eTAT-Apoptin R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eCCTCTTCTGAGATGAGTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eRGD-MEL F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eGACTGCTTCTGCGGTATT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eRGD-MEL R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eTTGTCGTCATCATCCTTATAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"investigational-new-drugs","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"drug","sideBox":"Learn more about [Investigational New Drugs](https://www.springer.com/journal/10637)","snPcode":"10637","submissionUrl":"https://submission.nature.com/new-submission/10637/3","title":"Investigational New Drugs","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"recombinant adenovirus, melittin, apoptin, hepatocellular carcinoma","lastPublishedDoi":"10.21203/rs.3.rs-4301482/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4301482/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"HCC is the most common fatal malignancy. Although surgical resection is the primary treatment strategy, most patients are not eligible for resection due to tumor heterogeneity, underlying liver disease, or comorbidities. Therefore, this study explores the possibility of multi-molecular targeted drug delivery in treating HCC. In this study, we constructed the recombinant adenovirus co-expressing apoptin and melittin (MEL) genes. The inhibitory effect of recombinant adenovirus on hepatocellular carcinoma cells was detected through experiments on cell apoptosis, migration, invasion, and other factors. The tumor inhibitory effect in vivo was assessed using subcutaneous HCC mice. Results showed that recombinant adenovirus co-expressing anti-tumor genes TAT and apoptin, RGD and MEL can significantly inhibit the proliferation, migration, and invasion of HCC cells by inducing an increase in reactive oxygen species (ROS) levels, upregulation of apoptotic proteins such as Bax, caspase-3, and caspase-9, and downregulation of the anti-apoptotic protein Bcl2. In subcutaneous HCC mice, recombinant adenovirus induced significant apoptosis in tumor cells, inhibited tumor growth. In conclusion, recombinant adenovirus co-expressing apoptin and MEL can inhibit the growth and proliferation of tumor cells both in vivo and in vitro.","manuscriptTitle":"A novel recombinant adenovirus expressing apoptin and MEL genes kills hepatocellular carcinoma cells and inhibits the growth and metastasis of ectopic tumors","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-30 22:08:49","doi":"10.21203/rs.3.rs-4301482/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-05-22T16:39:21+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-22T15:44:17+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"30797350467377418905949391016392042654","date":"2024-05-09T12:52:13+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-04-25T11:49:09+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-25T01:41:52+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-25T01:41:52+00:00","index":"","fulltext":""},{"type":"submitted","content":"Investigational New Drugs","date":"2024-04-21T16:06:32+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"investigational-new-drugs","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"drug","sideBox":"Learn more about [Investigational New Drugs](https://www.springer.com/journal/10637)","snPcode":"10637","submissionUrl":"https://submission.nature.com/new-submission/10637/3","title":"Investigational New Drugs","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"91ab7501-76c1-451b-bfc3-ab2b6514a93a","owner":[],"postedDate":"April 30th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-06-12T02:17:04+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-30 22:08:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4301482","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4301482","identity":"rs-4301482","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}