GSDMD ablation reduces intestinal inflammation of experimental NEC through macrophage pyroptosis

GSDMD ablation reduces intestinal inflammation of experimental NEC through macrophage pyroptosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article GSDMD ablation reduces intestinal inflammation of experimental NEC through macrophage pyroptosis Cuilian Ye, Xinli Liu, Yue Ma, Xinyi Yang, Dandan Mo, Qin Deng, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6983696/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Necrotizing enterocolitis (NEC) is predominantly linked to heightened macrophage inflammasome activity. This heightened activity triggers the pyroptotic cell death of macrophages, a process orchestrated by the protein gasdermin D (GSDMD). The exact contribution of macrophages pyroptosis to NEC remains to be fully elucidated. Our study delves into the pivotal function of GSDMD in the pyroptosis of macrophages within the context of experimental NEC. We identified a correlation between GSDMD and macrophage pyroptosis in the terminal ileum of infants with NEC. Employing GSDMD-deficient models and disulfiram, an agent that impedes GSDMD-mediated pore formation, we observed a marked improvement in the symptoms of NEC in mouse pups, coupled with a diminished presence of intestinal macrophages. Additionally, bone marrow-derived macrophages (BMDMs) from GSDMD-deficient mice demonstrated reduced overall macrophage numbers and M1 polarization. Notably, while GSDMD inhibition enhanced the macrophages antibacterial capabilities, their phagocytic activity towards zymosan particles was unaffected. Collectively, our findings highlight the integral role of GSDMD in modulating macrophage inflammasome responses and posit GSDMD as a promising candidate for therapeutic intervention in NEC. Biological sciences/Cell biology Health sciences/Diseases Biological sciences/Immunology Biological sciences/Microbiology NEC GSDMD macrophage pyroptosis IL-1β disulfiram Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Necrotizing enterocolitis (NEC) predominantly affects medically fragile preterm infants, marked by a decrease in intestinal blood flow and subsequent inflammatory necrosis(Kang et al., 2023 ; Li et al., 2022 ). The pathological progression is intensified by aberrant intestinal microbiota colonization breaching the epithelial barrier, leading to dysregulated proinflammatory responses. However, current research lacks comprehensive human data(Zhang et al., 2022 ). The obscure pathogenesis of NEC obscures the development of effective prevention and treatment strategies, making the clarification of its pathogenesis and the discovery of new therapeutic targets a priority in modern research. Emerging evidence suggests that innate immune responses in preterm neonates, provoked by bacteria and protozoa, lead to systemic inflammatory dysregulation, which in turn hampers the control of microbial infections in the development of NEC(Shang et al., 2017 ). Pyroptosis, an innate immune response to pathogen invasion, is characterized by an overproduction of proinflammatory cytokines that amplify tissue inflammation(Fu et al., 2023 ). Among these cytokines, interleukin-1β (IL-1β) plays a pivotal role in caspase-1-mediated monocyte destruction during bacterial infections(Shi et al., 2023). Prior studies have correlated serum IL-1β levels with the severity of NEC(Pan et al., 2021 ). Previous research has delineated the link between NLRP3 inflammasome activation and caspase activation. Upon activation, caspases cleave gasdermin D (GSDMD), triggering the formation of nonselective membrane pores through a process of oligomerization. GSDMD is ubiquitously expressed across various tissues and cell types, facilitating the maturation and release of proinflammatory cytokines such as IL-1β and IL-18 from macrophages into the plasma(Ding et al., 2021 ). Mice lacking key inflammasome components, including NLRP3 or caspase-1/11, demonstrate decreased vulnerability to lethal endotoxemia and increased resistance against bacterial sepsis(Danielski et al., 2020 ). Furthermore, GSDMD disruption mitigates cytokine release, thereby attenuating the severity of septic shock induced by polymicrobial infections. Our previous work has established that hyperinflammatory activation of innate immune macrophages is a key feature in premature infants(Luo et al., 2022 ), contributing significantly to the inflammatory damage associated with NEC progression. During inflammatory and stressful conditions, like sepsis, macrophages may secrete these cytokines via GSDMD pores(Xia et al., 2021 ), potentially exacerbating the condition. Nevertheless, the physiological state of GSDMD and its precise role in pyroptosis during the pathogenesis of NEC warrant further investigation. In our current study, we explored the impact of GSDMD on intestinal inflammatory injury, aiming to shed light on its pivotal role in macrophage function. Our study determined the extent of macrophage infiltration and pyroptosis, with a particular focus on the mechanisms involving GSDMD and proinflammatory cytokines in NEC pathogenesis. Consequently, our findings posit GSDMD as a promising therapeutic target for neonatal NEC. 2. MATERIALS AND METHODS 2.1.Human samples Intestinal tissue samples were collected from infants aged between 1 and 31 days who underwent emergency laparotomies for a diagnosis of NEC (n = 6) at the Chongqing Health Center for Women and Children. Control tissue samples were obtained from eight infants undergoing surgery for congenital conditions, including duodenal stenosis and ileal atresia, as detailed in Table 1 . The timing of GSDMD level testing is crucial as it can markedly influence the outcomes and their relevance to clinical characteristics. The tissues collected were initially subjected to a primary pathological assessment. To ensure data integrity, the excess portions of NEC tissue samples, which were resected and selected from the resection margins that contained intact viable mucosa, were promptly preserved at -80°C for further analysis within a 15-minute window. This process ensures that the GSDMD levels reflect the immediate state of the tissue post-inflammation. Preterm infants were defined as those born with a gestational age of less than 37 weeks, while full-term infants were categorized as those with a gestational age ranging from 37 to 42 weeks. The protocol for this human subjects investigation, spanning from July 1, 2022, to July 30, 2024, was approved by the Institutional Review Board (IRB, No.: WCHMU2021-052) of the Chongqing Health Center for Women and Children. All methods were performed in accordance with the relevant guidelines and regulations of the ethical standards of the Declaration of Helsinki. Informed consent for participation in the study was obtained from the parents or legal guardians of the infants. Table 1 Demographics and characteristics of Cases and Control. No. Sex birth weight gestational age Age(days) Diseases Site of collection Cases 1 M 2130g 31W 12 Necrotizing Enterocolitis ileum 2 F 1862g 30W 28 Necrotizing Enterocolitis ileum 3 F 2476g 33W 8 Necrotizing Enterocolitis ileum 4 F 1289g 26W 21 Necrotizing Enterocolitis Ileum 5 M 1684g 28W 17 Necrotizing Enterocolitis ileum 6 M 1931g 31W 32 Necrotizing Enterocolitis ileum Control 1 F 2915g 37W 3 Imperforate anus colon 2 M 2343g 33W 12 Ileal atresia jejunum 3 M 3252g 38W 5 Duodenal septum ileum 4 F 2747g 36W 7 Ileal atresia ileum 5 M 3126g 39W 16 Ileal atresia jejunum 6 M 2539g 34W 25 Duodenal septum jejunum 7 M 2883g 36W 4 Ileal atresia jejunum 8 F 2282g 32W 22 Duodenal septum ileum&jejunum 2.2. Experimental NEC Model and Interventions Our laboratory animal management protocol has been approved by the Animal Care and Use Committee of the Chongqing Health Center for Women and Children and all methods were performed in accordance with the relevant guidelines and regulations. The study is reported in according to the ARRIVE guidelines form reporting on animal experiments ( https://arriveguidelines.org ). We sourced C57BL/6 mice from Dr. Wenli Han at the Experimental Animal Center, Chongqing Medical University, and were graciously provided with GSDMD-deficient (GSDMD-/-) mice by Dr. Hongbo Luo from Boston Children's Hospital. Our study involved neonatal mice, five days old, weighing approximately 1.36 ± 0.10 grams, and born within the last 24 hours, which were exposed to stress conditions designed to induce NEC, following established methods from our laboratory. The protocol involved formula feeding every 4 hours at a dosage of 0.03 ml/g body weight, using a mixture of 7.5 g Similac Lower Iron (Abbott Laboratories, Ltd., Saint-Laurent, QC, Canada) and 34.5 ml Esbilac Puppy Milk Replacer (PetAg, Inc., Hampshire, IL, USA). Additionally, the subjects were exposed to cold (4°C for 10 minutes two times per day) and hypoxia (5% oxygen concentration for 10 minutes two times per day). The pups were monitored daily for NEC symptoms such as abdominal distension, apnea, and rectal bleeding. We meticulously recorded key parameters including the clinical incidence of NEC, changes in body weight, the time to NEC onset, and survival rates throughout the study. To assess the in vivo impact of disulfiram on our NEC model, we administered disulfiram, sourced from Biochempartner in Shanghai, China, via intraperitoneal injection to the neonatal mice at 24 and 48 hours post-NEC stress induction. The selected dosage of disulfiram was 50 mg/kg, which equates to a human equivalent dose of 284 mg/day. This dosage falls within the clinically approved range of 125–500 mg/day, typically prescribed for the treatment of alcohol dependence. In some cases, pups in the NEC group received an intraperitoneal injection of MCC950 (10 mg/kg, Selleck) once a day for 4 consecutive days. On postnatal Day 14, the surviving animals were humanely euthanized using carbon dioxide(flow rate: displace 30–70% of the euthanasia chamber volume per minute; concentrations: below 40%), and the complete intestinal tract was harvested for comprehensive macroscopic evaluation. Furthermore a secondary method of exsanguination may be required to ensure death. Subsequently, a detailed microscopic examination was conducted to assess the histological characteristics. The presence of NEC was definitively established by scrutinizing the histology of the terminal ileum. The criteria for grading the severity of NEC have been delineated by our research team. Furthermore, an additional section of the terminal ileum was meticulously preserved for subsequent detailed analyses, in accordance with methodologies outlined in our prior publications(Shang et al., 2017 ). 2.3.Morphological examination and histological analysis On postnatal Day 14, the surviving animals were humanely euthanized, followed by microscopic examination of the hematoxylin and eosin (H&E) stained sections of the terminal ileum. A blinded pathologist evaluated the histological alterations, indicative of mucosal injury, utilizing a standardized grading system as previously reported in our studies (Shang et al., 2017 ). 2.4.Immunofluorescence assessment The human tissue slides were meticulously prepared using a protocol we have detailed in previous works(Shang et al., 2017 ). They were stained to identify CD86, a marker for the M1 macrophage phenotype, and CD206, a marker for the M2 macrophage phenotype. The slides were individually subjected to an overnight incubation at 4°C with a suite of primary antibodies, including monoclonal mouse anti-human CD86, monoclonal mouse anti-human CD206, anti-F4/80 (diluted 1:50, Sigma), and anti-GSDMD-NT (diluted 1:50, Sigma). Following the primary antibody incubation, the slides were exposed to relevant secondary antibodies conjugated with Alexa Fluor 488/594 (Invitrogen, San Diego, CA) for 1 hour at room temperature. This step allowed for the fluorescent labeling of the target proteins, facilitating their visualization under a fluorescence microscope. To delineate the cell nuclei, the slides were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Sigma). Both a negative control, devoid of F4/80 antibodies, and an appropriate isotype control were systematically incorporated throughout the staining process to ensure the specificity of the immunofluorescence signal. The stained sections were examined using a fluorescence confocal microscope, which provided high-resolution imaging of the cellular structures and antigen distribution. The subsequent quantitative evaluation was performed using the WCIF ImageJ software (National Institutes of Health, Bethesda, MD), an open-source tool renowned for its analytical capabilities. In a thorough and systematic manner, a total of 20 fields per section were assessed to ensure a comprehensive and representative analysis of the tissue slides. This approach allowed us to quantify the presence of M1 and M2 macrophages within the tissue samples, providing valuable insights into the immunological landscape of the human tissue under study. 2.5.Bone marrow-derived macrophages (BMDMs) and stimulation BMDMs were meticulously isolated from the femurs and tibias of 8-week-old mice, following an established protocol (Ding et al., 2021 ). To achieve this, the bone marrow cells were extracted, resuspended, and subsequently cultured in the presence of macrophage colony-stimulating factor (M-CSF, 20 ng/ml) for six days to facilitate their differentiation into mature primary macrophages. Unless specified otherwise, the M-CSF-differentiated BMDMs were employed for the experiments that followed. Microscopic analysis verified that over 95% of the adherent cells displayed the morphological features typical of mature macrophages. The isolated BMDMs were then plated in 12-well plates that had been precoated with poly-L-lysine (Sigma-Aldrich) and were primed with lipopolysaccharide (LPS, 100 ng/ml) for a duration of four hours, after which the priming stimulus was eliminated. In the context of pharmacological interventions, disulfiram (concentrations ranging from 0 to 1 µM) was introduced into the culture medium and allowed to incubate for 12 hours before the introduction of E. coli infection or LPS priming. 2.6.qRT‒PCR Total cellular RNA was meticulously extracted from freshly isolated intestinal tissues using TRIzol reagent (Invitrogen, Carlsbad, CA). Subsequently, one microgram of the isolated RNA was subjected to reverse transcription and amplification using an ABI 7300 system (Applied Biosystems). This process employed oligo-dT (18) primers and SuperScript II Reverse Transcriptase, both procured from Invitrogen (Carlsbad, CA). The specific primer sequences, provided by Life Technologies Corporation (Carlsbad, CA), are detailed in Table 2 . To ascertain the relative expression levels of each gene, we applied the comparative ΔΔCt method. Table 2 The primer sequences for the real-time PCR measurement Gene Forward (5′-3′) Reverse (5′-3′) Human NLRP3 CACCTGTTGTGCAATCTGAAG GCAAGATCCTGACAACATGC Human Caspase-1 AGACCTCTGACAGCACGTTCCT TCCCACAAATGCCTTCCCGAAT Human GSDMD GTAGACTGGCCACATGGCTA CTGGGTCTTGCTGGACGAGT Human IL-1β GCCCTAAACAGATGAAGTGCTC GAACCAGCATCTTCCTCAG Human β-actin GGC ACC AGG GCG TGA TGG GTC TCA AAC ATG ATC TGG GTC Mouse IL-1β AGTGTGGATCCCAAGCAATACCCA TGTCCTGACCACTGTTGTTTCCCA Mouse IL-6 CCAATTTCCAATGCTCTCCT ACCACAGTGAGGAATGTCCA Mouse CXCL2 CCAACCACCAGGCTACAG GCGTCACACTCAAGCTCTG Mouse CCL3 TACAAGCAGCAGCGAGTACC GAGCAAAGGCTGCTGGTTTC Mouse CCL4 TGTGCTCCAGGGTTCTCAGC CCAGGGCTCACTGGGGTTAG Mouse CXCL5 GGTCCACAGTGCCCTACG GCGAGTGCATTCCGCTTA Mouse CD86 TGGAGAGGGAAGAGAGTGAACA GCCCATAAGTGTGCTCTGAA Mouse iNOS GTTCTCAAGGCACAGGTCTC GCAGGTCACTTATGTCACTTATC Mouse CD206 CCATGGACAATGCGCGAGCG CACCTGTGGCCCAAGACACGT Mouse Arg-1 TTCTCAAAAGGACAGCCTCG GCTCTTCATTGGCTTTCCC Mouse TNF-α ATGGCCTCCCTCTCATCAGTT ACAGGCTTGTCACTCGAATTTTG Mouse IL-10 CAGGCAGAGAAGCATGGC TGCTCCACTGCCTTGCTC Mouse β-actin CCCTGGAGAAGAGCTACGAG CGTACAGGTCTTTGCGGATG 2.7.Myeloperoxidase (MPO), Malondialdehyde (MDA) and Superoxide dismutase (SOD) assessments The biochemical evaluation of intestinal tissues for myeloperoxidase (MPO), malondialdehyde (MDA), and superoxide dismutase (SOD) was conducted with a meticulous approach. Fresh intestinal tissue samples, each weighing 8 milligrams, were meticulously homogenized and then subjected to a centrifugation process to isolate the cellular components. Protein concentrations within the supernatant were ascertained utilizing a bicinchoninic acid (BCA) protein assay reagent, procured from Pierce (Rockford, IL), which provided a quantitative assessment of the protein content. Building upon the methodologies outlined in preceding studies(Shang et al., 2017 ), we employed commercially available kits for the subsequent analyses. Myeloperoxidase activity was quantified using a specialized assay kit from Abcam (Cambridge, UK), which is designed to measure MPO levels accurately. The levels of malondialdehyde, an indicator of lipid peroxidation, were evaluated with a TBARS (thiobarbituric acid-reactive substances) assay kit sourced from Sigma (St. Louis, MO). Superoxide dismutase activity was determined using a highly sensitive ELISA kit provided by the Nanjing Jiancheng Bioengineering Institute (Nanjing, China), following the manufacturer's instructions for precise results. All data obtained from these assays were normalized against the protein levels of the respective samples to ensure the accuracy and reliability of the comparative analysis. This normalization step is critical for ensuring that the results are biologically meaningful and not confounded by variations in protein content. 2.8.Flow cytometric analysis of apoptosis The determination of BMDMs apoptosis was carried out with precision using an Annexin V-FITC Apoptosis Detection Kit from BD Pharmingen (San Diego, CA). The process commenced with the initial staining of BMDMs with Annexin V-FITC, a fluorescent conjugate with high affinity for phosphatidylserine, and propidium iodide (PI), which is used to identify non-viable cells. This dual-staining approach allowed for the clear discrimination of apoptotic and necrotic cells. Subsequently, the cells were subjected to analysis on a state-of-the-art BD LSR II flow cytometer from BD Biosciences (San Jose, CA). A meticulous count of 20,000 cells per sample was ensured to obtain statistically robust results. This step was critical in acquiring accurate and reliable measurements of apoptosis levels within the BMDM population. Following data acquisition, a thorough analysis was conducted using FlowJo software (Tree Star, San Carlos, CA). The software's advanced algorithms facilitated the interpretation of flow cytometric data, enabling the identification of distinct cell populations and the quantification of apoptosis rates. The results were then normalized and presented to reflect the biological status of the BMDMs in response to various experimental conditions. This comprehensive approach provided a clear and detailed assessment of BMDM apoptosis, contributing valuable insights into the cellular mechanisms at play. 2.9.Western Blot assessment The extraction and quantification of total protein from snap-frozen intestinal homogenates and whole-cell lysates were performed following the established methods referenced in the literature (Shang et al., 2017 ). With precision, the protein concentrations were measured, ensuring that each sample contained an equal amount of protein—specifically, 30 µg. The samples were then carefully subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), a technique that effectively separates proteins based on their molecular weight. Following electrophoresis, the resolved proteins were transferred onto polyvinylidene fluoride (PVDF) membranes, a step critical for the immunoblotting process. The membranes were incubated with a set of primary antibodies that target specific proteins of interest: GSDMD, the N-terminal fragment of GSDMD (GSDMD-NT), Caspase-1, NLRP3 inflammasome complex, Interleukin-1β (IL-1β), and the housekeeping protein β-actin. These antibodies were sourced from Santa Cruz Biotechnology, known for their specificity and reliability. After the primary incubation, the membranes were subjected to appropriate secondary antibodies that bind to the primary antibodies, which facilitated the visualization of immunoreactive bands. The use of horseradish peroxidase as a revealing agent allowed for the detection of these bands, providing a visual representation of the protein expression levels. The relative band intensities, indicative of the relative abundance of the proteins, were quantified using a Kodak Scientific Imaging System from Kodak (Rockville, MD). This system provided high-resolution imaging and accurate quantification capabilities. β-actin was utilized as an internal loading control to normalize the protein levels across samples, ensuring the reliability of the comparative analysis. This meticulous process ensured a robust and reliable assessment of protein expression, providing valuable insights into the molecular mechanisms at play in the intestinal samples. 2.10.Measurement of cytokines. The quantification of key cytokines and inflammatory mediators in both culture supernatants and mouse serum was performed with a high degree of precision using enzyme-linked immunosorbent assay (ELISA) kits from R&D Systems. The specific targets of these assays included the chemokine (C-X-C motif) ligand 2 (CXCL2), chemokine (C-C motif) ligand 3 (CCL3), interleukin-1 beta (IL-1β), interleukin-18 (IL-18), tumor necrosis factor-alpha (TNF-α), interleukin-6 (IL-6), high-mobility group box 1 (HMGB1), and extracellular cold-inducible RNA-binding protein (eCIRP). Each ELISA kit was employed in strict accordance with the manufacturer's detailed guidelines, ensuring the accuracy and reproducibility of the results. The assays were designed to capture the respective proteins with high specificity, allowing for the sensitive detection and quantification of these critical inflammatory markers. The process involved the addition of culture supernatants or mouse serum samples to the pre-coated ELISA plates, followed by a series of incubation steps with specific antibodies. This was succeeded by the addition of a substrate that, upon reaction with the bound enzyme, yielded a colorimetric signal proportional to the concentration of the target protein present in the sample. The optical density of each well was measured using a microplate reader, and the concentration of each cytokine or mediator was calculated by comparing the absorbance values to a standard curve generated from known concentrations of the respective protein standards provided with the ELISA kits. This comprehensive approach provided a robust assessment of the inflammatory milieu, offering valuable insights into the immune response and the role of these mediators in the pathophysiological processes under investigation. 2.11.Cell viability assays. The vitality of the cultured BMDMs was meticulously evaluated employing the lactate dehydrogenase (LDH) release assay, a standard method for gauging cell survival. The Pierce™ LDH Cytotoxicity Assay Kit from Thermo Fisher Scientific was utilized in accordance with the manufacturer's comprehensive guidelines, ensuring a standardized and reliable procedure. The supernatant from the BMDM cultures was carefully collected and subjected to centrifugation to remove any cell debris, which could potentially interfere with the assay results. This step was performed at a speed of 500 × g for a duration of 6 minutes, ensuring a clear and debris-free sample. Subsequently, the luminescence and absorbance were measured at an optical density (OD) of 490 nm using a BioTek Synergy 2 plate reader. This advanced instrument provided sensitive and accurate readings, crucial for assessing the LDH activity in the samples. The cytotoxicity index, an important parameter in our analysis, was calculated as the percentage of LDH activity in the culture medium relative to the total LDH activity, which includes both the medium and the cellular content. This index provides a quantitative measure of cell damage or lysis, offering valuable insights into the viability of the BMDMs under various experimental conditions. This rigorous and systematic approach to assessing cell viability ensures that our findings are robust and reflective of the true biological effects, facilitating a deeper understanding of the cellular responses under investigation. 2.12.Phagocytosis assessment The phagocytic ability of macrophages was evaluated employing a method we have previously detailed(Shang et al., 2017 ). Initially, the zymosan bioparticles, procured from Invitrogen (Carlsbad, CA), were incubated with fluorescein isothiocyanate (FITC) in a light-controlled environment to ensure the integrity of the fluorescence signal. This step was critical for the subsequent tracking of phagocytosis by macrophages. Before initiating the assay, BMDMs were primed with 100 ng/ml of lipopolysaccharide (LPS) to activate their phagocytic pathways. Subsequently, the zymosan bioparticles were introduced to the macrophage cultures at a precise ratio of 1:10 (zymosan to cell number), providing an optimal balance for effective phagocytic assessment. Flow cytometry (FACS) was then utilized to measure the extent of phagocytosis. This was achieved by quantifying the percentage of macrophages that had engulfed the FITC-labeled bioparticles, an indicator expressed as the phagocytosis index (PI). The use of FACS allowed for the rapid and accurate determination of the phagocytic capacity of the macrophages, providing a clear and quantitative reflection of their functional state in terms of particle engulfment and processing. This refined and systematic approach to assessing macrophage phagocytosis offers a robust method for evaluating the cellular immune response and the efficacy of macrophage function under various experimental conditions. 2.13. Antimicrobial assessment of BMDMs Fresh cultures of Escherichia coli, Candida albicans, and Cronobacter sakazakii, sourced from the American Type Culture Collection (ATCC, Manassas, VA), were meticulously cultured overnight. These cultures were then resuspended in phosphate-buffered saline (PBS) and their optical density adjusted to an OD600 of 0.20, a measure indicative of the bacterial concentration. BMDMs of diverse genotypes were prepared at a density of 0.5 × 10 6 cells per well and pretreated with a range of disulfiram concentrations, procured from Sigma-Aldrich (St. Louis, MO), for a period of 12 hours prior to the assay. This pretreatment step was integral to evaluating the effects of disulfiram on macrophage function. Subsequently, the BMDMs, at a concentration of 10 5 , were cocultured with the bacteria at a multiplicity of infection (MOI) that resulted in 10 7 colony-forming units (CFUs) of bacteria. The coculture was conducted at a controlled temperature of 37°C with periodic agitation to ensure uniform distribution and interaction between the macrophages and bacteria. Following an overnight incubation at 30°C, the bacterial growth was assessed by quantifying the CFUs. This quantification was performed 24 hours postincubation, a time point selected based on prior research (Shang et al., 2017 ), and was conducted using methods previously described in the literature for accuracy and consistency. This systematic and controlled experimental approach allowed for a comprehensive assessment of the interaction between macrophages and various bacterial species under the influence of disulfiram, providing valuable insights into the potential modulation of macrophage activity and bacterial growth. 2.14.Statistical measurement The data for this research were carefully manipulated using GraphPad Prism software, version 4, developed by GraphPad Software in San Diego, California. Quantitative data, depicted as mean values with their corresponding standard deviations (± SDs), were subjected to rigorous statistical analysis. Student's t-test or analysis of variance (ANOVA) was initially applied to identify significant differences, with subsequent Bonferroni's multiple comparison test being utilized for further refinement as necessary. For the analysis of survival data across different groups, the log-rank (Mantel-Cox) test was employed. A threshold of P < 0.05 was established to indicate the presence of statistically significant findings. 3. Results 3.1.Macrophage pyroptosis in human NEC samples We first investigated the specific cellular sources of cleaved GSDMD in the inflamed intestine using immunofluorescence assays on tissue samples from six NEC patients. Our findings indicated a substantial presence of activated GSDMD within inflammatory cells, including CD68-positive macrophages, suggesting the occurrence of macrophage pyroptosis in NEC (Fig. 1 A). GSDMD expression was significantly elevated in inflamed areas compared to normal intestinal tissues (Fig. 1 B). These observations suggest that GSDMD plays a regulatory role in the release of inflammatory mediators, potentially exacerbating intestinal damage in NEC. In line with this, data from the BioGPS website showed that GSDMD is expressed in various human and mouse tissues, with whole blood cells displaying the highest levels of GSDMD expression (Fig. 1 C, D, E). 3.2. Inhibition of NLRP3 reduces GSDMD/IL-1β activation during NEC We conducted experiments to demonstrate the activation of the NLRP3 inflammasome in our NEC model. The intestinal segments were subjected to RNA extraction, and the mRNA levels of various inflammatory mediators were quantified using PCR, as depicted in Fig. 1 A. This will include assessing the expression levels of NLRP3 and the activation of caspase-1, which are key indicators of NLRP3 inflammasome activation(Fig. 2 A). Notably, the median expression levels of NLRP3, caspase-1, IL-1β, and GSDMD were marked increase in the affected NEC samples, compared to tissues from non-NEC controls. We treat our NEC model with a specific NLRP3 inhibitor (MCC950) and examine the formation of GSDMD oligomers and the levels of mature IL-1β and using non-reducing Western blot. We found that inhibiting NLRP3 using MCC950 will significantly reduce the maturation of IL-1β and formation of GSDMD oligomers, thereby attenuating the inflammatory response(Fig. 2 B). 3.3.GSDMD ablation alleviated NEC phenotype Building upon our findings, we proceeded to investigate the potential of GSDMD deficiency to mitigate intestinal inflammation, thereby offering protection against the development of experimental NEC. Utilizing GSDMD knockout (GSDMD-/-) pups, we induced the NEC phenotype and confirmed the successful ablation of GSDMD through the absence of GSDMD protein in peritoneal macrophages from GSDMD-/- pups (Fig. 3 A). Under conditions of formula gavage and hypoxia (Fig. 3 B), GSDMD-/- pups displayed a delayed onset of NEC symptoms (Fig. 3 C), with a reduced incidence rate of approximately 35% compared to wild-type (WT) mice (Fig. 3 D). Further examination of the protective role of GSDMD deficiency in NEC severity showed that, while NEC pups exhibited compromised microvillus integrity and mucosal epithelial cell structure, GSDMD-/- pups displayed a significant reduction in these histological changes, making them nearly indistinguishable from control specimens (Fig. 3 E). Pathological scoring by blinded observers also indicated a lower severity in GSDMD-deficient pups with NEC. Furthermore, while NEC led to a decrease in body weight in pups, GSDMD-/- pups experienced less weight loss and exhibited a more robust appearance (Fig. 3 F). Additionally, GSDMD-/- pups, including those with NEC, showed reduced white blood cell (WBC) counts and C-reactive protein (CRP) levels, akin to the observed effects on other inflammatory cytokines (Fig. 3 G, 3 H, 3 I, 3 J). 3.4.GSDMD ablation attenuates intestinal macrophages pyroptotic during NEC development. Our findings indicated a higher presence of peripheral neutrophils and monocytes in the blood of GSDMD knockout (GSDMD-/-) pups with NEC compared to their wild-type (WT) counterparts, as depicted in Fig. 4 A and 4 B. Under NEC stress, the intestinal count of F4/80 positive cells, indicative of macrophages, was notably reduced in GSDMD depleted pups, a reduction observable in the flow cytometry imagery presented in Fig. 4 C. Furthermore, a delay in the spontaneous demise of monocytes was observed in GSDMD-deficient pups, as illustrated in Fig. 4 D. Subsequently, peritoneal macrophages were harvested and evaluated, revealing that those extracted from GSDMD-/- pups were comparatively smaller in size than those from WT controls, indicating reduced inflammatory signaling (Fig. 4 E). The production of pro-inflammatory cytokines such as IL-1β and IL-18 also decreased in macrophages from GSDMD-/- pups (Fig. 4 F, 4 G). 3.5.GSDMD deficiency increases the killing abilities of macrophages Further verification of plasma membrane integrity post-infection was conducted by observing the presence of propidium iodide (PI) positive BMDMs. The proportion of PI positive BMDMs was significantly reduced in GSDMD knockout samples following E. coli infection (Fig. 5 A). Concurrently, the release of LDH by GSDMD-deficient BMDMs after E. coli infection was diminished compared to WT BMDMs. This reduction suggests that GSDMD depletion inhibits the pyroptosis of macrophages induced by E. coli, as indicated in Fig. 5 B. The administration of disulfiram to BMDMs significantly mitigated the number of PI positive cells and LDH release in a dose-dependent manner at 12 hours post LPS treatment, as shown in Figs. 5 C and 5 D. Bacterial overgrowth and translocation are pivotal factors driving the progression of NEC. To elucidate how GSDMD influences macrophage function, we conducted antimicrobial experiment. The use of disulfiram also significantly increased the killing abilities of BMDMs for E. coli. (Fig. 5 E and 5 F). These findings suggest that inhibiting GSDMD enhances the ability of BMDMs to eliminate bacteria by reducing the mortality of BMDMs. 3.6.Disulfiram reduces the severity of experimental NEC. Advancing our inquiry, we investigated the therapeutic impact of disulfiram within an experimental NEC model, as depicted in Fig. 6 A. Disulfiram mitigated intestinal injury and improved the survival rates of NEC pups, as depicted in Figs. 6 B, 6 C, and 6 D. Notably, disulfiram did not significantly modify the levels of these cytokines in the context of GSDMD depletion (as detailed in Fig. 6 E, 6 F, and 6 G). 4. Discussion In our current investigation, we have uncovered a heightened release of proinflammatory cytokines and significant infiltration of proinflammatory macrophages within the intestinal tract during the progression of NEC. Our findings also confirm that intestinal macrophages undergo pyroptosis, a process that triggers the release of proinflammatory factors through the gasdermin D (GSDMD) signaling pathway. This pathway appears to be intricately linked to the intestinal injury that is a hallmark of NEC. The targeted inhibition of GSDMD signaling led to an immature phenotype in macrophages and enhanced their anti-inflammatory functions, thus offering protection against severe inflammation and the associated intestinal injury. These results propose a groundbreaking therapeutic approach for infants afflicted with NEC. To the best of our knowledge, this study is pioneering in revealing the mechanism through which GSDMD signaling modulates macrophage activity and its contribution to intestinal injury in the development of NEC. It is widely recognized that the immature immune system of neonates plays a crucial role in severe intestinal inflammation, particularly when combating infections. Among these processes, macrophage pyroptosis, a predominant form of lytic cell death, is a critical cellular defense mechanism in the innate immune response(Chen et al., 2023 ; Ma et al., 2020 ). However, the exact mechanism of macrophage pyroptosis in the pathogenesis of NEC remains to be fully elucidated. Previous studies have indicated that the activation of the NLRP3 inflammasome and the resulting production of proinflammatory cytokines are associated with a variety of inflammatory conditions. Inhibiting the NLRP3 inflammasome can potentially compromise the integrity of the intestinal mucosal barrier (Song-Zhao et al., 2014 ) and has been shown to have beneficial effects on several digestive diseases, including ulcerative colitis and sepsis (Bulek et al., 2020 ). In this study, we discovered that the NLRP3 inflammasome, caspase-1, and GSDMD were activated during the intestinal injury associated with NEC, alongside a significant upregulation of the proinflammatory factor IL-1β. We observed a notable increase in GSDMD expression in the intestinal tissue following the development of NEC, which coincides with intestinal injury during the pathogenesis of NEC. This discovery highlights the role of pyroptosis and inflammatory activation in the progression of NEC and provides a foundation for further research into targeted therapies. Gasdermin D (GSDMD) is recognized as a pivotal mediator of pyroptosis, a programmed cell death pathway triggered by the emission of danger signals from pathogenic elements. GSDMD is activated through cleavage by inflammatory caspases, leading to the formation of GSDMD pores that compromise cell membrane integrity and precipitate pyroptosis. This inflammatory mechanism has been linked to the early shock phases observed in systemic hyperinflammatory responses (Hu et al., 2020 ; Xia et al., 2021 ). In concordance, another study reported that GSDMD-deficient mice demonstrated significantly higher survival rates and mitigated myocardial injury and dysfunction during lethal bacterial sepsis (Dai et al., 2021 ). Our research has uncovered that GSDMD depletion mitigates excessive inflammatory responses and intestinal barrier dysfunction in NEC. In human NEC samples, we observed activation of the NLRP3-GSDMD signaling pathway, presence of cleaved GSDMD in infiltrating macrophages, and release of proinflammatory cytokines. This finding confirms that GSDMD-induced pyroptosis is a prominent feature and plays an essential role in these pathological conditions. Additionally, the upregulation and activation of GSDMD in the NEC mouse model suggest that GSDMD is a potential molecular target for alleviating intestinal damage during the pathogenesis of sepsis. This finding is consistent with studies in mice deficient in other components of the inflammasome, such as NLRP3, caspase-1/11, and ASC, which are part of the upstream signaling pathways of GSDMD. In these studies, suppression of IL-1β production and bacterial sepsis were similarly observed (Zhang et al., 2021 ). We have previously reported the abundance of infiltrating macrophages in the intestinal lamina propria and the production of inflammatory cytokines in neonatal mouse models of NEC and human NEC patients. Moreover, circulating monocytes contribute to macrophage infiltration in the intestine, which is implicated in the disruption of intestinal barrier function during NEC. GSDMD has been confirmed as the principal mediator of macrophage activation (Liu et al., 2022 ) and orchestrating pyroptotic cell death (de Vasconcelos et al., 2020 ). During pyroptosis, macrophages are activated by inflammasomes and caspase-1/11, leading to the cleavage of GSDMD and facilitating the secretion of IL-1β (Jorgensen et al., 2015; Paik et al., 2021 ). For the first time, we have determined the critical role of GSDMD, the executor of pyroptosis, in the pathogenesis of NEC in both patients and in mice with stress-induced macrophage pyroptosis. Our findings reveal associations between GSDMD deficiency, macrophage migration, and cytokine signaling, suggesting that GSDMD activity is intertwined with macrophage activation and innate immunity. Subsequent animal studies have shown GSDMD oligomerization in the intestines in the context of NEC, with pyroptosis and inflammatory activation predominantly observed in infiltrating M1 macrophages. Monocytes and macrophages are pivotal as regulatory cells within the innate immune system and significantly contribute to the pathogenesis of NEC (Liu et al., 2021 ). The observed reduction of macrophages in GSDMD-deficient mice is associated with the dampening of inflammatory responses. In this study, peritoneal macrophages from GSDMD knockout (GSDMD-/-) mice displayed distinctive features, such as a smaller size suggestive of immaturity, diminished production of inflammatory cytokines, and lowered expression of PU.1. Notably, intestinal macrophages from GSDMD-/- mice demonstrated enhanced anti-inflammatory activity compared to those from wild-type (WT) mice. A possible explanation for this observation is that resident intestinal macrophages retain anti-inflammatory properties, and the absence of GSDMD further promotes the polarization of M2 macrophages with anti-inflammatory capabilities (Wang et al., 2023 ). Our findings highlight the potential therapeutic utility of GSDMD-depleted intestinal macrophages in managing inflammatory pathogenesis, particularly in low-birth-weight infants. The modulation of proinflammatory activation by GSDMD depletion during NEC may be linked to the mitigation of intestinal inflammatory injury, and GSDMD is also implicated in the differentiation of monocyte-like cells into macrophages (Sarkar et al., 2023 ). Macrophages contribute to intestinal inflammatory injury through the secretion of a spectrum of proinflammatory or anti-inflammatory cytokines (Tan et al., 2022 ). Proinflammatory M1 macrophages are instrumental in pathological inflammation, producing a range of proinflammatory cytokines, and their activity is correlated with NEC (Maheshwari et al., 2009 ). The advancement of various inflammatory conditions, including sepsis, can be curbed by limiting M1 macrophage infiltration (Zhang et al., 2020 ). Prior research has indicated that NEC induced damage enhances the activity of chemokines and their receptors, such as CXCL3, CCR1, CCR2, and CCR5, which regulate the migration of immune cells to sites of infection or distress [Maheshwari et al., 2011 ; Mei et al., 2010 ]. The recruitment and activation of immune cells, particularly macrophages, can exacerbate localized injury and trigger NEC-mediated systemic inflammatory responses. Our study disclosed that in GSDMD-depleted mice, both the infiltration of monocytes and macrophages in the intestines were numerically reduced, and the expression of surface markers was downregulated, suggesting a critical role for GSDMD in immune cell mobilization and inflammatory processes. During the pathogenesis of NEC, the activation of macrophages triggers the production of a plethora of chemokines and cytokines, which can significantly influence the apoptosis of intestinal epithelial cells (Wei et al., 2019 ). Our study has unveiled that GSDMD deficiency curtails macrophage infiltration and lessens systemic inflammatory reactions. Among the proinflammatory cytokines, interleukin-1 beta (IL-1β) is predominantly secreted during GSDMD-mediated macrophage pyroptosis in the NEC mouse model. This pivotal proinflammatory factor was notably released in the serum of NEC patients. IL-1β has the potential to incite intestinal inflammation, escalate intestinal permeability, undermine the intestinal barrier, and mediate further intestinal inflammation. This, in turn, facilitates the production of chemokines and other proinflammatory cytokines. GSDMD is implicated in inflammation and cell death, with particular relevance to neurological disorders and immune responses. In our study, we noted that GSDMD-deficient mice exhibited decreased morbidity and mortality, which we attribute to the suppression of inflammatory activation, indicating GSDMD's role in intestinal inflammation. This suggests that GSDMD deficiency may confer protective effects in specific inflammatory scenarios but could also potentially disrupt normal immune function. Further experimental research is necessary to elucidate the side effects of GSDMD deficiency. 5. Conclusions In summary, our findings suggest that GSDMD depletion alleviates the inflammatory response associated with M1 macrophages and confers significant protection against NEC. This new found understanding may lay the groundwork for innovative preventative strategies for infants suffering from NEC, offering hope for more effective clinical interventions in the future. Declarations Ethics Approval and Consent to participate Not applicable. Consent for publication Not applicable. Availability of data and Materials The data that support the findings of this study are available from the corresponding author upon reasonable request. Competing interests No potential conflicts of interest relevant to this article are reported. Funding This study was supported by the National Natural Science Foundation of China (No. 81900001), Chongqing Natural Science Foundation (No. cstc2019jcyj-msxmX0189, CSTB2022NSCQ-MSX0819), the Scientific and Technological Research Program of Chongqing Municipal Education Commission (Grant No. KJZD-K202100406) and the institute Research Program of Chongqing health center for women and children(2021YJQN03). Author’s Contributions X.L., Y.M., X.Y., D.M. and Q.D. performed the research. C.Y., Q.D. and C.G. designed the research study. X.D., X. L. and C.G. contributed essential reagents or tools. Q.D., Y.M., X.Y. and X.D. analysed the data. C.Y. and C.G. wrote the paper. Acknowledgements All experiments were approved by the animal care and use committee of Chongqing Medical University. We thank Miss Siqi Yang for academic support and Jiaren Liu at the Harvard University, USA, for help with the linguistic revision of the manuscript. References Bulek K, Zhao J, Liao Y, et al. Epithelial-derived gasdermin D mediates nonlytic IL-1β release during experimental colitis. J Clin Invest. 2020; 130(8):4218-4234. doi: 10.1172/JCI138103. Chen X, Wu R, Li L, et al. Pregnancy-induced changes to the gut microbiota drive macrophage pyroptosis and exacerbate septic inflammation. Immunity. 2023; 56(2):336-352.e9. doi: 10.1016/j.immuni.2023.01.015. Dai S, Ye B, Zhong L, et al. GSDMD Mediates LPS-Induced Septic Myocardial Dysfunction by Regulating ROS-dependent NLRP3 Inflammasome Activation. Front Cell Dev Biol. 2021; 9:779432. doi: 10.3389/fcell.2021.779432. Danielski LG, Giustina AD, Bonfante S, et al. The NLRP3 Inflammasome and Its Role in Sepsis Development. Inflammation. 2020; 43(1):24-31. doi: 10.1007/s10753-019-01124-9. de Vasconcelos NM, Van Opdenbosch N, Van Gorp H, et al. An Apoptotic Caspase Network Safeguards Cell Death Induction in Pyroptotic Macrophages. Cell Rep. 2020; 32(4):107959. doi: 10.1016/j.celrep.2020.107959. Ding X, Kambara H, Guo R, et al. Inflammasome-mediated GSDMD activation facilitates escape of Candida albicans from macrophages. Nat Commun. 2021; 12(1):6699. doi: 10.1038/s41467-021-27034-9. Fu H, Zhang P, Zhao XD, et al. Interfering with Rac1-activation during neonatal monocyte-macrophage differentiation influences the inflammatory responses of M1 macrophages. Cell Death Dis. 2023; 14(9):619. doi: 10.1038/s41419-023-06150-y. Hu JJ, Liu X, Xia S, et al. FDA-approved disulfiram inhibits pyroptosis by blocking gasdermin D pore formation. Nat Immunol. 2020; 21(7):736-745. doi: 10.1038/s41590-020-0669-6. Jorgensen I, Miao EA. Pyroptotic cell death defends against intracellular pathogens. Immunol Rev. 2015; 265(1):130-42. doi: 10.1111/imr.12287. Kang C, Zhang R, Wang G, et al. Simple Scoring System that Predicts the Need for Surgical Intervention in Infants with Necrotizing Enterocolitis. Arch Med Res. 2023; 54(1):37-44. doi: 10.1016/j.arcmed.2022.11.002. Li P, Wang B, Tang X, et al. Risk factors and a simple scoring system for predicting bowel resection in infants with NEC. Clin Res Hepatol Gastroenterol. 2022; 46(9):102020. doi: 10.1016/j.clinre.2022.102020. Liu Y, Xu Q, Wang Y, et al. Necroptosis is active and contributes to intestinal injury in a piglet model with lipopolysaccharide challenge. Cell Death Dis. 2021; 12(1):62. doi: 10.1038/s41419-020-03365-1. Liu Z, Wang M, Wang X, et al. XBP1 deficiency promotes hepatocyte pyroptosis by impairing mitophagy to activate mtDNA-cGAS-STING signaling in macrophages during acute liver injury. Redox Biol. 2022; 52:102305. doi: 10.1016/j.redox.2022.102305. Luo Y, Mo D, Guo H, et al. NF-κB inactivation attenuates the M1 macrophage polarization in experimental necrotizing enterocolitis by glutaredoxin-1 deficiency. Cell Biol Int. 2022; 46(11):1886-1899. doi: 10.1002/cbin.11861. Ma C, Yang D, Wang B, et al. Gasdermin D in macrophages restrains colitis by controlling cGAS-mediated inflammation. Sci Adv. 2020; 6(21):eaaz6717. doi: 10.1126/sciadv.aaz6717. Maheshwari A, Kelly DR, Nicola T, et al. TGF-β2 suppresses macrophage cytokine production and mucosal inflammatory responses in the developing intestine. Gastroenterology. 2011; 140(1):242-53. doi: 10.1053/j.gastro.2010.09.043. Maheshwari A, Kurundkar AR, Shaik SS, et al. Epithelial cells in fetal intestine produce chemerin to recruit macrophages. Am J Physiol Gastrointest Liver Physiol. 2009; 297(1):G1-G10. doi: 10.1152/ajpgi.90730.2008. Mei J, Liu Y, Dai N, et al. CXCL5 regulates chemokine scavenging and pulmonary host defense to bacterial infection. Immunity. 2010; 33(1):106-17. doi: 10.1016/j.immuni.2010.07.009. Paik S, Kim JK, Silwal P, et al. An update on the regulatory mechanisms of NLRP3 inflammasome activation. Cell Mol Immunol. 2021; 18(5):1141-1160. doi: 10.1038/s41423-021-00670-3. Pan HX, Zhang CS, Lin CH, et al. Mucin 1 and interleukin-11 protein expression and inflammatory reactions in the intestinal mucosa of necrotizing enterocolitis children after surgery. World J Clin Cases. 2021;9(25):7372-7380. doi: 10.12998/wjcc.v9.i25.7372. Sarkar A, Das S, Bone H, et al. Regulation of Mesenchymal Cell Fate by Transfer of Active Gasdermin-D via Monocyte-Derived Extracellular Vesicles. J Immunol. 2023; 210(6):832-841. doi: 10.4049/jimmunol.2200511. Shang Q, Bao L, Guo H, et al. Contribution of glutaredoxin-1 to S-glutathionylation of endothelial nitric oxide synthase for mesenteric nitric oxide generation in experimental necrotizing enterocolitis. Transl Res. 2017; 188:92-105. doi: 10.1016/j.trsl.2016.01.004. Shi B, Lyu CJ, Le ZK, et al. NLRP3 activation in macrophages promotes acute intestinal injury in neonatal necrotizing enterocolitis. World J Pediatr. 2024; 20(2):153-164. doi: 10.1007/s12519-023-00727-5. Song-Zhao GX, Srinivasan N, Pott J, et al. Nlrp3 activation in the intestinal epithelium protects against a mucosal pathogen. Mucosal Immunol. 2014; 7(4):763-774. doi: 10.1038/mi.2013.94. Tan F, Cao Y, Zheng L, et al. Diabetes exacerbated sepsis-induced intestinal injury by promoting M1 macrophage polarization via miR-3061/Snail1 signaling. Front Immunol. 2022; 13:922614. doi: 10.3389/fimmu.2022.922614. Wang Z, Chong Q, Zhou J, et al. Reduction of absolute monocyte counts is associated with the severity of preterm necrotizing enterocolitis. J Pediatr (Rio J). 2023; 99(5):449-455. doi: 10.1016/j.jped.2023.02.006. Wei J, Tang D, Lu C, et al. Irf5 deficiency in myeloid cells prevents necrotizing enterocolitis by inhibiting M1 macrophage polarization. Mucosal Immunol. 2019; 12(4):888-896. doi: 10.1038/s41385-019-0169-x. Xia S, Zhang Z, Magupalli VG, et al. Gasdermin D pore structure reveals preferential release of mature interleukin-1. Nature. 2021; 593(7860):607-611. doi: 10.1038/s41586-021-03478-3. Zhang WJ, Chen SJ, Zhou SC, et al. Inflammasomes and Fibrosis. Front Immunol. 2021; 12:643149. doi: 10.3389/fimmu.2021.643149. Zhang X, Tian B, Deng Q, et al. Nicotinamide riboside relieves the severity of experimental necrotizing enterocolitis by regulating endothelial function via eNOS deacetylation. Free Radic Biol Med. 2022;184:218-229. doi: 10.1016/j.freeradbiomed.2022.04.008. Zhang Y, Li X, Luo Z, et al. ECM1 is an essential factor for the determination of M1 macrophage polarization in IBD in response to LPS stimulation. Proc Natl Acad Sci U S A. 2020; 117(6):3083-3092. doi: 10.1073/pnas.1912774117. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFULLwb.pptx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6983696","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":487798423,"identity":"da63affa-ced0-4bf5-b0ca-2b838fc87ade","order_by":0,"name":"Cuilian Ye","email":"","orcid":"","institution":"Chongqing University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Cuilian","middleName":"","lastName":"Ye","suffix":""},{"id":487798424,"identity":"1fec388a-175f-496a-a11a-f758e43a3aae","order_by":1,"name":"Xinli Liu","email":"","orcid":"","institution":"Children’s Hospital of Chongqing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xinli","middleName":"","lastName":"Liu","suffix":""},{"id":487798425,"identity":"76048f65-2028-4a13-bc84-a4bb1db58df6","order_by":2,"name":"Yue Ma","email":"","orcid":"","institution":"Chongqing Health Center for Women and Children","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Ma","suffix":""},{"id":487798427,"identity":"b73a9ea5-bb22-43bf-8f34-4d799b27dd02","order_by":3,"name":"Xinyi Yang","email":"","orcid":"","institution":"Chongqing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xinyi","middleName":"","lastName":"Yang","suffix":""},{"id":487798428,"identity":"ee074856-3732-4778-b248-f5cefa5e605f","order_by":4,"name":"Dandan Mo","email":"","orcid":"","institution":"Chongqing University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Dandan","middleName":"","lastName":"Mo","suffix":""},{"id":487798433,"identity":"099217a8-2ebe-4a0f-bf26-699f60e783ff","order_by":5,"name":"Qin Deng","email":"","orcid":"","institution":"Children’s Hospital of Chongqing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qin","middleName":"","lastName":"Deng","suffix":""},{"id":487798435,"identity":"dd826b65-541d-42bf-891d-0031c6c0de43","order_by":6,"name":"Xionghui Ding","email":"","orcid":"","institution":"Children’s Hospital of Chongqing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xionghui","middleName":"","lastName":"Ding","suffix":""},{"id":487798436,"identity":"026d01ce-4d19-4553-b813-8fbfee17f608","order_by":7,"name":"Chunbao Guo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA30lEQVRIiWNgGAWjYJACZiBOAFIHPoB4bOzEa2FLnAHWwky8Fh7DGXAuPiAfkXzwc2HbnTz+9p6PDR/btsnzMTMwfviYg1uL4Y20ZOmZbc+KJc6c3dg448xtwzZmBmbJmdvwaJmRY8bM23Y4seFG7vbHPBW3GYFa2Jh5idEy/0bOw2Yeg9v2BLXIS0C1bLiRw9gMtCWRoBYDnmfJ0jznDhcbnjlmCPJLchszYzNev8i3A0OMp+xwntzx5ofAELttO7+9+eCHj/hsOYApxtiAWz3IFvzSo2AUjIJRMAqAAABqC1MIJcP1ZQAAAABJRU5ErkJggg==","orcid":"","institution":"Chongqing University of Technology","correspondingAuthor":true,"prefix":"","firstName":"Chunbao","middleName":"","lastName":"Guo","suffix":""}],"badges":[],"createdAt":"2025-06-26 12:53:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6983696/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6983696/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":87373765,"identity":"c5e6d47b-6e42-40b4-b1b5-b6662e59d7b7","added_by":"auto","created_at":"2025-07-23 07:34:44","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":378109,"visible":true,"origin":"","legend":"\u003cp\u003eGSDMD expression is positively correlated with the increases of monocyte and neutrophil in human and mice. \u003cbr\u003e\nA. Representative immunofluorescence staining for CD68 (red) and GSDMD (green) in the intestinal samples from human NEC infants (n = 6) and the tissue stains show fields chosen at random. Nuclei are stained by DAPI (blue). Scale bar = 100 μm. Three independent experiments were repeated with similar results. B. Quantitative analysis the number of indicated cells from (A). Twelve fields per section from each patients were analyzed. Columns: average values of a minimum of 3 independent experiments; The data are presented as means ± SDs from each group; #, P \u0026lt; 0.01, vs Non-NEC control (n = 8) (one-way ANOVA). C.Human GSDMD mRNA levels in various tissues for data retrieved from the BioGPS website. D.GSDMD mRNA levels in a subtype of immune cells from human (left panel). E.GSDMD mRNA levels in a subtype of immune cells from mice (right panel).\u003c/p\u003e","description":"","filename":"FIGURE1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6983696/v1/d4c8f9241cd4981203f97dbb.jpg"},{"id":87372926,"identity":"e9ef1d7f-d82b-4062-b00d-afa3a2a6455a","added_by":"auto","created_at":"2025-07-23 07:26:44","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":228302,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNLRP3 inhibitor MCC950 reduces IL-1β maturation and GSDMD cleavage during NEC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA.The intestinal segments from pups with experimental NEC and control groups (n = 6) were analyzed for mRNA levels of NLRP3, caspase-1, GSDMD, IL-1β, and IL-10, normalized to β-actin. A minimum of three independent experiments were conducted. Data are presented as mean values ± standard deviations (SDs). Statistical significance is denoted by * for P \u0026lt; 0.01 compared to non-NEC controls, and # for P \u0026lt; 0.01 compared to non-NEC controls (assessed by one-way ANOVA). B. Intestinal tissues from pups in the indicated treatment groups were analyzed by Western blot to evaluate the expression of Caspase1, NLRP3, GSDMD-NT(ologomer), GSDMD-NT, and IL-1β. Representative Western blots from three independent experiments are shown. The right panel presents quantification of Caspase1, NLRP3, GSDMD-N, and IL-1β levels, normalized to the loading control (n = 4), with data shown as means ± SDs. *, P \u0026lt; 0.01; #, P \u0026lt; 0.01 (one-way ANOVA).\u003c/p\u003e","description":"","filename":"FIGURE2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6983696/v1/776d3c1e5aea5be84ff4cbe7.jpg"},{"id":87374926,"identity":"05104728-8d92-4fe2-b2c4-f627d987b09b","added_by":"auto","created_at":"2025-07-23 07:42:44","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":399703,"visible":true,"origin":"","legend":"\u003cp\u003eGSDMD deficiency could lead decreased inflammatory reaction\u003c/p\u003e\n\u003cp\u003eA. Representative bands from immunoblotting analysis for GSDMD in intestinal homogenates with the indicated conditions. B. Diagram of the animal experiment. C. The manifestations (hours) intervals for the indicated managements were measured. The data are presented as means ± SDs from each group (n = 10-12 pups). #p \u0026lt; 0.01 versus WT (Student's t-test). D. The incidence of experimental NEC (damage scores over 2) in pups with the indicated conditions. The data are presented as means ± SDs from each group (n = 10-12 pups). #p \u0026lt; 0.01 versus WT (Student's t-test). E. Representative H \u0026amp; E staining of terminal ileums of experimental NEC mice as indicated at indicated conditions. Right panel: quantification of the scores of histological examination. The data are expressed as means ± SDs and represent three independent replicates (n = 6). Scale bars 100 µm. *, P \u0026lt; 0.01; #, P \u0026lt; 0.01 (one-way ANOVA). F. Body Weight changes at different group pups. The data are presented as means ± SDs from each group (n = 15-16 pups). G. The peri WBC levels were measured from pups with the indicated conditions(n = 6). The data are represented as means ± SDs. *, P \u0026lt; 0.01; #, P \u0026lt; 0.01 (one-way ANOVA). H. The peri CRP levels were measured from pups with the indicated conditions(n = 6). The data are represented as means ± SDs. *, P \u0026lt; 0.01; #, P \u0026lt; 0.01 (one-way ANOVA). I. The mRNA expression of IL-6 was measured in the terminal ileum of mice treated as indicated (n = 6). The data are represented as means ± SDs. *, P \u0026lt; 0.01; #, P \u0026lt; 0.01 (one-way ANOVA). J. The mRNA expression of IL-1β was measured in the terminal ileum of mice treated as indicated (n = 6). The data are represented as means ± SDs. *, P \u0026lt; 0.01; #, P \u0026lt; 0.01 (one-way ANOVA).\u003c/p\u003e","description":"","filename":"FIGURE3.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6983696/v1/676650cc6ec13b53abe7795b.jpg"},{"id":87374923,"identity":"aaf6dadc-0bf1-4dc9-b40e-0d433b2bb172","added_by":"auto","created_at":"2025-07-23 07:42:44","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":415296,"visible":true,"origin":"","legend":"\u003cp\u003eGSDMD deficiency could affect the biological performance of macrophages in NEC\u003c/p\u003e\n\u003cp\u003eA. B. Bar diagrams show the total number of peripheral neutrophils and monocytes from fresh blood samples of NEC mice in different time points(n = 6) assessed by flow cyto. Groups were compared by one-way ANOVA; #, P \u0026lt; 0.01. C. Under NEC stress, the expression of CD11c and F4/80 cells in intestines of NEC mice was evaluated by flow cytometry with the indicated conditions(n = 6). The representative flow cytometry diagrams of at least 3 independent experiments are presented. Right panal: Histogram of multiple flow cytometry experiments, columns represent the mean percentage of annexin V–positive cells from 5 independent experiments; *, P \u0026lt; 0.01; #, P \u0026lt; 0.01 (one-way ANOVA). D. Bone marrow (BM) cells were isolated from WT and GSDMD -/- pups with NEC and were differentiated into macrophages with M-CSF. Spontaneous death analyzed by annexin V and PI staining and evaluated by flow cytometry (n = 6). The representative flow cytometry diagrams of at least 3 independent experiments are presented. Right panal: Histogram of multiple flow cytometry experiments, columns represent the mean number of macrophages from 5 independent experiments; *, P \u0026lt; 0.01; #, P \u0026lt; 0.01 (one-way ANOVA). E. Representative images for peritoneal macrophages derived from GSDMD-/- and WT pups with NEC (n = 6). Scale bar = 50μm. Right panal: The two dimensional areas of intestinal macrophages were assessed utilizing image analysis software. The data are presented as means ± SDs. #, P \u0026lt; 0.01 (Student's t-test). F, G. The expression of IL-1β and IL-18 was measured by ELISA in the terminal ileum of NEC mice (n = 6). \u0026nbsp;The data are presented as means ± SDs. #, P \u0026lt; 0.01 (Student's t-test).\u003c/p\u003e","description":"","filename":"FIGURE4.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6983696/v1/3496352119785033baaf6bfa.jpg"},{"id":87373764,"identity":"15c1f82b-c4e7-4e55-9b78-d099315beccf","added_by":"auto","created_at":"2025-07-23 07:34:44","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":312586,"visible":true,"origin":"","legend":"\u003cp\u003eDisulfiram enhances the cytotoxicity and bacteria-killing capability of macrophage.\u003c/p\u003e\n\u003cp\u003eA. The percentage of PI-positive cells calculated for each group of BMDMs treated as indicated (n = 5). The data are represented as means ± SDs. #, P \u0026lt; 0.01 (one-way ANOVA). B. C. albicans induced BMDM death assessed by a lactate dehydrogenase (LDH) cytotoxicity assay (n = 5). The data are represented as means ± SDs. #, P \u0026lt; 0.01 (one-way ANOVA). C. Dose response of effect of disulfiram on the percentage of PI-positive cells treated as indicated. The data are represented as means ± SDs (n = 5). #, P \u0026lt; 0.01 (one-way ANOVA). D. Dose response of effect of disulfiram on the LDH release treated as indicated. The data are represented as means ± SDs (n = 5). #, P \u0026lt; 0.01 (one-way ANOVA). E. BMDMs treated with different doses of Disulfiram (n = 6). Samples were serially diluted and spread on Luria-Bertani agar plates. The numbers of E coli colonies were determined at 37°C. F. Quantitative analysis the number of CFU E for coli colonies. The data are represented as means ± SDs (n = 5). #, P \u0026lt; 0.01 (one-way ANOVA).\u003c/p\u003e","description":"","filename":"FIGURE5.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6983696/v1/b40151851c295340d6e273d5.jpg"},{"id":87375377,"identity":"95efbf30-fd8b-42cb-8497-f46b579f1ba7","added_by":"auto","created_at":"2025-07-23 07:50:44","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":300378,"visible":true,"origin":"","legend":"\u003cp\u003eThe inflammatory cytokines during NEC development were ameliorated by Disulfiram\u003c/p\u003e\n\u003cp\u003eA. Diagram of the animal experiment. B. Representative H \u0026amp; E staining of terminal ileums of experimental NEC mice at indicated condition. The data are representative of three independent replicates. Scale bars 50 µm. C. NEC severity scores were graded microscopically by a pathologist blinded to the indicated groups (n=10). The values are presented as the means ± SDs. *, P \u0026lt; 0.01; #, P \u0026lt; 0.01 (one-way ANOVA). D. Kaplan-Meier analysis the survival for pups with experimental NEC treated as indicated. Data are expressed as percent survival of the total study population (n=15–16 mice per group) Log-rank [Mantel-Cox] test, *, P \u0026lt; 0.01, vs non-NEC control; #, P \u0026lt; 0.01, vs NEC group. The serum IL-1β(E), TNF(F) and IL-6(G) concentrations in the experimental NEC treated as indicated. The data are represented as means ± SDs (n =5–7 mice in each group). *, P \u0026lt;0.01; #, P \u0026lt;0.01 (one-way ANOVA).\u003c/p\u003e","description":"","filename":"FIGURE6.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6983696/v1/1c7c9527c7595141ded2f669.jpg"},{"id":94251548,"identity":"133882e7-226d-4226-b3cf-2e643d8f1708","added_by":"auto","created_at":"2025-10-24 06:54:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3173891,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6983696/v1/e3ef9ace-0d3d-48be-8bb2-3d43ed485200.pdf"},{"id":87372951,"identity":"5836be44-1828-4627-b56a-0fe49d1c03b8","added_by":"auto","created_at":"2025-07-23 07:26:45","extension":"pptx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":908951,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFULLwb.pptx","url":"https://assets-eu.researchsquare.com/files/rs-6983696/v1/e951990c7737508dafd4f0c4.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"GSDMD ablation reduces intestinal inflammation of experimental NEC through macrophage pyroptosis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eNecrotizing enterocolitis (NEC) predominantly affects medically fragile preterm infants, marked by a decrease in intestinal blood flow and subsequent inflammatory necrosis(Kang et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Li et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The pathological progression is intensified by aberrant intestinal microbiota colonization breaching the epithelial barrier, leading to dysregulated proinflammatory responses. However, current research lacks comprehensive human data(Zhang et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The obscure pathogenesis of NEC obscures the development of effective prevention and treatment strategies, making the clarification of its pathogenesis and the discovery of new therapeutic targets a priority in modern research.\u003c/p\u003e\u003cp\u003eEmerging evidence suggests that innate immune responses in preterm neonates, provoked by bacteria and protozoa, lead to systemic inflammatory dysregulation, which in turn hampers the control of microbial infections in the development of NEC(Shang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Pyroptosis, an innate immune response to pathogen invasion, is characterized by an overproduction of proinflammatory cytokines that amplify tissue inflammation(Fu et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Among these cytokines, interleukin-1β (IL-1β) plays a pivotal role in caspase-1-mediated monocyte destruction during bacterial infections(Shi et al., 2023). Prior studies have correlated serum IL-1β levels with the severity of NEC(Pan et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003ePrevious research has delineated the link between NLRP3 inflammasome activation and caspase activation. Upon activation, caspases cleave gasdermin D (GSDMD), triggering the formation of nonselective membrane pores through a process of oligomerization.\u003c/p\u003e\u003cp\u003eGSDMD is ubiquitously expressed across various tissues and cell types, facilitating the maturation and release of proinflammatory cytokines such as IL-1β and IL-18 from macrophages into the plasma(Ding et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Mice lacking key inflammasome components, including NLRP3 or caspase-1/11, demonstrate decreased vulnerability to lethal endotoxemia and increased resistance against bacterial sepsis(Danielski et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Furthermore, GSDMD disruption mitigates cytokine release, thereby attenuating the severity of septic shock induced by polymicrobial infections.\u003c/p\u003e\u003cp\u003eOur previous work has established that hyperinflammatory activation of innate immune macrophages is a key feature in premature infants(Luo et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), contributing significantly to the inflammatory damage associated with NEC progression. During inflammatory and stressful conditions, like sepsis, macrophages may secrete these cytokines via GSDMD pores(Xia et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), potentially exacerbating the condition. Nevertheless, the physiological state of GSDMD and its precise role in pyroptosis during the pathogenesis of NEC warrant further investigation.\u003c/p\u003e\u003cp\u003eIn our current study, we explored the impact of GSDMD on intestinal inflammatory injury, aiming to shed light on its pivotal role in macrophage function. Our study determined the extent of macrophage infiltration and pyroptosis, with a particular focus on the mechanisms involving GSDMD and proinflammatory cytokines in NEC pathogenesis. Consequently, our findings posit GSDMD as a promising therapeutic target for neonatal NEC.\u003c/p\u003e"},{"header":"2. MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1.Human samples\u003c/h2\u003e\u003cp\u003eIntestinal tissue samples were collected from infants aged between 1 and 31 days who underwent emergency laparotomies for a diagnosis of NEC (n\u0026thinsp;=\u0026thinsp;6) at the Chongqing Health Center for Women and Children. Control tissue samples were obtained from eight infants undergoing surgery for congenital conditions, including duodenal stenosis and ileal atresia, as detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The timing of GSDMD level testing is crucial as it can markedly influence the outcomes and their relevance to clinical characteristics. The tissues collected were initially subjected to a primary pathological assessment. To ensure data integrity, the excess portions of NEC tissue samples, which were resected and selected from the resection margins that contained intact viable mucosa, were promptly preserved at -80\u0026deg;C for further analysis within a 15-minute window. This process ensures that the GSDMD levels reflect the immediate state of the tissue post-inflammation. Preterm infants were defined as those born with a gestational age of less than 37 weeks, while full-term infants were categorized as those with a gestational age ranging from 37 to 42 weeks. The protocol for this human subjects investigation, spanning from July 1, 2022, to July 30, 2024, was approved by the Institutional Review Board (IRB, No.: WCHMU2021-052) of the Chongqing Health Center for Women and Children. All methods were performed in accordance with the relevant guidelines and regulations of the ethical standards of the Declaration of Helsinki. Informed consent for participation in the study was obtained from the parents or legal guardians of the infants.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eDemographics and characteristics of Cases and Control.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNo.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSex\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ebirth weight\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003egestational age\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eAge(days)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eDiseases\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eSite of collection\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u003cp\u003eCases\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colspan=\"4\" nameend=\"c7\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2130g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e31W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNecrotizing Enterocolitis\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eileum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1862g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e30W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e28\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNecrotizing Enterocolitis\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eileum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2476g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNecrotizing Enterocolitis\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eileum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1289g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e26W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNecrotizing Enterocolitis\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eIleum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1684g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e28W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNecrotizing Enterocolitis\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eileum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1931g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e31W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e32\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNecrotizing Enterocolitis\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eileum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u003cp\u003eControl\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colspan=\"4\" nameend=\"c7\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2915g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e37W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eImperforate\u0026nbsp;anus\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ecolon\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2343g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eIleal atresia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ejejunum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3252g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e38W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eDuodenal septum\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eileum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2747g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e36W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eIleal atresia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eileum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3126g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e39W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e16\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eIleal atresia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ejejunum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2539g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e34W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eDuodenal septum\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ejejunum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2883g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e36W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eIleal atresia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ejejunum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2282g\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e32W\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eDuodenal septum\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eileum\u0026amp;jejunum\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e\u003cb\u003e2.2.\u003c/b\u003eExperimental NEC Model and Interventions\u003c/h2\u003e\u003cp\u003e Our laboratory animal management protocol has been approved by the Animal Care and Use Committee of the Chongqing Health Center for Women and Children and all methods were performed in accordance with the relevant guidelines and regulations. The study is reported in according to the ARRIVE guidelines form reporting on animal experiments (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://arriveguidelines.org\u003c/span\u003e\u003cspan address=\"https://arriveguidelines.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). We sourced C57BL/6 mice from Dr. Wenli Han at the Experimental Animal Center, Chongqing Medical University, and were graciously provided with GSDMD-deficient (GSDMD-/-) mice by Dr. Hongbo Luo from Boston Children's Hospital. Our study involved neonatal mice, five days old, weighing approximately 1.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10 grams, and born within the last 24 hours, which were exposed to stress conditions designed to induce NEC, following established methods from our laboratory. The protocol involved formula feeding every 4 hours at a dosage of 0.03 ml/g body weight, using a mixture of 7.5 g Similac Lower Iron (Abbott Laboratories, Ltd., Saint-Laurent, QC, Canada) and 34.5 ml Esbilac Puppy Milk Replacer (PetAg, Inc., Hampshire, IL, USA). Additionally, the subjects were exposed to cold (4\u0026deg;C for 10 minutes two times per day) and hypoxia (5% oxygen concentration for 10 minutes two times per day). The pups were monitored daily for NEC symptoms such as abdominal distension, apnea, and rectal bleeding. We meticulously recorded key parameters including the clinical incidence of NEC, changes in body weight, the time to NEC onset, and survival rates throughout the study. To assess the in vivo impact of disulfiram on our NEC model, we administered disulfiram, sourced from Biochempartner in Shanghai, China, via intraperitoneal injection to the neonatal mice at 24 and 48 hours post-NEC stress induction. The selected dosage of disulfiram was 50 mg/kg, which equates to a human equivalent dose of 284 mg/day. This dosage falls within the clinically approved range of 125\u0026ndash;500 mg/day, typically prescribed for the treatment of alcohol dependence. In some cases, pups in the NEC group received an intraperitoneal injection of MCC950 (10 mg/kg, Selleck) once a day for 4 consecutive days.\u003c/p\u003e\u003cp\u003eOn postnatal Day 14, the surviving animals were humanely euthanized using carbon dioxide(flow rate: displace 30\u0026ndash;70% of the euthanasia chamber volume per minute; concentrations: below 40%), and the complete intestinal tract was harvested for comprehensive macroscopic evaluation. Furthermore a secondary method of exsanguination may be required to ensure death. Subsequently, a detailed microscopic examination was conducted to assess the histological characteristics. The presence of NEC was definitively established by scrutinizing the histology of the terminal ileum. The criteria for grading the severity of NEC have been delineated by our research team. Furthermore, an additional section of the terminal ileum was meticulously preserved for subsequent detailed analyses, in accordance with methodologies outlined in our prior publications(Shang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3.Morphological examination and histological analysis\u003c/h2\u003e\u003cp\u003eOn postnatal Day 14, the surviving animals were humanely euthanized, followed by microscopic examination of the hematoxylin and eosin (H\u0026amp;E) stained sections of the terminal ileum. A blinded pathologist evaluated the histological alterations, indicative of mucosal injury, utilizing a standardized grading system as previously reported in our studies (Shang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4.Immunofluorescence assessment\u003c/h2\u003e\u003cp\u003eThe human tissue slides were meticulously prepared using a protocol we have detailed in previous works(Shang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). They were stained to identify CD86, a marker for the M1 macrophage phenotype, and CD206, a marker for the M2 macrophage phenotype. The slides were individually subjected to an overnight incubation at 4\u0026deg;C with a suite of primary antibodies, including monoclonal mouse anti-human CD86, monoclonal mouse anti-human CD206, anti-F4/80 (diluted 1:50, Sigma), and anti-GSDMD-NT (diluted 1:50, Sigma).\u003c/p\u003e\u003cp\u003eFollowing the primary antibody incubation, the slides were exposed to relevant secondary antibodies conjugated with Alexa Fluor 488/594 (Invitrogen, San Diego, CA) for 1 hour at room temperature. This step allowed for the fluorescent labeling of the target proteins, facilitating their visualization under a fluorescence microscope.\u003c/p\u003e\u003cp\u003eTo delineate the cell nuclei, the slides were counterstained with 4\u0026rsquo;,6-diamidino-2-phenylindole (DAPI, Sigma). Both a negative control, devoid of F4/80 antibodies, and an appropriate isotype control were systematically incorporated throughout the staining process to ensure the specificity of the immunofluorescence signal.\u003c/p\u003e\u003cp\u003eThe stained sections were examined using a fluorescence confocal microscope, which provided high-resolution imaging of the cellular structures and antigen distribution. The subsequent quantitative evaluation was performed using the WCIF ImageJ software (National Institutes of Health, Bethesda, MD), an open-source tool renowned for its analytical capabilities.\u003c/p\u003e\u003cp\u003eIn a thorough and systematic manner, a total of 20 fields per section were assessed to ensure a comprehensive and representative analysis of the tissue slides. This approach allowed us to quantify the presence of M1 and M2 macrophages within the tissue samples, providing valuable insights into the immunological landscape of the human tissue under study.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5.Bone marrow-derived macrophages (BMDMs) and stimulation\u003c/h2\u003e\u003cp\u003eBMDMs were meticulously isolated from the femurs and tibias of 8-week-old mice, following an established protocol (Ding et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). To achieve this, the bone marrow cells were extracted, resuspended, and subsequently cultured in the presence of macrophage colony-stimulating factor (M-CSF, 20 ng/ml) for six days to facilitate their differentiation into mature primary macrophages. Unless specified otherwise, the M-CSF-differentiated BMDMs were employed for the experiments that followed. Microscopic analysis verified that over 95% of the adherent cells displayed the morphological features typical of mature macrophages. The isolated BMDMs were then plated in 12-well plates that had been precoated with poly-L-lysine (Sigma-Aldrich) and were primed with lipopolysaccharide (LPS, 100 ng/ml) for a duration of four hours, after which the priming stimulus was eliminated. In the context of pharmacological interventions, disulfiram (concentrations ranging from 0 to 1 \u0026micro;M) was introduced into the culture medium and allowed to incubate for 12 hours before the introduction of E. coli infection or LPS priming.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6.qRT‒PCR\u003c/h2\u003e\u003cp\u003eTotal cellular RNA was meticulously extracted from freshly isolated intestinal tissues using TRIzol reagent (Invitrogen, Carlsbad, CA). Subsequently, one microgram of the isolated RNA was subjected to reverse transcription and amplification using an ABI 7300 system (Applied Biosystems). This process employed oligo-dT (18) primers and SuperScript II Reverse Transcriptase, both procured from Invitrogen (Carlsbad, CA). The specific primer sequences, provided by Life Technologies Corporation (Carlsbad, CA), are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. To ascertain the relative expression levels of each gene, we applied the comparative ΔΔCt method.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe primer sequences for the real-time PCR measurement\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHuman NLRP3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCACCTGTTGTGCAATCTGAAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCAAGATCCTGACAACATGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHuman Caspase-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGACCTCTGACAGCACGTTCCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCCCACAAATGCCTTCCCGAAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHuman GSDMD\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTAGACTGGCCACATGGCTA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGGGTCTTGCTGGACGAGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHuman IL-1β\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCCTAAACAGATGAAGTGCTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAACCAGCATCTTCCTCAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHuman β-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGC ACC AGG GCG TGA TGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTC TCA AAC ATG ATC TGG GTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse IL-1β\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGTGTGGATCCCAAGCAATACCCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGTCCTGACCACTGTTGTTTCCCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse IL-6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCAATTTCCAATGCTCTCCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACCACAGTGAGGAATGTCCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse CXCL2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCAACCACCAGGCTACAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCGTCACACTCAAGCTCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse CCL3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTACAAGCAGCAGCGAGTACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAGCAAAGGCTGCTGGTTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse CCL4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGTGCTCCAGGGTTCTCAGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCAGGGCTCACTGGGGTTAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse CXCL5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGTCCACAGTGCCCTACG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCGAGTGCATTCCGCTTA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse CD86\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGGAGAGGGAAGAGAGTGAACA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCCCATAAGTGTGCTCTGAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse iNOS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTTCTCAAGGCACAGGTCTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCAGGTCACTTATGTCACTTATC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse CD206\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCATGGACAATGCGCGAGCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCACCTGTGGCCCAAGACACGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse Arg-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTCTCAAAAGGACAGCCTCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCTCTTCATTGGCTTTCCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse TNF-α\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATGGCCTCCCTCTCATCAGTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACAGGCTTGTCACTCGAATTTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse IL-10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGGCAGAGAAGCATGGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGCTCCACTGCCTTGCTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse β-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCCTGGAGAAGAGCTACGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGTACAGGTCTTTGCGGATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7.Myeloperoxidase (MPO), Malondialdehyde (MDA) and Superoxide dismutase (SOD) assessments\u003c/h2\u003e\u003cp\u003eThe biochemical evaluation of intestinal tissues for myeloperoxidase (MPO), malondialdehyde (MDA), and superoxide dismutase (SOD) was conducted with a meticulous approach. Fresh intestinal tissue samples, each weighing 8 milligrams, were meticulously homogenized and then subjected to a centrifugation process to isolate the cellular components.\u003c/p\u003e\u003cp\u003eProtein concentrations within the supernatant were ascertained utilizing a bicinchoninic acid (BCA) protein assay reagent, procured from Pierce (Rockford, IL), which provided a quantitative assessment of the protein content.\u003c/p\u003e\u003cp\u003eBuilding upon the methodologies outlined in preceding studies(Shang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), we employed commercially available kits for the subsequent analyses. Myeloperoxidase activity was quantified using a specialized assay kit from Abcam (Cambridge, UK), which is designed to measure MPO levels accurately. The levels of malondialdehyde, an indicator of lipid peroxidation, were evaluated with a TBARS (thiobarbituric acid-reactive substances) assay kit sourced from Sigma (St. Louis, MO). Superoxide dismutase activity was determined using a highly sensitive ELISA kit provided by the Nanjing Jiancheng Bioengineering Institute (Nanjing, China), following the manufacturer's instructions for precise results.\u003c/p\u003e\u003cp\u003eAll data obtained from these assays were normalized against the protein levels of the respective samples to ensure the accuracy and reliability of the comparative analysis. This normalization step is critical for ensuring that the results are biologically meaningful and not confounded by variations in protein content.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8.Flow cytometric analysis of apoptosis\u003c/h2\u003e\u003cp\u003eThe determination of BMDMs apoptosis was carried out with precision using an Annexin V-FITC Apoptosis Detection Kit from BD Pharmingen (San Diego, CA). The process commenced with the initial staining of BMDMs with Annexin V-FITC, a fluorescent conjugate with high affinity for phosphatidylserine, and propidium iodide (PI), which is used to identify non-viable cells. This dual-staining approach allowed for the clear discrimination of apoptotic and necrotic cells.\u003c/p\u003e\u003cp\u003eSubsequently, the cells were subjected to analysis on a state-of-the-art BD LSR II flow cytometer from BD Biosciences (San Jose, CA). A meticulous count of 20,000 cells per sample was ensured to obtain statistically robust results. This step was critical in acquiring accurate and reliable measurements of apoptosis levels within the BMDM population.\u003c/p\u003e\u003cp\u003eFollowing data acquisition, a thorough analysis was conducted using FlowJo software (Tree Star, San Carlos, CA). The software's advanced algorithms facilitated the interpretation of flow cytometric data, enabling the identification of distinct cell populations and the quantification of apoptosis rates. The results were then normalized and presented to reflect the biological status of the BMDMs in response to various experimental conditions. This comprehensive approach provided a clear and detailed assessment of BMDM apoptosis, contributing valuable insights into the cellular mechanisms at play.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9.Western Blot assessment\u003c/h2\u003e\u003cp\u003eThe extraction and quantification of total protein from snap-frozen intestinal homogenates and whole-cell lysates were performed following the established methods referenced in the literature (Shang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). With precision, the protein concentrations were measured, ensuring that each sample contained an equal amount of protein\u0026mdash;specifically, 30 \u0026micro;g.\u003c/p\u003e\u003cp\u003e The samples were then carefully subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), a technique that effectively separates proteins based on their molecular weight. Following electrophoresis, the resolved proteins were transferred onto polyvinylidene fluoride (PVDF) membranes, a step critical for the immunoblotting process. The membranes were incubated with a set of primary antibodies that target specific proteins of interest: GSDMD, the N-terminal fragment of GSDMD (GSDMD-NT), Caspase-1, NLRP3 inflammasome complex, Interleukin-1β (IL-1β), and the housekeeping protein β-actin. These antibodies were sourced from Santa Cruz Biotechnology, known for their specificity and reliability. After the primary incubation, the membranes were subjected to appropriate secondary antibodies that bind to the primary antibodies, which facilitated the visualization of immunoreactive bands. The use of horseradish peroxidase as a revealing agent allowed for the detection of these bands, providing a visual representation of the protein expression levels. The relative band intensities, indicative of the relative abundance of the proteins, were quantified using a Kodak Scientific Imaging System from Kodak (Rockville, MD). This system provided high-resolution imaging and accurate quantification capabilities. β-actin was utilized as an internal loading control to normalize the protein levels across samples, ensuring the reliability of the comparative analysis. This meticulous process ensured a robust and reliable assessment of protein expression, providing valuable insights into the molecular mechanisms at play in the intestinal samples.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10.Measurement of cytokines.\u003c/h2\u003e\u003cp\u003eThe quantification of key cytokines and inflammatory mediators in both culture supernatants and mouse serum was performed with a high degree of precision using enzyme-linked immunosorbent assay (ELISA) kits from R\u0026amp;D Systems. The specific targets of these assays included the chemokine (C-X-C motif) ligand 2 (CXCL2), chemokine (C-C motif) ligand 3 (CCL3), interleukin-1 beta (IL-1β), interleukin-18 (IL-18), tumor necrosis factor-alpha (TNF-α), interleukin-6 (IL-6), high-mobility group box 1 (HMGB1), and extracellular cold-inducible RNA-binding protein (eCIRP).\u003c/p\u003e\u003cp\u003eEach ELISA kit was employed in strict accordance with the manufacturer's detailed guidelines, ensuring the accuracy and reproducibility of the results. The assays were designed to capture the respective proteins with high specificity, allowing for the sensitive detection and quantification of these critical inflammatory markers.\u003c/p\u003e\u003cp\u003eThe process involved the addition of culture supernatants or mouse serum samples to the pre-coated ELISA plates, followed by a series of incubation steps with specific antibodies. This was succeeded by the addition of a substrate that, upon reaction with the bound enzyme, yielded a colorimetric signal proportional to the concentration of the target protein present in the sample.\u003c/p\u003e\u003cp\u003eThe optical density of each well was measured using a microplate reader, and the concentration of each cytokine or mediator was calculated by comparing the absorbance values to a standard curve generated from known concentrations of the respective protein standards provided with the ELISA kits.\u003c/p\u003e\u003cp\u003eThis comprehensive approach provided a robust assessment of the inflammatory milieu, offering valuable insights into the immune response and the role of these mediators in the pathophysiological processes under investigation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11.Cell viability assays.\u003c/h2\u003e\u003cp\u003eThe vitality of the cultured BMDMs was meticulously evaluated employing the lactate dehydrogenase (LDH) release assay, a standard method for gauging cell survival. The Pierce\u0026trade; LDH Cytotoxicity Assay Kit from Thermo Fisher Scientific was utilized in accordance with the manufacturer's comprehensive guidelines, ensuring a standardized and reliable procedure.\u003c/p\u003e\u003cp\u003eThe supernatant from the BMDM cultures was carefully collected and subjected to centrifugation to remove any cell debris, which could potentially interfere with the assay results. This step was performed at a speed of 500 \u0026times; g for a duration of 6 minutes, ensuring a clear and debris-free sample.\u003c/p\u003e\u003cp\u003eSubsequently, the luminescence and absorbance were measured at an optical density (OD) of 490 nm using a BioTek Synergy 2 plate reader. This advanced instrument provided sensitive and accurate readings, crucial for assessing the LDH activity in the samples.\u003c/p\u003e\u003cp\u003eThe cytotoxicity index, an important parameter in our analysis, was calculated as the percentage of LDH activity in the culture medium relative to the total LDH activity, which includes both the medium and the cellular content. This index provides a quantitative measure of cell damage or lysis, offering valuable insights into the viability of the BMDMs under various experimental conditions.\u003c/p\u003e\u003cp\u003eThis rigorous and systematic approach to assessing cell viability ensures that our findings are robust and reflective of the true biological effects, facilitating a deeper understanding of the cellular responses under investigation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.12.Phagocytosis assessment\u003c/h2\u003e\u003cp\u003eThe phagocytic ability of macrophages was evaluated employing a method we have previously detailed(Shang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Initially, the zymosan bioparticles, procured from Invitrogen (Carlsbad, CA), were incubated with fluorescein isothiocyanate (FITC) in a light-controlled environment to ensure the integrity of the fluorescence signal. This step was critical for the subsequent tracking of phagocytosis by macrophages.\u003c/p\u003e\u003cp\u003eBefore initiating the assay, BMDMs were primed with 100 ng/ml of lipopolysaccharide (LPS) to activate their phagocytic pathways. Subsequently, the zymosan bioparticles were introduced to the macrophage cultures at a precise ratio of 1:10 (zymosan to cell number), providing an optimal balance for effective phagocytic assessment.\u003c/p\u003e\u003cp\u003eFlow cytometry (FACS) was then utilized to measure the extent of phagocytosis. This was achieved by quantifying the percentage of macrophages that had engulfed the FITC-labeled bioparticles, an indicator expressed as the phagocytosis index (PI). The use of FACS allowed for the rapid and accurate determination of the phagocytic capacity of the macrophages, providing a clear and quantitative reflection of their functional state in terms of particle engulfment and processing.\u003c/p\u003e\u003cp\u003eThis refined and systematic approach to assessing macrophage phagocytosis offers a robust method for evaluating the cellular immune response and the efficacy of macrophage function under various experimental conditions.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e2.13. Antimicrobial assessment of BMDMs\u003c/h2\u003e\u003cp\u003eFresh cultures of Escherichia coli, Candida albicans, and Cronobacter sakazakii, sourced from the American Type Culture Collection (ATCC, Manassas, VA), were meticulously cultured overnight. These cultures were then resuspended in phosphate-buffered saline (PBS) and their optical density adjusted to an OD600 of 0.20, a measure indicative of the bacterial concentration.\u003c/p\u003e\u003cp\u003eBMDMs of diverse genotypes were prepared at a density of 0.5 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells per well and pretreated with a range of disulfiram concentrations, procured from Sigma-Aldrich (St. Louis, MO), for a period of 12 hours prior to the assay. This pretreatment step was integral to evaluating the effects of disulfiram on macrophage function.\u003c/p\u003e\u003cp\u003eSubsequently, the BMDMs, at a concentration of 10\u003csup\u003e5\u003c/sup\u003e, were cocultured with the bacteria at a multiplicity of infection (MOI) that resulted in 10\u003csup\u003e7\u003c/sup\u003e colony-forming units (CFUs) of bacteria. The coculture was conducted at a controlled temperature of 37\u0026deg;C with periodic agitation to ensure uniform distribution and interaction between the macrophages and bacteria.\u003c/p\u003e\u003cp\u003eFollowing an overnight incubation at 30\u0026deg;C, the bacterial growth was assessed by quantifying the CFUs. This quantification was performed 24 hours postincubation, a time point selected based on prior research (Shang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), and was conducted using methods previously described in the literature for accuracy and consistency.\u003c/p\u003e\u003cp\u003eThis systematic and controlled experimental approach allowed for a comprehensive assessment of the interaction between macrophages and various bacterial species under the influence of disulfiram, providing valuable insights into the potential modulation of macrophage activity and bacterial growth.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e2.14.Statistical measurement\u003c/h2\u003e\u003cp\u003eThe data for this research were carefully manipulated using GraphPad Prism software, version 4, developed by GraphPad Software in San Diego, California. Quantitative data, depicted as mean values with their corresponding standard deviations (\u0026plusmn;\u0026thinsp;SDs), were subjected to rigorous statistical analysis. Student's t-test or analysis of variance (ANOVA) was initially applied to identify significant differences, with subsequent Bonferroni's multiple comparison test being utilized for further refinement as necessary. For the analysis of survival data across different groups, the log-rank (Mantel-Cox) test was employed. A threshold of P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was established to indicate the presence of statistically significant findings.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.1.Macrophage pyroptosis in human NEC samples\u003c/h2\u003e\u003cp\u003eWe first investigated the specific cellular sources of cleaved GSDMD in the inflamed intestine using immunofluorescence assays on tissue samples from six NEC patients. Our findings indicated a substantial presence of activated GSDMD within inflammatory cells, including CD68-positive macrophages, suggesting the occurrence of macrophage pyroptosis in NEC (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). GSDMD expression was significantly elevated in inflamed areas compared to normal intestinal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). These observations suggest that GSDMD plays a regulatory role in the release of inflammatory mediators, potentially exacerbating intestinal damage in NEC. In line with this, data from the BioGPS website showed that GSDMD is expressed in various human and mouse tissues, with whole blood cells displaying the highest levels of GSDMD expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D, E).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.2. Inhibition of NLRP3 reduces GSDMD/IL-1β activation during NEC\u003c/h2\u003e\u003cp\u003eWe conducted experiments to demonstrate the activation of the NLRP3 inflammasome in our NEC model. The intestinal segments were subjected to RNA extraction, and the mRNA levels of various inflammatory mediators were quantified using PCR, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. This will include assessing the expression levels of NLRP3 and the activation of caspase-1, which are key indicators of NLRP3 inflammasome activation(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Notably, the median expression levels of NLRP3, caspase-1, IL-1β, and GSDMD were marked increase in the affected NEC samples, compared to tissues from non-NEC controls.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe treat our NEC model with a specific NLRP3 inhibitor (MCC950) and examine the formation of GSDMD oligomers and the levels of mature IL-1β and using non-reducing Western blot. We found that inhibiting NLRP3 using MCC950 will significantly reduce the maturation of IL-1β and formation of GSDMD oligomers, thereby attenuating the inflammatory response(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e3.3.GSDMD ablation alleviated NEC phenotype\u003c/h2\u003e\u003cp\u003eBuilding upon our findings, we proceeded to investigate the potential of GSDMD deficiency to mitigate intestinal inflammation, thereby offering protection against the development of experimental NEC. Utilizing GSDMD knockout (GSDMD-/-) pups, we induced the NEC phenotype and confirmed the successful ablation of GSDMD through the absence of GSDMD protein in peritoneal macrophages from GSDMD-/- pups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Under conditions of formula gavage and hypoxia (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), GSDMD-/- pups displayed a delayed onset of NEC symptoms (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), with a reduced incidence rate of approximately 35% compared to wild-type (WT) mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFurther examination of the protective role of GSDMD deficiency in NEC severity showed that, while NEC pups exhibited compromised microvillus integrity and mucosal epithelial cell structure, GSDMD-/- pups displayed a significant reduction in these histological changes, making them nearly indistinguishable from control specimens (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Pathological scoring by blinded observers also indicated a lower severity in GSDMD-deficient pups with NEC. Furthermore, while NEC led to a decrease in body weight in pups, GSDMD-/- pups experienced less weight loss and exhibited a more robust appearance (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Additionally, GSDMD-/- pups, including those with NEC, showed reduced white blood cell (WBC) counts and C-reactive protein (CRP) levels, akin to the observed effects on other inflammatory cytokines (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e3.4.GSDMD ablation attenuates intestinal macrophages pyroptotic during NEC development.\u003c/h2\u003e\u003cp\u003eOur findings indicated a higher presence of peripheral neutrophils and monocytes in the blood of GSDMD knockout (GSDMD-/-) pups with NEC compared to their wild-type (WT) counterparts, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB. Under NEC stress, the intestinal count of F4/80 positive cells, indicative of macrophages, was notably reduced in GSDMD depleted pups, a reduction observable in the flow cytometry imagery presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC. Furthermore, a delay in the spontaneous demise of monocytes was observed in GSDMD-deficient pups, as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eSubsequently, peritoneal macrophages were harvested and evaluated, revealing that those extracted from GSDMD-/- pups were comparatively smaller in size than those from WT controls, indicating reduced inflammatory signaling (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). The production of pro-inflammatory cytokines such as IL-1β and IL-18 also decreased in macrophages from GSDMD-/- pups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003e3.5.GSDMD deficiency increases the killing abilities of macrophages\u003c/h2\u003e\u003cp\u003eFurther verification of plasma membrane integrity post-infection was conducted by observing the presence of propidium iodide (PI) positive BMDMs. The proportion of PI positive BMDMs was significantly reduced in GSDMD knockout samples following E. coli infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Concurrently, the release of LDH by GSDMD-deficient BMDMs after E. coli infection was diminished compared to WT BMDMs. This reduction suggests that GSDMD depletion inhibits the pyroptosis of macrophages induced by E. coli, as indicated in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB. The administration of disulfiram to BMDMs significantly mitigated the number of PI positive cells and LDH release in a dose-dependent manner at 12 hours post LPS treatment, as shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD. Bacterial overgrowth and translocation are pivotal factors driving the progression of NEC. To elucidate how GSDMD influences macrophage function, we conducted antimicrobial experiment. The use of disulfiram also significantly increased the killing abilities of BMDMs for E. coli. (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). These findings suggest that inhibiting GSDMD enhances the ability of BMDMs to eliminate bacteria by reducing the mortality of BMDMs.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\u003ch2\u003e3.6.Disulfiram reduces the severity of experimental NEC.\u003c/h2\u003e\u003cp\u003eAdvancing our inquiry, we investigated the therapeutic impact of disulfiram within an experimental NEC model, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA. Disulfiram mitigated intestinal injury and improved the survival rates of NEC pups, as depicted in Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC, and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD. Notably, disulfiram did not significantly modify the levels of these cytokines in the context of GSDMD depletion (as detailed in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF, and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn our current investigation, we have uncovered a heightened release of proinflammatory cytokines and significant infiltration of proinflammatory macrophages within the intestinal tract during the progression of NEC. Our findings also confirm that intestinal macrophages undergo pyroptosis, a process that triggers the release of proinflammatory factors through the gasdermin D (GSDMD) signaling pathway. This pathway appears to be intricately linked to the intestinal injury that is a hallmark of NEC. The targeted inhibition of GSDMD signaling led to an immature phenotype in macrophages and enhanced their anti-inflammatory functions, thus offering protection against severe inflammation and the associated intestinal injury. These results propose a groundbreaking therapeutic approach for infants afflicted with NEC. To the best of our knowledge, this study is pioneering in revealing the mechanism through which GSDMD signaling modulates macrophage activity and its contribution to intestinal injury in the development of NEC.\u003c/p\u003e\u003cp\u003eIt is widely recognized that the immature immune system of neonates plays a crucial role in severe intestinal inflammation, particularly when combating infections. Among these processes, macrophage pyroptosis, a predominant form of lytic cell death, is a critical cellular defense mechanism in the innate immune response(Chen et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Ma et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, the exact mechanism of macrophage pyroptosis in the pathogenesis of NEC remains to be fully elucidated. Previous studies have indicated that the activation of the NLRP3 inflammasome and the resulting production of proinflammatory cytokines are associated with a variety of inflammatory conditions. Inhibiting the NLRP3 inflammasome can potentially compromise the integrity of the intestinal mucosal barrier (Song-Zhao et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) and has been shown to have beneficial effects on several digestive diseases, including ulcerative colitis and sepsis (Bulek et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn this study, we discovered that the NLRP3 inflammasome, caspase-1, and GSDMD were activated during the intestinal injury associated with NEC, alongside a significant upregulation of the proinflammatory factor IL-1β. We observed a notable increase in GSDMD expression in the intestinal tissue following the development of NEC, which coincides with intestinal injury during the pathogenesis of NEC. This discovery highlights the role of pyroptosis and inflammatory activation in the progression of NEC and provides a foundation for further research into targeted therapies.\u003c/p\u003e\u003cp\u003eGasdermin D (GSDMD) is recognized as a pivotal mediator of pyroptosis, a programmed cell death pathway triggered by the emission of danger signals from pathogenic elements. GSDMD is activated through cleavage by inflammatory caspases, leading to the formation of GSDMD pores that compromise cell membrane integrity and precipitate pyroptosis. This inflammatory mechanism has been linked to the early shock phases observed in systemic hyperinflammatory responses (Hu et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Xia et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In concordance, another study reported that GSDMD-deficient mice demonstrated significantly higher survival rates and mitigated myocardial injury and dysfunction during lethal bacterial sepsis (Dai et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Our research has uncovered that GSDMD depletion mitigates excessive inflammatory responses and intestinal barrier dysfunction in NEC. In human NEC samples, we observed activation of the NLRP3-GSDMD signaling pathway, presence of cleaved GSDMD in infiltrating macrophages, and release of proinflammatory cytokines. This finding confirms that GSDMD-induced pyroptosis is a prominent feature and plays an essential role in these pathological conditions. Additionally, the upregulation and activation of GSDMD in the NEC mouse model suggest that GSDMD is a potential molecular target for alleviating intestinal damage during the pathogenesis of sepsis. This finding is consistent with studies in mice deficient in other components of the inflammasome, such as NLRP3, caspase-1/11, and ASC, which are part of the upstream signaling pathways of GSDMD. In these studies, suppression of IL-1β production and bacterial sepsis were similarly observed (Zhang et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eWe have previously reported the abundance of infiltrating macrophages in the intestinal lamina propria and the production of inflammatory cytokines in neonatal mouse models of NEC and human NEC patients. Moreover, circulating monocytes contribute to macrophage infiltration in the intestine, which is implicated in the disruption of intestinal barrier function during NEC. GSDMD has been confirmed as the principal mediator of macrophage activation (Liu et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and orchestrating pyroptotic cell death (de Vasconcelos et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). During pyroptosis, macrophages are activated by inflammasomes and caspase-1/11, leading to the cleavage of GSDMD and facilitating the secretion of IL-1β (Jorgensen et al., 2015; Paik et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). For the first time, we have determined the critical role of GSDMD, the executor of pyroptosis, in the pathogenesis of NEC in both patients and in mice with stress-induced macrophage pyroptosis. Our findings reveal associations between GSDMD deficiency, macrophage migration, and cytokine signaling, suggesting that GSDMD activity is intertwined with macrophage activation and innate immunity. Subsequent animal studies have shown GSDMD oligomerization in the intestines in the context of NEC, with pyroptosis and inflammatory activation predominantly observed in infiltrating M1 macrophages.\u003c/p\u003e\u003cp\u003eMonocytes and macrophages are pivotal as regulatory cells within the innate immune system and significantly contribute to the pathogenesis of NEC (Liu et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The observed reduction of macrophages in GSDMD-deficient mice is associated with the dampening of inflammatory responses. In this study, peritoneal macrophages from GSDMD knockout (GSDMD-/-) mice displayed distinctive features, such as a smaller size suggestive of immaturity, diminished production of inflammatory cytokines, and lowered expression of PU.1. Notably, intestinal macrophages from GSDMD-/- mice demonstrated enhanced anti-inflammatory activity compared to those from wild-type (WT) mice. A possible explanation for this observation is that resident intestinal macrophages retain anti-inflammatory properties, and the absence of GSDMD further promotes the polarization of M2 macrophages with anti-inflammatory capabilities (Wang et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Our findings highlight the potential therapeutic utility of GSDMD-depleted intestinal macrophages in managing inflammatory pathogenesis, particularly in low-birth-weight infants. The modulation of proinflammatory activation by GSDMD depletion during NEC may be linked to the mitigation of intestinal inflammatory injury, and GSDMD is also implicated in the differentiation of monocyte-like cells into macrophages (Sarkar et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eMacrophages contribute to intestinal inflammatory injury through the secretion of a spectrum of proinflammatory or anti-inflammatory cytokines (Tan et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Proinflammatory M1 macrophages are instrumental in pathological inflammation, producing a range of proinflammatory cytokines, and their activity is correlated with NEC (Maheshwari et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The advancement of various inflammatory conditions, including sepsis, can be curbed by limiting M1 macrophage infiltration (Zhang et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Prior research has indicated that NEC induced damage enhances the activity of chemokines and their receptors, such as CXCL3, CCR1, CCR2, and CCR5, which regulate the migration of immune cells to sites of infection or distress [Maheshwari et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Mei et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2010\u003c/span\u003e]. The recruitment and activation of immune cells, particularly macrophages, can exacerbate localized injury and trigger NEC-mediated systemic inflammatory responses. Our study disclosed that in GSDMD-depleted mice, both the infiltration of monocytes and macrophages in the intestines were numerically reduced, and the expression of surface markers was downregulated, suggesting a critical role for GSDMD in immune cell mobilization and inflammatory processes.\u003c/p\u003e\u003cp\u003eDuring the pathogenesis of NEC, the activation of macrophages triggers the production of a plethora of chemokines and cytokines, which can significantly influence the apoptosis of intestinal epithelial cells (Wei et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Our study has unveiled that GSDMD deficiency curtails macrophage infiltration and lessens systemic inflammatory reactions. Among the proinflammatory cytokines, interleukin-1 beta (IL-1β) is predominantly secreted during GSDMD-mediated macrophage pyroptosis in the NEC mouse model. This pivotal proinflammatory factor was notably released in the serum of NEC patients. IL-1β has the potential to incite intestinal inflammation, escalate intestinal permeability, undermine the intestinal barrier, and mediate further intestinal inflammation. This, in turn, facilitates the production of chemokines and other proinflammatory cytokines. GSDMD is implicated in inflammation and cell death, with particular relevance to neurological disorders and immune responses. In our study, we noted that GSDMD-deficient mice exhibited decreased morbidity and mortality, which we attribute to the suppression of inflammatory activation, indicating GSDMD's role in intestinal inflammation. This suggests that GSDMD deficiency may confer protective effects in specific inflammatory scenarios but could also potentially disrupt normal immune function. Further experimental research is necessary to elucidate the side effects of GSDMD deficiency.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn summary, our findings suggest that GSDMD depletion alleviates the inflammatory response associated with M1 macrophages and confers significant protection against NEC. This new found understanding may lay the groundwork for innovative preventative strategies for infants suffering from NEC, offering hope for more effective clinical interventions in the future.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics Approval and Consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and Materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo potential conflicts of interest relevant to this article are reported.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Natural Science Foundation of China (No. 81900001), Chongqing Natural Science Foundation (No. cstc2019jcyj-msxmX0189, CSTB2022NSCQ-MSX0819), the Scientific and Technological Research Program of Chongqing Municipal Education Commission (Grant No. KJZD-K202100406) and the institute Research Program of Chongqing health center for women and children(2021YJQN03). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eX.L., Y.M., X.Y., D.M. and Q.D. performed the research. C.Y., Q.D. and C.G. designed the research study. X.D., X. L. and C.G. contributed essential reagents or tools. Q.D., Y.M., X.Y. and X.D. analysed the data. C.Y. and C.G. wrote the paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were approved by the animal care and use committee of Chongqing Medical University. We thank Miss Siqi Yang for academic support and Jiaren Liu at the Harvard University, USA, for help with the linguistic revision of the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBulek K, Zhao J, Liao Y, et al. Epithelial-derived gasdermin D mediates nonlytic IL-1\u0026beta; release during experimental colitis. J Clin Invest. 2020; 130(8):4218-4234. doi: 10.1172/JCI138103. \u003c/li\u003e\n\u003cli\u003eChen X, Wu R, Li L, et al. Pregnancy-induced changes to the gut microbiota drive macrophage pyroptosis and exacerbate septic inflammation. Immunity. 2023; 56(2):336-352.e9. doi: 10.1016/j.immuni.2023.01.015. \u003c/li\u003e\n\u003cli\u003eDai S, Ye B, Zhong L, et al. GSDMD Mediates LPS-Induced Septic Myocardial Dysfunction by Regulating ROS-dependent NLRP3 Inflammasome Activation. Front Cell Dev Biol. 2021; 9:779432. doi: 10.3389/fcell.2021.779432. \u003c/li\u003e\n\u003cli\u003eDanielski LG, Giustina AD, Bonfante S, et al. The NLRP3 Inflammasome and Its Role in Sepsis Development. Inflammation. 2020; 43(1):24-31. doi: 10.1007/s10753-019-01124-9. \u003c/li\u003e\n\u003cli\u003ede Vasconcelos NM, Van Opdenbosch N, Van Gorp H, et al. An Apoptotic Caspase Network Safeguards Cell Death Induction in Pyroptotic Macrophages. Cell Rep. 2020; 32(4):107959. doi: 10.1016/j.celrep.2020.107959. \u003c/li\u003e\n\u003cli\u003eDing X, Kambara H, Guo R, et al. Inflammasome-mediated GSDMD activation facilitates escape of Candida albicans from macrophages. Nat Commun. 2021; 12(1):6699. doi: 10.1038/s41467-021-27034-9. \u003c/li\u003e\n\u003cli\u003eFu H, Zhang P, Zhao XD, et al. Interfering with Rac1-activation during neonatal monocyte-macrophage differentiation influences the inflammatory responses of M1 macrophages. Cell Death Dis. 2023; 14(9):619. doi: 10.1038/s41419-023-06150-y.\u003c/li\u003e\n\u003cli\u003eHu JJ, Liu X, Xia S, et al. FDA-approved disulfiram inhibits pyroptosis by blocking gasdermin D pore formation. Nat Immunol. 2020; 21(7):736-745. doi: 10.1038/s41590-020-0669-6. \u003c/li\u003e\n\u003cli\u003eJorgensen I, Miao EA. Pyroptotic cell death defends against intracellular pathogens. Immunol Rev. 2015; 265(1):130-42. doi: 10.1111/imr.12287. \u003c/li\u003e\n\u003cli\u003eKang C, Zhang R, Wang G, et al. Simple Scoring System that Predicts the Need for Surgical Intervention in Infants with Necrotizing Enterocolitis. Arch Med Res. 2023; 54(1):37-44. doi: 10.1016/j.arcmed.2022.11.002. \u003c/li\u003e\n\u003cli\u003eLi P, Wang B, Tang X, et al. Risk factors and a simple scoring system for predicting bowel resection in infants with NEC. Clin Res Hepatol Gastroenterol. 2022; 46(9):102020. doi: 10.1016/j.clinre.2022.102020.\u003c/li\u003e\n\u003cli\u003eLiu Y, Xu Q, Wang Y, et al. Necroptosis is active and contributes to intestinal injury in a piglet model with lipopolysaccharide challenge. Cell Death Dis. 2021; 12(1):62. doi: 10.1038/s41419-020-03365-1. \u003c/li\u003e\n\u003cli\u003eLiu Z, Wang M, Wang X, et al. XBP1 deficiency promotes hepatocyte pyroptosis by impairing mitophagy to activate mtDNA-cGAS-STING signaling in macrophages during acute liver injury. Redox Biol. 2022; 52:102305. doi: 10.1016/j.redox.2022.102305. \u003c/li\u003e\n\u003cli\u003eLuo Y, Mo D, Guo H, et al. NF-\u0026kappa;B inactivation attenuates the M1 macrophage polarization in experimental necrotizing enterocolitis by glutaredoxin-1 deficiency. Cell Biol Int. 2022; 46(11):1886-1899. doi: 10.1002/cbin.11861. \u003c/li\u003e\n\u003cli\u003eMa C, Yang D, Wang B, et al. Gasdermin D in macrophages restrains colitis by controlling cGAS-mediated inflammation. Sci Adv. 2020; 6(21):eaaz6717. doi: 10.1126/sciadv.aaz6717.\u003c/li\u003e\n\u003cli\u003eMaheshwari A, Kelly DR, Nicola T, et al. TGF-\u0026beta;2 suppresses macrophage cytokine production and mucosal inflammatory responses in the developing intestine. Gastroenterology. 2011; 140(1):242-53. doi: 10.1053/j.gastro.2010.09.043.\u003c/li\u003e\n\u003cli\u003eMaheshwari A, Kurundkar AR, Shaik SS, et al. Epithelial cells in fetal intestine produce chemerin to recruit macrophages. Am J Physiol Gastrointest Liver Physiol. 2009; 297(1):G1-G10. doi: 10.1152/ajpgi.90730.2008. \u003c/li\u003e\n\u003cli\u003eMei J, Liu Y, Dai N, et al. CXCL5 regulates chemokine scavenging and pulmonary host defense to bacterial infection. Immunity. 2010; 33(1):106-17. doi: 10.1016/j.immuni.2010.07.009. \u003c/li\u003e\n\u003cli\u003ePaik S, Kim JK, Silwal P, et al. An update on the regulatory mechanisms of NLRP3 inflammasome activation. Cell Mol Immunol. 2021; 18(5):1141-1160. doi: 10.1038/s41423-021-00670-3.\u003c/li\u003e\n\u003cli\u003ePan HX, Zhang CS, Lin CH, et al. Mucin 1 and interleukin-11 protein expression and inflammatory reactions in the intestinal mucosa of necrotizing enterocolitis children after surgery. World J Clin Cases. 2021;9(25):7372-7380. doi: 10.12998/wjcc.v9.i25.7372. \u003c/li\u003e\n\u003cli\u003eSarkar A, Das S, Bone H, et al. Regulation of Mesenchymal Cell Fate by Transfer of Active Gasdermin-D via Monocyte-Derived Extracellular Vesicles. J Immunol. 2023; 210(6):832-841. doi: 10.4049/jimmunol.2200511. \u003c/li\u003e\n\u003cli\u003eShang Q, Bao L, Guo H, et al. Contribution of glutaredoxin-1 to S-glutathionylation of endothelial nitric oxide synthase for mesenteric nitric oxide generation in experimental necrotizing enterocolitis. Transl Res. 2017; 188:92-105. doi: 10.1016/j.trsl.2016.01.004. \u003c/li\u003e\n\u003cli\u003eShi B, Lyu CJ, Le ZK, et al. NLRP3 activation in macrophages promotes acute intestinal injury in neonatal necrotizing enterocolitis. World J Pediatr. 2024; 20(2):153-164. doi: 10.1007/s12519-023-00727-5. \u003c/li\u003e\n\u003cli\u003eSong-Zhao GX, Srinivasan N, Pott J, et al. Nlrp3 activation in the intestinal epithelium protects against a mucosal pathogen. Mucosal Immunol. 2014; 7(4):763-774. doi: 10.1038/mi.2013.94. \u003c/li\u003e\n\u003cli\u003eTan F, Cao Y, Zheng L, et al. Diabetes exacerbated sepsis-induced intestinal injury by promoting M1 macrophage polarization via miR-3061/Snail1 signaling. Front Immunol. 2022; 13:922614. doi: 10.3389/fimmu.2022.922614. \u003c/li\u003e\n\u003cli\u003eWang Z, Chong Q, Zhou J, et al. Reduction of absolute monocyte counts is associated with the severity of preterm necrotizing enterocolitis. J Pediatr (Rio J). 2023; 99(5):449-455. doi: 10.1016/j.jped.2023.02.006.\u003c/li\u003e\n\u003cli\u003eWei J, Tang D, Lu C, et al. Irf5 deficiency in myeloid cells prevents necrotizing enterocolitis by inhibiting M1 macrophage polarization. Mucosal Immunol. 2019; 12(4):888-896. doi: 10.1038/s41385-019-0169-x. \u003c/li\u003e\n\u003cli\u003eXia S, Zhang Z, Magupalli VG, et al. Gasdermin D pore structure reveals preferential release of mature interleukin-1. Nature. 2021; 593(7860):607-611. doi: 10.1038/s41586-021-03478-3. \u003c/li\u003e\n\u003cli\u003eZhang WJ, Chen SJ, Zhou SC, et al. Inflammasomes and Fibrosis. Front Immunol. 2021; 12:643149. doi: 10.3389/fimmu.2021.643149. \u003c/li\u003e\n\u003cli\u003eZhang X, Tian B, Deng Q, et al. Nicotinamide riboside relieves the severity of experimental necrotizing enterocolitis by regulating endothelial function via eNOS deacetylation. Free Radic Biol Med. 2022;184:218-229. doi: 10.1016/j.freeradbiomed.2022.04.008.\u003c/li\u003e\n\u003cli\u003eZhang Y, Li X, Luo Z, et al. ECM1 is an essential factor for the determination of M1 macrophage polarization in IBD in response to LPS stimulation. Proc Natl Acad Sci U S A. 2020; 117(6):3083-3092. doi: 10.1073/pnas.1912774117.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"NEC, GSDMD, macrophage pyroptosis, IL-1β, disulfiram","lastPublishedDoi":"10.21203/rs.3.rs-6983696/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6983696/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNecrotizing enterocolitis (NEC) is predominantly linked to heightened macrophage inflammasome activity. This heightened activity triggers the pyroptotic cell death of macrophages, a process orchestrated by the protein gasdermin D (GSDMD). The exact contribution of macrophages pyroptosis to NEC remains to be fully elucidated. Our study delves into the pivotal function of GSDMD in the pyroptosis of macrophages within the context of experimental NEC. We identified a correlation between GSDMD and macrophage pyroptosis in the terminal ileum of infants with NEC. Employing GSDMD-deficient models and disulfiram, an agent that impedes GSDMD-mediated pore formation, we observed a marked improvement in the symptoms of NEC in mouse pups, coupled with a diminished presence of intestinal macrophages. Additionally, bone marrow-derived macrophages (BMDMs) from GSDMD-deficient mice demonstrated reduced overall macrophage numbers and M1 polarization. Notably, while GSDMD inhibition enhanced the macrophages antibacterial capabilities, their phagocytic activity towards zymosan particles was unaffected. Collectively, our findings highlight the integral role of GSDMD in modulating macrophage inflammasome responses and posit GSDMD as a promising candidate for therapeutic intervention in NEC.\u003c/p\u003e","manuscriptTitle":"GSDMD ablation reduces intestinal inflammation of experimental NEC through macrophage pyroptosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-23 07:26:39","doi":"10.21203/rs.3.rs-6983696/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a459d78d-e73e-48e9-beee-4babd1d38190","owner":[],"postedDate":"July 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":51788380,"name":"Biological sciences/Cell biology"},{"id":51788381,"name":"Health sciences/Diseases"},{"id":51788382,"name":"Biological sciences/Immunology"},{"id":51788383,"name":"Biological sciences/Microbiology"}],"tags":[],"updatedAt":"2025-10-24T06:53:44+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-23 07:26:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6983696","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6983696","identity":"rs-6983696","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}