PCGF1 promotes the tumorigenesis of malignancies through upregulating CCDC34 in glioma

PCGF1 promotes the tumorigenesis of malignancies through upregulating CCDC34 in glioma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article PCGF1 promotes the tumorigenesis of malignancies through upregulating CCDC34 in glioma Yuanbing Chen, Jianbing Xiong, Ziran Ou, Tianhao Zhao, Hui Li, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4486121/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Introduction Polycomb group factor 1 (PCGF1) and coiled-coil domain-containing protein 34 (CCDC34) are detected as tumorigenesis of malignancies. However, the function and the prognostic value of PCGF1 and CCDC34 in glioma still remain unclear. Methods Analyzed the data of RNA-seq with the knockdown of PCGF1 in glioma cell lines from GEO database. Explored the correlation of gene expression between PCGF1 and CCDC34 in TCGA, CGGA, and GEO databases. Moreover, RT-qPCR was used to measure the expression of PCGF1 and CCDC34 in glioma specimens. Additionally, Kaplan-Meier analyses were conducted to explore the prognostic value of CCDC34 in glioma. Further, CCDC34 knockdown and PCGF1 overexpressed cell lines were constructed to investigate the effect of CCDC34 and PCGF1 on glioma. The cell growth and colony formation were performed. Results The CCDC34 was significantly downregulated in glioma cell lines with the knockdown of PCGF1 compared to the control group. The expression level of CCDC34 were positive correlation with the grade of WHO in glioma. The outcome of the patients were strongly associated with the expression of CCDC34. The knockdown of CCDC34 was shown to inhibit cell proliferation and colony formation. And a rescue experiment revealed PCGF1 promotes the proliferation of glioma dependent on CCDC34. The analysis of GSEA suggests that the expression of PCGF and CCDC34 were positively correlated with the hypoxia, coagulation, and EMT signaling pathway. Conclusion Our data demonstrated that PCGF1 promotes the proliferation of glioma dependent on CCDC34, which indicated that CCDC34 could be used as a novel potential prognostic marker. Glioma PCGF1 CCDC34 Prognosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Glioma is the most common malignant primary brain tumors, which make up approximately 80% of all malignant central nervous system tumors[ 1 ]. Glioblastoma multiforme (GBM) is the most common and most aggressive subtype of glioma in adult, which the 5-year survival is only about 5.5%, whereas the 10-year survival up to 90% in LGG patients [ 2 , 3 ]. Thus, gliomas with higher grade indicate worse prognosis than lower grade gliomas base on the WHO grading system[ 4 ]. However, the prognosis varies widely among individuals with the same grade is still remained in clinical practice. Polycomb group (PcG) proteins act as a regulator of gene expression, polycomb group ring finger1 (PCGF1) is the member of PcG[ 5 – 7 ]. In previous study, the function of PCGF1 related to regulate the differentiation and self-renewal of hematopoietic cells, and maintain the stemness of embryonic stem (ES) cells[ 8 – 10 ]. And the PCGF1 play a stemness maintainer role in several cancer, such as embryonal carcinoma cells and oral squamous cell carcinomas[ 11 , 12 ]. In addition, PCGF1 also been found to promote the cancer stem cell self-renewal and the proliferation of glioma cell[ 13 , 14 ], which indicating that PCGF1 could become a prognostic biomarker for glioma. The coiled-coil domain-containing 34 (CCDC34), include the coiled-coil domain which have the function of regulating the cell movement and the cellular signal transduction[ 15 ]. Overexpression of CCDC34 would be promote the proliferation and metastasis of hepatocellular carcinoma[ 16 ]. In colorectal cancer, the high expression of CCDC34 that corrected with tumor growth, apoptosis and invasion[ 17 ]. Moreover, it is worth to note that the up-regulated CCDC34 is associated with poor survival in cervical cancer, pancreatic adenocarcinoma, esophageal squamous cell carcinoma[ 18 – 20 ]. However, CCDC34 has not been reported about the expression of CCDC34 in glioma. In this study, we aim to identity the prognosis marker for glioma. According to previously published databases, investigated the relationship between the PCGF1 and CCDC34 as well as the prognostic value of CCDC34 in glioma, then performed the in vitro assay to elucidate the functions of CCDC34 in glioma. Materials & methods Bioinformatics prediction To detect the downstream gene of PCGF1, the data of RNA-seq with the knockdown of PCGF1 in glioma cell lines from GEO database(GSE121463) would be used. The mRNA expression date of PCGF1 and CCDC34 were downloaded from The Cancer Genome Atlas (TCGA) database, CGGA, and GEO, which also be used to analysis and the correlation between PCGF1 and CCDC34. The survival analysis was carried out by the Kaplan-Meier method. Patients in the study 68 patients who had not had any treatment prior to surgery had their tumor tissues removed, and these were kept in a refrigerator at -80°C. The principal glioma that was surgically removed at the Xiangya Hospital between March 2017 and January 2021. The patients were called back or seen in person for follow-up appointments as outpatients. Based on the WHO categorization system, the gliomas were classified as grade II (n = 20), grade III (n = 16), grade IV (n = 32). The Xiangya Hospital's Research Ethics Committee gave its approval for this study((Number: 202112184). Cell culture, plasmids, and shRNAs The DMEM medium (Gibco, #C1995500BT, Switzerland) supplemented with 10% fetal bovine serum (FBS, Sigma, #12103C, USA) was used to cultivate the gliomas cells U251 and SHG44. These cell lines were kept in a humidified environment with 5% CO 2 at 37°C. We acquired nonspecific target control (GV248) and lentiviral shRNA clones targeting human CCDC34 from GeneChem (Shanghai, China). Based on the guidelines provided by the manufacturer, 293T cells were used to create lentiviral particles using Lipofectamine® 2000. Lentivral particles transfected into SHG44 cell lines that had been pre-seeded in six-well plates produced 10 mg/ml polybrene. Using 2 µg/ml of puromycin, colonies that were consistently expressed were chosen. The sequences of shCCDC34#1: TGAAGATGCCCATGATTCA, shCCDC34#2: CCATGGGAGGTGTGGTTTATT. RNA isolation and quantitative real-time PCR (RT-qPCR). With the aid of RNAiso Plus (Takara, #9109, Japan), total RNA was extracted. The PrimeScriptTMRT reagent Kit with gDNA Eraser (Takara, #RR047A, Japan) manufacturer's protocol was followed to isolate the gRNA and reverse transcribe 1 µg of it into cDNA. Using a 7500 Fast Real-Time PCR System (Applied Biosystems, Life Technologies, USA) and Fast Start Universal SYBR Green Master (Roche, #4913914001, Switzerland), RT-qPCR was carried out. The relative gene expression levels were normalized to β-actin. The following primers: PCGF1 forward sequence: ACGAGACACAGCCACTGCTCAA and reverse sequence: TCCAAACCTCGGGACTGGTAGA. CCDC34 forward sequence: AAAGTGGCGAGCCTGAGAGGAA and reverse sequence: ATGGTGTCAGGCGGCTTTCTGG. β-actin forward sequence: CACCATTGGCAATGAGCGGTTC and reverse sequence: AGGTCTTTGCGGATGTCCACGT. Western blot (WB) Immunoprecipitation (IP) lysis buffer was used to precipitate and lyse the glioma cells. 30 mg of total protein were separated by electrophoresis on 10% SDS-PAGE gels and then transferred to PVDF (polyvinylidene fluoride). These membranes were incubated with primary antibody against CCDC34 (Bioss, #bs-8098R, 1:1000, China), PCGF1 (SANTA CRUZ, #sc-515371, 1:1000, USA), and β-actin (Sigma, #A5441, 1:10000, USA). Subsequently, the membranes were incubated for 1 hour at room temperature with the secondary antibodies. The membranes were then washed three times with PBST. Chemiluminescent signals were determined using the ChemiDox XRS + imaging system (Bio-Rad, USA). Cell proliferation assays, migration and invasion assays, colony formation assays Centrifugation was used to precipitate and count the glioma cells. 500 cells per well were seeded onto 96-well plates using complete media (200 µl) supplemented with 10% foetal bovine serum. The CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega, #G3588, USA) was used to measure the vitality of the cells. Moreover, 500 cells were plated on six-well plates with a full medium. To produce colonies, the cells were cultured for 14 days at 37°C in a humidified atmosphere with 5% CO2. The colonies were then dyed with crystal violet for fifteen minutes and preserved with methanol for ten minutes. Image J took a picture of the colonies and counted them. Statistical analysis For statistical analysis, GraphPad Prism8.0 and IBM SPSS Statistical 21.0 were utilized. The independent-samples t-test was utilized to assess the variation in the mRNA expression of CCDC34. Kaplan-Meier analysis was used to determine survival. A p-value of less than 0.05 was deemed statistically significant. Results PCGF1 targets CCDC34 and upregulates its expression in glioma cell lines U87 and U251 To detect the downstream gene of PCGF1, the data of RNA-seq with the knockdown of PCGF1 in glioma cell lines from GEO database (GSE121463) was analyzed. Following data processing, 687 genes were detected with differential expression between the two groups, and a volcano plot visualized these changes, revealing 245 downregulated genes and 422 upregulated genes (Fig. 1 a). From these analysis, we selected the top 20 genes with significant implications for further analysis, CCDC34 was downregulated after the knockdown of PCGF1 in glioma cell lines and been found without any research in glioma (Fig. 1 a). To further demonstrated the relationship between PCGF1 and CCDC34, we analyzed the mRNA expression of PCGF1 and CCDC34 in in the TCGA, CGGA, and GEO datasets, which revealed a positive correlation between their expression levels (Fig. 1 b-d). A similarly relationship was detected in clinical glioma tissues (Fig. 1 e). Notably, overexpression of PCGF1 enhanced CCDC34 expression in U87 and U251 cells (Fig. 1 f). These results showed that the CCDC34 was the downstream gene of PCGF1 in glioma. The mRNA expression levels of CCDC34 in the TCGA, CGGA, and GEO datasets We examined the CCDC34 mRNA expression in various histological grades using data from the TCGA, CGGA, and GEO (GSE43378) databases. Tumor grades and CCDC34 expression showed a positive correlation (Fig. 2 a-c). For instance, grade II gliomas have low levels of CCDC34 mRNA expression. In order to provide additional evidence of CCDC34 expression in gliomas, we isolated the RNA from tissue samples that had been refrigerated at -80°C. Similarly, CCDC34 was shown to be substantially expressed in tumors with higher histological grades by RT-qPCR analysis (Fig. 2 d). When considered together, the tumor grade and the mRNA expression of CCDC34 showed a positive correlation, indicating that CCDC34 may have an oncogenic function in gliomas. High expression of CCDC34 associated with worse prognosis in glioma Kaplan-Meier plots based on the TCGA, CGGA, and GEO(GSE43378) databases were used for the survival study. The findings demonstrated that, in comparison to a high expression of CCDC34, a low expression of CCDC34 was linked to a prolonged survival time (Fig. 3 a-c). The mRNA expression level of CCDC34 was assessed in 68 patients with glioma grades varying. The patients were followed up to determine survival. Higher expression of CCDC34 was consistently linked to a shorter overall survival time. Between the groups with high and low levels of CCDC34 expression, there were notable variations in OS (Fig. 3 d). When considered together, the OS of patients and CCDC34 expression were associated, indicating that CCDC34 play a vital function in the progression of gliomas. Knockdown of CCDC34 inhibits glioma cell growth and colony formation To elucidate the function of PCGF1 in glioma, U251 and U87 cell lines were stable overexpression of PCGF1 by using lentivirus, WB performed to detect the efficiency of knockdown (Fig. 1 f). The MTS assays were performed. Overexpression of PCGF1 in U251 and U87 cell lines was shown to promote cell growth significantly (Fig. 4 a-b). Besides, overexpression of PCGF1 was shown to significantly enhance colony formation in the two cell lines (Fig. 4 ). SHG44 cell lines were stable knockdowns of CCDC34 with two separate sequences by using lentivirus, WB performed to detect the efficiency of knockdown (Fig. 4 e). To determine whether the silencing of CCDC34 affected the ability of proliferation in glioma cells. The MTS assays were performed. Knockdown of CCDC34 in SHG44 cell lines was shown to inhibited cell growth significantly (Fig. 4 f). Besides, downregulated of CCDC34 was shown to significantly decreased colony formation in glioma (Fig. 4 g). These results showed that the expression of CCDC34 affected cell growth, colony formation of glioma cell lines. PCGF1 promotes the proliferation of glioma dependent on CCDC34 To further elucidate the relationship between PCGF1 and CCDC34, a rescue experiment was performed. The results revealed that PCGF1 upregulated the protein of CCDC34, while depletion of CCDC34 in the stably overexpressing PCGF1 cells resulted in downregulation of CCDC34 expression and didn’t affect the expression of PCGF1 (Fig. 5 a). Furthermore, the MTS assays and colony formation assays were performed, we found that PCGF1 promoted the proliferation of glioma, while depletion of CCDC34 in the stably overexpressing PCGF1 cells resulted in inhibiting the ability of the PCGF1 promoted the proliferation in glioma (Fig. 5 b-c), suggesting that PCGF1 promotes the proliferation of glioma dependent on CCDC34. Potential downstream pathways of PCGF1 and CCDC34 In order to preliminarily explore the potential downstream pathways of PCGF1 and CCDC34, both the TCGA and CCGA databases were divided into the high and low expression of PCGF1 and CCDC34 according to the expression level of PCGF1 and CCDC34. GSEA suggests that the expression of TCGA and CCGA were correlated with 8 signaling pathways (Fig. 6 a). Furthermore, we also analyzed the data of RNA-seq with the knockdown of PCGF1 in glioma cell lines from GEO database(GSE121463), and GSEA suggests that the expression of PCGF1 was correlated with the 10 signaling pathway (Fig. 6 b-e). And through analyzing the three data, we found that the expression of PCGF1 and CCDC34 was positively correlated with the hypoxia, coagulation, and EMT signaling pathway (Fig. 6 b-e). Discussion According to the WHO pathologic grading system, gliomas are classified into 4 grades (I-IV), the grade I/II also belong to low-grade gliomas(LGG), while the grade III/IV are classified as high-grade gliomas[ 21 ]. In last decade years, to improve the exact judgement of prognosis and treatment, many studies have focused on finding new biomarkers and pathways in regulating the progression of gliomas[ 22 – 25 ]. However, the ideal prognosis marker and molecular mechanisms remain further studied in glioma. This study explored the potential downstream gene of the PCGF1, and analyzed the expression of CCDC34 in the TCGA, CGGA and GEO databases. The expression of CCDC34 was shown to be positively correlated with the histological grades of gliomas. Further, RT-qPCR revealed that patients with higher histological tumor grades had a higher expression of CCDC34. And a rescue experiment revealed that PCGF1 promotes the proliferation of glioma dependent on CCDC34. These results suggest that PCGF1 promotes the tumorigenesis of malignancies through upregulating CCDC34 in glioma. In previous studies have found that the PCGF1 possesses the ability of accelerating cancer progression[ 26 ]. As for the potential mechanical of PCGF1, the transcriptional repression activity of PCGF1 is one of the most important[ 27 ]. And PCGF1 could interact with other protein and further amplify its suppressive effects[ 26 ]. Interestingly, we found that PCGF1 was able to upregulate the CCDC34 rather than function as the transcriptional repression activity of PCGF1, which indicated that the PCGF1 also can function as the transcriptional promtor in cancer. CCDC34 has been reported as oncogenic properties in some cancers, such as hepatocellular carcinoma, colorectal cancer, and bladder cancer[ 28 ]. The mechanism of CCDC34 in promoting the progression of cancer, which including through regulating the cell movement and the cellular signal transduction[ 15 ]. However, there were no studies exploring the relationship between CCDC34 and cell proliferation in gliomas. In this study, the expression of CCDC34 was detected associated with the progression and prognosis of glioma. In addition, silencing of CCDC34 expression inhibited cell growth and colony formation. The results revealed that CCDC34 promoted cell growth in glioma. CCDC34 was associated with the MAPK and AKT pathways were been reported in previous[ 28 ]. In this study, through GSEA analysis of the TCGA, CGGA, and GEO databases, found that the expression of PCGF1 and CCDC34 was positively correlated with the hypoxia, coagulation, and EMT signaling pathway. Importantly, the hypoxia, coagulation, and EMT pathways played an important role in the development of cancer [ 29 , 30 ]. It was confirmed that CCDC34 plays an oncogene role in glioma. And PCGF1 promotes the proliferation of glioma dependent on CCDC34. It is further speculated that PCGF1 may upregulate the expression of CCDC34 to promote the progression of glioma by affecting the hypoxia, coagulation, and EMT pathways, but the specific mechanism needs to be further studied. Declarations Authors’ Contributions WC and JH designed the study and wrote the paper. YC and JX analyzed the data. YC collected clinical data and performed follow-up. YC and JX performed in vitro experiments. HL, ZO and TZ performed in vivo experiments. All authors contributed to the article and approved the final manuscript. Funding This work was funded by the National Natural Science Foundation of China [82160554(J. Huang)] and the Health Commission Fund of Hunan province [202202014633 (J. Xiong), 202304048972 (W.Cao)]. Data Availability The datasets used analyzed in the present study are included in the manuscript. These data are available in GEO (https://www.ncbi.nlm.nih.gov/geo/), TCGA (https://portal.gdc.cancer.gov/), and CGGA (http://www.cgga.org. cn) databases. The other data analyzed during this study are available from the corresponding author upon reasonable request. Ethics approval and consent to participate The human material was used in this research, which protected the patient’s privacy and met the ethical requirements and was approved by the Research Ethics Committee of the Xiangya hospital (Number: 202112184) and written informed consent was obtained from all subjects. All experiments were conducted according to the relevant guidelines and regulations. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. References Goodenberger ML, Jenkins RB: Genetics of adult glioma. Cancer Genet 2012, 205(12):613–621. Ostrom QT, Gittleman H, Liao P, Vecchione-Koval T, Wolinsky Y, Kruchko C, Barnholtz-Sloan JS: CBTRUS Statistical Report: Primary brain and other central nervous system tumors diagnosed in the United States in 2010–2014. Neuro Oncol 2017, 19(suppl_5):v1-v88. McNeill KA: Epidemiology of Brain Tumors. Neurol Clin 2016, 34(4):981–998. Chen A, Zhong L, Lv J: FOXL1 overexpression is associated with poor outcome in patients with glioma. Oncol Lett 2019, 18(1):751–757. Junco SE, Wang R, Gaipa JC, Taylor AB, Schirf V, Gearhart MD, Bardwell VJ, Demeler B, Hart PJ, Kim CA: Structure of the polycomb group protein PCGF1 in complex with BCOR reveals basis for binding selectivity of PCGF homologs. Structure 2013, 21(4):665–671. Isshiki Y, Iwama A: Emerging role of noncanonical polycomb repressive complexes in normal and malignant hematopoiesis. Exp Hematol 2018, 68:10–14. Scelfo A, Fernandez-Perez D, Tamburri S, Zanotti M, Lavarone E, Soldi M, Bonaldi T, Ferrari KJ, Pasini D: Functional Landscape of PCGF Proteins Reveals Both RING1A/B-Dependent-and RING1A/B-Independent-Specific Activities. Mol Cell 2019, 74(5):1037–1052 e1037. Yan Y, Zhao W, Huang Y, Tong H, Xia Y, Jiang Q, Qin J: Loss of Polycomb Group Protein Pcgf1 Severely Compromises Proper Differentiation of Embryonic Stem Cells. Sci Rep 2017, 7:46276. Oliviero G, Munawar N, Watson A, Streubel G, Manning G, Bardwell V, Bracken AP, Cagney G: The variant Polycomb Repressor Complex 1 component PCGF1 interacts with a pluripotency sub-network that includes DPPA4, a regulator of embryogenesis. Sci Rep 2015, 5:18388. Ross K, Sedello AK, Todd GP, Paszkowski-Rogacz M, Bird AW, Ding L, Grinenko T, Behrens K, Hubner N, Mann M et al : Polycomb group ring finger 1 cooperates with Runx1 in regulating differentiation and self-renewal of hematopoietic cells. Blood 2012, 119(18):4152–4161. Li H, Fan R, Sun M, Jiang T, Gong Y: Nspc1 regulates the key pluripotent Oct4-Nanog-Sox2 axis in P19 embryonal carcinoma cells via directly activating Oct4. Biochem Biophys Res Commun 2013, 440(4):527–532. Zhang P, Zhang Y, Mao L, Zhang Z, Chen W: Side population in oral squamous cell carcinoma possesses tumor stem cell phenotypes. Cancer Lett 2009, 277(2):227–234. Hu PS, Xia QS, Wu F, Li DK, Qi YJ, Hu Y, Wei ZZ, Li SS, Tian NY, Wei QF et al : NSPc1 promotes cancer stem cell self-renewal by repressing the synthesis of all-trans retinoic acid via targeting RDH16 in malignant glioma. Oncogene 2017, 36(33):4706–4718. Yan R, Cui F, Dong L, Liu Y, Chen X, Fan R: Repression of PCGF1 Decreases the Proliferation of Glioblastoma Cells in Association with Inactivation of c-Myc Signaling Pathway. Onco Targets Ther 2020, 13:253–261. Burkhard P, Stetefeld J, Strelkov SV: Coiled coils: a highly versatile protein folding motif. Trends Cell Biol 2001, 11(2):82–88. Lin Z, Qu S, Peng W, Yang P, Zhang R, Zhang P, Guo D, Du J, Wu W, Tao K et al : Up-Regulated CCDC34 Contributes to the Proliferation and Metastasis of Hepatocellular Carcinoma. Onco Targets Ther 2020, 13:51–60. Geng W, Liang W, Fan Y, Ye Z, Zhang L: Overexpression of CCDC34 in colorectal cancer and its involvement in tumor growth, apoptosis and invasion. Mol Med Rep 2018, 17(1):465–473. Liu LB, Huang J, Zhong JP, Ye GL, Xue L, Zhou MH, Huang G, Li SJ: High Expression of CCDC34 Is Associated with Poor Survival in Cervical Cancer Patients. Med Sci Monit 2018, 24:8383–8390. Qi W, Shao F, Huang Q: Expression of Coiled-Coil Domain Containing 34 (CCDC34) and its Prognostic Significance in Pancreatic Adenocarcinoma. Med Sci Monit 2017, 23:6012–6018. Hu DD, Li PC, He YF, Jia W, Hu B: Overexpression of Coiled-Coil Domain-Containing Protein 34 (CCDC34) and its Correlation with Angiogenesis in Esophageal Squamous Cell Carcinoma. Med Sci Monit 2018, 24:698–705. Komori T: The 2016 WHO Classification of Tumours of the Central Nervous System: The Major Points of Revision. Neurol Med Chir (Tokyo) 2017, 57(7):301–311. Cheng Q, Huang C, Cao H, Lin J, Gong X, Li J, Chen Y, Tian Z, Fang Z, Huang J: A Novel Prognostic Signature of Transcription Factors for the Prediction in Patients With GBM. Front Genet 2019, 10:906. Alafate W, Zuo J, Deng Z, Guo X, Wu W, Zhang W, Xie W, Wang M, Wang J: Combined elevation of AURKB and UBE2C predicts severe outcomes and therapy resistance in glioma. Pathol Res Pract 2019, 215(10):152557. Chen Y, Liu Y, Xiong J, Ouyang L, Tang M, Mao C, Li L, Xiao D, Liu S, Yang Z et al : LINC02774 inhibits glycolysis in glioma to destabilize HIF-1alpha dependent on transcription factor RP58. MedComm (2020) 2023, 4(5):e364. Chen Y, Tang M, Xiong J, Gao Q, Cao W, Huang J: GRB10 is a novel oncogene associated with cell proliferation and prognosis in glioma. Cancer Cell Int 2022, 22(1):223. Liang Y, Wu D, Qu Q, Li Z, Yin H: MORC4 plays a tumor-promoting role in colorectal cancer via regulating PCGF1/CDKN1A axis in vitro and in vivo. Cancer Gene Ther 2023, 30(7):985–996. Gong Y, Wang X, Liu J, Shi L, Yin B, Peng X, Qiang B, Yuan J: NSPc1, a mainly nuclear localized protein of novel PcG family members, has a transcription repression activity related to its PKC phosphorylation site at S183. FEBS Lett 2005, 579(1):115–121. Zhou M, Chen X, Bai H, Sun Y, Zhang Z, Li S, Wang X, Zeng M: RABL2A-CCDC34 Axis Promotes Sorafenib Resistance in Hepatocellular Carcinoma. DNA Cell Biol 2021, 40(11):1418–1427. Wei X, Chen Y, Jiang X, Peng M, Liu Y, Mo Y, Ren D, Hua Y, Yu B, Zhou Y et al : Mechanisms of vasculogenic mimicry in hypoxic tumor microenvironments. Mol Cancer 2021, 20(1):7. Cook DP, Wrana JL: A specialist-generalist framework for epithelial-mesenchymal plasticity in cancer. Trends Cancer 2022, 8(5):358–368. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4486121","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":312192034,"identity":"2a034423-37d5-4530-a659-89a74ce0aaab","order_by":0,"name":"Yuanbing Chen","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Yuanbing","middleName":"","lastName":"Chen","suffix":""},{"id":312192035,"identity":"38bf5551-3d88-4145-89fc-6f943378af42","order_by":1,"name":"Jianbing Xiong","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Jianbing","middleName":"","lastName":"Xiong","suffix":""},{"id":312192036,"identity":"6d48eff3-1d75-4d24-8d5c-575e90ce43af","order_by":2,"name":"Ziran Ou","email":"","orcid":"","institution":"The First Affiliated Hospital of University of South China","correspondingAuthor":false,"prefix":"","firstName":"Ziran","middleName":"","lastName":"Ou","suffix":""},{"id":312192037,"identity":"2ac4cf20-a688-474a-a9e9-fef36007b39f","order_by":3,"name":"Tianhao Zhao","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Tianhao","middleName":"","lastName":"Zhao","suffix":""},{"id":312192038,"identity":"78e809c8-81d5-4414-9886-6d428ecd5ad3","order_by":4,"name":"Hui Li","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Hui","middleName":"","lastName":"Li","suffix":""},{"id":312192039,"identity":"bd906aed-f93a-4e68-91bc-6b574cd7327d","order_by":5,"name":"Jun Huang","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Huang","suffix":""},{"id":312192040,"identity":"f90662e8-19e4-4da6-9b5f-33fcd1db8e1b","order_by":6,"name":"Wuyang Cao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0ElEQVRIiWNgGAWjYFAD+cMHDnz4QZIWCbbEgzN7SNPCY3yYg40Ihfzth49J87bZ5clH93w4zMDDIM8vdoCA2WfS0oBakosN75zdcLjAgsFw5uwE/FoMGHLMbvO2MSdubMjdcHgGD0OCwW1CWvjfgLTUA7XkPDjMw0aMFgmwLYcT50vkMBCnReLGs/Sfc84dT9zAc8wAGMgShP3C35982OBNWXXi/Pbmxx8+/LCR55cmoAUMGIHRYXAAYisRysHgDzC9NBCreBSMglEwCkYcAABZ6kiZ8h6i2gAAAABJRU5ErkJggg==","orcid":"","institution":"Changde Hospital, Central South University (The first people’s hospital of Changde city)","correspondingAuthor":true,"prefix":"","firstName":"Wuyang","middleName":"","lastName":"Cao","suffix":""}],"badges":[],"createdAt":"2024-05-27 15:51:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4486121/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4486121/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":58231906,"identity":"09e205f7-6d66-445c-83af-91dbe4c44c10","added_by":"auto","created_at":"2024-06-12 19:31:22","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":525579,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCGF1 targets CCDC34 and upregulates its expression in glioma cell lines U87 and U251\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea) A volcano plot visualized the downstream gene of PCGF1. b-e) The relationship between PCGF1 and CCDC34 were analyzed in the TCGA (b), CGGA (c), GEO(d), and clinical tissue(e). f) The WB was conducted to determine the overexpression of PCGF1 enhanced CCDC34 expression in U87 and U251 cells.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4486121/v1/c638e5369240e24d8c325de9.jpg"},{"id":58231150,"identity":"6fd4a486-cc5a-48e9-9c06-32c9de702a4c","added_by":"auto","created_at":"2024-06-12 19:23:22","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":348151,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe mRNA expression levels of CCDC34 in the TCGA, CGGA, and GEO datasets\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expressions of CCDC34 in glioma were detected in CGGA database(a), TCGA database(b), GEO database(c), and clinical patients (d).\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4486121/v1/6f3287c416e501c800ffc274.jpg"},{"id":58231151,"identity":"1158e556-4109-4179-996c-d9ee1c24dbde","added_by":"auto","created_at":"2024-06-12 19:23:22","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":343786,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHigh expression of CCDC34 associated with worse prognosis in glioma \u003c/strong\u003eKaplan–Meier analysis revealed overall survival (OS) curves of glioma patients with different expressions of CCDC34 in CGGA database(a), TCGA database(b), GEO database(c), and clinical patients (d).\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4486121/v1/a4ebdd7b526e32ab1760c851.jpg"},{"id":58231907,"identity":"f4baf163-575f-4135-ab3c-c560412ef941","added_by":"auto","created_at":"2024-06-12 19:31:22","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":439218,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of CCDC34 inhibits glioma cell growth and colony formation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea-b) The cell viability assay showed that overexpressed of PCGF1 promote cell proliferation of U251(a) and U87(b). c-d) Colony-formation assay of U251 and U87 cells with stably overexpressed of PCGF1. e) The WB was conducted to determine the level of CCDC34 in SHG44. f) Colony-formation assay of SHG44 cells with knockdown of CCDC34 was shown to inhibit the cell proliferation.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4486121/v1/3d9bee2618bf0e2f6c1ef6e0.jpg"},{"id":58231154,"identity":"0cfdd167-a6b8-4175-816d-2bc1117ed8ac","added_by":"auto","created_at":"2024-06-12 19:23:23","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":381247,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCGF1 promotes the proliferation of glioma dependent on CCDC34\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea) A rescue experiment was performed. Depletion of CCDC34 in the stably overexpressing PCGF1 cells resulted in downregulation of CCDC34 expression and didn’t affect the expression of PCGF1. b) The cell viability detected by MTS assay in U251. c) Colony-formation assay in U251.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4486121/v1/ae6df2ca511008feb5a32213.jpg"},{"id":58231155,"identity":"788a0a3f-4d26-406d-abdc-e1da8f5ef23c","added_by":"auto","created_at":"2024-06-12 19:23:23","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":745864,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePotential downstream pathways of PCGF1 and CCDC34\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea) GSEA suggests that the expression of PCGF1 and CCDC34 was correlated with 8 pathways in TCGA and CCGA databases. b) The expression of PCGF1 and CCDC34 was positively correlated with the hypoxia, coagulation, and EMT signaling pathway. c) The expression of PCGF1 and CCDC34 were positively associated with the pathway of hypoxia, coagulation, and EMT signaling pathway in TCGA. d) The expression of PCGF1 and CCDC34 were positively associated with the pathway of hypoxia, coagulation, and EMT signaling pathway in CGGA. e) The downregulated of PCGF1 was positively associated with the pathway of hypoxia, coagulation, and EMT signaling pathway.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4486121/v1/9487fc5c01a7f057066b1c35.jpg"},{"id":58241916,"identity":"9db6f49c-48bd-4ace-9655-3d0352bafd9a","added_by":"auto","created_at":"2024-06-13 01:46:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3381857,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4486121/v1/54238c58-eaab-4416-b988-4dc3951efa58.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"PCGF1 promotes the tumorigenesis of malignancies through upregulating CCDC34 in glioma","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGlioma is the most common malignant primary brain tumors, which make up approximately 80% of all malignant central nervous system tumors[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Glioblastoma multiforme (GBM) is the most common and most aggressive subtype of glioma in adult, which the 5-year survival is only about 5.5%, whereas the 10-year survival up to 90% in LGG patients [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Thus, gliomas with higher grade indicate worse prognosis than lower grade gliomas base on the WHO grading system[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. However, the prognosis varies widely among individuals with the same grade is still remained in clinical practice.\u003c/p\u003e \u003cp\u003ePolycomb group (PcG) proteins act as a regulator of gene expression, polycomb group ring finger1 (PCGF1) is the member of PcG[\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In previous study, the function of PCGF1 related to regulate the differentiation and self-renewal of hematopoietic cells, and maintain the stemness of embryonic stem (ES) cells[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. And the PCGF1 play a stemness maintainer role in several cancer, such as embryonal carcinoma cells and oral squamous cell carcinomas[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. In addition, PCGF1 also been found to promote the cancer stem cell self-renewal and the proliferation of glioma cell[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], which indicating that PCGF1 could become a prognostic biomarker for glioma.\u003c/p\u003e \u003cp\u003eThe coiled-coil domain-containing 34 (CCDC34), include the coiled-coil domain which have the function of regulating the cell movement and the cellular signal transduction[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Overexpression of CCDC34 would be promote the proliferation and metastasis of hepatocellular carcinoma[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In colorectal cancer, the high expression of CCDC34 that corrected with tumor growth, apoptosis and invasion[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Moreover, it is worth to note that the up-regulated CCDC34 is associated with poor survival in cervical cancer, pancreatic adenocarcinoma, esophageal squamous cell carcinoma[\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. However, CCDC34 has not been reported about the expression of CCDC34 in glioma.\u003c/p\u003e \u003cp\u003eIn this study, we aim to identity the prognosis marker for glioma. According to previously published databases, investigated the relationship between the PCGF1 and CCDC34 as well as the prognostic value of CCDC34 in glioma, then performed the in vitro assay to elucidate the functions of CCDC34 in glioma.\u003c/p\u003e"},{"header":"Materials \u0026 methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics prediction\u003c/h2\u003e \u003cp\u003eTo detect the downstream gene of PCGF1, the data of RNA-seq with the knockdown of PCGF1 in glioma cell lines from GEO database(GSE121463) would be used. The mRNA expression date of PCGF1 and CCDC34 were downloaded from The Cancer Genome Atlas (TCGA) database, CGGA, and GEO, which also be used to analysis and the correlation between PCGF1 and CCDC34. The survival analysis was carried out by the Kaplan-Meier method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003ePatients in the study\u003c/h2\u003e \u003cp\u003e68 patients who had not had any treatment prior to surgery had their tumor tissues removed, and these were kept in a refrigerator at -80\u0026deg;C. The principal glioma that was surgically removed at the Xiangya Hospital between March 2017 and January 2021. The patients were called back or seen in person for follow-up appointments as outpatients. Based on the WHO categorization system, the gliomas were classified as grade II (n\u0026thinsp;=\u0026thinsp;20), grade III (n\u0026thinsp;=\u0026thinsp;16), grade IV (n\u0026thinsp;=\u0026thinsp;32). The Xiangya Hospital's Research Ethics Committee gave its approval for this study((Number: 202112184).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCell culture, plasmids, and shRNAs\u003c/h2\u003e \u003cp\u003eThe DMEM medium (Gibco, #C1995500BT, Switzerland) supplemented with 10% fetal bovine serum (FBS, Sigma, #12103C, USA) was used to cultivate the gliomas cells U251 and SHG44. These cell lines were kept in a humidified environment with 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C.\u003c/p\u003e \u003cp\u003eWe acquired nonspecific target control (GV248) and lentiviral shRNA clones targeting human CCDC34 from GeneChem (Shanghai, China). Based on the guidelines provided by the manufacturer, 293T cells were used to create lentiviral particles using Lipofectamine\u0026reg; 2000. Lentivral particles transfected into SHG44 cell lines that had been pre-seeded in six-well plates produced 10 mg/ml polybrene. Using 2 \u0026micro;g/ml of puromycin, colonies that were consistently expressed were chosen. The sequences of shCCDC34#1: TGAAGATGCCCATGATTCA, shCCDC34#2: CCATGGGAGGTGTGGTTTATT.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA isolation and quantitative real-time PCR (RT-qPCR).\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWith the aid of RNAiso Plus (Takara, #9109, Japan), total RNA was extracted. The PrimeScriptTMRT reagent Kit with gDNA Eraser (Takara, #RR047A, Japan) manufacturer's protocol was followed to isolate the gRNA and reverse transcribe 1 \u0026micro;g of it into cDNA. Using a 7500 Fast Real-Time PCR System (Applied Biosystems, Life Technologies, USA) and Fast Start Universal SYBR Green Master (Roche, #4913914001, Switzerland), RT-qPCR was carried out. The relative gene expression levels were normalized to β-actin. The following primers:\u003c/p\u003e \u003cp\u003ePCGF1 forward sequence: ACGAGACACAGCCACTGCTCAA and reverse sequence: TCCAAACCTCGGGACTGGTAGA.\u003c/p\u003e \u003cp\u003eCCDC34 forward sequence: AAAGTGGCGAGCCTGAGAGGAA and reverse sequence: ATGGTGTCAGGCGGCTTTCTGG.\u003c/p\u003e \u003cp\u003eβ-actin forward sequence: CACCATTGGCAATGAGCGGTTC and reverse sequence: AGGTCTTTGCGGATGTCCACGT.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot (WB)\u003c/h2\u003e \u003cp\u003eImmunoprecipitation (IP) lysis buffer was used to precipitate and lyse the glioma cells. 30 mg of total protein were separated by electrophoresis on 10% SDS-PAGE gels and then transferred to PVDF (polyvinylidene fluoride). These membranes were incubated with primary antibody against CCDC34 (Bioss, #bs-8098R, 1:1000, China), PCGF1 (SANTA CRUZ, #sc-515371, 1:1000, USA), and β-actin (Sigma, #A5441, 1:10000, USA). Subsequently, the membranes were incubated for 1 hour at room temperature with the secondary antibodies. The membranes were then washed three times with PBST. Chemiluminescent signals were determined using the ChemiDox XRS\u0026thinsp;+\u0026thinsp;imaging system (Bio-Rad, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation assays, migration and invasion assays, colony formation assays\u003c/h2\u003e \u003cp\u003eCentrifugation was used to precipitate and count the glioma cells. 500 cells per well were seeded onto 96-well plates using complete media (200 \u0026micro;l) supplemented with 10% foetal bovine serum. The CellTiter 96\u0026reg; AQueous One Solution Cell Proliferation Assay (Promega, #G3588, USA) was used to measure the vitality of the cells.\u003c/p\u003e \u003cp\u003eMoreover, 500 cells were plated on six-well plates with a full medium. To produce colonies, the cells were cultured for 14 days at 37\u0026deg;C in a humidified atmosphere with 5% CO2. The colonies were then dyed with crystal violet for fifteen minutes and preserved with methanol for ten minutes. Image J took a picture of the colonies and counted them.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eFor statistical analysis, GraphPad Prism8.0 and IBM SPSS Statistical 21.0 were utilized. The independent-samples t-test was utilized to assess the variation in the mRNA expression of CCDC34. Kaplan-Meier analysis was used to determine survival. A p-value of less than 0.05 was deemed statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003ePCGF1 targets CCDC34 and upregulates its expression in glioma cell lines U87 and U251\u003c/h2\u003e \u003cp\u003eTo detect the downstream gene of PCGF1, the data of RNA-seq with the knockdown of PCGF1 in glioma cell lines from GEO database (GSE121463) was analyzed. Following data processing, 687 genes were detected with differential expression between the two groups, and a volcano plot visualized these changes, revealing 245 downregulated genes and 422 upregulated genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). From these analysis, we selected the top 20 genes with significant implications for further analysis, CCDC34 was downregulated after the knockdown of PCGF1 in glioma cell lines and been found without any research in glioma (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). To further demonstrated the relationship between PCGF1 and CCDC34, we analyzed the mRNA expression of PCGF1 and CCDC34 in in the TCGA, CGGA, and GEO datasets, which revealed a positive correlation between their expression levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb-d). A similarly relationship was detected in clinical glioma tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee). Notably, overexpression of PCGF1 enhanced CCDC34 expression in U87 and U251 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef). These results showed that the CCDC34 was the downstream gene of PCGF1 in glioma.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eThe mRNA expression levels of CCDC34 in the TCGA, CGGA, and GEO datasets\u003c/h2\u003e \u003cp\u003eWe examined the CCDC34 mRNA expression in various histological grades using data from the TCGA, CGGA, and GEO (GSE43378) databases. Tumor grades and CCDC34 expression showed a positive correlation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-c). For instance, grade II gliomas have low levels of CCDC34 mRNA expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn order to provide additional evidence of CCDC34 expression in gliomas, we isolated the RNA from tissue samples that had been refrigerated at -80\u0026deg;C. Similarly, CCDC34 was shown to be substantially expressed in tumors with higher histological grades by RT-qPCR analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). When considered together, the tumor grade and the mRNA expression of CCDC34 showed a positive correlation, indicating that CCDC34 may have an oncogenic function in gliomas.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eHigh expression of CCDC34 associated with worse prognosis in glioma\u003c/h2\u003e \u003cp\u003eKaplan-Meier plots based on the TCGA, CGGA, and GEO(GSE43378) databases were used for the survival study. The findings demonstrated that, in comparison to a high expression of CCDC34, a low expression of CCDC34 was linked to a prolonged survival time (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-c). The mRNA expression level of CCDC34 was assessed in 68 patients with glioma grades varying. The patients were followed up to determine survival. Higher expression of CCDC34 was consistently linked to a shorter overall survival time. Between the groups with high and low levels of CCDC34 expression, there were notable variations in OS (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed). When considered together, the OS of patients and CCDC34 expression were associated, indicating that CCDC34 play a vital function in the progression of gliomas.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eKnockdown of CCDC34 inhibits glioma cell growth and colony formation\u003c/h2\u003e \u003cp\u003eTo elucidate the function of PCGF1 in glioma, U251 and U87 cell lines were stable overexpression of PCGF1 by using lentivirus, WB performed to detect the efficiency of knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef). The MTS assays were performed. Overexpression of PCGF1 in U251 and U87 cell lines was shown to promote cell growth significantly (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-b). Besides, overexpression of PCGF1 was shown to significantly enhance colony formation in the two cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). SHG44 cell lines were stable knockdowns of CCDC34 with two separate sequences by using lentivirus, WB performed to detect the efficiency of knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). To determine whether the silencing of CCDC34 affected the ability of proliferation in glioma cells. The MTS assays were performed. Knockdown of CCDC34 in SHG44 cell lines was shown to inhibited cell growth significantly (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef). Besides, downregulated of CCDC34 was shown to significantly decreased colony formation in glioma (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg). These results showed that the expression of CCDC34 affected cell growth, colony formation of glioma cell lines.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003ePCGF1 promotes the proliferation of glioma dependent on CCDC34\u003c/h2\u003e \u003cp\u003eTo further elucidate the relationship between PCGF1 and CCDC34, a rescue experiment was performed. The results revealed that PCGF1 upregulated the protein of CCDC34, while depletion of CCDC34 in the stably overexpressing PCGF1 cells resulted in downregulation of CCDC34 expression and didn\u0026rsquo;t affect the expression of PCGF1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). Furthermore, the MTS assays and colony formation assays were performed, we found that PCGF1 promoted the proliferation of glioma, while depletion of CCDC34 in the stably overexpressing PCGF1 cells resulted in inhibiting the ability of the PCGF1 promoted the proliferation in glioma (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb-c), suggesting that PCGF1 promotes the proliferation of glioma dependent on CCDC34.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003ePotential downstream pathways of PCGF1 and CCDC34\u003c/h2\u003e \u003cp\u003eIn order to preliminarily explore the potential downstream pathways of PCGF1 and CCDC34, both the TCGA and CCGA databases were divided into the high and low expression of PCGF1 and CCDC34 according to the expression level of PCGF1 and CCDC34. GSEA suggests that the expression of TCGA and CCGA were correlated with 8 signaling pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). Furthermore, we also analyzed the data of RNA-seq with the knockdown of PCGF1 in glioma cell lines from GEO database(GSE121463), and GSEA suggests that the expression of PCGF1 was correlated with the 10 signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb-e). And through analyzing the three data, we found that the expression of PCGF1 and CCDC34 was positively correlated with the hypoxia, coagulation, and EMT signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb-e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAccording to the WHO pathologic grading system, gliomas are classified into 4 grades (I-IV), the grade I/II also belong to low-grade gliomas(LGG), while the grade III/IV are classified as high-grade gliomas[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In last decade years, to improve the exact judgement of prognosis and treatment, many studies have focused on finding new biomarkers and pathways in regulating the progression of gliomas[\u003cspan additionalcitationids=\"CR23 CR24\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. However, the ideal prognosis marker and molecular mechanisms remain further studied in glioma. This study explored the potential downstream gene of the PCGF1, and analyzed the expression of CCDC34 in the TCGA, CGGA and GEO databases. The expression of CCDC34 was shown to be positively correlated with the histological grades of gliomas. Further, RT-qPCR revealed that patients with higher histological tumor grades had a higher expression of CCDC34. And a rescue experiment revealed that PCGF1 promotes the proliferation of glioma dependent on CCDC34. These results suggest that PCGF1 promotes the tumorigenesis of malignancies through upregulating CCDC34 in glioma.\u003c/p\u003e \u003cp\u003eIn previous studies have found that the PCGF1 possesses the ability of accelerating cancer progression[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. As for the potential mechanical of PCGF1, the transcriptional repression activity of PCGF1 is one of the most important[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. And PCGF1 could interact with other protein and further amplify its suppressive effects[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Interestingly, we found that PCGF1 was able to upregulate the CCDC34 rather than function as the transcriptional repression activity of PCGF1, which indicated that the PCGF1 also can function as the transcriptional promtor in cancer.\u003c/p\u003e \u003cp\u003eCCDC34 has been reported as oncogenic properties in some cancers, such as hepatocellular carcinoma, colorectal cancer, and bladder cancer[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The mechanism of CCDC34 in promoting the progression of cancer, which including through regulating the cell movement and the cellular signal transduction[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. However, there were no studies exploring the relationship between CCDC34 and cell proliferation in gliomas. In this study, the expression of CCDC34 was detected associated with the progression and prognosis of glioma. In addition, silencing of CCDC34 expression inhibited cell growth and colony formation. The results revealed that CCDC34 promoted cell growth in glioma.\u003c/p\u003e \u003cp\u003eCCDC34 was associated with the MAPK and AKT pathways were been reported in previous[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In this study, through GSEA analysis of the TCGA, CGGA, and GEO databases, found that the expression of PCGF1 and CCDC34 was positively correlated with the hypoxia, coagulation, and EMT signaling pathway. Importantly, the hypoxia, coagulation, and EMT pathways played an important role in the development of cancer [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. It was confirmed that CCDC34 plays an oncogene role in glioma. And PCGF1 promotes the proliferation of glioma dependent on CCDC34. It is further speculated that PCGF1 may upregulate the expression of CCDC34 to promote the progression of glioma by affecting the hypoxia, coagulation, and EMT pathways, but the specific mechanism needs to be further studied.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWC and JH designed the study and wrote the paper. YC and JX analyzed the data. YC collected clinical data and performed follow-up. YC and JX performed in vitro experiments. HL, ZO and TZ performed in vivo experiments. All authors contributed to the article and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was funded by the National Natural Science Foundation of China [82160554(J. Huang)] and the Health Commission Fund of Hunan province [202202014633 (J. Xiong), 202304048972 (W.Cao)].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used analyzed in the present study are included in the manuscript. These data are available in GEO (https://www.ncbi.nlm.nih.gov/geo/), TCGA (https://portal.gdc.cancer.gov/), and CGGA (http://www.cgga.org. cn) databases. The other data analyzed during this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe human material was used in this research, which protected the patient\u0026rsquo;s privacy and met the ethical requirements and was approved by the Research Ethics Committee of the Xiangya hospital (Number: 202112184) and written informed consent was obtained from all subjects. All experiments were conducted according to the relevant guidelines and regulations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGoodenberger ML, Jenkins RB: Genetics of adult glioma. Cancer Genet 2012, 205(12):613\u0026ndash;621.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOstrom QT, Gittleman H, Liao P, Vecchione-Koval T, Wolinsky Y, Kruchko C, Barnholtz-Sloan JS: CBTRUS Statistical Report: Primary brain and other central nervous system tumors diagnosed in the United States in 2010\u0026ndash;2014. Neuro Oncol 2017, 19(suppl_5):v1-v88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcNeill KA: Epidemiology of Brain Tumors. Neurol Clin 2016, 34(4):981\u0026ndash;998.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen A, Zhong L, Lv J: FOXL1 overexpression is associated with poor outcome in patients with glioma. Oncol Lett 2019, 18(1):751\u0026ndash;757.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJunco SE, Wang R, Gaipa JC, Taylor AB, Schirf V, Gearhart MD, Bardwell VJ, Demeler B, Hart PJ, Kim CA: Structure of the polycomb group protein PCGF1 in complex with BCOR reveals basis for binding selectivity of PCGF homologs. Structure 2013, 21(4):665\u0026ndash;671.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsshiki Y, Iwama A: Emerging role of noncanonical polycomb repressive complexes in normal and malignant hematopoiesis. Exp Hematol 2018, 68:10\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScelfo A, Fernandez-Perez D, Tamburri S, Zanotti M, Lavarone E, Soldi M, Bonaldi T, Ferrari KJ, Pasini D: Functional Landscape of PCGF Proteins Reveals Both RING1A/B-Dependent-and RING1A/B-Independent-Specific Activities. Mol Cell 2019, 74(5):1037\u0026ndash;1052 e1037.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan Y, Zhao W, Huang Y, Tong H, Xia Y, Jiang Q, Qin J: Loss of Polycomb Group Protein Pcgf1 Severely Compromises Proper Differentiation of Embryonic Stem Cells. Sci Rep 2017, 7:46276.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOliviero G, Munawar N, Watson A, Streubel G, Manning G, Bardwell V, Bracken AP, Cagney G: The variant Polycomb Repressor Complex 1 component PCGF1 interacts with a pluripotency sub-network that includes DPPA4, a regulator of embryogenesis. Sci Rep 2015, 5:18388.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoss K, Sedello AK, Todd GP, Paszkowski-Rogacz M, Bird AW, Ding L, Grinenko T, Behrens K, Hubner N, Mann M \u003cem\u003eet al\u003c/em\u003e: Polycomb group ring finger 1 cooperates with Runx1 in regulating differentiation and self-renewal of hematopoietic cells. Blood 2012, 119(18):4152\u0026ndash;4161.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H, Fan R, Sun M, Jiang T, Gong Y: Nspc1 regulates the key pluripotent Oct4-Nanog-Sox2 axis in P19 embryonal carcinoma cells via directly activating Oct4. Biochem Biophys Res Commun 2013, 440(4):527\u0026ndash;532.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang P, Zhang Y, Mao L, Zhang Z, Chen W: Side population in oral squamous cell carcinoma possesses tumor stem cell phenotypes. Cancer Lett 2009, 277(2):227\u0026ndash;234.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu PS, Xia QS, Wu F, Li DK, Qi YJ, Hu Y, Wei ZZ, Li SS, Tian NY, Wei QF \u003cem\u003eet al\u003c/em\u003e: NSPc1 promotes cancer stem cell self-renewal by repressing the synthesis of all-trans retinoic acid via targeting RDH16 in malignant glioma. Oncogene 2017, 36(33):4706\u0026ndash;4718.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan R, Cui F, Dong L, Liu Y, Chen X, Fan R: Repression of PCGF1 Decreases the Proliferation of Glioblastoma Cells in Association with Inactivation of c-Myc Signaling Pathway. Onco Targets Ther 2020, 13:253\u0026ndash;261.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurkhard P, Stetefeld J, Strelkov SV: Coiled coils: a highly versatile protein folding motif. Trends Cell Biol 2001, 11(2):82\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin Z, Qu S, Peng W, Yang P, Zhang R, Zhang P, Guo D, Du J, Wu W, Tao K \u003cem\u003eet al\u003c/em\u003e: Up-Regulated CCDC34 Contributes to the Proliferation and Metastasis of Hepatocellular Carcinoma. Onco Targets Ther 2020, 13:51\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeng W, Liang W, Fan Y, Ye Z, Zhang L: Overexpression of CCDC34 in colorectal cancer and its involvement in tumor growth, apoptosis and invasion. Mol Med Rep 2018, 17(1):465\u0026ndash;473.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu LB, Huang J, Zhong JP, Ye GL, Xue L, Zhou MH, Huang G, Li SJ: High Expression of CCDC34 Is Associated with Poor Survival in Cervical Cancer Patients. Med Sci Monit 2018, 24:8383\u0026ndash;8390.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi W, Shao F, Huang Q: Expression of Coiled-Coil Domain Containing 34 (CCDC34) and its Prognostic Significance in Pancreatic Adenocarcinoma. Med Sci Monit 2017, 23:6012\u0026ndash;6018.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu DD, Li PC, He YF, Jia W, Hu B: Overexpression of Coiled-Coil Domain-Containing Protein 34 (CCDC34) and its Correlation with Angiogenesis in Esophageal Squamous Cell Carcinoma. Med Sci Monit 2018, 24:698\u0026ndash;705.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKomori T: The 2016 WHO Classification of Tumours of the Central Nervous System: The Major Points of Revision. Neurol Med Chir (Tokyo) 2017, 57(7):301\u0026ndash;311.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng Q, Huang C, Cao H, Lin J, Gong X, Li J, Chen Y, Tian Z, Fang Z, Huang J: A Novel Prognostic Signature of Transcription Factors for the Prediction in Patients With GBM. Front Genet 2019, 10:906.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlafate W, Zuo J, Deng Z, Guo X, Wu W, Zhang W, Xie W, Wang M, Wang J: Combined elevation of AURKB and UBE2C predicts severe outcomes and therapy resistance in glioma. Pathol Res Pract 2019, 215(10):152557.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Liu Y, Xiong J, Ouyang L, Tang M, Mao C, Li L, Xiao D, Liu S, Yang Z \u003cem\u003eet al\u003c/em\u003e: LINC02774 inhibits glycolysis in glioma to destabilize HIF-1alpha dependent on transcription factor RP58. \u003cem\u003eMedComm (2020)\u003c/em\u003e 2023, 4(5):e364.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Tang M, Xiong J, Gao Q, Cao W, Huang J: GRB10 is a novel oncogene associated with cell proliferation and prognosis in glioma. Cancer Cell Int 2022, 22(1):223.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang Y, Wu D, Qu Q, Li Z, Yin H: MORC4 plays a tumor-promoting role in colorectal cancer via regulating PCGF1/CDKN1A axis in vitro and in vivo. Cancer Gene Ther 2023, 30(7):985\u0026ndash;996.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGong Y, Wang X, Liu J, Shi L, Yin B, Peng X, Qiang B, Yuan J: NSPc1, a mainly nuclear localized protein of novel PcG family members, has a transcription repression activity related to its PKC phosphorylation site at S183. FEBS Lett 2005, 579(1):115\u0026ndash;121.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou M, Chen X, Bai H, Sun Y, Zhang Z, Li S, Wang X, Zeng M: RABL2A-CCDC34 Axis Promotes Sorafenib Resistance in Hepatocellular Carcinoma. DNA Cell Biol 2021, 40(11):1418\u0026ndash;1427.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei X, Chen Y, Jiang X, Peng M, Liu Y, Mo Y, Ren D, Hua Y, Yu B, Zhou Y \u003cem\u003eet al\u003c/em\u003e: Mechanisms of vasculogenic mimicry in hypoxic tumor microenvironments. Mol Cancer 2021, 20(1):7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCook DP, Wrana JL: A specialist-generalist framework for epithelial-mesenchymal plasticity in cancer. Trends Cancer 2022, 8(5):358\u0026ndash;368.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Glioma, PCGF1, CCDC34, Prognosis","lastPublishedDoi":"10.21203/rs.3.rs-4486121/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4486121/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eIntroduction\u003c/h2\u003e \u003cp\u003ePolycomb group factor 1 (PCGF1) and coiled-coil domain-containing protein 34 (CCDC34) are detected as tumorigenesis of malignancies. However, the function and the prognostic value of PCGF1 and CCDC34 in glioma still remain unclear. \u003cb\u003eMethods\u003c/b\u003e Analyzed the data of RNA-seq with the knockdown of PCGF1 in glioma cell lines from GEO database. Explored the correlation of gene expression between PCGF1 and CCDC34 in TCGA, CGGA, and GEO databases. Moreover, RT-qPCR was used to measure the expression of PCGF1 and CCDC34 in glioma specimens. Additionally, Kaplan-Meier analyses were conducted to explore the prognostic value of CCDC34 in glioma. Further, CCDC34 knockdown and PCGF1 overexpressed cell lines were constructed to investigate the effect of CCDC34 and PCGF1 on glioma. The cell growth and colony formation were performed.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe CCDC34 was significantly downregulated in glioma cell lines with the knockdown of PCGF1 compared to the control group. The expression level of CCDC34 were positive correlation with the grade of WHO in glioma. The outcome of the patients were strongly associated with the expression of CCDC34. The knockdown of CCDC34 was shown to inhibit cell proliferation and colony formation. And a rescue experiment revealed PCGF1 promotes the proliferation of glioma dependent on CCDC34. The analysis of GSEA suggests that the expression of PCGF and CCDC34 were positively correlated with the hypoxia, coagulation, and EMT signaling pathway.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOur data demonstrated that PCGF1 promotes the proliferation of glioma dependent on CCDC34, which indicated that CCDC34 could be used as a novel potential prognostic marker.\u003c/p\u003e","manuscriptTitle":"PCGF1 promotes the tumorigenesis of malignancies through upregulating CCDC34 in glioma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-12 19:23:18","doi":"10.21203/rs.3.rs-4486121/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1744ad62-465e-41a7-9060-30c96cd3ca86","owner":[],"postedDate":"June 12th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-21T08:39:15+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-12 19:23:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4486121","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4486121","identity":"rs-4486121","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}