Transcranial direct current stimulation-mediated miR-298-5p downregulation enhances autophagy by targeting LC3 to promote motor recovery after spinal cord injury | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Transcranial direct current stimulation-mediated miR-298-5p downregulation enhances autophagy by targeting LC3 to promote motor recovery after spinal cord injury Qinhe Pan, Jianmin Chen, Weifeng Zuo, Xiaolu Li, chun LiuFu, Yun Tang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4355457/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract While transcranial direct current stimulation (tDCS) has been shown to contribute to motor recovery after spinal cord injury (SCI), the underlying mechanisms behind this process remain unclear. In the present study, we sought to explore whether tDCS can inhibit apoptosis, activate autophagy, and promote functional recovery. To achieve this aim, SCI was induced in rats using a modified Allen’s method and managed with tDCS. MicroRNAs responding to tDCS administration were detected using microRNA sequencing and validated using a quantitative real-time polymerase chain reaction. Dual-luciferase reporter analysis and miRNA overexpression were applied to verify the possible mechanisms of tDCS regulation. Stimulation of PC12 cells with hydrogen peroxide (H2O2) to simulate SCI models in vitro allowed for the detection of the effect of miR-298-5p on neuronal apoptosis and autophagy induced by SCI. The findings revealed that miR-298-5p was upregulated after SCI and decreased after tDCS. In vitro, miR-298-5p silencing was found to promote autophagy and reduce apoptosis in SCI, whereas miR-298-5p overexpression was associated with enhanced SCI-induced neuronal injury. LC3 was demonstrated to be the functional target of miR-298-5p, and tDCS was found to enhance autophagy flux, reduce neuronal apoptosis, improve nerve fiber regeneration, and minimize motor deficits after SCI in vivo. However, all tDCS-induced effects were counteracted after overexpression of miR-298-5p by agomir. In conclusion, this study shows that while miR-298-5p could be detrimental to SCI, tDCS can increase autophagy flux and inhibit neuronal apoptosis by negatively regulating miR-98-5p, thereby improving the recovery of motor function in SCI. Spinal cord injury transcranial direct current stimulation motor cortex autophagy apoptosis neuroprotection motor function recovery Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Introduction Spinal cord injury (SCI) is a serious and complicated neurological disorder that can result in the dysfunction or loss of multiple functions below the injured spinal cord segments[ 1 , 2 ]. Generally, people with SCI consider motor function to be the highest priority in terms of recovery[ 3 , 4 ]. Indeed, such loss of motor control is largely attributable to the interruption of descending control signals from the motor cortex (M1) of the brain past the lesion site[ 5 ]. Restoring this control requires reconstruction of the fibrous connections between the spinal motor neurons below the injury and the specific neurons of M1, which remains a major surgical challenge[ 6 , 7 ]. Most SCIs are incomplete, thereby allowing for the opportunity to foster the reconnection of the brain with the spinal cord below the lesion by sprouting residual nerve fibers from spared and/or inured axon populations[ 5 , 8 ]. However, to date, only a few satisfactory therapies for neural repair have been established[ 9 , 10 ]. This is likely due to the multidimensional pathophysiological changes that develop in injured regions[ 10 – 12 ]. The pathophysiology of SCI involves primary and secondary injury mechanisms[ 13 ]. Specifically, mechanical events can lead to compression and tearing of the spinal cord, which would be referred to as the primary injury. The primary injury is followed by a secondary injury cascade, which consists of the activation of neuronal apoptosis and the inhibition of autophagy flux, which ultimately lead to massive tissue destruction[ 14 , 15 ]. Autophagy is a cellular response that maintains homeostasis in the cell structure and function and exhibits close interactions with apoptosis[ 16 ]. However, autophagy is often inhibited after SCI,[ 17 ] which can further aggravate the damage and lead to continued functional deficits[ 6 ]. Generally, secondary injury leads to cystic cavitation in the lesion, which makes the local microenvironment unfavorable for the regeneration of nerve fibers[ 6 , 18 ]. Because secondary injury involves a relatively long and reversible process, it is often an available target for therapeutic mediation[ 17 , 19 ]. MicroRNA (miRNA) is a type of endogenous, noncoding, small-molecule RNA that can participate in the post-transcriptional regulation of the gene expressions of various biological functions[ 20 , 21 ]. Extensive work has been done to study changes in gene expression by screening miRNAs, of which a small proportion may play a vital role in the modulation of the secondary injury cascade after SCI[ 22 ]. In one of our previous studies, we discovered that blocking the expression of miR-106-5p in a rat SCI model can promote motor recovery by modulating neuronal apoptosis and autophagic flux[ 15 ]. In a related vein, He et al. concluded that overexpression of miR-92a-3p could promote functional recovery by inhibiting apoptosis in SCI mice. Therefore, certain miRNAs may serve as promising therapeutic targets for SCI rehabilitation[ 23 , 24 ]. Transcranial direct current stimulation (tDCS) is considered a promising non-invasive neuromodulation approach, and its effects on improving motor function in persons with SCI conditions have been universally supported[ 25 , 26 ]. In particular, the latest research emphasizes that tDCS can induce plasticity among the residual neural circuits at the lesion site to facilitate motor output after an SCI; however, knowledge of the inner molecular mechanisms at play here has yet to be obtained[ 5 , 27 ]. Nevertheless, despite these limitations, Sharif et al. found that neuromodulation delivered over M1 can drive corticospinal tract sprouting by reactivating the axon growth-promoting molecular pathways [ 6 ]. In another study, Zhang et al. demonstrated how the tDCS-induced effects of neuroplasticity were associated with the anti-apoptosis mechanism in stroke[ 28 ], and Guo et al. showed that tDCS may exert neuroprotective effects in cases of vascular dementia via the modulation of autophagy[ 29 ]. Against this background, this study advances the hypothesis that certain miRNAs might be involved in the tDCS-mediated repair of motor function after SCI by regulating apoptosis and autophagy. Specifically, we suggest that the associated in-depth molecular mechanisms investigated in this study may be involved in the tDCS-mediated repair of motor function after SCI by regulating apoptosis and autophagy. Material and Methods Animals All female adult Sprague-Dawley rats (eight weeks old, weighing 180–220 g) were purchased from the Animal Experimental Center (Guangxi Medical University, Nanning, China). All experimental procedures were approved by the Guangxi Medical University Ethics Committee (approval No. 202105013) in May 2021 and were performed in strict accordance with the National Institutes of Health guidelines for laboratory animal care and safety. Following SCI, many animals suffer from urination dysfunction. The urethra of female rats is wide and short, which is convenient for squeezing urine out of the bladder. Thus, female rats were chosen for this experiment. All rats were housed in an Specefic Pathogen Free (SPF) environment at 22–24℃ under a 12-hour light-dark cycle, with food and water consistently available. The rats were randomized into the following five groups: the sham group, the SCI group, the SCI + tDCS group, the SCI + tDCS + miR-negative control (NC) group, and the SCI + tDCS + miR-agomir group. Establish SCI animal model The SCI rat model was implemented on the basis of a modified version of Allen’s method. Briefly, pentobarbital (1%, 50 mg/kg) was used to anesthetize each rat, which was then immobilized in the prone position. Then, the rat underwent a laminectomy at the thoracic vertebra level to expose the T10 spinal segment. Afterward, a stereotaxic apparatus (Ruiwode Life Science Co., Ltd., Shenzhen, China) was used to secure the rat, and the dorsal surface of the spine was submitted to weight-drop injury using a 10-g impact rod with a diameter of 3 mm that was released from a 5-cm vertical height through a glass tube[15, 30, 31].The striking force on the dura mater and spinal cord measured 50 g (Fig. 1a and Fig. 1b). The rats with signs of hyperaemia and edema on the surface of the spinal cord surrounding T10, spasmodic tail-wagging reflection, retraction flutter of the body and lower limbs, and flaccid paralysis of both hind limbs represented a successful application of the model[10, 17, 32]. In the sham group, the rats underwent laminectomy without further spinal cord contusion. Finally, for all of the rats, the muscles and skin were disinfected and sutured separately. After the operation, each rat received an intraperitoneal injection of penicillin daily for three consecutive days. Their bladders were checked and manually massaged twice a day to help in urinating. Motor function evaluation According to the Basso–Beattie–Bresnahan (BBB) scale, the hind limb function of the rats was evaluated blindly before and one, three, five, and seven days after each operation in an open field by two trained independent observers. The evaluation time for each rat was 5 min, and the scores ranged from 0 to 21 points (0 points indicated complete paralysis, and 21 points meant normal locomotion)[33]. Rats with BBB scores higher than 3 on the first postoperative day were excluded due to modeling failure, and backup rats were then supplemented in the model. The swim test is another scoring system for assessing functional recovery. One week before surgery, all the rats were trained to swim from one end of the glass-filled tank to the other for five consecutive days. The rats in each group were then scored by the Louisville Swimming Scale (LSS)[34], which evaluates forelimb dependence, hindlimb movement and alternation, trunk instability, and body angle. Mean scores were calculated when tested more than twice for each ra tDCS-protocol Twenty-four hours after the SCI, the rats underwent a tDCS procedure (1 m A, 20 min, 10 min per side) each day for seven days[35-37]. First, the fur around the bregma was shaved to ensure the tight attachment of the electrodes. Then, the anode and cathode electrodes—both pediatric electrocardiogram electrodes with conductive hydrogel—were trimmed to a contact area of 1.5 cm 2 for a better fit [38].The anode was then fixed to the skin with an adhesive tape over the M1 area (3 mm to the left of the bregma, and 2 mm in front of the interaural line) and then connected to a battery-driven stimulator. (ActivaTek lnc., Gilroy, CA, USA). The cathode electrode was placed over the supraorbital area (midpoint between the lateral angles of both eyes)[39]. The rats were restrained by a soft cloth during stimulation[40, 41](Fig. 2). High-throughput miRNA sequencing To assess possible changes of miRNA in response to tDCS after SCI, rats were anesthetized at seven days post-tDCS, and a 10-mm long spinal cord segment (at a distance of approximately 0.5 cm from the injury epicenter) was harvested. The total RNA was extracted using Trizol (Invitrogen, CA), and the concentration was quantified. Regarding microarray detection, hybridization and analysis were performed using mirDeep2 software based on the miRBase database. The miRNA sequencing was performed by Sangon Biotech (Shanghai, China). The threshold set for upregulated and downregulated genes was a p-value 1. Luciferase Reporter Assay A bioinformatics analysis was then performed using TargetScan (http://www.targetscan.org/vert_72/) to identify the favorable binding site between miR-298-5p and LC3. A wild-type (WT) LC3 3’UTR fragment containing the putative miR-298-5p binding sequence, along with the mutant version (MU), was ordered from Sangon Biotech. (Shanghai, China). The above sequences were cloned into a psiCHECK-2 dual-luciferase vector (Promega, USA) to generate LC3-WT and LC3-MU recombinant vectors. PC-12 cells were plated in 96-well plates for co-transfection with LC3-WT/LC3-MU plasmids and rno-miR-298-5p mimic or NC. Quantification of luciferase activity after 48 hours of transfection was determined using a luciferase detection system (Madison, USA, USA) according to the manufacturer’s protocol. Lentivirus (LV) Construction and Intrathecal Injections To further explore the function of miR-298-5p, miR-298-5p lentiviral vectors were constructed using GeneChem Co. Ltd. (Shanghai, China). In the SCI + tDCS + miR-agomir group, the rats were intrathecally injected with LV-rno-miR-298-5p-agomir; in contrast, the rats in the SCI + tDCS + miR-NC group were intrathecally injected with LV-rno-miR-298-5p-NC. The original titers of the lentiviral vector were 6×10 8 transduction units (TU) / mL. Before injection, lentiviral vectors (6×10 8 TU/mL) were mixed with 0.01 M phosphate buffer solution (PBS; Servicebio, Wuhan, China) on ice to obtain a final lentiviral vector concentration of 4×10 8 TU/mL. Subsequently, intrathecal injections of agomir or NC were performed daily for three consecutive days in these rats[42-44]. Experiments were performed one week later. Haematoxylin & Eosin (H&E) and Nissl Staining The 10-mm spinal cord segments centered at the injury epicenter were carefully harvested, fixed with 4% paraformaldehyde immersion for 24 hours, and then embedded with paraffin.A cross-section (5μm thick) was then placed on a glass slide coated with poly-L-lysine for analysis of the diseased tissue after deaffinity and rehydration. H&E staining was employed to examine the tissue histopathology. After being stained with toluidine blue (1%) for Nissl bodies, the spinal tissue sections were visualized under an optical microscope. (BX53, Olympus, Tokyo, Japan). Immunofluorescence analysis The paraffin-embedded sections were added and incubated with the primary antibodies for an entire night at 4°C. Then, dewaxing was performed to ensure transparency, after which hydrogen peroxide (H 2 O 2 ) was applied to repair the antigen. Finally, the sections were incubated with a secondary antibody at 37°C for 30 min, incubated with diaminobenzidine (DAB) for 10 min, counterstained with hematoxylin for 3 min, and attached to coverslips. The results were visualized and photographed under an optical microscope. (BX53, Olympus, Tokyo, Japan). Transmission electron microscope (TEM) The tissue segments were then dissected and fixed in glutaraldehyde (2.5%) in sodium phosphate buffer (0.1 M) for 24 hours. After rinsing with PBS, the tissues were post-fixed with osmium tetroxide (1%) in a sodium phosphate buffer. The specimens of spinal tissues were then dehydrated with gradient ethyl alcohol solutions and embedded in epoxy resin. Ultrathin sections were prepared and stained with 2% uranyl acetate and 2.6% lead citrate, which were later visualized using a transmission electron microscope (7800; Hitachi, Tokyo, Japan). Cell culture and cell model establishment PC-12 cell lines are often selected as research tools for in vitro SCI studies.[93,59] In line with this approach, PC-12 cells purchased from the Chinese Academy of Sciences (Shanghai, China) were cultured at 37°C with 5% CO 2 in Dulbecco’s modified Eagle’s medium (Gibco, CA, USA) supplemented with 8% fetal bovine serum (Gibco) and 1% penicillin-streptomycin solution mixture (Gibco) .The PC-12 cells were randomly divided into the following six groups: a control group, H 2 O 2 group, H 2 O 2 + miR-mimics group,H 2 O 2 + miR-mimics-NC group, H 2 O 2 + miR-inhibitors group, and H 2 O 2 + miR-inhibitors-NC group. An application of H 2 O 2 (100 µM for six hours) was used to mimic neuronal injury, according to the results of the half-maximal inhibitory concentration (IC 50 ) values (additional files 1). The PC-12 cells were then transiently transfected with Lipofectamine™ 6000 (Invitrogen, USA), as directed by the manufacturer. The miR-298-5p mimics and inhibitors, along with their corresponding NC mimics and NC inhibitors, were purchased from Jikai Co. (Shanghai, China). Cell Viability Assa y Cell viability was detected using a Cell Counting Kit-8 assay (CCK-8; Meilun, China). Cells were seeded at a density of 1.5×10 4 cells/well on the 96-well plate, and then 10 µL of CCK-8 reagent in 90 µl of the medium was added to each well. After 30 min, cell viability was evaluated under a microplate reader (Synergy H1, BioTek, USA) at a wavelength of 450 nm. Terminal Deoxynucleotidyl Transferase-Mediated dUTP Nick-End Labeling (TUNEL) Staining A TUNEL kit (Meilun, China) was used to determine the apoptosis of the neurons. The cells were first immobilized using 4% paraformaldehyde. The previously generated tissue sections and cells were then dipped into a TUNEL reaction mixture (50 μL) at 37°C for one hour; after this, the nuclei were stained for 3 min with 4',6-diamidino-2-phenylindole (DAPI) solution. The fluorescence density was observed under a fluorescence microscope (EVOS™ FL Auto 2, Thermo Fisher). Immunohistochemical The cell slides and tissue sections were permeabilized with 0.2% Triton X-100 (Solarbio, China) and blocked with 5% goat serum (Gibco) for 30 min at room temperature. Afterward, these samples were incubated at 4°C overnight with primary antibodies against Bcl2-associated X protein (Bax; 1:100, mouse), p62 (1:100, rabbit), and anti-light chain 3 (LC3; 1:100, rabbit). Tissue sections were also stained with neurofilament protein-200 (NF-200; 1:200, rabbit) and cluster of differentiation 31 (CD31;1:200, mouse). These primary antibodies were all obtained from Proteintech (Wuhan, China) . After washing with PBS, the samples were subsequently stained for two hours with the appropriate secondary antibody (1:400, goat anti-rabbit conjugated to Alexa Fluor 488; 1:200 rat anti-rabbit conjugated to Alexa Fluor 549; UElandy Suzhou, China) at room temperature. Finally, the samples were counterstained using DAPI (1 μg/mL) and covered with coverslips. Images were captured via fluorescence microscopy (BX51, Olympus, Tokyo, Japan). Western blot analysis (WB) The total protein in each of the samples was extracted using RIPA buffer (89900, Thermo Fisher, USA). Proteins per sample were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). After that, the separated samples were transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Bedford, MA). The membranes were subsequently blocked by 5% skimmed milk in Tris-buffered saline and 1% Tween 20 (TBST, Thermo Fisher, USA) at room temperature for one hour and incubated at 4°C overnight with the primary antibodies, which included rabbit β-Actin, rabbit LC3, rabbit beclin1, rabbit p62, mouse Bax, and rabbit Bcl2 (all diluted 1:2000, Proteintech, China); with rabbit β-Actin serving as an internal control. After washing with TBST, the membranes were incubated in the secondary antibody (goat anti-rabbit IgG, 1:15000, Proteintech, China) for another hour at room temperature. The LiCor Odyssey Scanner was used for blot scanning, and the Odyssey 3.0 software package (LiCor, USA) was used for the analysis. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA in the samples was extracted with the NucleoZol RNA reagent (Macherey–Nagel, Düren, Germany) and then reversely transcribed into cDNAs through a PrimeScript RT reagent kit with a gDNA eraser (code no. RR047A, Takara, Japan) or PrimeScript RT Master Mix (code no. RR036Q/A/B, Takara, Japan). TB GreenprexExTaqII (code number. RR820Q/A/B, Takara, Japan) and the Applied Biosystems 7500 real-time PCR instrument (Applied Biosystems, USA) were used to evaluate the PCR reactions. U6/β-actin was employed as the internal control for miRNA and mRNA, respectively. The relative gene expression levels were calculated by the 2 -ΔΔCt methods. The primer sequences are listed in Table1. Table 1 . Primer sequence for quantitative real-time polymerase chain reaction Forward (5’-3’) Reverse (3’-5’) rno-miR-298-5p GGAGGGCTGTTCTTCCCAA mRQ 3’primer (Takara, Japan) Bcl-2 GACTGAGTACCTGAACCGGCATC CTGAGCAGCGTCTTCAGAGACA Bax TGGCGATGAACTGGACAACAA GGGAGTCTGTATCCACATCAGCA LC3 AGCTCTGAAGGCAACAGCAACA GCTCCATGCAGGTAGCAGGAA p62 TGAAGGCTATTACAGCCAGAGTCAA CCTTCAGTGATGGCCTGGTC U6 GGAACGATACAGAGAAGATTAGC TGGAACGCTTCACGAATTTGCG β-actin TGTCACCAACTGGGACGATA GGGGTGTTGAAGGTCTCAAA Statistical Analysis The statistical tests of all the data were completed by SPSS software (version 25.0, USA) and GraphPad Prism software (version 8.0, USA), Data are presented as mean ± standard deviation from at least three independent experiments in this study. The measurement data were first analysed for normal distribution. One-way ANOVA was performed, followed by Tukey's post-hoc test for Comparisons among multiple groups. Comparisons between the two groups were conducted using Student’s t-tests. For comparisons of motor scores, repeated-measures analysis of variance (ANOVA) was performed. Statistical significance was denoted as follows: * p < 0.05, ** p < 0.01, *** p 1 and p < 0.05 between SCI group and SCI + tDCS group (Fig. 3a). Among these miRNAs, miR-298-5p was the most significantly suppressed in the tDCS group compared to the SCI group. To validate the outcome of the sequencing, qRT-PCR was applied. The relative expression of miR-298-5p was significantly upregulated at one, five, seven, and 14 days post-operation in the SCI group compared to the sham group (p <0.05, Fig. 3b). However, the expression was downregulated after tDCS in the SCI + tDCS group compared with the SCI group ( p <0.001; Fig. 3c) In conclusion, the expression of miR-298-5p was upregulated after SCI and decreased after tDCS treatment in vivo. LC3 is a direct target of miR-298-5p In the present study, we predicted the target gene of miR-298-5p via bioinformatics. Two potential binding sites were identified between LC3 and miR-298-5p by TargetScan (Fig. 4a ). Based on the binding sequences, LC3-WT and LC3-MUT were constructed. The luciferase activity markedly decreased in cells co-transfected with miR-298-5p-mimics and LC3-WT (p 0.05, Fig. 4b ). Both of these results strongly support the idea that miR-298-5p interacts with LC3 directly. Meanwhile, the WB results showed that LC3 expression was negatively regulated by miR-298-5p, which is consistent with the qRT-PCR results (p <0.05, Fig. 4c and Fig. 4 d and Fig. 4 e). Mir-298-5p affects the SCI-induced autophagy and apoptosis in vitro Transfect efficiency was assessed by qRT-PCR. As displayed in Fig. 5a, miR-298-5p expression was significantly increased after injury in the H 2 O 2 group compared with the control group ( p < 0.05). At that point, miR-298-5p mimics/NC mimics and miR-298-5p inhibitors/NC inhibitors were transfected into the H 2 O 2 -induced PC-12 cells. The findings indicated that the viability of the PC-12 cells was reduced after injury ( p < 0.001). Following the transfection of miR-298-5p mimics, cell viability had further declined ( p < 0.001). However, cell viability was significantly enhanced following transfection with miR-298-5p inhibitors ( ( p < 0.001, Fig. 5b. The TUNEL assay revealed that cell apoptosis was enhanced in the H 2 O 2 group compared with the control group. The ratio of apoptotic cells was further increased after transfection with the miR-298-5p mimics ( p < 0.001), while it was significantly inhibited by miR-298-5p inhibitors ( p < 0.001, Fig. 5 c and Fig. 5 d). The results of the immunofluorescence staining showed that H 2 O 2 can activate autophagy and induce apoptosis, which can be manifested as the increased fluorescence intensity of Bax, p62, and LC3. The positive signals of Bax and p62 were markedly enhanced, while LC3 was decreased in the H 2 O 2 + miR-mimics group compared with theH 2 O 2 group; the opposite results were observed in the H 2 O 2 + miR-inhibitors group compared to the H 2 O 2 group (Fig. 6a and Fig. 6b). Subsequently, the WB assay showed that the expression of the Bcl-2 protein decreased after H 2 O 2 injury. While the expression was further attenuated after miR-298-5p mimic-transfection ( p < 0.05), it increased by miR-298-5p inhibitor-transfection( p < 0.01, Fig. 4c and Fig. 6c). tDCS attenuates tissue damage, ameliorates neural functional status and motor function of SCI rats via downregulating miR-298-5p To further explore the function of miR-298-5p in the neuroprotection of tDCS for SCI, miR-298-5p-agomir or miR-298-5p-NC was administered. The expression level of miR-298-5p in the injured spinal segment was significantly decreased after tDCS in the SCI + tDCS group compared to the SCI group (p < 0.001). However, miR-298-5p-agomir actually reversed the change in the SCI + tDCS + miR-agomir group (p < 0.001; Fig. 3c). The functional recovery of the rats after the different treatments was comprehensively evaluated based on the BBB and LSS scales. The preoperative BBB scores were similar among the groups(p>0.05). At one day post-operation, the scores of the sham group were higher than those of the other groups (P<0.01). Starting at five days and ranging up to seven days post-operation, the BBB scores in the SCI + tDCS group were significantly higher than those in the SCI group. However, the effects of tDCS treatment were reversed by miR-298-5p overexpression (all p < 0.01, Fig. 7a and Table 2). The LSS could thus intuitively reflect the differences in motor function among the various groups, and the scores displayed a similar trend as the BBB (Fig. 7b and Fig. 7c,and Table 3 ). The results also indicated that the structure of the gray-white matter was intact and clear in the sham group. The images show a lesion cavity in the center of the injury, with clear signs of tissue swelling in the SCI group. After the tDCS procedure, a clearer structure and less tissue loss could be observed in the SCI + tDCS group. These results emphasize the role of tDCS in the repair of SCI in rats. However, miR-298-5p overexpression counteracted the tDCS-induced effects, leading to significant necrotic cavities and spinal cord edema in the SCI + tDCS + miR-agomir group and a significant reduction in the number of neuronal cells compared with the +miR-NC group (Fig.7d). In the sham group, the image of Nissl staining showed that the neuronal structures were complete and clear, the nucleus was obvious, and a large number of Nissl bodies were evenly distributed in the cytoplasm. In the SCI group, neurons were swollen and morphologically unclear, and Nissl bodies were reduced. The cell morphology improved, and edema was reduced in response to treatment with tDCS, while the number of Nissl bodies significantly increased in the SCI + tDCS group. However, the image displayed shrunken neuronal cell bodies and Nissl granule dissolution after the overexpression of miR-298-5p in the SCI + tDCS + miR-agomir group compared with the SCI + tDCS + miR-NC group (Fig. 7e). Overall, these results reveal that tDCS promotes autophagy and suppresses SCI-induced apoptosis by downregulating miR-298-5p. Table 2 : BBB scores at various times pre- and postsurgery BBB score Group Before surgery After surgery 0 Day Third day Fifth day Fifth day sham 21.00±0.00 21.00±0.00 21.00±0.00 21.00±0.00 21.00±0.00 SCI 21.00±0.00 0.00±0.00†** 1.06±0.40 1.72±0.45†** 2.39±0.49†** SCI+tDCS 21.00±0.00 0.00±0.00†** 2.78±0.63 3.39±0.49‡** 5.17±0.50‡** SCI+miR298-5p NC+tDCS 21.00±0.00 0.00±0.00†** 2.67±0.47 3.22±0.42§** 5.11±0.57§** SCI+ago-miR298-5p+tDCS 21.00±0.00 0.00±0.00†** 1.50±0.50 1.56±0.50 2.11±0.46 Values are presented as mean± standard deviation of 20 rats per group per time point, where lower BBB scores indicate poorer locomotor function. BBB, Basso-Beattie-Bresnahan locomotor scale; SCI, spinal cord injury; tDCS:Transcranial direct current stimulation; NC, negative control. A one-way analysis of variance followed by Tukey’s post-hoc test was performed. †, as Table 3 : LSS scores at various times pre- and postsurgery LSS score Group Before surgery After surgery 0 Day Third day Fifth day Fifth day sham 17.00±0.00 17.00±0.00 17.00±0.00 17.00±0.00 17.00±0.00 SCI 17.00±0.00 0.45±0.51†** 1.95±0.69 2.65±0.49†** 3.15±0.67†** SCI+tDCS 17.00±0.00 0.75±0.44†** 2.45±0.60 4.45±0.51‡* 6.70±0.73‡* SCI+miR298-5p NC+tDCS 17.00±0.00 0.65±0.59†** 2.45±0.51 4.20±0.70§* 6.35±0.93§* SCI+ago-miR298-5p+tDCS 17.00±0.00 0.50±0.51†** 1.9±0.40 2.40±0.50 3.00±0.65 Values are presented as mean± standard deviation of 20 rats per group per time point, LSS:Louisville Swim Scale. SCI, spinal cord injury; tDCS:Transcranial direct current stimulation; NC, negative control. A one-way analysis of variance followed by Tukey’s post-hoc test was performed. †, as compared with sham group; ‡, as compared with SCI group;§, as compared with SCI+tDCS+miR-298-5p agomir group.* P < 0.05, ** P < 0.01, *** P < 0.001. tDCS promotes autophagy and suppresses SCI-induced apoptosis via downregulating miR-298-5p TEM was used to examine the ultrastructural characteristics (×3,000 magnification) of the injured segment. In the sham group, abnormal structures were not identified in either the nucleus or the organelles. Moreover, no autolysosomes or autophagosomes were observed (Fig. 8a). In contrast, intracellular edema, an irregular nucleus, and an increased number of lysosomes (yellow arrow) and autolysosomes (green arrow) were found in the cells in the SCI group (Fig. 8 b). The SCI + tDCS group showed an improved state and a creased number of autolysosomes (green arrow) and autophagosomes (red arrow) compared with the SCI group (Fig. 8c). In addition, more autophagosomes (red arrows) and autolysosomes (green arrows) were observed in the SCI + tDCS + miR-NC group compared to the SCI group (Fig. 8 d). Finally, in the SCI + tDCS + miR-agomir group, the cells were swollen, and some lysosomes (yellow arrows) could be detected (Fig. 8e). These results clarify that tDCS can heighten the autophagy flux after SCI, while miR-298-5p overexpression can neutralize these effects. In comparison with the sham group, the number of TUNEL-positive cells markedly increased in the SCI group. In the SCI + tDCS group, the proportion of TUNEL-positive cells was obviously decreased in response to the tDCS procedure (p < 0.001). However, miR-298-5p-agomir was able to reverse the change in tDCS, such that the proportion of TUNEL-positive cells in the SCI + tDCS + miR-agomir group was higher than those in the SCI + tDCS + miR-NC group ( p < 0.001,Fig. 9a and Fig. 9b). The expression of the autophagy-related proteins LC3, p62, and Beclin-1, as well as the apoptotic-related proteins Bax and Bcl-2, in the spinal tissues was detected via WB (Fig. 10a and Fig. 10b) and immunohistochemical staining (Fig. 10c and Fig. 10d). The contents of LC3, p62, and Bax increased, while those of Bcl-2 decreased following SCI. However, tDCS decreased the level of p62 and Bax, as well as increased the expression of Bcl-2 and LC3, compared to the SCI group (all p <0.05). It was also found that miR-298-5p-agomir can reverse the tDCS-induced changes. Additionally, qRT-PCR of LC3, Beclin-1, p62, Bax, and Bcl-2 mRNA further confirmed the above findings (Fig. 10e). These observations suggest that tDCS can promote autophagy and inhibit apoptosis after SCI by downregulating miR-298-5p. tDCS facilitates neurogenesis post-SCI via downregulating miR-298-5p Double immunofluorescent staining for NF-200 (axon marker) and CD31 (vascular marker) was used to investigate nerve fiber regeneration in each group (Fig. 11). The results confirmed that the fluorescence intensity of NF-200 and CD31 in the SCI group significantly decreased compared with the corresponding values in the sham group. In contrast, the NF-200- and CD31-positive signals were significantly inducted after tDCS therapy. Subsequently, these tDCS-induced effects were reversed by miR-298-5p overexpression. Observation of microstructure and autophagosome changes of each group by transmission electron microscopy.a In the sham group, the nucleus was intact with obvious nucleoli. The myelin sheath was arranged around the axon in concentric circles. (B) In the SCI group, the irregular myelin sheath, pyknotic nuclei, and swelling mitochondrial with several autolysosomes are shown. (C&D) In the SCI+tDCS group and SCI+tDCS+miR-NC group, the morphology of the nuclei was nearly normal, the mitochondria exhibited swelling to a lesser extent, and the number of autophagosomes obviously increased. (E) In the SCI+tDCS+miR-agomir group, neurons showed swelling mitochondrial with vacuolization, karyopyknotic, and the number of autophagosomes has obviously decreased. The microstructure of each group was observed with scale bar = 5 μM, and the autophagosomes were observed with scale bar = 2 μM. The blue asterisk identifies the nuclei; the green points to autophagosomes. Discussion SCI is a serious neurological disease that can cause extensive damage to the structure of the spinal cord, resulting in motor dysfunction[ 2 , 45 ]. Massive neuronal death and atrophy after SCI are notable pathophysiologies and mechanisms of motor function defects[ 46 ]. Increased apoptosis and decreased autophagy can cause secondary injury and negatively impact neuronal survival following SCI[ 47 ]. Therefore, the improvement of the neuronal microenvironment in the injured section by regulation of both autophagy and apoptosis is crucial for encouraging the regeneration of nerve fibers[ 46 ]. Our data demonstrated that tDCS therapy can promote neuronal survival, neural regeneration, and functional recovery via the molecular mechanism of activating autophagy flux and attenuating cell apoptosis after SCI. Previously, some studies had suggested that SCI may perturb miRNA homeostasis[ 11 ]. Depending on their downstream target genes, the dysregulation of these miRNAs might result in either alleviated or aggravated post-SCI conditions[ 23 , 48 ]. In the present study, we detected high expression levels of miR-298-5p after SCI. The function of miR-298-5p in apoptosis has been extensively investigated elsewhere. For example, Wallach et al. demonstrated that miR-298-5p can be released from apoptotic cortical neurons, thereby triggering further neuronal apoptosis in the central nervous system[ 49 ]. In another study, Wei et al. found that miR-298-5p targets Srpk1 to change cell viability and apoptosis as mediated by sevoflurane[ 50 ]. However, little is known about the regulatory role of miR-298-5p in SCI repair. Here, we validated that miR-298-5p acts as a harmful factor after SCI, wherein neural and autophagy flux was enhanced and apoptosis was inhibited after downregulating miR-298-5p through the tDCS procedure, which indicates that tDCS has a regulatory effect by inhibiting the expression of miR-298-5p. An in vitro model of H 2 O 2 -induced neurotoxicity in PC12 cells was used to further confirm the involvement of miR-298-5p in autophagy and apoptosis. The crosstalk between apoptosis and autophagy has been observed elsewhere[ 39 , 51 ]. Several studies have indicated that the appropriate activation of autophagy can protect neurons in the spinal cord from undergoing apoptosis, while the dysfunction of autophagy could further lead to neuronal cell injury[ 16 , 47 , 52 ]. In this study, we confirmed that miR-298-5p can directly target LC3 via the dual-luciferase reporter system. LC3 is correlated with the control of autophagosome elongation and is a reliable indicator for monitoring autophagy induction in mammals[ 39 , 53 ]. Moreover, p62, an autophagy cargo protein, can interact directly with LC3 to bring damaged mitochondria and other autophagosomes into the autolysosomes for degradation through specific autophagy-lysosome pathways. Thus, the accumulation of p62 indicates a blockage in autophagy[ 54 , 55 ]. Our data indicated that tDCS conditions markedly enhanced LC3 levels and reduced p62 and Beclin-1 expression in SCI rats, which was accompanied by the accumulation of autolysosome and autophagosome observed by TEM, thereby indicating that functional autophagic flux in the SCI + tDCS group was significantly heightened by tDCS. Also, the inhibitory effect of tDCS on neuronal apoptosis, which was accompanied by the increase of autophagy flux, was also observed in the present study as a gradual decrease in the apoptotic protein Bax and Bcl-2 levels and the proportion of TUNEL-positive cells. These findings suggest that tDCS has the therapeutic effect of strengthening autophagic flux and inhibiting SCI-induced apoptosis. SCI leads to the interruption of neural connectivity, resulting in serious neurological dysfunction. Functional restoration relies on the formation of new fibrous connections and neural circuits[ 56 ]. The remodeling of functional neural circuits between the spinal cord and brain may need to be driven by rehabilitation[ 57 ]. One study has suggested that tDCS, a non-invasive neuromodulation technique targeting the promotion of neuronal plasticity, seems to be an effective approach[ 9 ]. Previous studies have found that suitable conditions for neuronal survival and plasticity can be induced by enhancing autophagy flux and inhibiting neuronal apoptosis after SCI[ 10 , 58 ]. The intriguing finding related to Nissl staining in our study demonstrated that neuronal function and survival were significantly increased after tDCS treatment. We also observed that the fluorescence intensity of NF-200 in the SCI + tDCS group was significantly higher than that in the SCI group. NF-200 is an axon-specific intermediate filament protein that is used as a “growth” or “plasticity” marker in the regeneration of nerve fibers[ 18 , 46 , 59 ]. The higher expression of NF-200 in the SCI + tDCS group hinted that tDCS treatment could promote the regeneration of nerve fibers in spinal tissue after SCI. The results of TEM and H&E staining further demonstrated that the local microenvironment in the injury segment and the ultrastructure of neurons were markedly modified after tDCS therapy. These effects coincided with the trend of restored motor capacity in the SCI rats evaluated by BBB and LSS scores, which therefore explained the significant functional recovery after tDCS treatment. After SCI, neural repair and plasticity require the formation of blood vessels to supply sufficient oxygen and nutrients to the injured area[ 60 ]. The blood vessel–specific marker CD31 reflects vascular structure and function.[ 43 ] In this study, immunofluorescence staining showed that the level of CD31 protein decreased in the spinal tissues after SCI and increased after tDCS. These findings illustrate that tDCS promotes angiogenesis. Moreover, double staining with NF-200 and CD31 in the lesions of the rats suggested that nerve fiber regeneration was associated with the formation of vessels. To better illustrate the potential role of miR-298-5p in the treatment of tDCS after SCI, we next attempted to treat rats with tDCS in combination with intrathecal miR-298-5p agomir. However, the protective effects of tDCS could be counteracted by the overexpression of miR-298-5p. Nevertheless, these observations show that tDCS exerted its effects against SCI by inhibiting miR-298-5p expression. The present study has several limitations. First, we did not provide evidence of the best time points or treatment parameters for the repair of SCI by tDCS. Second, we did not detect changes in neurotrophic factor content or neurite extension in the in-vivo experiments. Third, the present study was carried out only with adult female rats. Thus, it is not clear whether the use of rats of different ages and sexes may affect the experimental data. Furthermore, we chose PC-12 cells to simulate an SCI model in vitro, which would be more convincing if primary spinal cord neuronal cells were selected to further corroborate our conclusions. Conclusions Our results provide new insights for explaining the therapeutic mechanism of tDCS for SCI-related motor dysfunction. Through the regulation of autophagy and apoptosis by the downregulation of miR-298-5p, tDCS might promote neural repair and enhance motor functional recovery after SCI. Therefore, the results of the present study provide experimental basic evidence for the application of tDCS in clinical treatments for SCI. Declarations Acknowledgements TThe authors would like to express their appreciation to Shu-Hui Guo and Chen-Xi Liang for their support on the experiment. Funding This study was supported by the National Natural Science Foundation of China (No. 81960417), Guangxi Key Research and Development Program (No. GuiKeAB20159027), and Guangxi Natural Science Foundation (No. 2018GXNSFAA050033).n of China (Grant number. 82172531). Author Contribution JWX, YJS and YL designed the study; JWX provided funding support; QHP, XLL and YT conducted the in vitro experiment; YY, FCL,KWW and YCG performed the in vivo experiment; QHP and WFZ analysed data; JMC drafted and wrote the manuscript. All authors approved the final version of the paper. Data Availability The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Ethics Approval and Consent to Participate All animal care and experimental procedures in this study were approved by the Guangxi Medical University Animal Research Ethics Committee ( No. 202105013) Consent for Publication All authors agree to the publication of this manuscript Competing Interests The authors declare no competing interests. References Yang Y, Xu HY, Deng QW, Wu GH, Zeng X, Jin H, Wang LJ, Lai BQ, Li G, Ma YH, Jiang B, Ruan JW, Wang YQ, Ding Y, Zeng YS.(2021) Electroacupuncture facilitates the integration of a grafted TrkC-modified mesenchymal stem cell-derived neural network into transected spinal cord in rats via increasing neurotrophin-3. CNS neuroscience & therapeutics 27:776-91.https://doi.org /10.1111/cns.13638 Xu Y, An BY, Xi XB, Li ZW, Li FY.(2016) MicroRNA-9 controls apoptosis of neurons by targeting monocyte chemotactic protein-induced protein 1 expression in rat acute spinal cord injury model. Brain research bulletin 121:233-40.https://doi.org /10.1016/j.brainresbull.2016.01.011 Yang Q, Ramamurthy A, Lall S, Santos J, Ratnadurai-Giridharan S, Lopane M, Zareen N, Alexander H, Ryan D, Martin JH, Carmel JB.(2019) Independent replication of motor cortex and cervical spinal cord electrical stimulation to promote forelimb motor function after spinal cord injury in rats. Experimental neurology 320:112962.https://doi.org /10.1016/j.expneurol.2019.112962 Wu MF, Zhang SQ, Liu JB, Li Y, Zhu QS, Gu R.(2015) Neuroprotective effects of electroacupuncture on early- and late-stage spinal cord injury. Neural regeneration research 10:1628-34.https://doi.org /10.4103/1673-5374.167762 Zheng Y, Mao YR, Yuan TF, Xu DS, Cheng LM.(2020) Multimodal treatment for spinal cord injury: a sword of neuroregeneration upon neuromodulation. Neural regeneration research 15:1437-50.https://doi.org /10.4103/1673-5374.274332 Sharif H, Alexander H, Azam A, Martin JH.(2021) Dual motor cortex and spinal cord neuromodulation improves rehabilitation efficacy and restores skilled locomotor function in a rat cervical contusion injury model. Experimental neurology 341:113715.https://doi.org /10.1016/j.expneurol.2021.113715 Hofer AS, Schwab ME.(2019) Enhancing rehabilitation and functional recovery after brain and spinal cord trauma with electrical neuromodulation. Current opinion in neurology 32:828-35.https://doi.org /10.1097/wco.0000000000000750 Hu Y, Sun YF, Yuan H, Liu J, Chen L, Liu DH, Xu Y, Zhou XF, Ding L, Zhang ZT, Xiong LL, Xue LL, Wang TH.(2024) Vof16-miR-185-5p-GAP43 network improves the outcomes following spinal cord injury via enhancing self-repair and promoting axonal growth. CNS neuroscience & therapeutics 30:e14535.https://doi.org /10.1111/cns.14535 Jo HJ, Perez MA.(2020) Corticospinal-motor neuronal plasticity promotes exercise-mediated recovery in humans with spinal cord injury. Brain : a journal of neurology 143:1368-82.https://doi.org /10.1093/brain/awaa052 Xiao WP, Ding LL, Min YJ, Yang HY, Yao HH, Sun J, Zhou X, Zeng XB, Yu W.(2019) Electroacupuncture Promoting Axonal Regeneration in Spinal Cord Injury Rats via Suppression of Nogo/NgR and Rho/ROCK Signaling Pathway. Neuropsychiatric disease and treatment 15:3429-42.https://doi.org /10.2147/ndt.S216874 Ma L, Ma L, Yang Y, Chen T, Wang L, Deng Q.(2022) Electroacupuncture-Regulated miR-34a-3p/PDCD6 Axis Promotes Post-Spinal Cord Injury Recovery in Both In Vitro and In Vivo Settings. Journal of immunology research 2022:9329494.https://doi.org /10.1155/2022/9329494 Zhang Q, Liu M, Nong H, Zhang Y, Bai Y, Liu P, Zong S, Zeng G.(2022) Total flavonoids of hawthorn leaves protect spinal motor neurons via promotion of autophagy after spinal cord injury. Frontiers in pharmacology 13:925568.https://doi.org /10.3389/fphar.2022.925568 Fei M, Li Z, Cao Y, Jiang C, Lin H, Chen Z.(2021) MicroRNA-182 improves spinal cord injury in mice by modulating apoptosis and the inflammatory response via IKKβ/NF-κB. Laboratory investigation; a journal of technical methods and pathology 101:1238-53.https://doi.org /10.1038/s41374-021-00606-5 Xiao S, Zhang Y, Liu Z, Li A, Tong W, Xiong X, Nie J, Zhong N, Zhu G, Liu J, Liu Z.(2023) Alpinetin inhibits neuroinflammation and neuronal apoptosis via targeting the JAK2/STAT3 signaling pathway in spinal cord injury. CNS neuroscience & therapeutics 29:1094-108.https://doi.org /10.1111/cns.14085 Guo S, Chen J, Yang Y, Li X, Tang Y, Gui Y, Chen J, Xu J.(2023) Electroacupuncture-Modulated MiR-106b-5p Expression Enhances Autophagy by Targeting Beclin-1 to Promote Motor Function Recovery After Spinal Cord Injury in Rats. Neurospine 20:1011-27.https://doi.org /10.14245/ns.2346446.223 Gu Y, Chen D, Zhou L, Zhao X, Lin J, Lin B, Lin T, Chen Z, Chen Z, Wang Z, Liu W.(2021) Lysine-specific demethylase 1 inhibition enhances autophagy and attenuates early-stage post-spinal cord injury apoptosis. Cell death discovery 7:69.https://doi.org /10.1038/s41420-021-00455-7 Hongna Y, Hongzhao T, Quan L, Delin F, Guijun L, Xiaolin L, Fulin G, Zhongren S.(2020) Jia-Ji Electro-Acupuncture Improves Locomotor Function With Spinal Cord Injury by Regulation of Autophagy Flux and Inhibition of Necroptosis. Frontiers in neuroscience 14:616864.https://doi.org /10.3389/fnins.2020.616864 Chen Z, Li Z, Jiang C, Jiang X, Zhang J.(2019) MiR-92b-3p promotes neurite growth and functional recovery via the PTEN/AKT pathway in acute spinal cord injury. Journal of cellular physiology 234:23043-52.https://doi.org /10.1002/jcp.28864 Saraswat Ohri S, Bankston AN, Mullins SA, Liu Y, Andres KR, Beare JE, Howard RM, Burke DA, Riegler AS, Smith AE, Hetman M, Whittemore SR.(2018) Blocking Autophagy in Oligodendrocytes Limits Functional Recovery after Spinal Cord Injury. The Journal of neuroscience : the official journal of the Society for Neuroscience 38:5900-12.https://doi.org /10.1523/jneurosci.0679-17.2018 Guan C, Luan L, Li J, Yang L.(2021) MiR-212-3p improves rat functional recovery and inhibits neurocyte apoptosis in spinal cord injury models via PTEN downregulation-mediated activation of AKT/mTOR pathway. Brain research 1768:147576.https://doi.org /10.1016/j.brainres.2021.147576 Shen LM, Song ZW, Hua Y, Chao X, Liu JB.(2017) miR-181d-5p promotes neurite outgrowth in PC12 Cells via PI3K/Akt pathway. CNS neuroscience & therapeutics 23:894-906.https://doi.org /10.1111/cns.12761 Ding SQ, Chen J, Wang SN, Duan FX, Chen YQ, Shi YJ, Hu JG, Lü HZ.(2019) Identification of serum exosomal microRNAs in acute spinal cord injured rats. Experimental biology and medicine (Maywood, NJ) 244:1149-61.https://doi.org /10.1177/1535370219872759 An Y, Li J, Yuan Q, Fan M.(2020) MicroRNA-466c-3p exerts protective effect on neuronal apoptosis and improves functional recovery post spinal cord injury via mitochondrial apoptotic pathway. AMB Express 10:113.https://doi.org /10.1186/s13568-020-01033-3 Zhang C, Wang MM, Zhang Y, Yang L, Zhu MS, Dong QR.(2019) Downregulation of miRNA-127-5p aggravates spinal cord injury through activating MAPK1. European review for medical and pharmacological sciences 23:10617-22.https://doi.org /10.26355/eurrev_201912_19757 Chen JM, Li XL, Pan QH, Yang Y, Xu SM, Xu JW.(2023) Effects of non-invasive brain stimulation on motor function after spinal cord injury: a systematic review and meta-analysis. Journal of neuroengineering and rehabilitation 20:3.https://doi.org /10.1186/s12984-023-01129-4 Evans NH, Field-Fote EC.(2022) A Pilot Study of Intensive Locomotor-Related Skill Training and Transcranial Direct Current Stimulation in Chronic Spinal Cord Injury. Journal of neurologic physical therapy : JNPT 46:281-92.https://doi.org /10.1097/npt.0000000000000403 Gunduz A, Rothwell J, Vidal J, Kumru H.(2017) Non-invasive brain stimulation to promote motor and functional recovery following spinal cord injury. Neural regeneration research 12:1933-8.https://doi.org /10.4103/1673-5374.221143 Zhang KY, Rui G, Zhang JP, Guo L, An GZ, Lin JJ, He W, Ding GR.(2020) Cathodal tDCS exerts neuroprotective effect in rat brain after acute ischemic stroke. BMC neuroscience 21:21.https://doi.org /10.1186/s12868-020-00570-8 Guo T, Fang J, Tong ZY, He S, Luo Y.(2020) Transcranial Direct Current Stimulation Ameliorates Cognitive Impairment via Modulating Oxidative Stress, Inflammation, and Autophagy in a Rat Model of Vascular Dementia. Frontiers in neuroscience 14:28.https://doi.org /10.3389/fnins.2020.00028 Zhou Y, Su P, Pan Z, Liu D, Niu Y, Zhu W, Yao P, Song Y, Sun Y.(2019) Combination Therapy With Hyperbaric Oxygen and Erythropoietin Inhibits Neuronal Apoptosis and Improves Recovery in Rats With Spinal Cord Injury. Physical therapy 99:1679-89.https://doi.org /10.1093/ptj/pzz125 Hart CG, Dyck SM, Kataria H, Alizadeh A, Nagakannan P, Thliveris JA, Eftekharpour E, Karimi-Abdolrezaee S.(2020) Acute upregulation of bone morphogenetic protein-4 regulates endogenous cell response and promotes cell death in spinal cord injury. Experimental neurology 325:113163.https://doi.org /10.1016/j.expneurol.2019.113163 Yao L, Guo Y, Wang L, Li G, Qian X, Zhang J, Liu H, Liu G.(2021) Knockdown of miR-130a-3p alleviates spinal cord injury induced neuropathic pain by activating IGF-1/IGF-1R pathway. Journal of neuroimmunology 351:577458.https://doi.org /10.1016/j.jneuroim.2020.577458 Basso DM, Beattie MS, Bresnahan JC.(1995) A sensitive and reliable locomotor rating scale for open field testing in rats. Journal of neurotrauma 12:1-21.https://doi.org /10.1089/neu.1995.12.1 Smith RR, Burke DA, Baldini AD, Shum-Siu A, Baltzley R, Bunger M, Magnuson DS.(2006) The Louisville Swim Scale: a novel assessment of hindlimb function following spinal cord injury in adult rats. Journal of neurotrauma 23:1654-70.https://doi.org /10.1089/neu.2006.23.1654 Park G, Suh JH, Han SJ.(2021) Transcranial direct current stimulation for balance and gait in repetitive mild traumatic brain injury in rats. BMC neuroscience 22:26.https://doi.org /10.1186/s12868-021-00633-4 Malinova V, Bleuel K, Stadelmann C, Iliev B, Tsogkas I, Psychogios MN, Rohde V, Mielke D.(2021) The impact of transcranial direct current stimulation on cerebral vasospasm in a rat model of subarachnoid hemorrhage. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism 41:2000-9.https://doi.org /10.1177/0271678x21990130 Hassanzahraee M, Nitsche MA, Zoghi M, Jaberzadeh S.(2020) Determination of anodal tDCS intensity threshold for reversal of corticospinal excitability: an investigation for induction of counter-regulatory mechanisms. Scientific reports 10:16108.https://doi.org /10.1038/s41598-020-72909-4 Lopes BC, Medeiros LF, Stein DJ, Cioato SG, de Souza VS, Medeiros HR, Sanches PRS, Fregni F, Caumo W, Torres ILS.(2021) tDCS and exercise improve anxiety-like behavior and locomotion in chronic pain rats via modulation of neurotrophins and inflammatory mediators. Behavioural brain research 404:113173.https://doi.org /10.1016/j.bbr.2021.113173 Li HT, Zhao XZ, Zhang XR, Li G, Jia ZQ, Sun P, Wang JQ, Fan ZK, Lv G.(2016) Exendin-4 Enhances Motor Function Recovery via Promotion of Autophagy and Inhibition of Neuronal Apoptosis After Spinal Cord Injury in Rats. Molecular neurobiology 53:4073-82.https://doi.org /10.1007/s12035-015-9327-7 Santos DS, Lopes BC, Medeiros LF, Assumpção JAF, de Souza A, Salvi AA, da Silva LS, Fregni F, Caumo W, Torres ILS.(2020) Transcranial Direct Current Stimulation (tDCS) Induces Analgesia in Rats with Neuropathic Pain and Alcohol Abstinence. Neurochemical research 45:2653-63.https://doi.org /10.1007/s11064-020-03116-w Longo L, de Souza VEG, Stein DJ, de Freitas JS, Uribe-Cruz C, Torres ILS, Álvares-da-Silva MR.(2021) Transcranial direct current stimulation (tDCS) has beneficial effects on liver lipid accumulation and hepatic inflammatory parameters in obese rats. Scientific reports 11:11037.https://doi.org /10.1038/s41598-021-90563-2 Zhang HH, Hu J, Zhou YL, Qin X, Song ZY, Yang PP, Hu S, Jiang X, Xu GY.(2015) Promoted Interaction of Nuclear Factor-κB With Demethylated Purinergic P2X3 Receptor Gene Contributes to Neuropathic Pain in Rats With Diabetes. Diabetes 64:4272-84.https://doi.org /10.2337/db15-0138 Chen F, Li X, Li Z, Qiang Z, Ma H.(2020) Altered expression of MiR-186-5p and its target genes after spinal cord ischemia-reperfusion injury in rats. Neuroscience letters 718:134669.https://doi.org /10.1016/j.neulet.2019.134669 Pan Z, Shan Q, Gu P, Wang XM, Tai LW, Sun M, Luo X, Sun L, Cheung CW.(2018) miRNA-23a/CXCR4 regulates neuropathic pain via directly targeting TXNIP/NLRP3 inflammasome axis. Journal of neuroinflammation 15:29.https://doi.org /10.1186/s12974-018-1073-0 Song W, Amer A, Ryan D, Martin JH.(2016) Combined motor cortex and spinal cord neuromodulation promotes corticospinal system functional and structural plasticity and motor function after injury. Experimental neurology 277:46-57.https://doi.org /10.1016/j.expneurol.2015.12.008 Zhang XM, Zeng LN, Yang WY, Ding L, Chen KZ, Fu WJ, Zeng SQ, Liang YR, Chen GH, Wu HF.(2022) Inhibition of LncRNA Vof-16 expression promotes nerve regeneration and functional recovery after spinal cord injury. Neural regeneration research 17:217-27.https://doi.org /10.4103/1673-5374.314322 Wang Y, Xiong M, Wang M, Chen H, Li W, Zhou X.(2021) Quercetin promotes locomotor function recovery and axonal regeneration through induction of autophagy after spinal cord injury. Clinical and experimental pharmacology & physiology 48:1642-52.https://doi.org /10.1111/1440-1681.13573 Liu J, Wu Y.(2017) Electro-acupuncture-modulated miR-214 prevents neuronal apoptosis by targeting Bax and inhibits sodium channel Nav1.3 expression in rats after spinal cord injury. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 89:1125-35.https://doi.org /10.1016/j.biopha.2017.02.077 Zou T, Zhang J, Liu Y, Zhang Y, Sugimoto K, Mei C.(2020) Antidepressant-Like Effect of Geniposide in Mice Exposed to a Chronic Mild Stress Involves the microRNA-298-5p-Mediated Nox1. Frontiers in molecular neuroscience 13:131.https://doi.org /10.3389/fnmol.2020.00131 Wei X, Xu S, Chen L.(2021) LncRNA Neat1/miR-298-5p/Srpk1 Contributes to Sevoflurane-Induced Neurotoxicity. Neurochemical research 46:3356-64.https://doi.org /10.1007/s11064-021-03436-5 Li X, Lou X, Xu S, Wang Q, Shen M, Miao J.(2018) Knockdown of miR-372 Inhibits Nerve Cell Apoptosis Induced by Spinal Cord Ischemia/Reperfusion Injury via Enhancing Autophagy by Up-regulating Beclin-1. Journal of molecular neuroscience : MN 66:437-44.https://doi.org /10.1007/s12031-018-1179-y Firat T, Kukner A, Ayturk N, Gezici AR, Serin E, Ozogul C, Tore F.(2021) The Potential Therapeutic Effects of Agmatine, Methylprednisolone, and Rapamycin on Experimental Spinal Cord Injury. Cell journal 23:701-7.https://doi.org /10.22074/cellj.2021.7198 Zhu Y, Zhao H, Zhang W, Ma X, Liu Y.(2021) Dexmedetomidine attenuates neuronal injury induced by cerebral ischemia‑reperfusion by regulating miR‑199a. Molecular medicine reports 24:/10.3892/mmr.2021.12213 Shao S, Xu CB, Chen CJ, Shi GN, Guo QL, Zhou Y, Wei YZ, Wu L, Shi JG, Zhang TT.(2021) Divanillyl sulfone suppresses NLRP3 inflammasome activation via inducing mitophagy to ameliorate chronic neuropathic pain in mice. Journal of neuroinflammation 18:142.https://doi.org /10.1186/s12974-021-02178-z Li K, Deng Y, Deng G, Chen P, Wang Y, Wu H, Ji Z, Yao Z, Zhang X, Yu B, Zhang K.(2020) High cholesterol induces apoptosis and autophagy through the ROS-activated AKT/FOXO1 pathway in tendon-derived stem cells. Stem cell research & therapy 11:131.https://doi.org /10.1186/s13287-020-01643-5 Sun X, Huang LY, Pan HX, Li LJ, Wang L, Pei GQ, Wang Y, Zhang Q, Cheng HX, He CQ, Wei Q.(2023) Bone marrow mesenchymal stem cells and exercise restore motor function following spinal cord injury by activating PI3K/AKT/mTOR pathway. Neural regeneration research 18:1067-75.https://doi.org /10.4103/1673-5374.355762 Loy K, Bareyre FM.(2019) Rehabilitation following spinal cord injury: how animal models can help our understanding of exercise-induced neuroplasticity. Neural regeneration research 14:405-12.https://doi.org /10.4103/1673-5374.245951 Kazim SF, Bowers CA, Cole CD, Varela S, Karimov Z, Martinez E, Ogulnick JV, Schmidt MH.(2021) Corticospinal Motor Circuit Plasticity After Spinal Cord Injury: Harnessing Neuroplasticity to Improve Functional Outcomes. Molecular neurobiology 58:5494-516.https://doi.org /10.1007/s12035-021-02484-w Zhou X, Du J, Qing L, Mee T, Xu X, Wang Z, Xu C, Jia X.(2021) Identification of sensory and motor nerve fascicles by immunofluorescence staining after peripheral nerve injury. Journal of translational medicine 19:207.https://doi.org /10.1186/s12967-021-02871-w Li X, Luo D, Hou Y, Hou Y, Chen S, Zhan J, Luan J, Wang L, Lin D.(2020) Sodium Tanshinone IIA Silate Exerts Microcirculation Protective Effects against Spinal Cord Injury In Vitro and In Vivo. Oxidative medicine and cellular longevity 2020:3949575.https://doi.org /10.1155/2020/3949575 Additional Declarations No competing interests reported. Supplementary Files additionalfile1.pdf abstractgraph.tif Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4355457","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":303358213,"identity":"2569d508-a648-4eed-ad52-934c638e2a40","order_by":0,"name":"Qinhe Pan","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qinhe","middleName":"","lastName":"Pan","suffix":""},{"id":303358214,"identity":"cdd31c70-442c-4cb4-8fbc-fda2a4f979ce","order_by":1,"name":"Jianmin Chen","email":"","orcid":"","institution":"The First Affiliated Hospital of Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jianmin","middleName":"","lastName":"Chen","suffix":""},{"id":303358215,"identity":"2aaf7dd4-3763-4a42-a564-abf5c38bff2d","order_by":2,"name":"Weifeng Zuo","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Weifeng","middleName":"","lastName":"Zuo","suffix":""},{"id":303358216,"identity":"7fc0fbb9-1a57-4f89-bd0c-061cbca8c7ce","order_by":3,"name":"Xiaolu Li","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiaolu","middleName":"","lastName":"Li","suffix":""},{"id":303358217,"identity":"be42a385-0656-4882-8cb2-570275d88ad1","order_by":4,"name":"chun LiuFu","email":"","orcid":"","institution":"Guangxi University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"chun","middleName":"","lastName":"LiuFu","suffix":""},{"id":303358218,"identity":"c133a32c-67f9-4b85-82ce-2da191d4e1cd","order_by":5,"name":"Yun Tang","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yun","middleName":"","lastName":"Tang","suffix":""},{"id":303358219,"identity":"56e5c06f-9a1b-4ad8-b632-52f7bea41908","order_by":6,"name":"Yuchang Gui","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuchang","middleName":"","lastName":"Gui","suffix":""},{"id":303358220,"identity":"c320d903-5c4a-405e-9ab4-a4959060a275","order_by":7,"name":"Kewen Wang","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Kewen","middleName":"","lastName":"Wang","suffix":""},{"id":303358221,"identity":"f12f55b5-31ea-4a07-9f52-2d19460f4f7e","order_by":8,"name":"Senming Xu","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Senming","middleName":"","lastName":"Xu","suffix":""},{"id":303358222,"identity":"996b049a-0918-4f1d-93a9-548eef59d3fa","order_by":9,"name":"JianWen Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA70lEQVRIiWNgGAWjYHCChANgir0Byj9AtBYemFIitECBRAKRWgxuJDw88HPHYTlzyefXpG62Mcjx3Uhg/FyAR4vkjISEg71nDhtbzs4pNs5tYzCWvJHALD0DjxZ+iYSEA7xttxM33M5JfAzUkrjhRgIbMw8eLWxALQf/tt2u33DzTMJhoJZ6glpAthwG2pJgcIP9IMgWIIOAFsmeBwmHZdv+G244k8NsnHNOwnDmmYfN0vi0GBzPSf74ti1N3uD48WfSOWU28nzHkw9+xqcFGIUJMIYBkJAAYsYGvBqACeUAjPGAgMpRMApGwSgYqQAA9vVTx64jdpcAAAAASUVORK5CYII=","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":true,"prefix":"","firstName":"JianWen","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2024-05-01 17:42:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4355457/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4355457/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":56763296,"identity":"0208fbcb-930e-49dc-9f99-251c95010866","added_by":"auto","created_at":"2024-05-20 07:38:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1453606,"visible":true,"origin":"","legend":"\u003cp\u003ePicture of an animal model of SCI.\u003cstrong\u003e a\u003c/strong\u003e After thoracic laminectomy, rats that were exposed to T10 spinal cord segments were fixed on a stereotaxic device and assigned the hit position. \u003cstrong\u003eb\u003c/strong\u003ethe dorsal surface of the spine was submitted to weight-drop injury using a 10-g impact rod with a diameter of 3 m m that was released from a 5-cm vertical height through a glass tube.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/40fcf14c287defa1a159ddae.png"},{"id":56763295,"identity":"9e289e6e-632d-4c72-8f25-27ad22ee1325","added_by":"auto","created_at":"2024-05-20 07:38:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":333128,"visible":true,"origin":"","legend":"\u003cp\u003etDCS-protocol sketch map : The anode was fixed in the M1 area (2mm in front of the ear line) and the cathode electrode was placed in the supraorbital area (the midpoint between the lateral angles of both eyes) and then connected to a battery-driven stimulator.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/59c5eeff50e6de84817c875f.png"},{"id":56763592,"identity":"3802910c-1be8-4d56-82e4-d29c92dc86f7","added_by":"auto","created_at":"2024-05-20 07:46:34","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":201612,"visible":true,"origin":"","legend":"\u003cp\u003etDCS altered miR-298-5p expression flowing injured area of SCI rats. \u003cstrong\u003ea \u003c/strong\u003eThe volcano plot of DEMs.\u003cstrong\u003e b\u003c/strong\u003e The miR-298-5p level in the spinal cord tissue of the SCI group at 1-, 5-, 7-, and 14-day postsurgery was higher than that in the sham group (n = 20/group). \u003cstrong\u003ec \u003c/strong\u003eThe expression of miR-298-5p was confirmed by qRT-PCR in spinal tissues from different groups. In A, red and blue dots indicate differentially expressed miRNAs that are up-regulated and down-regulated between the two groups, respectively. Grey dots indicate non-differentially expressed genes. DEM: differentially expressed microRNA; SCI: spinal cord injury. Data are expressed as the mean ± standard deviation, and differences between each group were compared by Student t-test. All experiments were repeated at least thrice. qRT-PCR, quantitative real-time polymerase chain reaction;* P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/8742cb693d001ab0f3f43348.png"},{"id":56763594,"identity":"ea882e4c-f49a-453f-9ecf-a4494faa18a2","added_by":"auto","created_at":"2024-05-20 07:46:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":624259,"visible":true,"origin":"","legend":"\u003cp\u003eLC3 was the target gene of miR-298-5p.\u003cstrong\u003e a\u003c/strong\u003e Potential binding sites between LC3 and miR-298-5p. \u003cstrong\u003eb\u003c/strong\u003eLuciferase activity markedly decreased in cells co-transfected with miR-298-5p-mimics and LC3-WT, whereas those co-transfected with miR-298-5p-mimics and LC3-MU did not show significant change.\u003cstrong\u003e c \u0026amp; d\u003c/strong\u003eWestern blot showed that LC3 expression was negatively regulated by miR-298-5p. \u003cstrong\u003ee\u003c/strong\u003e The relative expression of LC3 mRNA was determined by qRT-PCR in PC-12 cells following transfection with miR-298-5p mimics/NC mimics and inhibitors. β-actin was selected as the internal reference; A one-way analysis of variance followed by Tukey’s post-hoc test was performed. All results are shown as the mean± standard deviation (n= 3/group), and all experiments were repeated at least thrice. qRT-PCR, quantitative real-time polymerase chain reaction; NC, negatively control; WT, wild type; MUT, mutant.* P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/a6a4505a6fb29ce045ca07a8.png"},{"id":56763298,"identity":"8b9a376f-cd8d-42a1-a0ee-ca26a3938311","added_by":"auto","created_at":"2024-05-20 07:38:34","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":909075,"visible":true,"origin":"","legend":"\u003cp\u003eMir-298-5p affects the SCI-induced apoptosis in vitro. a The viability of PC-12 cells transfected with miR-298-5p mimics / NC mimics and inhibitors was verified by the CCK-8 assay. (b\u0026amp;c) PC-12 cell apoptosis changes in each group were detected based on TUNEL staining, with blue indicating DAPI-stained cell nuclei and red indicating TUNEL-positive cells. Counting the proportion of TUNEL-positive cells in each group (scale bars = 100 μm and 200 μm). A one-way analysis of variance followed by Tukey’s post-hoc test were used for analysis. All results are shown as the mean± standard deviation (n=3/group), and all experiments were repeated at least thrice; TUNEL: terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling; DAPI: 4′,6-diamidino-2-phenylindole; * P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/035d33e2b676f6a60d602eba.png"},{"id":56763303,"identity":"d9c621f6-7bf6-4095-ba8e-48c6139795fe","added_by":"auto","created_at":"2024-05-20 07:38:34","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2287546,"visible":true,"origin":"","legend":"\u003cp\u003eMir-298-5p affects the SCI-induced autophagy and apoptosis in vitro. \u003cstrong\u003ea\u003c/strong\u003e Immunofluorescence assay for p62 protein in PC-12 cells. p62 is a related protein with red fluorescence, and DAPI is a nuclear stain with blue fluorescence. Merge represents a composite of two channels (scale bars = 100 μm and 50 μm). \u003cstrong\u003eb\u003c/strong\u003e Representative immunofluorescent double-labeling with LC3 (red) and Bax (green) in PC12 cells from different groups. Nuclei were stained by DAPI (blue). Merge represents a composite of all channels (scale bars = 200 μm and 100um). \u003cstrong\u003ec\u003c/strong\u003e quantitative analysis of Bcl-2 proteins. DAPI: 4′,6-diamidino-2-phenylindole. β-actin was selected as the internal reference. A one-way analysis of variance followed by Tukey’s post-hoc test were used for analysis. All results are shown as the mean± standard deviation (n=3/group), and all experiments were repeated at least thrice. DAPI: 4′,6-diamidino-2-phenylindole; * P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/2c27405ad21753ab8cb6a857.png"},{"id":56763595,"identity":"ad553b3d-c705-44ed-97a1-583b28048387","added_by":"auto","created_at":"2024-05-20 07:46:34","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":3428369,"visible":true,"origin":"","legend":"\u003cp\u003etDCS attenuates tissue damage, ameliorates neural functional status and motor function of SCI rats via downregulating miR-298-5p. \u003cstrong\u003ea\u003c/strong\u003e BBB scores of rats in each group at 0-, 3-, 5-, and 7- days post-SCI. A lower score indicates a more severe injury. \u003cstrong\u003eb\u003c/strong\u003e Images of the swimming position of the experimental rats in each group. \u003cstrong\u003ec\u003c/strong\u003e LSS scores of rats in each group at seven-days post-SCI. \u003cstrong\u003ed \u003c/strong\u003eRepresentative H\u0026amp;E–stained transverse sections. The overall structure (scale bar = 200 μM) and pathological changes (scale bar = 50 μM) of the spinal cord tissue of each group were assessed by H\u0026amp;E staining. \u003cstrong\u003ee \u003c/strong\u003eObservation of Nissl bodies in neurons of spinal cord tissues of each group by Nissl staining (scale bars = 100 μM and 50 μM). Blue staining represents a Nissl body, as shown by the arrows. The darker the color of the Nissl bodies or the tabby shape, the better the neuron state. BBB: Basso–Beattie–Bresnahan; LSS:Louisville Swim Scale.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/0f4bb1d615cb2530678aa5b8.png"},{"id":56763304,"identity":"787a3d44-5765-4933-b02c-7316bb8d8aec","added_by":"auto","created_at":"2024-05-20 07:38:34","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":4458498,"visible":true,"origin":"","legend":"\u003cp\u003etDCS promotes autophagy and suppresses SCI-induced apoptosis via downregulating miR-298-5p\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/c9bcada6f2e1e01dde020186.png"},{"id":56764171,"identity":"de70caa6-26bd-4fc9-9673-66e61b063445","added_by":"auto","created_at":"2024-05-20 07:54:34","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":528810,"visible":true,"origin":"","legend":"\u003cp\u003etDCS promotes autophagy and suppresses SCI-induced apoptosis via downregulating miR-298-5p. \u003cstrong\u003ea\u003c/strong\u003e Observation of cell apoptosis in the spinal cord sections of each group by TUNEL staining (scale bar = 100 μM). Under the fluorescence microscope, red represents apoptotic cells in the spinal cord tissue. DAPI (blue) was used to stain all cell nuclei. \u003cstrong\u003eb\u003c/strong\u003e The percentage of TUNEL-positive cells was counted in the spinal cord tissues of each group. A one-way analysis of variance followed by Tukey’s post-hoc test was performed. All results are shown as mean ± SD (n = 3/group). All experiments were repeated at least three times. * P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001. TUNEL: terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling; DAPI: 4′,6-diamidino-2-phenylindole.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/96ccb7a979138b5ff32ef176.png"},{"id":56764172,"identity":"ef732c96-7205-4c4e-94fe-9b3e1ecd799e","added_by":"auto","created_at":"2024-05-20 07:54:34","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":3506452,"visible":true,"origin":"","legend":"\u003cp\u003etDCS promotes autophagy and suppresses SCI-induced apoptosis via downregulating miR-298-5p. \u003cstrong\u003ea \u0026amp;b \u003c/strong\u003eWestern blot assay and quantitative analysis of integrated optical densities for autophagy-related (LC3, p62, Beclin-1) and apoptosis-related (Bax, Bcl-2) proteins.\u003cstrong\u003e c\u003c/strong\u003e Immunohistochemical staining assay for LC3, Beclin-1, p62and Bax proteins (scale bars = 50 μM). \u003cstrong\u003ed \u003c/strong\u003eQuantitative analysis of the mean optical density for these proteins. \u003cstrong\u003ee \u003c/strong\u003eThe mRNA levels of LC3, p62, Bax, and Bcl-2 determined by qRT-PCR; β-actin was selected as the internal reference. A one-way analysis of variance followed by Tukey’s post-hoc test were used for analysis. All results are shown as the mean± standard deviation (n=3/group), and all experiments were repeated at least thrice. qRT-PCR, quantitative real-time polymerase chain reaction. A:the sham group; B: the SCI group; C: the SCI + tDCS group; D :the SCI + tDCS + miR-negative control (NC) group; E: the SCI + tDCS + miR-agomir group.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/7794674441bacfffe046f930.png"},{"id":56763308,"identity":"22a81367-5942-4204-86c6-d209162ad7b0","added_by":"auto","created_at":"2024-05-20 07:38:34","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":2380386,"visible":true,"origin":"","legend":"\u003cp\u003etDCS facilitates neurogenesis post-SCI via downregulating miR-298-5p .tDCS conduces regeneration of nerve fibers and blood vessels after SCI. Representative immunofluorescent double staining with NF-200 (regenerative nerve fiber marker: red) and CD31 (vascular marker: green) in the lesions of rats from different treatment groups seven days post-injury. All cell nuclei were stained with DAPI (blue). Merge represents a composite of all three channels (scale bars = 200 µm and 100 µm).\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/689478055da0cbdd67e3ba78.png"},{"id":57571752,"identity":"ed2f5bca-044e-47cc-8ef7-ad750d0c1134","added_by":"auto","created_at":"2024-06-02 15:16:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":25268998,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/f62383cd-0b8b-46c0-bfe5-b123715dd5df.pdf"},{"id":56763591,"identity":"03ce4ce4-9f13-41af-8efa-9d94ef3cba79","added_by":"auto","created_at":"2024-05-20 07:46:34","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":213933,"visible":true,"origin":"","legend":"","description":"","filename":"additionalfile1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/0b4a26dfd2e6a75042ef5cb0.pdf"},{"id":56763301,"identity":"ce6d58b5-c51c-4b34-bb3d-f7ff88df20bf","added_by":"auto","created_at":"2024-05-20 07:38:34","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":3359988,"visible":true,"origin":"","legend":"","description":"","filename":"abstractgraph.tif","url":"https://assets-eu.researchsquare.com/files/rs-4355457/v1/259ecbec040b9158b1d4b1d5.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Transcranial direct current stimulation-mediated miR-298-5p downregulation enhances autophagy by targeting LC3 to promote motor recovery after spinal cord injury","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSpinal cord injury (SCI) is a serious and complicated neurological disorder that can result in the dysfunction or loss of multiple functions below the injured spinal cord segments[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Generally, people with SCI consider motor function to be the highest priority in terms of recovery[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Indeed, such loss of motor control is largely attributable to the interruption of descending control signals from the motor cortex (M1) of the brain past the lesion site[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Restoring this control requires reconstruction of the fibrous connections between the spinal motor neurons below the injury and the specific neurons of M1, which remains a major surgical challenge[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMost SCIs are incomplete, thereby allowing for the opportunity to foster the reconnection of the brain with the spinal cord below the lesion by sprouting residual nerve fibers from spared and/or inured axon populations[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. However, to date, only a few satisfactory therapies for neural repair have been established[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. This is likely due to the multidimensional pathophysiological changes that develop in injured regions[\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The pathophysiology of SCI involves primary and secondary injury mechanisms[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Specifically, mechanical events can lead to compression and tearing of the spinal cord, which would be referred to as the primary injury. The primary injury is followed by a secondary injury cascade, which consists of the activation of neuronal apoptosis and the inhibition of autophagy flux, which ultimately lead to massive tissue destruction[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Autophagy is a cellular response that maintains homeostasis in the cell structure and function and exhibits close interactions with apoptosis[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. However, autophagy is often inhibited after SCI,[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] which can further aggravate the damage and lead to continued functional deficits[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Generally, secondary injury leads to cystic cavitation in the lesion, which makes the local microenvironment unfavorable for the regeneration of nerve fibers[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Because secondary injury involves a relatively long and reversible process, it is often an available target for therapeutic mediation[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMicroRNA (miRNA) is a type of endogenous, noncoding, small-molecule RNA that can participate in the post-transcriptional regulation of the gene expressions of various biological functions[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Extensive work has been done to study changes in gene expression by screening miRNAs, of which a small proportion may play a vital role in the modulation of the secondary injury cascade after SCI[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In one of our previous studies, we discovered that blocking the expression of miR-106-5p in a rat SCI model can promote motor recovery by modulating neuronal apoptosis and autophagic flux[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In a related vein, He et al. concluded that overexpression of miR-92a-3p could promote functional recovery by inhibiting apoptosis in SCI mice. Therefore, certain miRNAs may serve as promising therapeutic targets for SCI rehabilitation[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTranscranial direct current stimulation (tDCS) is considered a promising non-invasive neuromodulation approach, and its effects on improving motor function in persons with SCI conditions have been universally supported[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In particular, the latest research emphasizes that tDCS can induce plasticity among the residual neural circuits at the lesion site to facilitate motor output after an SCI; however, knowledge of the inner molecular mechanisms at play here has yet to be obtained[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Nevertheless, despite these limitations, Sharif et al. found that neuromodulation delivered over M1 can drive corticospinal tract sprouting by reactivating the axon growth-promoting molecular pathways [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In another study, Zhang et al. demonstrated how the tDCS-induced effects of neuroplasticity were associated with the anti-apoptosis mechanism in stroke[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], and Guo et al. showed that tDCS may exert neuroprotective effects in cases of vascular dementia via the modulation of autophagy[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Against this background, this study advances the hypothesis that certain miRNAs might be involved in the tDCS-mediated repair of motor function after SCI by regulating apoptosis and autophagy. Specifically, we suggest that the associated in-depth molecular mechanisms investigated in this study may be involved in the tDCS-mediated repair of motor function after SCI by regulating apoptosis and autophagy.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003e\u003cstrong\u003eAnimals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll female adult Sprague-Dawley rats (eight weeks old, weighing 180\u0026ndash;220 g) were purchased from the Animal Experimental Center (Guangxi Medical University, Nanning, China). All experimental procedures were approved by the Guangxi Medical University Ethics Committee (approval No. 202105013) in May 2021 and were performed in strict accordance with the National Institutes of Health guidelines for laboratory animal care and safety. Following SCI, many animals suffer from urination dysfunction. The urethra of female rats is wide and short, which is convenient for squeezing urine out of the bladder. Thus, female rats were chosen for this experiment. All rats were housed in an Specefic Pathogen Free (SPF) environment at 22\u0026ndash;24℃ under a 12-hour light-dark cycle, with food and water consistently available. The rats were randomized into the following five groups: the sham group, the SCI group, the SCI + tDCS group, the SCI + tDCS + miR-negative control (NC) group, and the SCI + tDCS + miR-agomir group.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEstablish SCI animal model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe SCI rat model was implemented on the basis of a modified version of Allen\u0026rsquo;s method. Briefly, pentobarbital (1%, 50 mg/kg) was used to anesthetize each rat, which was then immobilized in the prone position. Then, the rat underwent a laminectomy at the thoracic vertebra level to expose the T10 spinal segment. Afterward, a stereotaxic apparatus (Ruiwode Life Science Co., Ltd., Shenzhen, China) was used to secure the rat, and the dorsal surface of the spine was submitted to weight-drop injury using a 10-g impact rod with a diameter of 3\u0026thinsp;mm that was released from a 5-cm vertical height through a glass tube[15, 30, 31].The striking force on the dura mater and spinal cord measured 50 g (Fig. 1a and Fig. 1b). The rats with signs of hyperaemia and edema on the surface of the spinal cord surrounding T10, spasmodic tail-wagging reflection, retraction flutter of the body and lower limbs, and flaccid paralysis of both hind limbs represented a successful application of the model[10, 17, 32]. In the sham group, the rats underwent laminectomy without further spinal cord contusion. Finally, for all of the rats, the muscles and skin were disinfected and sutured separately. After the operation, each rat received an intraperitoneal injection of penicillin daily for three consecutive days. Their bladders were checked and manually massaged twice a day to help in urinating. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMotor\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003efunction\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eevaluation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to the Basso\u0026ndash;Beattie\u0026ndash;Bresnahan (BBB) scale, the hind limb function of the rats was evaluated blindly before and one, three, five, and seven days after each operation in an open field by two trained independent observers. The evaluation time for each rat was 5 min, and the scores ranged from 0 to 21 points (0 points indicated complete paralysis, and 21 points meant normal locomotion)[33].\u0026nbsp;Rats with BBB scores higher than 3 on the first postoperative day were excluded due to modeling failure, and backup rats were then supplemented in the model.\u003c/p\u003e\n\u003cp\u003eThe swim test is another scoring system for assessing functional recovery. One week before surgery, all the rats were trained to swim from one end of the glass-filled tank to the other for five consecutive days. The rats in each group were then scored by the Louisville Swimming Scale (LSS)[34], which evaluates forelimb dependence, hindlimb movement and alternation, trunk instability, and body angle. Mean scores were calculated when tested more than twice for each ra\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003etDCS-protocol\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwenty-four hours after the SCI, the rats underwent a tDCS procedure\u0026nbsp;(1 m\u0026nbsp;A, 20 min, 10 min per side) each day for seven days[35-37]. First, the fur around the bregma was shaved to ensure the tight attachment of the electrodes. Then, the anode and cathode electrodes\u0026mdash;both pediatric electrocardiogram electrodes with conductive hydrogel\u0026mdash;were trimmed to a contact area of 1.5 cm\u003csup\u003e2\u003c/sup\u003e for a better fit [38].The anode was then fixed to the skin with an adhesive tape over the M1 area (3 mm to the left of the bregma, and 2 mm in front of the interaural line) and then connected to a battery-driven stimulator. (ActivaTek lnc., Gilroy, CA, USA). The cathode electrode was placed over the supraorbital area (midpoint between the lateral angles of both eyes)[39]. The rats were restrained by a soft cloth during stimulation[40, 41](Fig. 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHigh-throughput miRNA sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo assess possible changes of miRNA in response to tDCS after SCI, rats were anesthetized at seven days post-tDCS, and a 10-mm long spinal cord segment (at a distance of approximately 0.5\u0026thinsp;cm from the injury epicenter) was harvested.\u0026nbsp;The total RNA was extracted using Trizol (Invitrogen, CA), and the concentration was quantified. Regarding microarray detection, hybridization and analysis were performed using mirDeep2 software based on the miRBase database. The miRNA sequencing was performed by Sangon Biotech (Shanghai, China). The threshold set for upregulated and downregulated genes was a p-value \u0026lt; 0.05 and a |log2 fold change (FC)| \u0026gt; 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLuciferase Reporter Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA\u0026nbsp;bioinformatics analysis was then performed using TargetScan\u0026nbsp;(http://www.targetscan.org/vert_72/)\u0026nbsp;to identify the favorable binding site between miR-298-5p and LC3.\u0026nbsp;A wild-type (WT) LC3 3\u0026rsquo;UTR fragment containing the putative miR-298-5p binding sequence, along with the mutant version (MU), was ordered from Sangon Biotech. (Shanghai, China). The above sequences were cloned into a psiCHECK-2 dual-luciferase vector\u0026nbsp;(Promega, USA) to generate LC3-WT and LC3-MU recombinant vectors. PC-12 cells were plated in 96-well plates for co-transfection with LC3-WT/LC3-MU plasmids and rno-miR-298-5p mimic or NC. Quantification of luciferase activity after 48 hours of transfection was determined using a luciferase detection system (Madison, USA, USA) according to the manufacturer\u0026rsquo;s protocol.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLentivirus (LV) Construction and Intrathecal Injections\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further explore the function of miR-298-5p, miR-298-5p lentiviral vectors were constructed using GeneChem Co. Ltd. (Shanghai, China). In the SCI + tDCS + miR-agomir group, the rats were intrathecally injected with LV-rno-miR-298-5p-agomir; in contrast, the rats in the SCI + tDCS + miR-NC group were intrathecally injected with LV-rno-miR-298-5p-NC. The original titers of the lentiviral vector were 6\u0026times;10\u003csup\u003e8\u003c/sup\u003e transduction units (TU) / mL. Before injection, lentiviral vectors (6\u0026times;10\u003csup\u003e8\u003c/sup\u003e TU/mL) were mixed with 0.01 M phosphate buffer solution (PBS; Servicebio, Wuhan, China) on ice to obtain a final lentiviral vector concentration of 4\u0026times;10\u003csup\u003e8\u003c/sup\u003e TU/mL. Subsequently, intrathecal injections of agomir or NC were performed daily for three consecutive days in these rats[42-44]. Experiments were performed one week later.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHaematoxylin \u0026amp; Eosin (H\u0026amp;E) and Nissl Staining\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe 10-mm spinal cord segments centered at the injury epicenter were carefully harvested, fixed with 4% paraformaldehyde immersion for 24 hours, and then embedded with paraffin.A cross-section (5\u0026mu;m thick) was then placed on a glass slide coated with poly-L-lysine for analysis of the diseased tissue after deaffinity and rehydration. H\u0026amp;E staining was employed to examine the tissue histopathology. After being stained with toluidine blue (1%) for Nissl bodies, the spinal tissue sections were visualized under an optical microscope. (BX53, Olympus, Tokyo, Japan).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe paraffin-embedded sections were added and incubated with the primary antibodies for an entire night at 4\u0026deg;C. Then, dewaxing was performed to ensure transparency, after which hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) was applied to repair the antigen. Finally, the sections were incubated with a secondary antibody at 37\u0026deg;C for 30 min, incubated with diaminobenzidine (DAB) for 10 min, counterstained with hematoxylin for 3 min, and attached to coverslips. The results were visualized and photographed under an optical microscope. (BX53, Olympus, Tokyo, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTransmission electron microscope (TEM)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe tissue segments were then dissected and fixed in glutaraldehyde (2.5%) in sodium phosphate buffer (0.1 M) for 24 hours. After rinsing with PBS, the tissues were post-fixed with osmium tetroxide (1%) in a sodium phosphate buffer. The specimens of spinal tissues were then dehydrated with gradient ethyl alcohol solutions and embedded in epoxy resin. Ultrathin sections were prepared and stained with 2% uranyl acetate and 2.6% lead citrate, which were later visualized using a transmission electron microscope (7800; Hitachi, Tokyo, Japan). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture and cell model establishment\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePC-12 cell lines are often selected as research tools for in vitro SCI studies.[93,59]\u0026nbsp;In line with this approach, PC-12 cells purchased from the Chinese Academy of Sciences (Shanghai, China) were cultured at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (Gibco, CA, USA) supplemented with 8% fetal bovine serum (Gibco) and 1% penicillin-streptomycin solution mixture (Gibco) .The PC-12 cells were randomly divided into the following six groups: a control group, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e + miR-mimics group,H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e + miR-mimics-NC group, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e + miR-inhibitors group, and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e + miR-inhibitors-NC group. An application of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (100 \u0026micro;M for six hours) was used to mimic neuronal injury, according to the results of the half-maximal inhibitory concentration (IC\u003csub\u003e50\u003c/sub\u003e) values (additional files 1).\u0026nbsp;The PC-12 cells were then transiently transfected with Lipofectamine\u0026trade; 6000 (Invitrogen, USA), as directed by the manufacturer. The miR-298-5p mimics and inhibitors, along with their corresponding NC mimics and NC inhibitors, were purchased from Jikai Co. (Shanghai, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Viability Assa\u003c/strong\u003ey\u003c/p\u003e\n\u003cp\u003eCell viability was detected using a Cell Counting Kit-8 assay (CCK-8; Meilun, China). Cells were seeded at a density of 1.5\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/well on the 96-well plate, and then 10 \u0026micro;L of CCK-8 reagent in 90 \u0026micro;l of the medium was added to each well. After 30 min, cell viability was evaluated under a microplate reader (Synergy H1, BioTek, USA) at a wavelength of 450 nm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTerminal Deoxynucleotidyl Transferase-Mediated dUTP Nick-End Labeling (TUNEL) Staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA TUNEL kit (Meilun, China) was used to determine the apoptosis of the neurons. The cells were first immobilized using 4% paraformaldehyde. The previously generated tissue sections and cells were then dipped into a TUNEL reaction mixture (50 \u0026mu;L) at 37\u0026deg;C for one hour; after this, the nuclei were stained for 3 min with 4\u0026apos;,6-diamidino-2-phenylindole (DAPI) solution. The fluorescence density was observed under a fluorescence microscope \u0026nbsp;(EVOS\u0026trade; FL Auto 2, Thermo Fisher).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemical\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cell slides and tissue sections were permeabilized with 0.2% Triton X-100 \u0026nbsp;(Solarbio, China) and blocked with 5% goat serum (Gibco) for 30 min at room temperature. Afterward, these samples were incubated at 4\u0026deg;C overnight with primary antibodies against Bcl2-associated X protein (Bax; 1:100, mouse), p62 (1:100, rabbit), and anti-light chain 3 (LC3; 1:100, rabbit). Tissue sections were also stained with neurofilament protein-200 (NF-200; 1:200, rabbit) and cluster of differentiation 31 (CD31;1:200, mouse). These primary antibodies were all obtained from Proteintech (Wuhan, China) . After washing with PBS, the samples were subsequently stained for two hours with the appropriate secondary antibody (1:400, goat anti-rabbit conjugated to Alexa Fluor 488; 1:200 rat anti-rabbit conjugated to Alexa Fluor 549; UElandy Suzhou, China) at room temperature. Finally, the samples were counterstained using DAPI (1 \u0026mu;g/mL) and covered with coverslips. Images were captured via fluorescence microscopy (BX51, Olympus, Tokyo, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot analysis (WB)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe total protein in each of the samples was extracted using RIPA buffer\u0026nbsp;(89900, Thermo Fisher, USA). Proteins per sample were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). After that, the separated samples were transferred to a polyvinylidene fluoride (PVDF) membrane\u0026nbsp;(Millipore, Bedford, MA). The membranes were subsequently blocked by 5% skimmed milk in Tris-buffered saline and 1% Tween 20 (TBST, Thermo Fisher, USA) at room temperature for one hour and incubated at 4\u0026deg;C overnight with the primary antibodies, which included rabbit \u0026beta;-Actin, rabbit LC3, rabbit beclin1, rabbit\u0026nbsp;p62, mouse Bax, and rabbit Bcl2\u0026nbsp;(all diluted 1:2000, Proteintech, China);\u0026nbsp;with rabbit \u0026beta;-Actin serving as an internal control. After washing with TBST, the membranes were incubated in the secondary antibody (goat anti-rabbit IgG, 1:15000, Proteintech, China)\u0026nbsp;for another hour at room temperature. The LiCor Odyssey Scanner was used for blot scanning, and the Odyssey 3.0 software package\u0026nbsp;(LiCor, USA)\u0026nbsp;was used for the analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative real-time polymerase chain reaction (qRT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA in the samples was extracted with the NucleoZol RNA reagent \u0026nbsp;(Macherey\u0026ndash;Nagel, D\u0026uuml;ren, Germany) and then reversely transcribed into cDNAs through a PrimeScript RT reagent kit with a gDNA eraser (code no. RR047A, Takara, Japan) or PrimeScript RT Master Mix (code no. RR036Q/A/B, Takara, Japan). TB GreenprexExTaqII (code number. RR820Q/A/B, Takara, Japan) and the Applied Biosystems 7500 real-time PCR instrument (Applied Biosystems, USA) were used to evaluate the PCR reactions. U6/\u0026beta;-actin was employed as the internal control for miRNA and mRNA, respectively. The relative gene expression levels were calculated by the 2\u003csup\u003e-\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e methods. The primer sequences are listed in Table1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003cstrong\u003e. Primer sequence for quantitative real-time polymerase chain reaction\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"561\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.671454219030522%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.36983842010772%\" valign=\"top\"\u003e\n \u003cp\u003eForward (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.95870736086176%\" valign=\"top\"\u003e\n \u003cp\u003eReverse (3\u0026rsquo;-5\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.671454219030522%\" valign=\"top\"\u003e\n \u003cp\u003erno-miR-298-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.36983842010772%\" valign=\"top\"\u003e\n \u003cp\u003eGGAGGGCTGTTCTTCCCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.95870736086176%\" valign=\"top\"\u003e\n \u003cp\u003emRQ 3\u0026rsquo;primer (Takara, Japan)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.671454219030522%\" valign=\"top\"\u003e\n \u003cp\u003eBcl-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.36983842010772%\" valign=\"top\"\u003e\n \u003cp\u003eGACTGAGTACCTGAACCGGCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.95870736086176%\" valign=\"top\"\u003e\n \u003cp\u003eCTGAGCAGCGTCTTCAGAGACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.671454219030522%\" valign=\"top\"\u003e\n \u003cp\u003eBax\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.36983842010772%\" valign=\"top\"\u003e\n \u003cp\u003eTGGCGATGAACTGGACAACAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.95870736086176%\" valign=\"top\"\u003e\n \u003cp\u003eGGGAGTCTGTATCCACATCAGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.671454219030522%\" valign=\"top\"\u003e\n \u003cp\u003eLC3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.36983842010772%\" valign=\"top\"\u003e\n \u003cp\u003eAGCTCTGAAGGCAACAGCAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.95870736086176%\" valign=\"top\"\u003e\n \u003cp\u003eGCTCCATGCAGGTAGCAGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.671454219030522%\" valign=\"top\"\u003e\n \u003cp\u003ep62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.36983842010772%\" valign=\"top\"\u003e\n \u003cp\u003eTGAAGGCTATTACAGCCAGAGTCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.95870736086176%\" valign=\"top\"\u003e\n \u003cp\u003eCCTTCAGTGATGGCCTGGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.671454219030522%\" valign=\"top\"\u003e\n \u003cp\u003eU6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.36983842010772%\" valign=\"top\"\u003e\n \u003cp\u003eGGAACGATACAGAGAAGATTAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.95870736086176%\" valign=\"top\"\u003e\n \u003cp\u003eTGGAACGCTTCACGAATTTGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.671454219030522%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.36983842010772%\" valign=\"top\"\u003e\n \u003cp\u003eTGTCACCAACTGGGACGATA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.95870736086176%\" valign=\"top\"\u003e\n \u003cp\u003eGGGGTGTTGAAGGTCTCAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe statistical tests of all the data were completed by\u0026nbsp;SPSS software (version 25.0, USA) and GraphPad Prism software (version 8.0, USA),\u0026nbsp;Data\u0026nbsp;are presented as mean \u0026plusmn; standard deviation from at least three independent experiments in this study. The measurement data were first analysed for normal distribution. One-way ANOVA was performed, followed by Tukey\u0026apos;s post-hoc test for Comparisons among multiple groups.\u0026nbsp;Comparisons between the two groups were conducted using Student\u0026rsquo;s t-tests. For comparisons of motor scores, repeated-measures analysis of variance (ANOVA) was performed. Statistical significance was denoted as follows: *\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, ***\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003etDCS altered miR-298-5p expression flowing injured area of SCI rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of\u0026nbsp;175\u0026nbsp;miRNAs were found with |log2 fold change (FC)| \u0026gt; 1 and p \u0026lt;\u0026thinsp;0.05 between SCI group and SCI\u0026thinsp;+\u0026thinsp;tDCS group (Fig.\u0026nbsp;3a). Among these miRNAs, miR-298-5p was the most significantly suppressed in the tDCS group compared to the SCI group. To validate the outcome of the sequencing, qRT-PCR was applied. The relative expression of miR-298-5p was significantly upregulated at one, five, seven, and 14 days post-operation in the SCI group compared to the sham group (p \u0026lt;0.05,\u0026nbsp;Fig.\u0026nbsp;3b). However, the expression was downregulated after tDCS in the SCI + tDCS group compared with the SCI group (\u003cem\u003ep\u003c/em\u003e \u0026lt;0.001; Fig. 3c) In conclusion, the expression of miR-298-5p was upregulated after SCI and decreased after tDCS treatment in vivo.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLC3 is a direct target of miR-298-5p\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the present study, we predicted the target gene of miR-298-5p via bioinformatics. Two potential binding sites were identified between LC3 and miR-298-5p by TargetScan (Fig. 4a ). Based on the binding sequences, LC3-WT and LC3-MUT were constructed. The luciferase activity markedly decreased in cells co-transfected with miR-298-5p-mimics and LC3-WT (p \u0026lt; 0.001), , whereas those co-transfected with miR-298-5p-mimics and LC3-MUT did not show a significant change (p\u0026thinsp;\u0026gt; 0.05, Fig. 4b ). Both of these results strongly support the idea that miR-298-5p interacts with LC3 directly. Meanwhile, the WB results showed that LC3 expression was negatively regulated by miR-298-5p, which is consistent with the qRT-PCR results (p \u0026lt;0.05, Fig. 4c and Fig. 4 d and Fig. 4 e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMir-298-5p affects the SCI-induced autophagy and apoptosis \u003cem\u003ein vitro\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTransfect efficiency was assessed by qRT-PCR.\u0026nbsp;As displayed in\u0026nbsp;Fig.\u0026nbsp;5a, miR-298-5p expression was significantly increased after injury in the\u0026nbsp;H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group compared with the control group (\u003cem\u003ep\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05). At that point, miR-298-5p mimics/NC mimics and miR-298-5p inhibitors/NC inhibitors were transfected into the\u0026nbsp;H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e-induced PC-12 cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The findings indicated that the viability of the PC-12 cells was reduced after injury \u0026nbsp;(\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001). Following the transfection of miR-298-5p mimics, cell viability had further declined \u0026nbsp;(\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001). However, cell viability was significantly enhanced following transfection with miR-298-5p inhibitors ( (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001,\u0026nbsp;Fig.\u0026nbsp;5b. The TUNEL assay revealed that cell apoptosis was enhanced in the\u0026nbsp;H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group compared with the control group. The ratio of apoptotic cells was further increased after transfection with the miR-298-5p mimics \u0026nbsp;(\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001), while it was significantly inhibited by miR-298-5p inhibitors (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.001, Fig. 5 c and Fig. 5 d).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe results of the immunofluorescence staining showed that H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e can activate autophagy and induce apoptosis, which can be manifested as the increased fluorescence intensity of Bax, p62, and LC3. The positive signals of Bax and p62 were markedly enhanced, while LC3 was decreased in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e + miR-mimics group compared with theH\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group; the opposite results were observed in the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003csub\u003e\u0026nbsp;\u003c/sub\u003e+ miR-inhibitors group compared to the\u0026nbsp;H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e group (Fig. 6a and Fig. 6b). Subsequently, the WB assay showed that the expression of the Bcl-2 protein decreased after H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e injury. While the expression was further attenuated after miR-298-5p mimic-transfection (\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05), it increased by miR-298-5p inhibitor-transfection(\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01,\u0026nbsp;Fig.\u0026nbsp;4c and\u0026nbsp;Fig.\u0026nbsp;6c).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003etDCS attenuates tissue damage,\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eameliorates\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;neural functional status and motor function of SCI rats via downregulating miR-298-5p\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further explore the function of miR-298-5p in the neuroprotection of tDCS for SCI, miR-298-5p-agomir or miR-298-5p-NC was administered. The expression level of miR-298-5p in the injured spinal segment was significantly decreased after tDCS in the SCI + tDCS group compared to the SCI group (p \u0026lt; 0.001). However, miR-298-5p-agomir actually reversed the change in the SCI + tDCS + miR-agomir group \u0026nbsp;(p \u0026lt; 0.001; Fig. 3c).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe functional recovery of the rats after the different treatments was comprehensively evaluated based on the BBB and LSS scales. The preoperative BBB scores were similar among the groups(p\u0026gt;0.05). At one day post-operation, the scores of the sham group were higher than those of the other groups (P\u0026lt;0.01). Starting at five days and ranging up to seven days post-operation, the BBB scores in the SCI + tDCS group were significantly higher than those in the SCI group. However, the effects of tDCS treatment were reversed by miR-298-5p overexpression \u0026nbsp;(all \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, Fig. 7a and Table 2). The LSS could thus intuitively reflect the differences in motor function among the various groups, and the scores displayed a similar trend as the BBB (Fig. 7b and Fig. 7c,and Table 3 ).\u003c/p\u003e\n\u003cp\u003eThe results also indicated that the structure of the gray-white matter was intact and clear in the sham group. The images show a lesion cavity in the center of the injury, with clear signs of tissue swelling in the SCI group. After the tDCS procedure, a clearer structure and less tissue loss could be observed in the SCI + tDCS group. These results emphasize the role of tDCS in the repair of SCI in rats. However, miR-298-5p overexpression counteracted the tDCS-induced effects, leading to significant necrotic cavities and spinal cord edema in the SCI + tDCS + miR-agomir group and a significant reduction in the number of neuronal cells compared with the +miR-NC group (Fig.7d).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the sham group, the image of Nissl staining showed that the neuronal structures were complete and clear, the nucleus was obvious, and a large number of Nissl\u0026nbsp;bodies\u0026nbsp;were\u0026nbsp;evenly distributed\u0026nbsp;in\u0026nbsp;the\u0026nbsp;cytoplasm. In the SCI group, neurons were swollen and morphologically unclear, and Nissl bodies were reduced. The cell morphology improved, and edema was reduced in response to treatment with tDCS, while the number of Nissl bodies significantly increased in the SCI + tDCS group. However, the image displayed shrunken neuronal cell bodies and Nissl granule dissolution after the overexpression of miR-298-5p in the SCI + tDCS + miR-agomir group compared with the SCI + tDCS + miR-NC group (Fig. 7e). Overall, these results reveal that tDCS promotes autophagy and suppresses SCI-induced apoptosis by downregulating miR-298-5p.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;BBB scores at various times pre- and postsurgery\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" align=\"left\" width=\"103%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.46938775510204%\" rowspan=\"2\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; BBB score \u0026nbsp;\u0026nbsp;\u003cbr\u003e\u0026nbsp; Group\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.346938775510203%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eBefore surgery\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.183673469387756%\" colspan=\"4\"\u003e\n \u003cp\u003e\u003cstrong\u003eAfter surgery\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0 Day\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.428571428571427%\"\u003e\n \u003cp\u003e\u003cstrong\u003eThird day\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.785714285714285%\"\u003e\n \u003cp\u003e\u003cstrong\u003eFifth day\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.785714285714285%\"\u003e\n \u003cp\u003e\u003cstrong\u003eFifth day\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.958333333333332%\"\u003e\n \u003cp\u003esham\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.708333333333332%\"\u003e\n \u003cp\u003e21.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\"\u003e\n \u003cp\u003e21.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\"\u003e\n \u003cp\u003e21.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\"\u003e\n \u003cp\u003e21.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\"\u003e\n \u003cp\u003e21.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.958333333333332%\"\u003e\n \u003cp\u003eSCI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.708333333333332%\"\u003e\n \u003cp\u003e21.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\"\u003e\n \u003cp\u003e0.00\u0026plusmn;0.00\u0026dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\"\u003e\n \u003cp\u003e1.06\u0026plusmn;0.40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\"\u003e\n \u003cp\u003e1.72\u0026plusmn;0.45\u0026dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\"\u003e\n \u003cp\u003e2.39\u0026plusmn;0.49\u0026dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.958333333333332%\"\u003e\n \u003cp\u003eSCI+tDCS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.708333333333332%\"\u003e\n \u003cp\u003e21.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\"\u003e\n \u003cp\u003e0.00\u0026plusmn;0.00\u0026dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\"\u003e\n \u003cp\u003e2.78\u0026plusmn;0.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\"\u003e\n \u003cp\u003e3.39\u0026plusmn;0.49\u0026Dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\"\u003e\n \u003cp\u003e5.17\u0026plusmn;0.50\u0026Dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.958333333333332%\"\u003e\n \u003cp\u003eSCI+miR298-5p NC+tDCS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.708333333333332%\"\u003e\n \u003cp\u003e21.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\"\u003e\n \u003cp\u003e0.00\u0026plusmn;0.00\u0026dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\"\u003e\n \u003cp\u003e2.67\u0026plusmn;0.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\"\u003e\n \u003cp\u003e3.22\u0026plusmn;0.42\u0026sect;**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\"\u003e\n \u003cp\u003e5.11\u0026plusmn;0.57\u0026sect;**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.958333333333332%\"\u003e\n \u003cp\u003eSCI+ago-miR298-5p+tDCS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.708333333333332%\"\u003e\n \u003cp\u003e21.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.583333333333334%\"\u003e\n \u003cp\u003e0.00\u0026plusmn;0.00\u0026dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.5%\"\u003e\n \u003cp\u003e1.50\u0026plusmn;0.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\"\u003e\n \u003cp\u003e1.56\u0026plusmn;0.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.625%\"\u003e\n \u003cp\u003e2.11\u0026plusmn;0.46\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eValues are presented as mean\u0026plusmn; standard deviation of 20 rats per group per time point, where lower BBB scores indicate poorer locomotor function. BBB, Basso-Beattie-Bresnahan locomotor scale; SCI, spinal cord injury; tDCS:Transcranial direct current stimulation; NC, negative control. A one-way analysis of variance followed by Tukey\u0026rsquo;s post-hoc test was performed. \u0026dagger;, as\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eLSS\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;scores at various times pre- and postsurgery\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"99%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.232323232323232%\" rowspan=\"2\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;LSS score \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003cbr\u003e\u0026nbsp; \u0026nbsp;Group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.171717171717173%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eBefore surgery\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.5959595959596%\" colspan=\"4\"\u003e\n \u003cp\u003e\u003cstrong\u003eAfter surgery\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.862068965517242%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0 Day\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.689655172413794%\"\u003e\n \u003cp\u003e\u003cstrong\u003eThird day\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.586206896551722%\"\u003e\n \u003cp\u003e\u003cstrong\u003eFifth day\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.862068965517242%\"\u003e\n \u003cp\u003e\u003cstrong\u003eFifth day\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.46938775510204%\"\u003e\n \u003cp\u003esham\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003e17.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003e17.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.244897959183673%\"\u003e\n \u003cp\u003e17.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\"\u003e\n \u003cp\u003e17.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003e17.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.46938775510204%\"\u003e\n \u003cp\u003eSCI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003e17.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003e0.45\u0026plusmn;0.51\u0026dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.244897959183673%\"\u003e\n \u003cp\u003e1.95\u0026plusmn;0.69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\"\u003e\n \u003cp\u003e2.65\u0026plusmn;0.49\u0026dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003e3.15\u0026plusmn;0.67\u0026dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.46938775510204%\"\u003e\n \u003cp\u003eSCI+tDCS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003e17.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003e0.75\u0026plusmn;0.44\u0026dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.244897959183673%\"\u003e\n \u003cp\u003e2.45\u0026plusmn;0.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\"\u003e\n \u003cp\u003e4.45\u0026plusmn;0.51\u0026Dagger;*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003e6.70\u0026plusmn;0.73\u0026Dagger;*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.46938775510204%\"\u003e\n \u003cp\u003eSCI+miR298-5p NC+tDCS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003e17.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003e0.65\u0026plusmn;0.59\u0026dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.244897959183673%\"\u003e\n \u003cp\u003e2.45\u0026plusmn;0.51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\"\u003e\n \u003cp\u003e4.20\u0026plusmn;0.70\u0026sect;*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003e6.35\u0026plusmn;0.93\u0026sect;*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.46938775510204%\"\u003e\n \u003cp\u003eSCI+ago-miR298-5p+tDCS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003e17.00\u0026plusmn;0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003e0.50\u0026plusmn;0.51\u0026dagger;**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.244897959183673%\"\u003e\n \u003cp\u003e1.9\u0026plusmn;0.40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.3265306122449%\"\u003e\n \u003cp\u003e2.40\u0026plusmn;0.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003e3.00\u0026plusmn;0.65\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eValues are presented as mean\u0026plusmn; standard deviation of 20 rats per group per time point, LSS:Louisville Swim Scale. SCI, spinal cord injury; tDCS:Transcranial direct current stimulation; NC, negative control. A one-way analysis of variance followed by Tukey\u0026rsquo;s post-hoc test was performed. \u0026dagger;, as compared with sham group; \u0026Dagger;, as compared with SCI group;\u0026sect;, as compared with SCI+tDCS+miR-298-5p agomir group.* P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003etDCS promotes autophagy and suppresses SCI-induced apoptosis via downregulating miR-298-5p\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTEM was used to examine the ultrastructural characteristics \u0026nbsp;(\u0026times;3,000 magnification) of the injured segment. In the sham group, abnormal structures were not identified in either the nucleus or the organelles. Moreover, no autolysosomes or autophagosomes were observed (Fig. 8a). In contrast, intracellular edema, an irregular nucleus, and an increased number of lysosomes (yellow arrow) and autolysosomes (green arrow) were found in the cells in the SCI group (Fig. 8 b). The SCI + tDCS group showed an improved state and a creased number of autolysosomes (green arrow) and autophagosomes (red arrow) compared with the SCI group (Fig. 8c). In addition, more autophagosomes (red arrows) and autolysosomes (green arrows) were observed in the SCI + tDCS + miR-NC group compared to the SCI group (Fig. 8 d). Finally, in the SCI + tDCS + miR-agomir group, the cells were swollen, and some lysosomes (yellow arrows) could be detected (Fig. 8e). These results clarify that tDCS can heighten the autophagy flux after SCI, while miR-298-5p overexpression can neutralize these effects.\u003c/p\u003e\n\u003cp\u003eIn comparison with the sham group, the number of TUNEL-positive cells markedly increased in the SCI group. In the SCI + tDCS group, the proportion of TUNEL-positive cells was obviously decreased in response to the tDCS procedure (p \u0026lt; 0.001). However, miR-298-5p-agomir was able to reverse the change in tDCS, such that the proportion of TUNEL-positive cells in the SCI + tDCS + miR-agomir group was higher than those in the SCI + tDCS + miR-NC group (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001,Fig. 9a and Fig. 9b).\u003c/p\u003e\n\u003cp\u003eThe expression of the autophagy-related proteins LC3, p62, and Beclin-1, as well as the apoptotic-related proteins Bax and Bcl-2, in the spinal tissues was detected via WB (Fig. 10a and Fig. 10b) and immunohistochemical staining (Fig. 10c and Fig. 10d). The contents of LC3, p62, and Bax increased, while those of Bcl-2 decreased following SCI. However, tDCS decreased the level of p62 and Bax, as well as increased the expression of Bcl-2 and LC3, compared to the SCI group (all \u003cem\u003ep\u003c/em\u003e \u0026lt;0.05). It was also found that miR-298-5p-agomir can reverse the tDCS-induced changes. Additionally, qRT-PCR of LC3, Beclin-1, p62, Bax, and Bcl-2 mRNA further confirmed the above findings (Fig. 10e). These observations suggest that tDCS can promote autophagy and inhibit apoptosis after SCI by downregulating miR-298-5p.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003etDCS facilitates neurogenesis post-SCI via downregulating miR-298-5p\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDouble immunofluorescent staining for NF-200 (axon marker) and CD31 (vascular marker) was used to investigate nerve fiber regeneration in each group (Fig. 11). The results confirmed that the fluorescence intensity of NF-200 and CD31 in the SCI group significantly decreased compared with the corresponding values in the sham group. In contrast, the NF-200- and CD31-positive signals were significantly inducted after tDCS therapy. Subsequently, these tDCS-induced effects were reversed by miR-298-5p overexpression.\u003c/p\u003e\n\u003cp\u003eObservation of microstructure and autophagosome changes of each group by transmission electron microscopy.a In the sham group, the nucleus was intact with obvious nucleoli. The myelin sheath was arranged around the axon in concentric circles. (B) In the SCI group, the irregular myelin sheath, pyknotic nuclei, and swelling mitochondrial with several autolysosomes are shown. (C\u0026amp;D) In the SCI+tDCS group and SCI+tDCS+miR-NC group, the morphology of the nuclei was nearly normal, the mitochondria exhibited swelling to a lesser extent, and the number of autophagosomes obviously increased. (E) In the SCI+tDCS+miR-agomir group, neurons showed swelling mitochondrial with vacuolization, karyopyknotic, and the number of autophagosomes has obviously decreased. The microstructure of each group was observed with scale bar = 5 \u0026mu;M, and the autophagosomes were observed with scale bar = 2 \u0026mu;M. The blue asterisk identifies the nuclei; the green points to autophagosomes.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSCI is a serious neurological disease that can cause extensive damage to the structure of the spinal cord, resulting in motor dysfunction[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Massive neuronal death and atrophy after SCI are notable pathophysiologies and mechanisms of motor function defects[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Increased apoptosis and decreased autophagy can cause secondary injury and negatively impact neuronal survival following SCI[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Therefore, the improvement of the neuronal microenvironment in the injured section by regulation of both autophagy and apoptosis is crucial for encouraging the regeneration of nerve fibers[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Our data demonstrated that tDCS therapy can promote neuronal survival, neural regeneration, and functional recovery via the molecular mechanism of activating autophagy flux and attenuating cell apoptosis after SCI.\u003c/p\u003e \u003cp\u003ePreviously, some studies had suggested that SCI may perturb miRNA homeostasis[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Depending on their downstream target genes, the dysregulation of these miRNAs might result in either alleviated or aggravated post-SCI conditions[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. In the present study, we detected high expression levels of miR-298-5p after SCI. The function of miR-298-5p in apoptosis has been extensively investigated elsewhere. For example, Wallach et al. demonstrated that miR-298-5p can be released from apoptotic cortical neurons, thereby triggering further neuronal apoptosis in the central nervous system[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. In another study, Wei et al. found that miR-298-5p targets Srpk1 to change cell viability and apoptosis as mediated by sevoflurane[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. However, little is known about the regulatory role of miR-298-5p in SCI repair. Here, we validated that miR-298-5p acts as a harmful factor after SCI, wherein neural and autophagy flux was enhanced and apoptosis was inhibited after downregulating miR-298-5p through the tDCS procedure, which indicates that tDCS has a regulatory effect by inhibiting the expression of miR-298-5p. An in vitro model of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e-induced neurotoxicity in PC12 cells was used to further confirm the involvement of miR-298-5p in autophagy and apoptosis.\u003c/p\u003e \u003cp\u003eThe crosstalk between apoptosis and autophagy has been observed elsewhere[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Several studies have indicated that the appropriate activation of autophagy can protect neurons in the spinal cord from undergoing apoptosis, while the dysfunction of autophagy could further lead to neuronal cell injury[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. In this study, we confirmed that miR-298-5p can directly target LC3 via the dual-luciferase reporter system. LC3 is correlated with the control of autophagosome elongation and is a reliable indicator for monitoring autophagy induction in mammals[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Moreover, p62, an autophagy cargo protein, can interact directly with LC3 to bring damaged mitochondria and other autophagosomes into the autolysosomes for degradation through specific autophagy-lysosome pathways. Thus, the accumulation of p62 indicates a blockage in autophagy[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Our data indicated that tDCS conditions markedly enhanced LC3 levels and reduced p62 and Beclin-1 expression in SCI rats, which was accompanied by the accumulation of autolysosome and autophagosome observed by TEM, thereby indicating that functional autophagic flux in the SCI\u0026thinsp;+\u0026thinsp;tDCS group was significantly heightened by tDCS. Also, the inhibitory effect of tDCS on neuronal apoptosis, which was accompanied by the increase of autophagy flux, was also observed in the present study as a gradual decrease in the apoptotic protein Bax and Bcl-2 levels and the proportion of TUNEL-positive cells. These findings suggest that tDCS has the therapeutic effect of strengthening autophagic flux and inhibiting SCI-induced apoptosis.\u003c/p\u003e \u003cp\u003eSCI leads to the interruption of neural connectivity, resulting in serious neurological dysfunction. Functional restoration relies on the formation of new fibrous connections and neural circuits[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. The remodeling of functional neural circuits between the spinal cord and brain may need to be driven by rehabilitation[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. One study has suggested that tDCS, a non-invasive neuromodulation technique targeting the promotion of neuronal plasticity, seems to be an effective approach[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Previous studies have found that suitable conditions for neuronal survival and plasticity can be induced by enhancing autophagy flux and inhibiting neuronal apoptosis after SCI[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. The intriguing finding related to Nissl staining in our study demonstrated that neuronal function and survival were significantly increased after tDCS treatment. We also observed that the fluorescence intensity of NF-200 in the SCI\u0026thinsp;+\u0026thinsp;tDCS group was significantly higher than that in the SCI group. NF-200 is an axon-specific intermediate filament protein that is used as a \u0026ldquo;growth\u0026rdquo; or \u0026ldquo;plasticity\u0026rdquo; marker in the regeneration of nerve fibers[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. The higher expression of NF-200 in the SCI\u0026thinsp;+\u0026thinsp;tDCS group hinted that tDCS treatment could promote the regeneration of nerve fibers in spinal tissue after SCI. The results of TEM and H\u0026amp;E staining further demonstrated that the local microenvironment in the injury segment and the ultrastructure of neurons were markedly modified after tDCS therapy. These effects coincided with the trend of restored motor capacity in the SCI rats evaluated by BBB and LSS scores, which therefore explained the significant functional recovery after tDCS treatment.\u003c/p\u003e \u003cp\u003eAfter SCI, neural repair and plasticity require the formation of blood vessels to supply sufficient oxygen and nutrients to the injured area[\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. The blood vessel\u0026ndash;specific marker CD31 reflects vascular structure and function.[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e] In this study, immunofluorescence staining showed that the level of CD31 protein decreased in the spinal tissues after SCI and increased after tDCS. These findings illustrate that tDCS promotes angiogenesis. Moreover, double staining with NF-200 and CD31 in the lesions of the rats suggested that nerve fiber regeneration was associated with the formation of vessels. To better illustrate the potential role of miR-298-5p in the treatment of tDCS after SCI, we next attempted to treat rats with tDCS in combination with intrathecal miR-298-5p agomir. However, the protective effects of tDCS could be counteracted by the overexpression of miR-298-5p. Nevertheless, these observations show that tDCS exerted its effects against SCI by inhibiting miR-298-5p expression.\u003c/p\u003e \u003cp\u003eThe present study has several limitations. First, we did not provide evidence of the best time points or treatment parameters for the repair of SCI by tDCS. Second, we did not detect changes in neurotrophic factor content or neurite extension in the in-vivo experiments. Third, the present study was carried out only with adult female rats. Thus, it is not clear whether the use of rats of different ages and sexes may affect the experimental data. Furthermore, we chose PC-12 cells to simulate an SCI model in vitro, which would be more convincing if primary spinal cord neuronal cells were selected to further corroborate our conclusions.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eOur results provide new insights for explaining the therapeutic mechanism of tDCS for SCI-related motor dysfunction. Through the regulation of autophagy and apoptosis by the downregulation of miR-298-5p, tDCS might promote neural repair and enhance motor functional recovery after SCI. Therefore, the results of the present study provide experimental basic evidence for the application of tDCS in clinical treatments for SCI.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTThe authors would like to express their appreciation to Shu-Hui Guo and Chen-Xi Liang for their support on the experiment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Natural Science Foundation of China (No. 81960417), Guangxi Key Research and Development Program (No. GuiKeAB20159027), and Guangxi Natural Science Foundation (No. 2018GXNSFAA050033).n of China (Grant number. 82172531).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJWX, YJS and YL designed the study; JWX provided funding support; QHP, XLL and YT conducted the in vitro experiment; YY, FCL,KWW and YCG performed the in vivo experiment; QHP and WFZ analysed data; JMC drafted and wrote the manuscript. All authors approved the final version of the paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval and Consent to Participate\u0026nbsp;\u003c/strong\u003eAll animal care and experimental procedures in this study were approved by the Guangxi Medical University Animal Research Ethics Committee ( No. 202105013)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for Publication\u0026nbsp;\u003c/strong\u003eAll authors agree to the publication of this manuscript\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e The authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eYang Y, Xu HY, Deng QW, Wu GH, Zeng X, Jin H, Wang LJ, Lai BQ, Li G, Ma YH, Jiang B, Ruan JW, Wang YQ, Ding Y, Zeng YS.(2021) Electroacupuncture facilitates the integration of a grafted TrkC-modified mesenchymal stem cell-derived neural network into transected spinal cord in rats via increasing neurotrophin-3. CNS neuroscience \u0026amp; therapeutics 27:776-91.https://doi.org /10.1111/cns.13638\u003c/li\u003e\n\u003cli\u003eXu Y, An BY, Xi XB, Li ZW, Li FY.(2016) MicroRNA-9 controls apoptosis of neurons by targeting monocyte chemotactic protein-induced protein 1 expression in rat acute spinal cord injury model. Brain research bulletin 121:233-40.https://doi.org /10.1016/j.brainresbull.2016.01.011\u003c/li\u003e\n\u003cli\u003eYang Q, Ramamurthy A, Lall S, Santos J, Ratnadurai-Giridharan S, Lopane M, Zareen N, Alexander H, Ryan D, Martin JH, Carmel JB.(2019) Independent replication of motor cortex and cervical spinal cord electrical stimulation to promote forelimb motor function after spinal cord injury in rats. Experimental neurology 320:112962.https://doi.org /10.1016/j.expneurol.2019.112962\u003c/li\u003e\n\u003cli\u003eWu MF, Zhang SQ, Liu JB, Li Y, Zhu QS, Gu R.(2015) Neuroprotective effects of electroacupuncture on early- and late-stage spinal cord injury. Neural regeneration research 10:1628-34.https://doi.org /10.4103/1673-5374.167762\u003c/li\u003e\n\u003cli\u003eZheng Y, Mao YR, Yuan TF, Xu DS, Cheng LM.(2020) Multimodal treatment for spinal cord injury: a sword of neuroregeneration upon neuromodulation. Neural regeneration research 15:1437-50.https://doi.org /10.4103/1673-5374.274332\u003c/li\u003e\n\u003cli\u003eSharif H, Alexander H, Azam A, Martin JH.(2021) Dual motor cortex and spinal cord neuromodulation improves rehabilitation efficacy and restores skilled locomotor function in a rat cervical contusion injury model. Experimental neurology 341:113715.https://doi.org /10.1016/j.expneurol.2021.113715\u003c/li\u003e\n\u003cli\u003eHofer AS, Schwab ME.(2019) Enhancing rehabilitation and functional recovery after brain and spinal cord trauma with electrical neuromodulation. Current opinion in neurology 32:828-35.https://doi.org /10.1097/wco.0000000000000750\u003c/li\u003e\n\u003cli\u003eHu Y, Sun YF, Yuan H, Liu J, Chen L, Liu DH, Xu Y, Zhou XF, Ding L, Zhang ZT, Xiong LL, Xue LL, Wang TH.(2024) Vof16-miR-185-5p-GAP43 network improves the outcomes following spinal cord injury via enhancing self-repair and promoting axonal growth. CNS neuroscience \u0026amp; therapeutics 30:e14535.https://doi.org /10.1111/cns.14535\u003c/li\u003e\n\u003cli\u003eJo HJ, Perez MA.(2020) Corticospinal-motor neuronal plasticity promotes exercise-mediated recovery in humans with spinal cord injury. Brain : a journal of neurology 143:1368-82.https://doi.org /10.1093/brain/awaa052\u003c/li\u003e\n\u003cli\u003eXiao WP, Ding LL, Min YJ, Yang HY, Yao HH, Sun J, Zhou X, Zeng XB, Yu W.(2019) Electroacupuncture Promoting Axonal Regeneration in Spinal Cord Injury Rats via Suppression of Nogo/NgR and Rho/ROCK Signaling Pathway. Neuropsychiatric disease and treatment 15:3429-42.https://doi.org /10.2147/ndt.S216874\u003c/li\u003e\n\u003cli\u003eMa L, Ma L, Yang Y, Chen T, Wang L, Deng Q.(2022) Electroacupuncture-Regulated miR-34a-3p/PDCD6 Axis Promotes Post-Spinal Cord Injury Recovery in Both In Vitro and In Vivo Settings. Journal of immunology research 2022:9329494.https://doi.org /10.1155/2022/9329494\u003c/li\u003e\n\u003cli\u003eZhang Q, Liu M, Nong H, Zhang Y, Bai Y, Liu P, Zong S, Zeng G.(2022) Total flavonoids of hawthorn leaves protect spinal motor neurons via promotion of autophagy after spinal cord injury. Frontiers in pharmacology 13:925568.https://doi.org /10.3389/fphar.2022.925568\u003c/li\u003e\n\u003cli\u003eFei M, Li Z, Cao Y, Jiang C, Lin H, Chen Z.(2021) MicroRNA-182 improves spinal cord injury in mice by modulating apoptosis and the inflammatory response via IKK\u0026beta;/NF-\u0026kappa;B. Laboratory investigation; a journal of technical methods and pathology 101:1238-53.https://doi.org /10.1038/s41374-021-00606-5\u003c/li\u003e\n\u003cli\u003eXiao S, Zhang Y, Liu Z, Li A, Tong W, Xiong X, Nie J, Zhong N, Zhu G, Liu J, Liu Z.(2023) Alpinetin inhibits neuroinflammation and neuronal apoptosis via targeting the JAK2/STAT3 signaling pathway in spinal cord injury. CNS neuroscience \u0026amp; therapeutics 29:1094-108.https://doi.org /10.1111/cns.14085\u003c/li\u003e\n\u003cli\u003eGuo S, Chen J, Yang Y, Li X, Tang Y, Gui Y, Chen J, Xu J.(2023) Electroacupuncture-Modulated MiR-106b-5p Expression Enhances Autophagy by Targeting Beclin-1 to Promote Motor Function Recovery After Spinal Cord Injury in Rats. Neurospine 20:1011-27.https://doi.org /10.14245/ns.2346446.223\u003c/li\u003e\n\u003cli\u003eGu Y, Chen D, Zhou L, Zhao X, Lin J, Lin B, Lin T, Chen Z, Chen Z, Wang Z, Liu W.(2021) Lysine-specific demethylase 1 inhibition enhances autophagy and attenuates early-stage post-spinal cord injury apoptosis. Cell death discovery 7:69.https://doi.org /10.1038/s41420-021-00455-7\u003c/li\u003e\n\u003cli\u003eHongna Y, Hongzhao T, Quan L, Delin F, Guijun L, Xiaolin L, Fulin G, Zhongren S.(2020) Jia-Ji Electro-Acupuncture Improves Locomotor Function With Spinal Cord Injury by Regulation of Autophagy Flux and Inhibition of Necroptosis. Frontiers in neuroscience 14:616864.https://doi.org /10.3389/fnins.2020.616864\u003c/li\u003e\n\u003cli\u003eChen Z, Li Z, Jiang C, Jiang X, Zhang J.(2019) MiR-92b-3p promotes neurite growth and functional recovery via the PTEN/AKT pathway in acute spinal cord injury. Journal of cellular physiology 234:23043-52.https://doi.org /10.1002/jcp.28864\u003c/li\u003e\n\u003cli\u003eSaraswat Ohri S, Bankston AN, Mullins SA, Liu Y, Andres KR, Beare JE, Howard RM, Burke DA, Riegler AS, Smith AE, Hetman M, Whittemore SR.(2018) Blocking Autophagy in Oligodendrocytes Limits Functional Recovery after Spinal Cord Injury. The Journal of neuroscience : the official journal of the Society for Neuroscience 38:5900-12.https://doi.org /10.1523/jneurosci.0679-17.2018\u003c/li\u003e\n\u003cli\u003eGuan C, Luan L, Li J, Yang L.(2021) MiR-212-3p improves rat functional recovery and inhibits neurocyte apoptosis in spinal cord injury models via PTEN downregulation-mediated activation of AKT/mTOR pathway. Brain research 1768:147576.https://doi.org /10.1016/j.brainres.2021.147576\u003c/li\u003e\n\u003cli\u003eShen LM, Song ZW, Hua Y, Chao X, Liu JB.(2017) miR-181d-5p promotes neurite outgrowth in PC12 Cells via PI3K/Akt pathway. CNS neuroscience \u0026amp; therapeutics 23:894-906.https://doi.org /10.1111/cns.12761\u003c/li\u003e\n\u003cli\u003eDing SQ, Chen J, Wang SN, Duan FX, Chen YQ, Shi YJ, Hu JG, L\u0026uuml; HZ.(2019) Identification of serum exosomal microRNAs in acute spinal cord injured rats. Experimental biology and medicine (Maywood, NJ) 244:1149-61.https://doi.org /10.1177/1535370219872759\u003c/li\u003e\n\u003cli\u003eAn Y, Li J, Yuan Q, Fan M.(2020) MicroRNA-466c-3p exerts protective effect on neuronal apoptosis and improves functional recovery post spinal cord injury via mitochondrial apoptotic pathway. AMB Express 10:113.https://doi.org /10.1186/s13568-020-01033-3\u003c/li\u003e\n\u003cli\u003eZhang C, Wang MM, Zhang Y, Yang L, Zhu MS, Dong QR.(2019) Downregulation of miRNA-127-5p aggravates spinal cord injury through activating MAPK1. European review for medical and pharmacological sciences 23:10617-22.https://doi.org /10.26355/eurrev_201912_19757\u003c/li\u003e\n\u003cli\u003eChen JM, Li XL, Pan QH, Yang Y, Xu SM, Xu JW.(2023) Effects of non-invasive brain stimulation on motor function after spinal cord injury: a systematic review and meta-analysis. Journal of neuroengineering and rehabilitation 20:3.https://doi.org /10.1186/s12984-023-01129-4\u003c/li\u003e\n\u003cli\u003eEvans NH, Field-Fote EC.(2022) A Pilot Study of Intensive Locomotor-Related Skill Training and Transcranial Direct Current Stimulation in Chronic Spinal Cord Injury. Journal of neurologic physical therapy : JNPT 46:281-92.https://doi.org /10.1097/npt.0000000000000403\u003c/li\u003e\n\u003cli\u003eGunduz A, Rothwell J, Vidal J, Kumru H.(2017) Non-invasive brain stimulation to promote motor and functional recovery following spinal cord injury. Neural regeneration research 12:1933-8.https://doi.org /10.4103/1673-5374.221143\u003c/li\u003e\n\u003cli\u003eZhang KY, Rui G, Zhang JP, Guo L, An GZ, Lin JJ, He W, Ding GR.(2020) Cathodal tDCS exerts neuroprotective effect in rat brain after acute ischemic stroke. BMC neuroscience 21:21.https://doi.org /10.1186/s12868-020-00570-8\u003c/li\u003e\n\u003cli\u003eGuo T, Fang J, Tong ZY, He S, Luo Y.(2020) Transcranial Direct Current Stimulation Ameliorates Cognitive Impairment via Modulating Oxidative Stress, Inflammation, and Autophagy in a Rat Model of Vascular Dementia. Frontiers in neuroscience 14:28.https://doi.org /10.3389/fnins.2020.00028\u003c/li\u003e\n\u003cli\u003eZhou Y, Su P, Pan Z, Liu D, Niu Y, Zhu W, Yao P, Song Y, Sun Y.(2019) Combination Therapy With Hyperbaric Oxygen and Erythropoietin Inhibits Neuronal Apoptosis and Improves Recovery in Rats With Spinal Cord Injury. Physical therapy 99:1679-89.https://doi.org /10.1093/ptj/pzz125\u003c/li\u003e\n\u003cli\u003eHart CG, Dyck SM, Kataria H, Alizadeh A, Nagakannan P, Thliveris JA, Eftekharpour E, Karimi-Abdolrezaee S.(2020) Acute upregulation of bone morphogenetic protein-4 regulates endogenous cell response and promotes cell death in spinal cord injury. Experimental neurology 325:113163.https://doi.org /10.1016/j.expneurol.2019.113163\u003c/li\u003e\n\u003cli\u003eYao L, Guo Y, Wang L, Li G, Qian X, Zhang J, Liu H, Liu G.(2021) Knockdown of miR-130a-3p alleviates spinal cord injury induced neuropathic pain by activating IGF-1/IGF-1R pathway. Journal of neuroimmunology 351:577458.https://doi.org /10.1016/j.jneuroim.2020.577458\u003c/li\u003e\n\u003cli\u003eBasso DM, Beattie MS, Bresnahan JC.(1995) A sensitive and reliable locomotor rating scale for open field testing in rats. Journal of neurotrauma 12:1-21.https://doi.org /10.1089/neu.1995.12.1\u003c/li\u003e\n\u003cli\u003eSmith RR, Burke DA, Baldini AD, Shum-Siu A, Baltzley R, Bunger M, Magnuson DS.(2006) The Louisville Swim Scale: a novel assessment of hindlimb function following spinal cord injury in adult rats. Journal of neurotrauma 23:1654-70.https://doi.org /10.1089/neu.2006.23.1654\u003c/li\u003e\n\u003cli\u003ePark G, Suh JH, Han SJ.(2021) Transcranial direct current stimulation for balance and gait in repetitive mild traumatic brain injury in rats. BMC neuroscience 22:26.https://doi.org /10.1186/s12868-021-00633-4\u003c/li\u003e\n\u003cli\u003eMalinova V, Bleuel K, Stadelmann C, Iliev B, Tsogkas I, Psychogios MN, Rohde V, Mielke D.(2021) The impact of transcranial direct current stimulation on cerebral vasospasm in a rat model of subarachnoid hemorrhage. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism 41:2000-9.https://doi.org /10.1177/0271678x21990130\u003c/li\u003e\n\u003cli\u003eHassanzahraee M, Nitsche MA, Zoghi M, Jaberzadeh S.(2020) Determination of anodal tDCS intensity threshold for reversal of corticospinal excitability: an investigation for induction of counter-regulatory mechanisms. Scientific reports 10:16108.https://doi.org /10.1038/s41598-020-72909-4\u003c/li\u003e\n\u003cli\u003eLopes BC, Medeiros LF, Stein DJ, Cioato SG, de Souza VS, Medeiros HR, Sanches PRS, Fregni F, Caumo W, Torres ILS.(2021) tDCS and exercise improve anxiety-like behavior and locomotion in chronic pain rats via modulation of neurotrophins and inflammatory mediators. Behavioural brain research 404:113173.https://doi.org /10.1016/j.bbr.2021.113173\u003c/li\u003e\n\u003cli\u003eLi HT, Zhao XZ, Zhang XR, Li G, Jia ZQ, Sun P, Wang JQ, Fan ZK, Lv G.(2016) Exendin-4 Enhances Motor Function Recovery via Promotion of Autophagy and Inhibition of Neuronal Apoptosis After Spinal Cord Injury in Rats. Molecular neurobiology 53:4073-82.https://doi.org /10.1007/s12035-015-9327-7\u003c/li\u003e\n\u003cli\u003eSantos DS, Lopes BC, Medeiros LF, Assump\u0026ccedil;\u0026atilde;o JAF, de Souza A, Salvi AA, da Silva LS, Fregni F, Caumo W, Torres ILS.(2020) Transcranial Direct Current Stimulation (tDCS) Induces Analgesia in Rats with Neuropathic Pain and Alcohol Abstinence. Neurochemical research 45:2653-63.https://doi.org /10.1007/s11064-020-03116-w\u003c/li\u003e\n\u003cli\u003eLongo L, de Souza VEG, Stein DJ, de Freitas JS, Uribe-Cruz C, Torres ILS, \u0026Aacute;lvares-da-Silva MR.(2021) Transcranial direct current stimulation (tDCS) has beneficial effects on liver lipid accumulation and hepatic inflammatory parameters in obese rats. Scientific reports 11:11037.https://doi.org /10.1038/s41598-021-90563-2\u003c/li\u003e\n\u003cli\u003eZhang HH, Hu J, Zhou YL, Qin X, Song ZY, Yang PP, Hu S, Jiang X, Xu GY.(2015) Promoted Interaction of Nuclear Factor-\u0026kappa;B With Demethylated Purinergic P2X3 Receptor Gene Contributes to Neuropathic Pain in Rats With Diabetes. Diabetes 64:4272-84.https://doi.org /10.2337/db15-0138\u003c/li\u003e\n\u003cli\u003eChen F, Li X, Li Z, Qiang Z, Ma H.(2020) Altered expression of MiR-186-5p and its target genes after spinal cord ischemia-reperfusion injury in rats. Neuroscience letters 718:134669.https://doi.org /10.1016/j.neulet.2019.134669\u003c/li\u003e\n\u003cli\u003ePan Z, Shan Q, Gu P, Wang XM, Tai LW, Sun M, Luo X, Sun L, Cheung CW.(2018) miRNA-23a/CXCR4 regulates neuropathic pain via directly targeting TXNIP/NLRP3 inflammasome axis. Journal of neuroinflammation 15:29.https://doi.org /10.1186/s12974-018-1073-0\u003c/li\u003e\n\u003cli\u003eSong W, Amer A, Ryan D, Martin JH.(2016) Combined motor cortex and spinal cord neuromodulation promotes corticospinal system functional and structural plasticity and motor function after injury. Experimental neurology 277:46-57.https://doi.org /10.1016/j.expneurol.2015.12.008\u003c/li\u003e\n\u003cli\u003eZhang XM, Zeng LN, Yang WY, Ding L, Chen KZ, Fu WJ, Zeng SQ, Liang YR, Chen GH, Wu HF.(2022) Inhibition of LncRNA Vof-16 expression promotes nerve regeneration and functional recovery after spinal cord injury. Neural regeneration research 17:217-27.https://doi.org /10.4103/1673-5374.314322\u003c/li\u003e\n\u003cli\u003eWang Y, Xiong M, Wang M, Chen H, Li W, Zhou X.(2021) Quercetin promotes locomotor function recovery and axonal regeneration through induction of autophagy after spinal cord injury. Clinical and experimental pharmacology \u0026amp; physiology 48:1642-52.https://doi.org /10.1111/1440-1681.13573\u003c/li\u003e\n\u003cli\u003eLiu J, Wu Y.(2017) Electro-acupuncture-modulated miR-214 prevents neuronal apoptosis by targeting Bax and inhibits sodium channel Nav1.3 expression in rats after spinal cord injury. Biomedicine \u0026amp; pharmacotherapy = Biomedecine \u0026amp; pharmacotherapie 89:1125-35.https://doi.org /10.1016/j.biopha.2017.02.077\u003c/li\u003e\n\u003cli\u003eZou T, Zhang J, Liu Y, Zhang Y, Sugimoto K, Mei C.(2020) Antidepressant-Like Effect of Geniposide in Mice Exposed to a Chronic Mild Stress Involves the microRNA-298-5p-Mediated Nox1. Frontiers in molecular neuroscience 13:131.https://doi.org /10.3389/fnmol.2020.00131\u003c/li\u003e\n\u003cli\u003eWei X, Xu S, Chen L.(2021) LncRNA Neat1/miR-298-5p/Srpk1 Contributes to Sevoflurane-Induced Neurotoxicity. Neurochemical research 46:3356-64.https://doi.org /10.1007/s11064-021-03436-5\u003c/li\u003e\n\u003cli\u003eLi X, Lou X, Xu S, Wang Q, Shen M, Miao J.(2018) Knockdown of miR-372 Inhibits Nerve Cell Apoptosis Induced by Spinal Cord Ischemia/Reperfusion Injury via Enhancing Autophagy by Up-regulating Beclin-1. Journal of molecular neuroscience : MN 66:437-44.https://doi.org /10.1007/s12031-018-1179-y\u003c/li\u003e\n\u003cli\u003eFirat T, Kukner A, Ayturk N, Gezici AR, Serin E, Ozogul C, Tore F.(2021) The Potential Therapeutic Effects of Agmatine, Methylprednisolone, and Rapamycin on Experimental Spinal Cord Injury. Cell journal 23:701-7.https://doi.org /10.22074/cellj.2021.7198\u003c/li\u003e\n\u003cli\u003eZhu Y, Zhao H, Zhang W, Ma X, Liu Y.(2021) Dexmedetomidine attenuates neuronal injury induced by cerebral ischemia‑reperfusion by regulating miR‑199a. Molecular medicine reports 24:/10.3892/mmr.2021.12213\u003c/li\u003e\n\u003cli\u003eShao S, Xu CB, Chen CJ, Shi GN, Guo QL, Zhou Y, Wei YZ, Wu L, Shi JG, Zhang TT.(2021) Divanillyl sulfone suppresses NLRP3 inflammasome activation via inducing mitophagy to ameliorate chronic neuropathic pain in mice. Journal of neuroinflammation 18:142.https://doi.org /10.1186/s12974-021-02178-z\u003c/li\u003e\n\u003cli\u003eLi K, Deng Y, Deng G, Chen P, Wang Y, Wu H, Ji Z, Yao Z, Zhang X, Yu B, Zhang K.(2020) High cholesterol induces apoptosis and autophagy through the ROS-activated AKT/FOXO1 pathway in tendon-derived stem cells. Stem cell research \u0026amp; therapy 11:131.https://doi.org /10.1186/s13287-020-01643-5\u003c/li\u003e\n\u003cli\u003eSun X, Huang LY, Pan HX, Li LJ, Wang L, Pei GQ, Wang Y, Zhang Q, Cheng HX, He CQ, Wei Q.(2023) Bone marrow mesenchymal stem cells and exercise restore motor function following spinal cord injury by activating PI3K/AKT/mTOR pathway. Neural regeneration research 18:1067-75.https://doi.org /10.4103/1673-5374.355762\u003c/li\u003e\n\u003cli\u003eLoy K, Bareyre FM.(2019) Rehabilitation following spinal cord injury: how animal models can help our understanding of exercise-induced neuroplasticity. Neural regeneration research 14:405-12.https://doi.org /10.4103/1673-5374.245951\u003c/li\u003e\n\u003cli\u003eKazim SF, Bowers CA, Cole CD, Varela S, Karimov Z, Martinez E, Ogulnick JV, Schmidt MH.(2021) Corticospinal Motor Circuit Plasticity After Spinal Cord Injury: Harnessing Neuroplasticity to Improve Functional Outcomes. Molecular neurobiology 58:5494-516.https://doi.org /10.1007/s12035-021-02484-w\u003c/li\u003e\n\u003cli\u003eZhou X, Du J, Qing L, Mee T, Xu X, Wang Z, Xu C, Jia X.(2021) Identification of sensory and motor nerve fascicles by immunofluorescence staining after peripheral nerve injury. Journal of translational medicine 19:207.https://doi.org /10.1186/s12967-021-02871-w\u003c/li\u003e\n\u003cli\u003eLi X, Luo D, Hou Y, Hou Y, Chen S, Zhan J, Luan J, Wang L, Lin D.(2020) Sodium Tanshinone IIA Silate Exerts Microcirculation Protective Effects against Spinal Cord Injury In Vitro and In Vivo. Oxidative medicine and cellular longevity 2020:3949575.https://doi.org /10.1155/2020/3949575\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Spinal cord injury, transcranial direct current stimulation, motor cortex, autophagy, apoptosis, neuroprotection, motor function recovery","lastPublishedDoi":"10.21203/rs.3.rs-4355457/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4355457/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eWhile transcranial direct current stimulation (tDCS) has been shown to contribute to motor recovery after spinal cord injury (SCI), the underlying mechanisms behind this process remain unclear. In the present study, we sought to explore whether tDCS can inhibit apoptosis, activate autophagy, and promote functional recovery. To achieve this aim, SCI was induced in rats using a modified Allen\u0026rsquo;s method and managed with tDCS. MicroRNAs responding to tDCS administration were detected using microRNA sequencing and validated using a quantitative real-time polymerase chain reaction. Dual-luciferase reporter analysis and miRNA overexpression were applied to verify the possible mechanisms of tDCS regulation. Stimulation of PC12 cells with hydrogen peroxide (H2O2) to simulate SCI models in vitro allowed for the detection of the effect of miR-298-5p on neuronal apoptosis and autophagy induced by SCI. The findings revealed that miR-298-5p was upregulated after SCI and decreased after tDCS. In vitro, miR-298-5p silencing was found to promote autophagy and reduce apoptosis in SCI, whereas miR-298-5p overexpression was associated with enhanced SCI-induced neuronal injury. LC3 was demonstrated to be the functional target of miR-298-5p, and tDCS was found to enhance autophagy flux, reduce neuronal apoptosis, improve nerve fiber regeneration, and minimize motor deficits after SCI in vivo. However, all tDCS-induced effects were counteracted after overexpression of miR-298-5p by agomir. In conclusion, this study shows that while miR-298-5p could be detrimental to SCI, tDCS can increase autophagy flux and inhibit neuronal apoptosis by negatively regulating miR-98-5p, thereby improving the recovery of motor function in SCI.\u003c/p\u003e","manuscriptTitle":"Transcranial direct current stimulation-mediated miR-298-5p downregulation enhances autophagy by targeting LC3 to promote motor recovery after spinal cord injury","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-20 07:38:29","doi":"10.21203/rs.3.rs-4355457/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b520aa47-a426-439b-8c9a-2e028826c72f","owner":[],"postedDate":"May 20th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-02T15:08:34+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-20 07:38:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4355457","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4355457","identity":"rs-4355457","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.