Comparison of the Effects of Xenograft Bone Granules Containing and Lacking Hyaluronic Acid on the Viability, Proliferation, and Differentiation of MG-63 Osteoblast-Like Cells: An In Vitro Study

preprint OA: closed
Full text JSON View at publisher
Full text 85,814 characters · extracted from preprint-html · click to expand
Comparison of the Effects of Xenograft Bone Granules Containing and Lacking Hyaluronic Acid on the Viability, Proliferation, and Differentiation of MG-63 Osteoblast-Like Cells: An In Vitro Study | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Comparison of the Effects of Xenograft Bone Granules Containing and Lacking Hyaluronic Acid on the Viability, Proliferation, and Differentiation of MG-63 Osteoblast-Like Cells: An In Vitro Study Surena Vahabi, Maryam Torshabi, Ehsan Chegeni This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7458194/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract Background : The therapeutic goal in periodontology is to preserve teeth and restore hard and soft tissues lost to periodontal disease. High–molecular–weight hyaluronic acid (HA) can stimulate bone formation during the wound-healing phase. One emerging approach in maxillofacial regenerative therapy is combining HA with xenogeneic bone grafts. This in vitro study compared the biological effects of an HA-enriched bovine bone xenograft (Cerabone® Plus) with those of a non-HA bovine bone xenograft (Cerabone® Granulate) on MG‑63 osteoblast-like cell viability, proliferation, migration, and osteogenic differentiation. Methods : Two bovine bone xenograft types—Cerabone® Plus (0.5–1 mm granule, HA-enriched) and Cerabone® Granulate (0.5–1 mm, without HA)—were tested. Extracts from each sample were prepared after 24 h and 72 h of incubation in culture medium. Cell viability and proliferation were assessed via a methyl-thiazolyl tetrazolium (MTT) assay after exposure to undiluted, half, and quarter dilutions. Migration was examined via the scratch wound-healing assay at 24 h and 48 h. Osteogenic differentiation was evaluated viaquantitative real-time PCR for alkaline phosphatase (ALP), osteopontin (OP), and osteocalcin (OC). Statistical analysis was performed via one-way ANOVA with Tukey's post hoc test via GraphPad Prism (p0.05). After 72 h of exposure to the extracts for 24 h, Cerabone® Plus maintained significantly greater viability than Cerabone® Granulate did (p<0.05). After 72 h of exposure to the extracts, viability was significantly greater for Cerabone® Granulate at the half- and quarter-fold dilutions (p<0.05). At 48 h,scratch closure, migration and proliferation were lower in the Cerabone® Granulate group than in the Cerabone® Plus and control groups. Gene expression analysis revealed no significant difference in ALP between the groups, but OP and OC were significantly greater in the Cerabone® Plus group (p<0.05), suggesting accelerated osteoblastic maturation. Conclusions : Within the constraints of this in vitro design, HA-enriched bovine xenografts (Cerabone® Plus) promoted faster migration and greater late-stage osteogenic differentiation of MG‑63 cells thannon-HA xenografts did. Hyaluronic acid Xenograft Cell proliferation Cell differentiation MTT assay Real-time PCR Figures Figure 1 Background Periodontal disease is one of the most common oral pathologies worldwide, leading to the progressive destruction of tooth‑supporting tissues. The primary objective of periodontal therapy is to preserve tooth function and regenerate lost structures [ 1 – 3 ]. In recent years, tissue engineering using biological scaffolds has emerged as a promising strategy for restoring bone defects [ 4 , 5 ]. Among these, xenogeneic bone grafts are widely employed, and their biological properties are largely determined by their origin and composition [ 6 ]. Hyaluronic acid (HA), a glycosaminoglycan of the extracellular matrix, is abundant in the gingiva and periodontal ligament [ 7 – 10 ]. In addition to its structural role, high‑molecular‑weight HA modulates cellular activities, promotes angiogenesis, and enhances osteogenesis during wound repair [ 11 , 12 ]. Cell-free bone substitutes, which are inherently osteoconductive, can acquire osteogenic potential when supplemented with bioactive agents such as concentrated growth factor (CGF) or HA. Notably, HA, as a carrier for recombinant human bone morphogenetic protein‑2 (rhBMP‑2), has shown remarkable efficacy in advanced alveolar ridge augmentation [ 13 , 14 ]. Clinical applications of HA in nonsurgical periodontal therapy, regenerative procedures, and peri-implantitis management have also yielded favorable outcomes [ 15 – 17 ]. Despite these findings, few in vitro studies have systematically investigated the effects of HA‑enriched xenografts on osteoblast gene expression profiles. To address this gap, the present study evaluated and compared the viability, proliferation, and osteoblastic differentiation of MG‑63 cells cultured with xenograft bone granules containing or lacking HA. The outcomes of such investigations may assist periodontists and oral and maxillofacial surgeons in selecting appropriate biomaterials and, on the basis of in vitro evidence, may facilitate the development of well-designed randomized clinical trials in this field. Methods In this in vitro experimental study, two commercially available bovine-derived xenografts were evaluated: Cerabone® Plus granules (0.5–1.0 mm; Botiss Biomaterials GmbH, Zossen, Germany), containing hyaluronic acid (HA), and Cerabone® Granulate granules (0.5–1.0 mm; Botiss Biomaterials GmbH, Zossen, Germany), without HA. Human osteoblast-like MG-63 cells were obtained from the Pasteur Institute Cell Bank (Tehran, Iran) and used for all the assays. Cell viability, proliferation, and cytotoxicity (MTT assay ) Material extracts were prepared according to ISO‑10993‑12 (2021): 0.2 g of granules in 1 mL of DMEM supplemented with 10% FBS (Gibco, UK) were incubated at 37 °C, 95% humidity, and 5% CO₂ for 24 h or 72 h. MG‑63 cells (2,500/well in 96‑well plates) were exposed to undiluted and diluted extracts (100%, 50%, 25%) for 24 h and 72 h and analyzed via the MTT assay (ISO‑10993‑5; 2009). Optical density (OD) was measured at 570 nm, and viability (%) was calculated relative to that of negative controls (untreated cells). Cytotoxicity was defined as viability < 70%. Cell Migration and Wound Healing (Scratch Assay) Human osteoblasts‑like MG‑63 cells (in the logarithmic growth phase) were seeded at a density of 8 × 10⁴ cells/well in 24‑well tissue culture plates (SPL Life Sciences, Korea) containing complete culture medium (Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin). After 24 h of incubation at 37°C in a humidified 5% CO₂ atmosphere, the cells reached full confluence (100% monolayer coverage). A linear vertical scratch (time 0 h) was introduced into each well via a sterile 10‑µL pipette tip (Axygen, USA). The detached cells were removed by washing twice with complete culture medium. The cells were then incubated either with culture medium alone (control) or with a 1:2 dilution (v/v) of extracts prepared from Cerabone® granules (Botiss Biomaterials GmbH, Germany). Wound closure was assessed at 0, 24, and 48 h post‑scratch. At each time point, the culture medium was removed, and the cells were washed twice with ice‑cold PBS containing Ca²⁺ and Mg²⁺ (PBS). Fixation was performed by adding 500 µL of pre‑chilled (−20 °C) 100% methanol to each well for 10 min at room temperature. The methanol was aspirated, and 0.5% (w/v) crystal violet solution (Sigma‑Aldrich, USA) was added for 10 min on an orbital shaker at room temperature. Excess dye was removed, and the cells were washed three times with deionized water. Digital micrographs of the scratch area were captured at ×4 magnification via an inverted light microscope (Olympus CKX53, Japan). Wound gap distances were quantified in inches via ImageJ software (National Institutes of Health, USA). Osteogenic Differentiation and Gene Expression (qPCR) MG‑63 cells (25,000/well, 24‑well plates) were treated with 1:2 dilutions of 24‑h extracts for 72 h. Negative controls received complete medium; positive controls received osteogenic medium (10 mM β-glycerophosphate, 10 nM dexamethasone, and 200 µM ascorbic acid). Total RNA was extracted (RNeasy Mini Plus Kit, Qiagen), and cDNA was synthesized (QuantiTect Reverse Transcription Kit, Qiagen). Quantitative RT‑PCR (SYBR Green, Ampliqon, Denmark) was performed for ALP, osteopontin (OPN), osteocalcin (OCN), and GAPDH (housekeeping gene) via an Applied Biosystem thermocycler at 60 °C. Gene expression was normalized to that of GAPDH and analyzed via the 2^−ΔΔCt method (Table 1). Table 1. The primers used to assess the expression of the genes under study. Gene name Sequence (5' ->3') Product Length (bp) Alkaline Phosphatase (ALP) F: ATTTCTCTTGGGCAGGCAGAGAGT 118 R: ATCCAGAATGTTCCACGGAGGCTT Osteopontin (OP) F: AGAATGCTGTGTCCTCTGAAG 146 R: GTTCGAGTCAATGGAGTCCTG Osteocalcin (OC) F: CAGCGAGGTAGTGAAGAGAC 144 R: TGAAAGCCGATGTGGTCAG R: GATGTCAAACTCACTCATGGCT GAPDH F: GGAGCGAGATCCCTCCAAAAT 197 R: GGCTGTTGTCATACTTCTCATGG Statistical analysis All experiments were performed in triplicate with at least three independent repetitions. The data are expressed as the means ± SD. One‑way ANOVA with Tukey's post hoc test (GraphPad Prism v9) was used, with statistical significance set at p < 0.05. Results Cell viability, proliferation, and cytotoxicity (MTT assay ) After 24 h of exposure to 24‑h or 72‑h material extracts (undiluted or diluted to 50% and 25%), MG‑63 cell viability did not significantly differ among the Cerabone® Plus, Cerabone® Granulate, and control groups (p > 0.05), maintaining values near 100% (Graph 1A, 1 B). After 72 h of exposure to the 24‑h extracts, the viability of the diluted extracts remained ~100% across the groups. However, compared with the control extracts, the undiluted extracts reduced viability by ~10–20% (p < 0.05). This reduction was more pronounced for Cerabone® Granulate than for Cerabone® Plus (p < 0.05) but did not meet the ISO‑10993‑5 cytotoxicity thresholds (< 70%). For the 72 h extracts, Cerabone® Granulate full‑strength reduced viability to ~36% (p < 0.05 vs. control), whereas Cerabone® Plus extracts (all concentrations) produced 40–60% viability (p < 0.05). Notably, the effects of the full‑strength extracts from both groups were less than the 70% cytotoxicity threshold. In the diluted form, Cerabone® Granulate maintained greater viability than Cerabone® Plus did (p < 0.05). On the basis of these results, 1:2 diluted 24‑h extracts were selected for subsequent assays (Graph 1C, 1 D). Cell Migration and Wound Closure (Scratch Assay) At 24 h, the migration rates were similar across all the groups (~70%). At 48 h, Cerabone® Plus matched the control performance, achieving complete wound closure. Compared with both Cerabone® Plus and the controls, Cerabone® Granulate resulted in slower migration and incomplete closure (Fig. 1; Graph 2). Osteogenic Differentiation of MG‑63 Cells As shown in graph 3, alkaline phosphatase (ALP) gene expression was significantly greater in the positive control and both Cerabone groups than in the negative control, with the positive control exceeding both Cerabone materials (p < 0.05). Notably, osteopontin (OPN) and osteocalcin (OC) expression did not differ significantly between the positive and negative controls, whereas both cerabone groups presented significantly elevated levels, indicating a shift from the proliferative phase to osteogenic differentiation. While ALP expression—a marker of early differentiation—was comparable between the two Cerabone groups, OPN and OC—late-stage differentiation markers—were significantly greater in the Cerabone® Plus group than in the Cerabone® Granulate group, suggesting accelerated and enhanced maturation. Discussion This in vitro analysis evaluated the influence of two commercially available bovine xenografts—Cerabone® Granulate, without hyaluronic acid (HA), and Cerabone® Plus, enriched with HA—on the cellular behavior of MG‑63 osteoblast-like cells. The cell responses assessed included viability, proliferation, migration, and osteogenic differentiation. The use of the MG‑63 cell line offers the advantages of reproducibility and comparability with a substantial number of prior studies; however, primary human osteoblasts or mesenchymal stem cells may display different profiles under similar experimental conditions. Given the increasing incorporation of HA into bone biomaterials used for periodontal and peri-implant site development, these findings merit comparison with other investigations in this field. Following ISO 10993-12 guidelines, an indirect contact (extract-based) approach was used to assess the interaction between the graft materials and MG-63 cells. Extracts were collected after 24 and 72 hours of incubation in serum-containing culture medium to capture a wide spectrum of potentially released components. Both undiluted (100%) and diluted (50% and 25%) extracts were tested to mimic physiological dilution by body fluids in vivo . Acute (24 h) and subchronic (72 h) exposures were performed to assess the cytotoxicity profiles. No significant cytotoxicity (> 30% reduction in viability) was observed for either material after 24 h of exposure. However, at 72 h, undiluted extracts—particularly from the 72-hour collection—had reduced cell viability. On the basis of these findings, 50% dilutions of 24-hour extracts were selected for migration and differentiation assays. The MTT assay results confirmed that both Cerabone® Granulate and Cerabone® Plus were highly cytocompatible. At 24 h, no significant differences were detected between the two materials. By 72 h, however, undiluted extracts from Cerabone® Plus supported higher cell viability than those from Cerabone® Granulate. However, no prior in vitro study has directly compared these two specific xenografts in MG-63 cells. Kyyak et al. (2021) reported that Cerabone® Plus (0.5–1 mm granules) promoted greater viability, migration, and proliferation of human osteoblasts than Cerabone® (1–2 mm granules) did at days 3, 7, and 10 [ 18 ]. Similarly, Qasim et al. (2024) reported that Cerabone® Plus outperformed Cerabone®, Bio-Oss®, and Straumann Xenograft® in supporting human osteoblast viability up to day 10 [ 19 ]. Collectively, these findings indicate that the addition of HA improves the cytocompatibility profile of bovine xenografts. Additional parallels were reported by Boeckel et al . (2012), where HA, when combined with platelet-rich plasma (PRP) and thrombin in a hydroxyapatite-based composite, achieved the highest cell viability among the tested conditions [ 20 ]. In cementoblast cultures, Hakki et al. (2024) reported that HA, particularly at optimized dilutions (1:2 to 1:8), promoted viability, migration, and mineralized nodule formation [ 21 ]. Together, these findings suggest that HA integration in xenografts enhances compatibility with osteogenic and cementogenic cells, potentially translating to improved regenerative outcomes in periodontal therapy. The effect of HA on osteoblastic cells is well documented. Boeckel et al. (2014) demonstrated that HA-containing constructs could support 67–79% viability depending on the presence of platelet-rich plasma and thrombin [ 20 ]. More recently, Hakki et al. (2024) reported that HA enhanced viability, migration, and mineral nodule formation in murine cementoblasts (OCCM-30) in a dose-dependent manner [ 21 ]. Cell migration is a fundamental component of regenerative success, influencing both initial defect repopulation and integration with host tissues. In our scratch assay, MG-63 cells were exposed to 50% diluted, 24-hour extracts. Cerabone® Plus demonstrated a superior ability to promote wound closure, particularly at 48 h, indicating enhanced proliferative and migratory responses in the postmigration phase. These findings are consistent with in vivo evidence suggesting that xenografts release chemotactic mediators such as MCP-1, which recruit monocytes, macrophages, and progenitor cells to the regenerative site. HA likely potentiates this effect via interaction with CD44 receptors, triggering PI3K/AKT and MAPK signaling cascades that regulate cytoskeletal reorganization and motility (22–24). Qasim et al. (2024) reported that HA not only induced MCP-1 release but also increased growth factor activity [ 19 ]. HA concentration and structural properties influence its bioactivity. Nguyen et al. (2024) demonstrated that HA at 6 mg/mL enhanced the proliferation and migration of human gingival fibroblasts while maintaining > 70% viability [ 25 ], which aligns with our observations of accelerated MG-63 migration. Differentiation was evaluated through early (alkaline phosphatase, ALP) and late (osteopontin, OP; osteocalcin, OC) osteogenic gene expression. ALP gene expression did not differ significantly between the groups by day 3; however, the OP and OC levels were markedly greater with Cerabone Plus. These findings indicate that HA may accelerate progression toward a mineralization phenotype even in preosteoblast cell lines. ALP typically peaks during the transition from proliferation to matrix maturation and then decreases as cells enter the mineral deposition stage. The upregulation of OC and OP in the HA group suggested an expedited transition toward late osteogenic stages. These results align with those of Qasim et al. (2024), who reported that Cerabone® Plus promoted greater ALP activity and mineral deposition in human osteoblasts than other xenografts did [ 19 ]. The role of HA in accelerating osteogenic gene expression is further supported by Hakki et al. (2024), who reported the upregulation of Runx2, ALP, OC, COL-I, and cementoblast-specific markers via the Smad and β-catenin signaling pathways [ 21 ]. Given that MG-63 cells are preosteoblasts, their differentiation window is relatively short, limiting long-term evaluation. Nevertheless, the enhanced late marker expression in the HA-containing group suggests that HA facilitates a microenvironment conducive to osteoblast maturation, possibly by improving matrix organization, mineral penetration, and osteoinductive signaling. HA exerts multifaceted regulatory effects on bone cells, primarily via CD44-mediated activation of the BMP/Smad and MAPK/ERK pathways [26]. Depending on context, HA can either enhance or modulate BMP-induced osteogenesis by altering Smad phosphorylation and ERK signaling [ 27 ]. This bidirectional influence may allow fine-tuning of the balance between proliferation and differentiation during bone regeneration. Previous studies have shown that bovine xenografts, including Cerabone®, generally outperform synthetic alloplasts in terms of osteoconductivity and do not require exogenous growth factors to the same extent. Among allografts, mineralized variants tend to support greater osteogenic differentiation than demineralized forms do [ 28 ]. The superior initial cell attachment and differentiation potential of xenografts may be attributable to their preserved natural bone architecture. This study has certain limitations that warrant consideration. First, a semidifferentiated osteoblast-like cell line (MG-63) was employed rather than primary human osteoblasts, which may limit the translational relevance of the findings. Second, osteogenic differentiation was not confirmed at the protein level, for example, through alkaline phosphatase (ALP) activity assays or ELISA quantification of osteogenic markers. Third, the relatively short culture period precludes assessment of long-term remodeling processes. In addition, no parallel comparison was performed with nonbovine xenografts or synthetic alloplastic materials. Future investigations should address these limitations by incorporating primary osteoblasts, mesenchymal stem cells (MSCs), and periodontal ligament stem cells (PDLSCs) in the experimental design. Protein-level analyses, such as ALP activity and mineralization assays, are essential for confirming osteogenic potential. Moreover, the inclusion of animal models and randomized clinical trials will be crucial for validating in vivo performance. The quantification of growth factors—such as bone morphogenetic protein-2 (BMP-2) and vascular endothelial growth factor (VEGF)—released from HA-containing xenografts would also provide mechanistic insights into their regenerative capacity [ 29 ]. From a clinical standpoint, HA-enriched xenografts offer advantages, such as the "sticky bone" effect, and may enhance regenerative outcomes. In vitro data—including our data—indicate improved cytocompatibility, migration, and osteogenic differentiation. However, robust clinical evidence from long-term, controlled trials is needed before definitive recommendations can be made. Conclusion Within the limits of this in vitro model, Cerabone® Plus demonstrated superior promotion of cell migration and osteogenic differentiation compared with Cerabone® Granulate. The addition of HA appears to accelerate late-stage osteoblast maturation and may enhance regenerative potential. These findings warrant further investigation in preclinical and clinical settings to determine the translational value of HA-enriched xenografts in bone regeneration. Declarations Ethical approval The present research was approved by the Research Ethics Committees of the Research Institute of Dental Sciences-Shahid Beheshti University of Medical Sciences with ethical code IR.SBMU.DRC.REC.1403.060. Clinical Trial Number Not applicable Consent for publication Not applicable Availability of data and materials The datasets used and analyzed during the current study are available from the corresponding author upon reasonable request. Competing interests The authors do not disclose any conflicts of interest. Funding The authors did not receive any funding. Authors' contributions ECH and SV initiated the study design. MT and EC collected the data. MT analyzed and interpreted the results. MT designed the tables and graphs. ECH wrote the original draft of the article. SV, MT and ECH contributed to the writing and editing of the manuscript. All the authors read and approved the final version of the manuscript. Acknowledgments Not applicable References Zander HA, Polson AM, Heijl LC. Goals Of Periodontal Therapy. J Periodontol 1976;47(5):261-6. Raitapuro-Murray T, Molleson TI, Hughes FJ. The Prevalence Of Periodontal Disease In A Romano-British Population C. 200-400 AD. Br Dent J 2014;217(8):459-66. Aslan, S., Rasperini, G. Fundamental Concepts and New Perspectives for Periodontal Regeneration. Curr Oral Health Rep 12, 15 (2025). DOI:10.1007/s40496-025-00406-6. Benatti BB, Silvério KG, Casati MZ, Sallum EA, Nociti FH Jr. Physiological Features Of Periodontal Regeneration And Approaches For Periodontal Tissue Engineering Utilizing Periodontal Ligament Cells. J Biosci Bioeng 2007;103(1):1-6. Percival KM, Paul V, Husseini GA. Recent Advancements in Bone Tissue Engineering: Integrating Smart Scaffold Technologies and Bio-Responsive Systems for Enhanced Regeneration. Int J Mol Sci. 2024;25(11):6012. Published 2024 May 30. doi:10.3390/ijms25116012. Zhao R, Yang R, Cooper PR, Khurshid Z, Shavandi A, Ratnayake J. Bone Grafts And Substitutes In Dentistry: A Review Of Current Trends And Developments. Molecules 2021;26(10). Amorim S, Reis CA, Reis RL, Pires RA. Extracellular Matrix Mimics Using Hyaluronan-Based Biomaterials.Trends Biotechnol 2021;39(1):90-104. Abatangelo G, Vindigni V, Avruscio G, Pandis L, Brun P. Hyaluronic Acid: Redefining Its Role. Cells 2020;9(7). Aydinyurt HS, Akbal D, Altindal D, Bozoglan A, Ertugrul AS, Demir H. Evaluation Of Biochemical And Clinical Effects Of Hyaluronic Acid On Non-Surgical Periodontal Treatment: A Randomized Controlled Trial. Ir J Med Sci 2020;189(4):1485-94. Gupta RC, Lall R, Srivastava A, Sinha A. Hyaluronic Acid: Molecular Mechanisms and Therapeutic Trajectory. Front Vet Sci. 2019;6:192. Published 2019 Jun 25. doi:10.3389/fvets.2019.00192. Sasaki T, Watanabe C. Stimulation Of Osteoinduction In Bone Wound Healing By High-Molecular Hyaluronic Acid. Bone 1995;16(1):9-15. Huang H, Feng J, Wismeijer D, Wu G, Hunziker EB. Hyaluronic Acid Promotes the Osteogenesis of BMP-2 in an Absorbable Collagen Sponge. Polymers (Basel). 2017;9(8):339. Published 2017 Aug 4. doi:10.3390/polym9080339. Hunt DR, Jovanovic SA, Wikesjö UM, Wozney JM, Bernard GW. Hyaluronan Supports Recombinant Human Bone Morphogenetic Protein-2 Induced Bone Reconstruction Of Advanced Alveolar Ridge Defects In Dogs. A pilot study. J Periodontol 2001;72(5):651-658. Arias-Betancur A, Badilla-Wenzel N, Astete-Sanhueza Á, Farfán-Beltrán N, Dias FJ. Carrier systems for bone morphogenetic proteins: An overview of biomaterials used for dentoalveolar and maxillofacial bone regeneration. Jpn Dent Sci Rev. 2022;58:316-327. doi:10.1016/j.jdsr.2022.10.001. Nguyen T, Ho H, Huynh N, Dien V, Vo T. Hyaluronic Acid 0.2% Application Enhanced Periodontitis Treatment In Non-Surgical Phase. J Stoma. 2021;74:76-83. Sánchez-Fernández E, Magán-Fernández A, O'Valle F, Bravo M, Mesa F. Hyaluronic Acid Reduces Inflammation And Crevicular Fluid IL-1β Concentrations In Peri-Implantitis: A Randomized Controlled Clinical Trial. J Periodontal Implant Sci 2021;51(1):63-74. Bhowmik E, Rao DPC. Clinicoradiographic Evaluation Of Hyaluronan-Nano Hydroxyapatite Composite Graft In The Management Of Periodontal Infrabony Defects. J Indian Soc Periodontol 2021;25(3):220-7. Kyyak S, Pabst A, Heimes D, Kämmerer PW. The Influence Of Hyaluronic Acid Biofunctionalization Of A Bovine Bone Substitute On Osteoblast Activity In Vitro. Materials (Basel) 2021;14(11). Qasim SSB, Trajkovski B, Zafiropoulos GG. The response of human osteoblasts on bovine xenografts with and without hyaluronate used in bone augmentation. J Biomater Sci Polym Ed 2024;35(6):880-897. Boeckel DG, Shinkai RS, Grossi ML, Teixeira ER. In vitro evaluation of cytotoxicity of hyaluronic acid as an extracellular matrix on OFCOL II cells by the MTT assay. Oral Surg Oral Med Oral Pathol Oral Radiol. 2014;117(6):e423-e428. doi:10.1016/j.oooo.2012.07.486. Hakki SS, Bozkurt SB, Sculean A, Božić D. Hyaluronic acid enhances cell migration, viability, and mineralized tissue-specific genes in cementoblasts. J Periodontal Res. 2024;59(1):63-73. doi:10.1111/jre.13201. Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res. 2009;29(6):313-326. doi:10.1089/jir.2008.0027. Zhang F, King MW. Immunomodulation Strategies for the Successful Regeneration of a Tissue-Engineered Vascular Graft. Adv Healthc Mater. 2022;11(12):e2200045. doi:10.1002/adhm.202200045. Li W, Xu Z, Zou B, et al. Macrophage regulation in vascularization upon regeneration and repair of tissue injury and engineered organ transplantation. Fundamental Research. Published online February 8, 2024. doi:https://doi.org/10.1016/j.fmre.2023.12.015. Nguyen XTY, Nguyen TT, Huynh NCN. Hyaluronic acid promotes cellular characteristics of human gingival fibroblasts in vitro. MedPharmRes 2024;8(3):197-207.doi:10.32895/UMP.MPR.8.3.22. ‌ Kaneko K, Higuchi C, Kunugiza Y, et al. Hyaluronan inhibits BMP-induced osteoblast differentiation. FEBS Lett. 2015;589(4):447-454. Kawano M, Ariyoshi W, Iwanaga K, et al. Mechanism involved in enhancement of osteoblast differentiation by hyaluronic acid. Biochem Biophys Res Commun. 2011;405(4):575-580. Lafzi A, Vahabi S, Ghods S, Torshabi M. In vitro effect of mineralized and demineralized bone allografts on proliferation and differentiation of MG-63 osteoblast-like cells. Cell Tissue Bank. 2016;17(1):91-104. Lorenzi C, Leggeri A, Cammarota I, Carosi P, Mazzetti V, Arcuri C. Hyaluronic Acid in Bone Regeneration: Systematic Review and Meta-Analysis. Dent J (Basel). 2024;12(8):263. Published 2024 Aug 19. Graphs Graphs 1 to 3 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files floatimage2.jpeg Graph 1. The results of the MTT assay evaluating the viability, proliferation, and cytotoxicity of MG-63 cells after 24-hour exposure to the 24-hour (A) and 72-hour (B) extracts and after 72-hour exposure to the 24-hour (C) and 72-hour (D) extracts (undiluted and diluted concentrations) of two types of Cerabone compared with the control group (untreated). floatimage3.png Graph 2. Percentage of MG-63 cell migration after 24- and 48-hour exposures to 1:2 diluted extracts of the two types of Cerabone, compared with the control group (untreated), relative to the initial time points of exposure and scratch creation. floatimage4.png Graph 3. Results of Expression of the osteogenic markers ALP (A), OPN (B), and OC (C) in MG‑63 cells after 72 h of exposure to 1:2 diluted extracts of Cerabone® Granulate or Cerabone® Plus compared with the negative control (standard medium) and positive control (osteogenic medium). Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 23 Sep, 2025 Reviews received at journal 18 Sep, 2025 Reviews received at journal 15 Sep, 2025 Reviewers agreed at journal 13 Sep, 2025 Reviewers agreed at journal 13 Sep, 2025 Reviewers invited by journal 12 Sep, 2025 Editor invited by journal 02 Sep, 2025 Editor assigned by journal 29 Aug, 2025 Submission checks completed at journal 29 Aug, 2025 First submitted to journal 25 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7458194","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":517239590,"identity":"22925926-1d97-4946-9bc6-80e1f04db647","order_by":0,"name":"Surena Vahabi","email":"","orcid":"","institution":"Shahid Beheshti University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Surena","middleName":"","lastName":"Vahabi","suffix":""},{"id":517239591,"identity":"38fcbd9a-a817-44ac-8b0f-e1256fabf731","order_by":1,"name":"Maryam Torshabi","email":"","orcid":"","institution":"Shahid Beheshti University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Maryam","middleName":"","lastName":"Torshabi","suffix":""},{"id":517239592,"identity":"fb3fef5b-28af-4c1f-a66a-20bdd60e1235","order_by":2,"name":"Ehsan Chegeni","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABFElEQVRIiWNgGAWjYBAC+xlg6gCE/GAgwcPPwMCGV4uBBJKWgzMqLOQkG0jRwsxzpsLY4AAhLdLtDz8X1NyRk3fvPXiAt00icfON5GcPPlQwyPOLHcDuF5kzxtIzjj0zNjxzLuGAJFDLthtp5oYzzjAYzpydgMNhOQzSvA2HEzfOyDE4YAjWkmAmzdvGkGBwG5eW9Me/gVrqN85/Y3AgEeSwGenfCGgBmdlwOEFegsfgwIEzEsZAewnZkmNmzXPssOEGnhyDgw0VEnISZ96USc44I4HTL/Yz0h/f5qk5LC/ffsb48x+DOh7+9vRtEh8qbOT5pbFrQVh3AMYSAKuUwK8cBOQbYCz+A7hVjYJRMApGwYgEAAEDZDiGhHBYAAAAAElFTkSuQmCC","orcid":"","institution":"Shahid Beheshti University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Ehsan","middleName":"","lastName":"Chegeni","suffix":""}],"badges":[],"createdAt":"2025-08-26 03:23:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7458194/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7458194/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":91863849,"identity":"b82ee683-0d3b-4ad4-af2f-aab8ab2ba7de","added_by":"auto","created_at":"2025-09-22 12:55:39","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1135465,"visible":true,"origin":"","legend":"","description":"","filename":"reviewedBMC3SHAHRIVAR.docx","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/4083defb16ff7507d2ea8a45.docx"},{"id":91863866,"identity":"b6254ae5-2801-4d9c-83b5-f9c9ebf81665","added_by":"auto","created_at":"2025-09-22 12:55:42","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6099,"visible":true,"origin":"","legend":"","description":"","filename":"ffa783b87b6f4b23a5f80419c203b79d.json","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/840f549466ea10c061fe5b58.json"},{"id":91863877,"identity":"dc3557a9-b8a8-45d8-9ac1-5d187d468453","added_by":"auto","created_at":"2025-09-22 12:55:47","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":72723,"visible":true,"origin":"","legend":"","description":"","filename":"ffa783b87b6f4b23a5f80419c203b79d1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/03ff984cb90b08bb34460860.xml"},{"id":91863868,"identity":"f1111e43-dee5-4bf1-893a-5ea18b3e339f","added_by":"auto","created_at":"2025-09-22 12:55:43","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":834608,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/0bae167fabc606da154a21e7.jpeg"},{"id":91863870,"identity":"e1a65048-15cd-4ad4-99e8-fae0bb7d4ca4","added_by":"auto","created_at":"2025-09-22 12:55:43","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":218369,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/206d6c0cab42eacedc19459c.jpeg"},{"id":91863869,"identity":"eb8c5772-140b-4257-a5d5-10efa6f62a32","added_by":"auto","created_at":"2025-09-22 12:55:43","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13984,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/a27c713781c3d8cf36fc4bdf.png"},{"id":91864290,"identity":"5a1ae305-68ca-4902-9c8f-892fd58f2989","added_by":"auto","created_at":"2025-09-22 13:03:44","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":23881,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/6ecc0beb7fffee78ad56ae03.png"},{"id":91863876,"identity":"b1600766-f51e-402e-846c-e6acc0f8b476","added_by":"auto","created_at":"2025-09-22 12:55:47","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":544505,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/5c81fba2ee3f69535e6430f5.png"},{"id":91863863,"identity":"4dd97db3-c8ab-45bc-b1ea-f76fb5e71f72","added_by":"auto","created_at":"2025-09-22 12:55:41","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":113755,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/f30fcbcda01402e92c6b8d1d.png"},{"id":91863865,"identity":"31c7dcaf-fc4d-41f0-907f-56bb74a432e9","added_by":"auto","created_at":"2025-09-22 12:55:41","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5485,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/19c62017a922f228b98e2a61.png"},{"id":91863848,"identity":"38d3ef1b-8658-4b2b-95fa-adfbd59b62bb","added_by":"auto","created_at":"2025-09-22 12:55:38","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9258,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/156bf127be3db61d72cab58f.png"},{"id":91863862,"identity":"c7124897-858e-490b-a703-a638d1ede8fb","added_by":"auto","created_at":"2025-09-22 12:55:41","extension":"xml","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":72901,"visible":true,"origin":"","legend":"","description":"","filename":"ffa783b87b6f4b23a5f80419c203b79d1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/fb986bdecedaad7f65df5b58.xml"},{"id":91863856,"identity":"7192e7c8-2cf3-4d77-bf81-f1e832ec9151","added_by":"auto","created_at":"2025-09-22 12:55:40","extension":"html","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":79415,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/f966f3fc6450c6684c710d12.html"},{"id":91863843,"identity":"245b19a9-ec9d-46f0-8e76-4b3128d37403","added_by":"auto","created_at":"2025-09-22 12:55:37","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":760565,"visible":true,"origin":"","legend":"\u003cp\u003eMicroscopic examination (40× magnification) of MG-63 cell migration at 0, 24, and 48 hours of exposure to 1:2 diluted extracts of two types of Cerabone compared with the control group (untreated).\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/c0ee8becf76be338cbe611b6.jpeg"},{"id":91864291,"identity":"e26aa1b4-eab4-41bf-acdf-200227e619c2","added_by":"auto","created_at":"2025-09-22 13:03:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1385051,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/71902a8d-0006-4b14-abb8-6cb90ab38aa8.pdf"},{"id":91863873,"identity":"ada7840b-ede9-437f-821c-1419cb67633b","added_by":"auto","created_at":"2025-09-22 12:55:44","extension":"jpeg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":218369,"visible":true,"origin":"","legend":"\u003cp\u003eGraph 1. The results of the MTT assay evaluating the viability, proliferation, and cytotoxicity of MG-63 cells after 24-hour exposure to the 24-hour (A) and 72-hour (B) extracts and after 72-hour exposure to the 24-hour (C) and 72-hour (D) extracts (undiluted and diluted concentrations) of two types of Cerabone compared with the control group (untreated).\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/acc0a8e2b52bcb6aba1a7b10.jpeg"},{"id":91863867,"identity":"6b8b6c21-32ff-4699-a8c2-c5e0d6703c41","added_by":"auto","created_at":"2025-09-22 12:55:42","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":21773,"visible":true,"origin":"","legend":"\u003cp\u003eGraph 2. Percentage of MG-63 cell migration after 24- and 48-hour exposures to 1:2 diluted extracts of the two types of Cerabone, compared with the control group (untreated), relative to the initial time points of exposure and scratch creation.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/33e236d8a067de71871f395f.png"},{"id":91863850,"identity":"aedeeeb8-6627-4754-853e-1694c831a2a6","added_by":"auto","created_at":"2025-09-22 12:55:39","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":40203,"visible":true,"origin":"","legend":"\u003cp\u003eGraph 3. Results of Expression of the osteogenic markers ALP (A), OPN (B), and OC (C) in MG‑63 cells after 72 h of exposure to 1:2 diluted extracts of Cerabone® Granulate or Cerabone® Plus compared with the negative control (standard medium) and positive control (osteogenic medium).\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7458194/v1/af6afe542c49a4f111d3e390.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Comparison of the Effects of Xenograft Bone Granules Containing and Lacking Hyaluronic Acid on the Viability, Proliferation, and Differentiation of MG-63 Osteoblast-Like Cells: An In Vitro Study","fulltext":[{"header":"Background","content":"\u003cp\u003ePeriodontal disease is one of the most common oral pathologies worldwide, leading to the progressive destruction of tooth‑supporting tissues. The primary objective of periodontal therapy is to preserve tooth function and regenerate lost structures [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In recent years, tissue engineering using biological scaffolds has emerged as a promising strategy for restoring bone defects [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Among these, xenogeneic bone grafts are widely employed, and their biological properties are largely determined by their origin and composition [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Hyaluronic acid (HA), a glycosaminoglycan of the extracellular matrix, is abundant in the gingiva and periodontal ligament [\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In addition to its structural role, high‑molecular‑weight HA modulates cellular activities, promotes angiogenesis, and enhances osteogenesis during wound repair [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Cell-free bone substitutes, which are inherently osteoconductive, can acquire osteogenic potential when supplemented with bioactive agents such as concentrated growth factor (CGF) or HA. Notably, HA, as a carrier for recombinant human bone morphogenetic protein‑2 (rhBMP‑2), has shown remarkable efficacy in advanced alveolar ridge augmentation [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Clinical applications of HA in nonsurgical periodontal therapy, regenerative procedures, and peri-implantitis management have also yielded favorable outcomes [\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Despite these findings, few \u003cem\u003ein vitro\u003c/em\u003e studies have systematically investigated the effects of HA‑enriched xenografts on osteoblast gene expression profiles. To address this gap, the present study evaluated and compared the viability, proliferation, and osteoblastic differentiation of MG‑63 cells cultured with xenograft bone granules containing or lacking HA. The outcomes of such investigations may assist periodontists and oral and maxillofacial surgeons in selecting appropriate biomaterials and, on the basis of \u003cem\u003ein vitro\u003c/em\u003e evidence, may facilitate the development of well-designed randomized clinical trials in this field.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003eIn this \u003cem\u003ein\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003evitro\u003c/em\u003e experimental study, two commercially available bovine-derived xenografts were evaluated: Cerabone\u0026reg; Plus granules (0.5\u0026ndash;1.0 mm; Botiss Biomaterials GmbH, Zossen, Germany), containing hyaluronic acid (HA), and Cerabone\u0026reg; Granulate granules (0.5\u0026ndash;1.0 mm; Botiss Biomaterials GmbH, Zossen, Germany), without HA. Human osteoblast-like MG-63 cells were obtained from the Pasteur Institute Cell Bank (Tehran, Iran) and used for all the assays.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eviability, proliferation, and cytotoxicity (MTT assay\u003c/strong\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMaterial extracts were prepared according to ISO‑10993‑12 (2021): 0.2 g of granules in 1 mL of DMEM supplemented with 10% FBS (Gibco, UK) were incubated at 37 \u0026deg;C, 95% humidity, and 5% CO₂\u0026nbsp;for 24 h or 72 h. MG‑63 cells (2,500/well in 96‑well plates) were exposed to undiluted and diluted extracts (100%, 50%, 25%) for 24 h\u0026nbsp;and 72 h and analyzed\u0026nbsp;via the\u0026nbsp;MTT assay (ISO‑10993‑5; 2009). Optical density (OD) was measured at 570 nm, and viability (%) was calculated relative to\u0026nbsp;that of\u0026nbsp;negative controls (untreated cells). Cytotoxicity was defined as viability \u0026lt; 70%.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Migration and Wound Healing (Scratch Assay)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman osteoblasts‑like MG‑63 cells (in the logarithmic growth phase) were seeded at a density of 8 \u0026times; 10⁴ cells/well in 24‑well tissue culture plates (SPL Life Sciences, Korea) containing complete culture medium (Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium supplemented with 10% fetal bovine serum and 1% penicillin\u0026ndash;streptomycin). After 24 h of incubation at 37\u0026deg;C in a humidified 5% CO₂\u0026nbsp;atmosphere,\u0026nbsp;the\u0026nbsp;cells reached full confluence (100% monolayer coverage). A linear vertical scratch (time 0 h) was introduced\u0026nbsp;into\u0026nbsp;each well\u0026nbsp;via\u0026nbsp;a sterile 10‑\u0026micro;L pipette tip (Axygen, USA).\u0026nbsp;The detached\u0026nbsp;cells were removed by washing twice with complete culture medium.\u0026nbsp;The cells\u0026nbsp;were then incubated either with culture medium alone (control) or with a 1:2 dilution (v/v) of extracts prepared from Cerabone\u0026reg;\u0026nbsp;granules (Botiss Biomaterials GmbH, Germany). Wound closure was assessed at 0, 24, and 48 h post‑scratch. At each time point,\u0026nbsp;the\u0026nbsp;culture medium was removed, and\u0026nbsp;the\u0026nbsp;cells were washed twice with ice‑cold PBS containing Ca\u0026sup2;⁺\u0026nbsp;and Mg\u0026sup2;⁺\u0026nbsp;(PBS). Fixation was performed by adding 500 \u0026micro;L of pre‑chilled (\u0026minus;20 \u0026deg;C) 100% methanol to each well for 10 min at room temperature.\u0026nbsp;The methanol\u0026nbsp;was aspirated, and 0.5% (w/v) crystal violet solution (Sigma‑Aldrich, USA) was added for 10 min on an orbital shaker at room temperature. Excess dye was removed, and\u0026nbsp;the\u0026nbsp;cells were washed three times with deionized water. Digital micrographs of the scratch area were captured at \u0026times;4 magnification\u0026nbsp;via\u0026nbsp;an inverted light microscope (Olympus CKX53, Japan). Wound gap distances were quantified in inches\u0026nbsp;via\u0026nbsp;ImageJ software (National Institutes of Health, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOsteogenic Differentiation and Gene Expression (qPCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMG‑63 cells (25,000/well, 24‑well plates) were treated with 1:2 dilutions of 24‑h extracts for 72 h. Negative controls received complete medium; positive controls received osteogenic medium (10 mM\u0026nbsp;\u0026beta;-glycerophosphate, 10 nM dexamethasone,\u0026nbsp;and\u0026nbsp;200 \u0026micro;M ascorbic acid). Total RNA was extracted (RNeasy Mini Plus Kit, Qiagen), and cDNA was synthesized (QuantiTect Reverse Transcription Kit, Qiagen). Quantitative RT‑PCR (SYBR Green, Ampliqon, Denmark) was performed for ALP, osteopontin (OPN), osteocalcin (OCN), and GAPDH (housekeeping gene)\u0026nbsp;via an\u0026nbsp;Applied Biosystem thermocycler at 60 \u0026deg;C. Gene expression was normalized to\u0026nbsp;that of\u0026nbsp;GAPDH and analyzed\u0026nbsp;via\u0026nbsp;the 2^\u0026minus;\u0026Delta;\u0026Delta;Ct method (Table 1).\u003c/p\u003e\n\u003cp\u003eTable 1. The primers used to assess the expression of the genes under study.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"610\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 109px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eGene name\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 310px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eSequence (5\u0026apos; -\u0026gt;3\u0026apos;)\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 190px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eProduct Length (bp)\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 109px;\"\u003e\n \u003cp\u003eAlkaline Phosphatase (ALP)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 310px;\"\u003e\n \u003cp\u003eF: ATTTCTCTTGGGCAGGCAGAGAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 190px;\"\u003e\n \u003cp\u003e118\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 310px;\"\u003e\n \u003cp\u003eR: ATCCAGAATGTTCCACGGAGGCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 109px;\"\u003e\n \u003cp\u003eOsteopontin (OP)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 310px;\"\u003e\n \u003cp\u003eF: AGAATGCTGTGTCCTCTGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 190px;\"\u003e\n \u003cp\u003e146\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 310px;\"\u003e\n \u003cp\u003eR: GTTCGAGTCAATGGAGTCCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\" style=\"width: 109px;\"\u003e\n \u003cp\u003eOsteocalcin\u003c/p\u003e\n \u003cp\u003e(OC)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 310px;\"\u003e\n \u003cp\u003eF: CAGCGAGGTAGTGAAGAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"3\" style=\"width: 190px;\"\u003e\n \u003cp\u003e144\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 310px;\"\u003e\n \u003cp\u003eR: TGAAAGCCGATGTGGTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 310px;\"\u003e\n \u003cp\u003eR: GATGTCAAACTCACTCATGGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 109px;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 310px;\"\u003e\n \u003cp\u003eF: GGAGCGAGATCCCTCCAAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 190px;\"\u003e\n \u003cp\u003e197\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 310px;\"\u003e\n \u003cp\u003eR: GGCTGTTGTCATACTTCTCATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eanalysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were performed in triplicate with at least three independent repetitions. The data are expressed as the means \u0026plusmn; SD. One‑way ANOVA with Tukey\u0026apos;s post hoc test (GraphPad Prism v9) was used, with statistical significance set at p \u0026lt; 0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eCell\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eviability, proliferation, and cytotoxicity (MTT assay\u003c/strong\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter 24 h of exposure to 24‑h or 72‑h material extracts (undiluted or diluted to 50% and 25%), MG‑63 cell viability\u0026nbsp;did not significantly differ among the\u0026nbsp;Cerabone\u0026reg;\u0026nbsp;Plus, Cerabone\u0026reg;\u0026nbsp;Granulate, and\u0026nbsp;control groups\u0026nbsp;(p \u0026gt; 0.05), maintaining values near 100% (Graph 1A,\u0026nbsp;\u003cspan dir=\"RTL\"\u003e1\u003c/span\u003eB).\u003c/p\u003e\n\u003cp\u003eAfter 72 h of exposure to the 24‑h extracts,\u0026nbsp;the\u0026nbsp;viability\u0026nbsp;of the\u0026nbsp;diluted extracts remained ~100% across\u0026nbsp;the\u0026nbsp;groups. However,\u0026nbsp;compared with the control extracts, the\u0026nbsp;undiluted extracts reduced viability by ~10\u0026ndash;20% (p \u0026lt; 0.05). This reduction was more pronounced for Cerabone\u0026reg; Granulate\u0026nbsp;than for\u0026nbsp;Cerabone\u0026reg; Plus (p \u0026lt; 0.05) but did not meet\u0026nbsp;the\u0026nbsp;ISO‑10993‑5 cytotoxicity thresholds (\u0026lt; 70%). For\u0026nbsp;the\u0026nbsp;72 h extracts, Cerabone\u0026reg; Granulate full‑strength reduced viability to ~36% (p \u0026lt; 0.05 vs. control),\u0026nbsp;whereas\u0026nbsp;Cerabone\u0026reg;\u0026nbsp;Plus extracts (all concentrations) produced 40\u0026ndash;60% viability (p \u0026lt; 0.05). Notably,\u0026nbsp;the effects of the\u0026nbsp;full‑strength extracts from both groups\u0026nbsp;were less than\u0026nbsp;the 70% cytotoxicity threshold. In\u0026nbsp;the\u0026nbsp;diluted form, Cerabone\u0026reg;\u0026nbsp;Granulate maintained\u0026nbsp;greater\u0026nbsp;viability than Cerabone\u0026reg;\u0026nbsp;Plus\u0026nbsp;did\u0026nbsp;(p \u0026lt; 0.05).\u0026nbsp;On the basis of\u0026nbsp;these results, 1:2 diluted 24‑h extracts were selected for subsequent assays (Graph 1C,\u0026nbsp;\u003cspan dir=\"RTL\"\u003e1\u003c/span\u003eD).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Migration and Wound Closure (Scratch Assay)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAt 24 h, the migration rates were similar across all the groups (~70%). At 48 h, Cerabone\u0026reg; Plus matched the control performance, achieving complete wound closure. Compared with both Cerabone\u0026reg; Plus and the controls, Cerabone\u0026reg; Granulate resulted in slower migration and incomplete closure (Fig. 1; Graph 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOsteogenic Differentiation of MG‑63 Cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs shown in graph 3, alkaline phosphatase (ALP) gene expression was significantly greater in the positive control and both Cerabone groups than in the negative control, with the positive control exceeding both Cerabone materials (p \u0026lt; 0.05). Notably, osteopontin (OPN) and osteocalcin (OC) expression did not differ significantly between the positive and negative controls, whereas both cerabone groups presented significantly elevated levels, indicating a shift from the proliferative phase to osteogenic differentiation. While ALP expression\u0026mdash;a marker of early differentiation\u0026mdash;was comparable between the two Cerabone groups, OPN and OC\u0026mdash;late-stage differentiation markers\u0026mdash;were significantly greater in the Cerabone\u0026reg; Plus group than in the Cerabone\u0026reg; Granulate group, suggesting accelerated and enhanced maturation.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis \u003cem\u003ein vitro\u003c/em\u003e analysis evaluated the influence of two commercially available bovine xenografts\u0026mdash;Cerabone\u0026reg; Granulate, without hyaluronic acid (HA), and Cerabone\u0026reg; Plus, enriched with HA\u0026mdash;on the cellular behavior of MG‑63 osteoblast-like cells. The cell responses assessed included viability, proliferation, migration, and osteogenic differentiation. The use of the MG‑63 cell line offers the advantages of reproducibility and comparability with a substantial number of prior studies; however, primary human osteoblasts or mesenchymal stem cells may display different profiles under similar experimental conditions. Given the increasing incorporation of HA into bone biomaterials used for periodontal and peri-implant site development, these findings merit comparison with other investigations in this field.\u003c/p\u003e\u003cp\u003eFollowing ISO 10993-12 guidelines, an indirect contact (extract-based) approach was used to assess the interaction between the graft materials and MG-63 cells. Extracts were collected after 24 and 72 hours of incubation in serum-containing culture medium to capture a wide spectrum of potentially released components. Both undiluted (100%) and diluted (50% and 25%) extracts were tested to mimic physiological dilution by body fluids \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eAcute (24 h) and subchronic (72 h) exposures were performed to assess the cytotoxicity profiles. No significant cytotoxicity (\u0026gt;\u0026thinsp;30% reduction in viability) was observed for either material after 24 h of exposure. However, at 72 h, undiluted extracts\u0026mdash;particularly from the 72-hour collection\u0026mdash;had reduced cell viability. On the basis of these findings, 50% dilutions of 24-hour extracts were selected for migration and differentiation assays.\u003c/p\u003e\u003cp\u003eThe MTT assay results confirmed that both Cerabone\u0026reg; Granulate and Cerabone\u0026reg; Plus were highly cytocompatible. At 24 h, no significant differences were detected between the two materials. By 72 h, however, undiluted extracts from Cerabone\u0026reg; Plus supported higher cell viability than those from Cerabone\u0026reg; Granulate. However, no prior \u003cem\u003ein vitro\u003c/em\u003e study has directly compared these two specific xenografts in MG-63 cells. Kyyak \u003cem\u003eet al.\u003c/em\u003e (2021) reported that Cerabone\u0026reg; Plus (0.5\u0026ndash;1 mm granules) promoted greater viability, migration, and proliferation of human osteoblasts than Cerabone\u0026reg; (1\u0026ndash;2 mm granules) did at days 3, 7, and 10 [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Similarly, Qasim \u003cem\u003eet al.\u003c/em\u003e (2024) reported that Cerabone\u0026reg; Plus outperformed Cerabone\u0026reg;, Bio-Oss\u0026reg;, and Straumann Xenograft\u0026reg; in supporting human osteoblast viability up to day 10 [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Collectively, these findings indicate that the addition of HA improves the cytocompatibility profile of bovine xenografts.\u003c/p\u003e\u003cp\u003eAdditional parallels were reported by Boeckel \u003cem\u003eet al\u003c/em\u003e. (2012), where HA, when combined with platelet-rich plasma (PRP) and thrombin in a hydroxyapatite-based composite, achieved the highest cell viability among the tested conditions [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In cementoblast cultures, Hakki et al. (2024) reported that HA, particularly at optimized dilutions (1:2 to 1:8), promoted viability, migration, and mineralized nodule formation [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Together, these findings suggest that HA integration in xenografts enhances compatibility with osteogenic and cementogenic cells, potentially translating to improved regenerative outcomes in periodontal therapy.\u003c/p\u003e\u003cp\u003eThe effect of HA on osteoblastic cells is well documented. Boeckel \u003cem\u003eet al.\u003c/em\u003e (2014) demonstrated that HA-containing constructs could support 67\u0026ndash;79% viability depending on the presence of platelet-rich plasma and thrombin [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. More recently, Hakki \u003cem\u003eet al.\u003c/em\u003e (2024) reported that HA enhanced viability, migration, and mineral nodule formation in murine cementoblasts (OCCM-30) in a dose-dependent manner [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eCell migration is a fundamental component of regenerative success, influencing both initial defect repopulation and integration with host tissues. In our scratch assay, MG-63 cells were exposed to 50% diluted, 24-hour extracts. Cerabone\u0026reg; Plus demonstrated a superior ability to promote wound closure, particularly at 48 h, indicating enhanced proliferative and migratory responses in the postmigration phase. These findings are consistent with \u003cem\u003ein vivo\u003c/em\u003e evidence suggesting that xenografts release chemotactic mediators such as MCP-1, which recruit monocytes, macrophages, and progenitor cells to the regenerative site. HA likely potentiates this effect via interaction with CD44 receptors, triggering PI3K/AKT and MAPK signaling cascades that regulate cytoskeletal reorganization and motility (22\u0026ndash;24). Qasim \u003cem\u003eet al.\u003c/em\u003e (2024) reported that HA not only induced MCP-1 release but also increased growth factor activity [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eHA concentration and structural properties influence its bioactivity. Nguyen \u003cem\u003eet al.\u003c/em\u003e (2024) demonstrated that HA at 6 mg/mL enhanced the proliferation and migration of human gingival fibroblasts while maintaining\u0026thinsp;\u0026gt;\u0026thinsp;70% viability [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], which aligns with our observations of accelerated MG-63 migration.\u003c/p\u003e\u003cp\u003eDifferentiation was evaluated through early (alkaline phosphatase, ALP) and late (osteopontin, OP; osteocalcin, OC) osteogenic gene expression. ALP gene expression did not differ significantly between the groups by day 3; however, the OP and OC levels were markedly greater with Cerabone Plus. These findings indicate that HA may accelerate progression toward a mineralization phenotype even in preosteoblast cell lines.\u003c/p\u003e\u003cp\u003eALP typically peaks during the transition from proliferation to matrix maturation and then decreases as cells enter the mineral deposition stage. The upregulation of OC and OP in the HA group suggested an expedited transition toward late osteogenic stages. These results align with those of Qasim \u003cem\u003eet al.\u003c/em\u003e (2024), who reported that Cerabone\u0026reg; Plus promoted greater ALP activity and mineral deposition in human osteoblasts than other xenografts did [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The role of HA in accelerating osteogenic gene expression is further supported by Hakki \u003cem\u003eet al.\u003c/em\u003e (2024), who reported the upregulation of Runx2, ALP, OC, COL-I, and cementoblast-specific markers via the Smad and β-catenin signaling pathways [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Given that MG-63 cells are preosteoblasts, their differentiation window is relatively short, limiting long-term evaluation. Nevertheless, the enhanced late marker expression in the HA-containing group suggests that HA facilitates a microenvironment conducive to osteoblast maturation, possibly by improving matrix organization, mineral penetration, and osteoinductive signaling.\u003c/p\u003e\u003cp\u003eHA exerts multifaceted regulatory effects on bone cells, primarily via CD44-mediated activation of the BMP/Smad and MAPK/ERK pathways [26]. Depending on context, HA can either enhance or modulate BMP-induced osteogenesis by altering Smad phosphorylation and ERK signaling [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. This bidirectional influence may allow fine-tuning of the balance between proliferation and differentiation during bone regeneration. Previous studies have shown that bovine xenografts, including Cerabone\u0026reg;, generally outperform synthetic alloplasts in terms of osteoconductivity and do not require exogenous growth factors to the same extent. Among allografts, mineralized variants tend to support greater osteogenic differentiation than demineralized forms do [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The superior initial cell attachment and differentiation potential of xenografts may be attributable to their preserved natural bone architecture.\u003c/p\u003e\u003cp\u003eThis study has certain limitations that warrant consideration. First, a semidifferentiated osteoblast-like cell line (MG-63) was employed rather than primary human osteoblasts, which may limit the translational relevance of the findings. Second, osteogenic differentiation was not confirmed at the protein level, for example, through alkaline phosphatase (ALP) activity assays or ELISA quantification of osteogenic markers. Third, the relatively short culture period precludes assessment of long-term remodeling processes. In addition, no parallel comparison was performed with nonbovine xenografts or synthetic alloplastic materials.\u003c/p\u003e\u003cp\u003eFuture investigations should address these limitations by incorporating primary osteoblasts, mesenchymal stem cells (MSCs), and periodontal ligament stem cells (PDLSCs) in the experimental design. Protein-level analyses, such as ALP activity and mineralization assays, are essential for confirming osteogenic potential. Moreover, the inclusion of animal models and randomized clinical trials will be crucial for validating \u003cem\u003ein vivo\u003c/em\u003e performance. The quantification of growth factors\u0026mdash;such as bone morphogenetic protein-2 (BMP-2) and vascular endothelial growth factor (VEGF)\u0026mdash;released from HA-containing xenografts would also provide mechanistic insights into their regenerative capacity [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eFrom a clinical standpoint, HA-enriched xenografts offer advantages, such as the \"sticky bone\" effect, and may enhance regenerative outcomes. \u003cem\u003eIn vitro\u003c/em\u003e data\u0026mdash;including our data\u0026mdash;indicate improved cytocompatibility, migration, and osteogenic differentiation. However, robust clinical evidence from long-term, controlled trials is needed before definitive recommendations can be made.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eWithin the limits of this \u003cem\u003ein vitro\u003c/em\u003e model, Cerabone\u0026reg; Plus demonstrated superior promotion of cell migration and osteogenic differentiation compared with Cerabone\u0026reg; Granulate. The addition of HA appears to accelerate late-stage osteoblast maturation and may enhance regenerative potential. These findings warrant further investigation in preclinical and clinical settings to determine the translational value of HA-enriched xenografts in bone regeneration.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present research was approved by the Research Ethics Committees of the Research Institute of Dental Sciences-Shahid Beheshti University of Medical Sciences with ethical code IR.SBMU.DRC.REC.1403.060.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical Trial Number\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and analyzed during the current study are available from\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003ethe corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors do not disclose any conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors did not receive any funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eECH and SV initiated the study design. MT and EC collected the data. MT analyzed and interpreted the results. MT designed the tables and graphs. ECH wrote the original draft of the article. SV, MT and ECH contributed to the writing and editing of the manuscript. All the authors read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003e\u003cem\u003eZander HA, Polson AM, Heijl LC. Goals Of Periodontal Therapy. J Periodontol 1976;47(5):261-6.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eRaitapuro-Murray T, Molleson TI, Hughes FJ. The Prevalence Of Periodontal Disease In A Romano-British Population C. 200-400 AD. Br Dent J 2014;217(8):459-66.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eAslan, S., Rasperini, G. Fundamental Concepts and New Perspectives for Periodontal Regeneration. Curr Oral Health Rep 12, 15 (2025). DOI:10.1007/s40496-025-00406-6.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eBenatti BB, Silv\u0026eacute;rio KG, Casati MZ, Sallum EA, Nociti FH Jr. Physiological Features Of Periodontal Regeneration And Approaches For Periodontal Tissue Engineering Utilizing Periodontal Ligament Cells. J Biosci Bioeng 2007;103(1):1-6.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003ePercival KM, Paul V, Husseini GA. Recent Advancements in Bone Tissue Engineering: Integrating Smart Scaffold Technologies and Bio-Responsive Systems for Enhanced Regeneration. Int J Mol Sci. 2024;25(11):6012. Published 2024 May 30. doi:10.3390/ijms25116012.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eZhao R, Yang R, Cooper PR, Khurshid Z, Shavandi A, Ratnayake J. Bone Grafts And Substitutes In Dentistry: A Review Of Current Trends And Developments. Molecules 2021;26(10).\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eAmorim S, Reis CA, Reis RL, Pires RA. Extracellular Matrix Mimics Using Hyaluronan-Based\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003eBiomaterials.Trends Biotechnol 2021;39(1):90-104.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eAbatangelo G, Vindigni V, Avruscio G, Pandis L, Brun P. Hyaluronic Acid: Redefining Its Role. Cells 2020;9(7).\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eAydinyurt HS, Akbal D, Altindal D, Bozoglan A, Ertugrul AS, Demir H. Evaluation Of Biochemical And Clinical Effects Of Hyaluronic Acid On Non-Surgical Periodontal Treatment: A Randomized Controlled Trial. Ir J Med Sci 2020;189(4):1485-94.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Gupta RC, Lall R, Srivastava A, Sinha A. Hyaluronic Acid: Molecular Mechanisms and Therapeutic Trajectory. Front Vet Sci. 2019;6:192. Published 2019 Jun 25. doi:10.3389/fvets.2019.00192.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Sasaki T, Watanabe C. Stimulation Of Osteoinduction In Bone Wound Healing By High-Molecular Hyaluronic Acid. Bone 1995;16(1):9-15.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Huang H, Feng J, Wismeijer D, Wu G, Hunziker EB. Hyaluronic Acid Promotes the Osteogenesis of BMP-2 in an Absorbable Collagen Sponge. Polymers (Basel). 2017;9(8):339. Published 2017 Aug 4. doi:10.3390/polym9080339.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Hunt DR, Jovanovic SA, Wikesj\u0026ouml; UM, Wozney JM, Bernard GW. Hyaluronan Supports Recombinant Human Bone Morphogenetic Protein-2 Induced Bone Reconstruction Of Advanced Alveolar Ridge Defects In Dogs. A pilot study. J Periodontol 2001;72(5):651-658.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Arias-Betancur A, Badilla-Wenzel N, Astete-Sanhueza \u0026Aacute;, Farf\u0026aacute;n-Beltr\u0026aacute;n N, Dias FJ. Carrier systems for bone morphogenetic proteins: An overview of biomaterials used for dentoalveolar and maxillofacial bone regeneration. Jpn Dent Sci Rev. 2022;58:316-327. doi:10.1016/j.jdsr.2022.10.001.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Nguyen T, Ho H, Huynh N, Dien V, Vo T. Hyaluronic Acid 0.2% Application Enhanced Periodontitis Treatment In Non-Surgical Phase. J Stoma. 2021;74:76-83.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;S\u0026aacute;nchez-Fern\u0026aacute;ndez E, Mag\u0026aacute;n-Fern\u0026aacute;ndez A, O\u0026apos;Valle F, Bravo M, Mesa F. Hyaluronic Acid Reduces Inflammation And Crevicular Fluid IL-1\u0026beta; Concentrations In Peri-Implantitis: A Randomized Controlled Clinical Trial. J Periodontal Implant Sci 2021;51(1):63-74.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003eBhowmik E, Rao DPC. Clinicoradiographic Evaluation Of Hyaluronan-Nano Hydroxyapatite Composite Graft In The Management Of Periodontal Infrabony Defects. J Indian Soc Periodontol 2021;25(3):220-7.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Kyyak S, Pabst A, Heimes D, K\u0026auml;mmerer PW. The Influence Of Hyaluronic Acid Biofunctionalization Of A Bovine Bone Substitute On Osteoblast Activity In Vitro. Materials (Basel) 2021;14(11).\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Qasim SSB, Trajkovski B, Zafiropoulos GG. The response of human osteoblasts on bovine xenografts with and without hyaluronate used in bone augmentation. J Biomater Sci Polym Ed 2024;35(6):880-897.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Boeckel DG, Shinkai RS, Grossi ML, Teixeira ER. In vitro evaluation of cytotoxicity of hyaluronic acid as an extracellular matrix on OFCOL II cells by the MTT assay. Oral Surg Oral Med Oral Pathol Oral Radiol. 2014;117(6):e423-e428. doi:10.1016/j.oooo.2012.07.486.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Hakki SS, Bozkurt SB, Sculean A, Božić D. Hyaluronic acid enhances cell migration, viability, and mineralized tissue-specific genes in cementoblasts. J Periodontal Res. 2024;59(1):63-73. doi:10.1111/jre.13201.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res. 2009;29(6):313-326. doi:10.1089/jir.2008.0027.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Zhang F, King MW. Immunomodulation Strategies for the Successful Regeneration of a Tissue-Engineered Vascular Graft. Adv Healthc Mater. 2022;11(12):e2200045. doi:10.1002/adhm.202200045.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Li W, Xu Z, Zou B, et al. Macrophage regulation in vascularization upon regeneration and repair of tissue injury and engineered organ transplantation. Fundamental Research. Published online February 8, 2024. doi:https://doi.org/10.1016/j.fmre.2023.12.015.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Nguyen XTY, Nguyen TT, Huynh NCN. Hyaluronic acid promotes cellular characteristics of human gingival fibroblasts in vitro. MedPharmRes 2024;8(3):197-207.doi:10.32895/UMP.MPR.8.3.22.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026zwnj;\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003eKaneko K, Higuchi C, Kunugiza Y, et al. Hyaluronan inhibits BMP-induced osteoblast differentiation. FEBS Lett. 2015;589(4):447-454.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Kawano M, Ariyoshi W, Iwanaga K, et al. Mechanism involved in enhancement of osteoblast differentiation by hyaluronic acid. Biochem Biophys Res Commun. 2011;405(4):575-580.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;Lafzi A, Vahabi S, Ghods S, Torshabi M. In vitro effect of mineralized and demineralized bone allografts on proliferation and differentiation of MG-63 osteoblast-like cells. Cell Tissue Bank. 2016;17(1):91-104.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003eLorenzi C, Leggeri A, Cammarota I, Carosi P, Mazzetti V, Arcuri C. Hyaluronic Acid in Bone Regeneration: Systematic Review and Meta-Analysis. Dent J (Basel). 2024;12(8):263. Published 2024 Aug 19.\u003c/em\u003e\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Graphs","content":"\u003cp\u003eGraphs 1 to 3 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-oral-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ohea","sideBox":"Learn more about [BMC Oral Health](http://bmcoralhealth.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/ohea/default.aspx","title":"BMC Oral Health","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Hyaluronic acid, Xenograft, Cell proliferation, Cell differentiation, MTT assay, Real-time PCR","lastPublishedDoi":"10.21203/rs.3.rs-7458194/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7458194/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e: The therapeutic goal in periodontology is to preserve teeth and restore hard and soft tissues lost to periodontal disease. High–molecular–weight hyaluronic acid (HA) can stimulate bone formation during the wound-healing phase. One emerging approach in maxillofacial regenerative therapy is combining HA with xenogeneic bone grafts. This \u003cem\u003ein vitro\u003c/em\u003e study compared the biological effects of an HA-enriched bovine bone xenograft (Cerabone® Plus) with those of a non-HA bovine bone xenograft (Cerabone® Granulate) on MG‑63 osteoblast-like cell viability, proliferation, migration, and osteogenic differentiation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e: Two bovine bone xenograft types—Cerabone® Plus (0.5–1 mm granule, HA-enriched) and Cerabone® Granulate (0.5–1 mm, without HA)—were tested. Extracts from each sample were prepared after 24 h and 72 h of incubation in culture medium. Cell viability and proliferation were assessed via a methyl-thiazolyl tetrazolium (MTT) assay after exposure to undiluted, half, and quarter dilutions. Migration was examined via the scratch wound-healing assay at 24 h and 48 h. Osteogenic differentiation was evaluated viaquantitative real-time PCR for alkaline phosphatase (ALP), osteopontin (OP), and osteocalcin (OC). Statistical analysis was performed via one-way ANOVA with Tukey's post hoc test via GraphPad Prism (p\u0026lt;0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e: At 24 h of exposure, no significant differences in viability were detected among the examined extract dilutions from either xenograft and the control (p\u0026gt;0.05). After 72 h of exposure to the extracts for 24 h, Cerabone® Plus maintained significantly greater viability than Cerabone® Granulate did (p\u0026lt;0.05). After 72 h of exposure to the extracts, viability was significantly greater for Cerabone® Granulate at the half- and quarter-fold dilutions (p\u0026lt;0.05). At 48 h,scratch closure, migration and proliferation were lower in the Cerabone® Granulate group than in the Cerabone® Plus and control groups. Gene expression analysis revealed no significant difference in ALP between the groups, but OP and OC were significantly greater in the Cerabone® Plus group (p\u0026lt;0.05), suggesting accelerated osteoblastic maturation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e: Within the constraints of this \u003cem\u003ein vitro\u003c/em\u003e design, HA-enriched bovine xenografts (Cerabone® Plus) promoted faster migration and greater late-stage osteogenic differentiation of MG‑63 cells thannon-HA xenografts did.\u003c/p\u003e","manuscriptTitle":"Comparison of the Effects of Xenograft Bone Granules Containing and Lacking Hyaluronic Acid on the Viability, Proliferation, and Differentiation of MG-63 Osteoblast-Like Cells: An In Vitro Study","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-22 12:53:47","doi":"10.21203/rs.3.rs-7458194/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-23T09:52:46+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-18T17:24:40+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-15T16:25:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"305115073038351160758077959615107566198","date":"2025-09-14T03:24:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"162202118710927991228909230064279768970","date":"2025-09-13T18:22:01+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-12T19:37:15+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-09-02T13:55:54+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-29T14:17:03+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-29T14:16:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Oral Health","date":"2025-08-26T03:14:19+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-oral-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ohea","sideBox":"Learn more about [BMC Oral Health](http://bmcoralhealth.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/ohea/default.aspx","title":"BMC Oral Health","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"317bb1bf-c592-4b92-a34f-b6d15064e743","owner":[],"postedDate":"September 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-02-02T10:39:10+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-22 12:53:47","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7458194","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7458194","identity":"rs-7458194","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (sparse)

Too few in-corpus citations on either side for a chart; here are the lists.

Cites (1)

References (25)

Source provenance

crossref
last seen: 2026-05-19T01:00:27.019754+00:00
europepmc
last seen: 2026-05-20T01:45:00.602351+00:00