CTSC promotes tumorigenesis in bladder cancer by activating Wnt/β-Catenin signaling

CTSC promotes tumorigenesis in bladder cancer by activating Wnt/β-Catenin signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article CTSC promotes tumorigenesis in bladder cancer by activating Wnt/β-Catenin signaling Xinsheng Wang, Yong Jia, Dawen Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4389779/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Cathepsin C (CTSC) participates in the development of numerous cancers. The function of bladder cancer (BCa) is still largely unknown. Bioinformatics prediction, RT-qPCR assay, and Western blotting assay determined the level of expression of CTSC in BCa tissues, para-cancer tissues, BCa cells, and normal uroepithelial cells (SV-HUC-1). Colony formation assay, CCK-8 assay, and Transwell assay were utilized to ascertain the involvement of CTSC in BCa. In addition, the effect of CTSC on BCa was further studied by animal experiments in vivo. The findings affirmed that CTSC exhibited a heightened expression level in BCa cells and tissues, and the overexpression of CTSC substantially enhanced the activity, proliferation, migration, and invasion of BCa cells, while suppression of CTSC repressed the above biological phenotypes. CTSC could both activate the Wnt/β-Catenin signaling pathway and up-regulate DIAPH3 expression. Overexpression of CTSC combined with knockdown of DIAPH3 could partially reverse the impact of CTSC on the biological behavior of BCa cells and the Wnt/β-Catenin signaling pathway activation. CTSC could up-regulate DIAPH3 and activate the aforementioned pathway to enhance the activity, proliferation, migration, and invasion of cells from BCa. CTSC bladder cancer Wnt/β-Catenin signaling pathway DIAPH3 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction A prevalent tumor that affects the urology system, bladder cancer (BCa), in recent years, gradually tends to be younger and the incidence is rising (Miller et al. 2022 ). The prognosis of patients is poor due to the tendency of metastasis and recurrence after clinical treatment (Powles et al. 2022 ; Borhani et al. 2022 ). Consequently, an expedition is needed to conduct a thorough investigation of the molecular process underlying the onset and progression of BCa, to provide powerful clues for the early diagnosis or to explore novel targets for the therapeutic management of BCa. Cathepsins are a vast class of proteolytic proteases markedly expressed in lysosomes. So far, at least 20 kinds of cathepsins have been found to exhibit 11 kinds of human cathepsins (cathepsin B, C, F, H, K, L, O, S, V, W, and X)(Turk et al. 2001 ). Cathepsin C (CTSC), also denoted as the dipeptide base peptidase I (DPPI), belongs to the cysteine protease categories of organization, and its main physiological function is to promote inflammatory response by activating pro-inflammatory granule-associated serine proteases(Guay et al. 2010 ). More data has emerged recently affirming that CTSC expresses a remarkable function in the occurrence and development of tumors. Growing evidence has implied that the expression level of CTSC in several tissues and cells gleaned from tumors is different from that in normal adjacent tissues and cells, and its mechanism of action is markedly linked to the occurrence, development, metastasis, and recurrence of cancers, including breast cancer(Xiao et al. 2021 ), colorectal cancer(Dang et al. 2023 ), glioma(Cheng et al. 2022 ; Li et al. 2024 ), and hepatocellular carcinoma(Zhang et al. 2020 ). Pharmacological suppression of CTSC is considered a possible strategy in cancer treatment(Abideen et al. 2022 ). In 2024, the latest research found that CTSC could promote tumor development in non-small cell lung cancer by activating the Yes-associated protein signaling pathway(Kim et al. 2024 ). Although CTSC acts as an oncogene in several cancers, howeverthe study of CTSC in BCa is rare, and its function is unknown. This study explores the CTSC expression level in BCa and the impact on BCa cell proliferation, migration, and invasion, and further studies the molecular mechanism of CTSC may play a role, to provide more basis for BCa pathogenesis research. 2. Materials and methods 2.1. Clinical samples Thirty paired BCa tissues and corresponding para-cancerous tissues were obtained from patients admitted to Tianjin First Central Hospital from January 2021 to January 2023. All of them were diagnosed by pathological diagnosis. The patients were not subjected to anti-tumor treatment like radiotherapy, chemotherapy, immunotherapy, and other malignant tumors before surgery. All the patients and their families provided informed consent which was signed. 2.2 Cell culture The Chinese Academy of Sciences (Shanghai, China) supplied human normal urinary tract epithelial cells (SV-HUC-1) and BCa cells (UMUC3, J82, 5637, and T24). SV-HUC-1 was cultured in Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM-F12) medium (Solarbio, Beijing, China) containing fetal bovine serum (FBS; Gibco, Carlsbad, USA) and 1% Penicillin-Streptomycin (Solarbio, Beijing, China), and BCa cells (T24, J82,5637, and UMUC3) were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Solarbio, Beijing, China) supplemented with 10% FBS and 1% Penicillin-Streptomycin with 37℃ and 5% CO 2 . 2.3. Plasmid construction and cell transfection The CTSC gene was synthesized by Anhui General Biological Company and cloned into the pcDNA3 vector to obtain pcDNA3-CTSC (CTSC). Construction of CTSC knockdown plasmid, CTSC forward and reverse sequence (shR-CTSC sense: 5'-GATCCG CAGGAAAGTACGCCCAAGATCTCGAGATCTTGGGCGTACTTTCCTGCTTTTTGA-3'; shR-CTSC antisense: 5'-AGCTTCAAAAAGCAGGAAAGTA CGCCCAAG ATCTCGAGATCTTGGGCGTACTTTCCTGCG-3') were synthesized by Anhui General Biological Company. The annealed product was cloned into pSilencer 2.1neo, generating pshR-CTSC. Construction of DIAPH3 knockdown plasmid, DIAPH3 forward and reverse sequence (shR-DIAPH3 sense: 5'-GATCCGTGACAAAGA TGTCCAGATTTCTCGAGAAATCTGGACATCTTTGTCACTTTTTGA-3'; shR-DIAPH3 antisense: 5'-AGCTTCAAAAAGTGACAAAGATGTCCAGATTTCTCGA GAAATCTGGACATCTTTGTCACG-3') were synthesized and annealed, then the product was cloned into pSilencer 2.1neo, generating pshR-DIAPH3. J82 and T24 cells in the logarithmic phase were collected, digested utilizing trypsin, and seeded in 6-well plates at 5×10 5 /well. Transfection was executed as per the instructions of the Lipofectamine™ 3000 kit (Invitrogen, USA) when the cell growth and fusion attained 80%. 2.4. Quantitative reverse transcription polymerase chain reaction (RT-qPCR) The Trizol method extracted total RNA from the cells and tissues with BCa and then reverse-transcribed into cDNA. The PCR reaction system was configured and RT-qPCR was performed. GAPDH was utilized as an internal control, and the 2 −△△Ct method was utilized to calculate the relative expressions of target genes. The primer sequences are as follows: CTSC: an upstream primer: 5'-TTACTGCAACGAGACAATGACTG-3', a downstream primer: 5'-AGGTGTGCTGTGTTGACATAC-3'; DIAPH3: an upstream primer: 5'-TGCAAGTAGCTTGTATGCAGC-3', a downstream primer: 5'-GGCGATG GGATAACTCAAACA-3'; GAPDH: upstream primer: 5'- ACAACCGTGCGTCTGA TTTC-3', downstream primer: 5'- AGCCTTCATGCACAGTGTTC-3'. 2.5. CCK-8 Transfected cells in each group were prepared into a cell suspension and seeded in a 96-well plate at 2×10 5 cells per milliliter for each well, and there were 3 multiple wells in each group. Then, 10 µl CCK-8 solution was introduced into every well and incubated in the dark for a duration of 2 h, and the absorbance value (A value) was detected at 450 nm by a microplate reader. 2.6. Colony formation assay A density of 350 cells/well was adopted to seed the transfected BCa cells in 6-well plates after preparation. At the end of 2 weeks (14 days) of culture, the medium was removed, The cells were fixed utilizing a 4% paraformaldehyde for ½ h. and stained utilizing a 0.4% crystal violet for ¼ h. The cell clones were visualized via a microscope and photographed. 2.7. Transwell assay For cell invasion assay, Matrigel underwent dilution utilizing a precooled RPMI1640 medium at a ratio of 1:8, and 100 µL was introduced into the Transwell chamber on the upper chamber portion. The transfected cells were diluted into a cell density of 1×10 6 cell/mL, and this was followed by an introduction of a suspension of 200 µL cells into the aforementioned upper chamber. Then, 600 µL RPMI1640 with 20% FBS was added to the bottom. Cells were continued to be cultured for 48 h and a 4% paraformaldehyde was utilized to fix them for 20 min. Then, they were stained utilizing crystal violet, washed, and dried. A microscope photographed the cells and the quantity of transmembrane cells was tallied. The Transwell chamber was not utilized together with Matrigel gel for cell migration assays, and the remaining steps were identical to those in the cell invasion assay, and the experiment was triplicated. 2.8. Western blotting analysis Lysis of the samples was executed utilizing the RIPA-enriched with phosphatase inhibitors at 4°C for 20 min, and centrifugation was performed to collect the supernatant. SDS-PAGE separated proteins and then changed to a PVDF membrane. The membrane was blocked utilizing 5% skim milk at room temperature (RT). The primary antibody was introduced and incubated overnight at 4°C. On the other hand, the secondary antibody was introduced and incubated at RT for 1 h on the following day. The proteins were probed by the ECL chemiluminescence method, and Image J software examined the protein gray value. 2.9. Statistical analysis SPSS 26. 0 statistical software and Student’s t-test executed statistical analysis and the data difference assessment between the two groups, respectively. P < 0. 05 connoted statistical significance. 3. Results 3.1. CTSC was upregulated in BCa and linked to poor prognosis To determine the function of CTSC in BCa, we first analyzed the mRNA levels of CTSC in bladder urothelial carcinoma (BLCA) tissues and normal tissues in The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) databases, and the findings inferred that the expression level of CTSC in BLCA tissues was markedly higher than that in adjacent normal tissues (Fig. 1 A). In addition, we also affirmed that BLCA patients with enhanced CTSC expression had a remarkably lesser overall survival in comparison to those with low CTSC expression (Fig. 1 B). To confirm the aforementioned analysis findings, we evaluated the expression of CTSC in 30 BCa tissues and adjacent tissues. The findings of RT-qPCR implied a substantial expression level of CTSC in BCa tissues than adjacent normal tissues (Fig. 1 C), which was in line with the prediction of bioinformatics. The findings of Western blot deduced that the expression level of CTSC in tissues obtained from BCa was greater than those of normal bladder tissues (Fig. 1 D). Finally, we explored the expression levels of CTSC in normal bladder epithelial cells alongside four distinct BCa cells. Our analysis affirmed a remarkable elevation in the expression levels of CTSC in BCa cells in comparison to normal bladder cells (Fig. 1 E). 3.2. CTSC acted as an oncogene in vitro and in vivo To delve further into the mechanisms of CTSC, we evaluated the impact of altered CTSC expression on BCa cells via colony formation assay, CCK-8, and Transwell migration and invasion assay. In comparison to the control group, the findings inferred that overexpression of CTSC markedly enhanced the colony formation capacity, cell viability, Transwell migration, and invasion ability of BCa cells (Fig. 2 A – 2 E). When CTSC was knockdown, on the contrary, we found that BCa cell activity and colony formation capability, Transwell migration, and invasion ability significantly declined (Fig. 2 A – 2 E). In addition, we analyzed the impact of CTSC overexpression on the tumorigenic potential of J82 cells in nude mice. The findings implied that CTSC overexpression significantly enhanced the tumorigenic capability of J82 cells in vivo, with a remarkable increase in tumor volume as well as weight (Fig. 3 A – 3 C). The results suggested that CTSC may exhibit a certain function in promoting BCa progression. 3.3. CTSC activated Wnt/β-Catenin signaling in BCa cells To examine the molecular mechanisms of CTSC, we performed GSEA analysis using the TCGA database, the findings affirmed a remarkable level of CTSC that was positively linked to an enrichment of Wnt/β - Catenin signaling pathway (Fig. 4 A). To demonstrate the link between CTSC and the above signaling pathway, the levels of proteins with key molecules in this pathway were ascertained by Western blotting analysis after overexpression or knockdown of CTSC. The findings implied that overexpression of CTSC markedly heightened the level of β-Catenin while repressing its phosphorylated form. Additionally, the knockdown of CTSC reduced β-Catenin levels but increased p-β-Catenin levels (Fig. 4 B- 4 E). These findings suggested that Wnt/β-Catenin signaling was activated by CTSC in BCa cells. 3.4. In BCa cells, CTSC increased the expression of DIAPH3 Our experiments demonstrated for the first time that CTSC can activate Wnt/β-Catenin signaling, but the molecular mechanism remains unclear. To further investigate the molecular mechanism, we analyzed the genes associated with CTSC expression in the TCGA database, and DIAPH3, a gene positively correlated with CTSC, was selected for further study (Fig. 5 A). DIAPH3 has been shown to be involved in HCC progression by blocking the interaction between GSK3β and HSP90, thus activating Wnt/β - Catenin signaling (Dong et al. 2018 ). TCGA database analysis inferred that the level of DIAPH3 in BCa expression was markedly heightened than that in adjacent normal tissues, and the survival time of patients with BCa with high DIAPH3 expression was markedly shorter than those with low DIAPH3 expression (Fig. 5 B and 5 C). We further confirmed that DIAPH3 was substantially expressed in the tumor tissues of BCa patients by detecting 30 clinical specimens, and verified that CTSC was positively correlated with DIAPH3 expression (Fig. 5 D and 5 E). Moreover, we overexpressed or knocked down CTSC in BCa cells, and Western blotting results confirmed that CTSC positively regulated DIAPH3 expression (Fig. 5 F and 5 G). 3.5. In BCa cells, CTSC upregulated DIAPH3 to activate Wnt/β-Catenin signaling Although our demonstrations that CTSC can activate Wnt/β-Catenin signaling and positively regulate DIAPH3 expression, whether the up-regulation of DIAPH3 expression by CTSC was related to Wnt/β-Catenin signaling activation was still unknown. To prove our hypothesis, we demonstrated that CTSC overexpression could significantly enhance cell viability, proliferation, migration, and invasion, while co-transfection of CTSC overexpression and DIAPH3 knockdown plasmids significantly thwarted the effects produced by CTSC expression (Fig. 6A-6C). In addition, Western blot studies showed that DIAPH3 knockdown could also counteract the activation of Wnt/β-Catenin signaling activated by CTSC (Fig. 6D-6H). The above results implied that CTSC activated Wnt/β-Catenin signaling via DIAPH3-mediated molecular mechanism in BCa. 4. Discussion Recently, the incidence of BCa has gradually increased with high metastasis and recurrence rates(Jin et al. 2022 ; Pietzak et al. 2017 ). In addition, there is still a dearth of effective targets as well as markers for clinical diagnosis and treatment, and the prognosis is unsatisfactory (Bruchbacher et al. 2018 ). As a result, it is paramount to provide accurate biomarkers for BCa early diagnosis and potential targets for therapy drugs or to elucidate the molecular mechanism of key genes affecting the pathogenesis of BCa. At first, the main role of CTSC is to degrade unwanted proteins in cells and activate serine proteases in immune and inflammatory cells(Reiser et al. 2010 ). Recent studies affirmed that CTSC functions in a variety of diseases, including the ctsc gene locus mutation in recessive hereditary diseases as usual chromosome Papillon-Lefèvre syndrome(Nagy et al. 2014 ; Sanchez Klose et al. 2021 ), nerve inflammation reaction process(Liu et al. 2019 ), malignant tumors(Korkmaz et al. 2021 ), etc. Herein, we ascertained that CTSC was expressed at a high level in BCa and linked to poor prognosis. We performed in vitro and in vivo functional studies on the role of CTSC in BCa. In vitro, overexpression of CTSC amplified the proliferation, migration, and invasion of BCa cells, whereas impeding of CTSC expression showed a tendency towards inhibition. In vivo experiments also confirmed the function of CTSC in promoting tumor formation. Our results show that CTSC plays an oncogene role in BCa, which is consistent with the function of CTSC in tumors reported in literature(Kim et al. 2024 ; Li et al. 2024 ; Zhang et al. 2020 ). However, the molecular mechanism of CTSC promoting tumors may have new regulatory pathways that have not yet been found in BCa. In terms of regulatory mechanisms, it has been reported that CTSC causes immune evasion by upregulating CSF1, and then promotes the metastasis of colorectal cancer(Dang et al. 2023 ). In addition, CTSC promotes breast cancer to lung metastasis by regulating the PR3-IL-1β axis(Xiao et al. 2021 ). Li et al. inferred that CTSC promotes the proliferation as well as metastasis of hepatocellular carcinoma via interacting with the TNF-α/p38 MAPK signaling pathway(Zhang et al. 2020 ). However, our study found that CTSC can activate the Wnt/β-catenin signaling pathway by upregulating DIAPH3. The activation and shutdown of this pathway participate in the modulation of tumorigenesis and cell proliferation (Yu et al. 2021 ; He and Tang 2020 ). According to recent studies, activation of the Wnt/β-catenin signaling pathway is demonstrated in lots of malignancies including colorectal cancer(Zhao et al. 2022 ), breast cancer(Xu et al. 2020 ), BCa(Katoh 2018 ), etc. Currently, the molecular mechanism by which CTSC can activate the Wnt/β-Catenin signaling pathway is not well understood, however, our findings provide an explanation for this mechanism. We have found that CTSC may lead to the Wnt/β-Catenin signaling pathway activation by promoting DIAPH3 expression. Since reports have shown that DIAPH3 can interact with GSK3β and HSP90 to activate Wnt/β-Catenin signaling(Dong et al. 2018 ), our conclusions provide a preliminary explanation of the molecular mechanism why CTSC can activate the Wnt/β-Catenin signaling pathway, making our results and findings more reliable At present, our study has certain limitations, such as the molecular mechanism underlying upregulation of DIAPH3 by CTSC is unknown. Therefore, I think it is of great significance to further study this molecular mechanism in the future research. 4. Conclusion Our study showed the oncogenic roles of CTSC in BCa. Mechanically, CTSC could upregulate DIAPH3 expression and thus leading toWnt/β-Catenin signaling pathway activation in BCa. Our findings might culminate in the development of BCa. Declarations Ethics Statement The Institutional Research Human or Animal Ethics Committee of Qingdao Municipal Hospital approved the study (Ethics No.: 15153287667). Declaration Of Competing Interest The authors declare that they have no competing interests. Funding This study was supported by the China Postdoctoral Science Foundation (Grant No.2018M640243) and the Tianjin Key Medical Discipline (Specialty) Construction Project. Author Contribution XW and DW conceived this study. XW and DW performed the experiment. XW, DW, and YJ evaluated the data. XW and DW wrote the manuscript. All authors discussed the findings and made contributions to the final manuscript. Acknowledgement None. References Abideen SA, Khan M, Al-Harbi AI, Ahmad S. Pharmacological inhibition of cathepsin C (CatC) as a potential approach for cancer therapeutics. J Biomol Struct Dyn. 2022;1–8. 10.1080/07391102.2022.2135603 . Borhani S, Borhani R, Kajdacsy-Balla A. Artificial intelligence: A promising frontier in bladder cancer diagnosis and outcome prediction. Crit Rev Oncol/Hematol. 2022;171:103601. 10.1016/j.critrevonc.2022.103601 . Bruchbacher A, Soria F, Hassler M, Shariat SF, D'Andrea D. (2018) Tissue biomarkers in nonmuscle-invasive bladder cancer: any role in clinical practice? Current opinion in urology 28 (6):584–90. 10.1097/mou.0000000000000546 . Cheng X, Ren Z, Liu Z, Sun X, Qian R, Cao C, Liu B, Wang J, Wang H, Guo Y, Gao Y. Cysteine cathepsin C: a novel potential biomarker for the diagnosis and prognosis of glioma. Cancer Cell Int. 2022;22(1):53. 10.1186/s12935-021-02417-6 . Dang YZ, Chen XJ, Yu J, Zhao SH, Cao XM, Wang Q. Cathepsin C promotes colorectal cancer metastasis by regulating immune escape through upregulating CSF1. Neoplasma. 2023;70(1):123–35. 10.4149/neo_2023_220726N757 . Dong L, Li Z, Xue L, Li G, Zhang C, Cai Z, Li H, Guo R. DIAPH3 promoted the growth, migration and metastasis of hepatocellular carcinoma cells by activating beta-catenin/TCF signaling. Mol Cell Biochem. 2018;438(1–2):183–90. 10.1007/s11010-017-3125-7 . Guay D, Beaulieu C, Percival MD. Therapeutic utility and medicinal chemistry of cathepsin C inhibitors. Curr Top Med Chem. 2010;10(7):708–16. 10.2174/156802610791113469 . He S, Tang S. WNT/β-catenin signaling in the development of liver cancers. Biomed pharmacotherapy = Biomedecine pharmacotherapie. 2020;132:110851. 10.1016/j.biopha.2020.110851 . Jin YH, Zeng XT, Liu TZ, Bai ZM, Dou ZL, Ding DG, Fan ZL, Han P, Huang YR, Huang X, Li M, Li XD, Li YN, Li XH, Liang CZ, Liu JM, Ma HS, Qi J, Shi JQ, Wang J, Wang DL, Wang ZP, Wang YY, Wang YB, Wei Q, Xia HB, Xing JC, Yan SY, Zhang XP, Zheng GY, Xing NZ, He DL, Wang XH. Treatment and surveillance for non-muscle-invasive bladder cancer: a clinical practice guideline (2021 edition). Military Med Res. 2022;9(1):44. 10.1186/s40779-022-00406-y . Katoh M. Multi–layered prevention and treatment of chronic inflammation, organ fibrosis and cancer associated with canonical WNT/β–catenin signaling activation (Review). Int J Mol Med. 2018;42(2):713–25. 10.3892/ijmm.2018.3689 . Kim N, Yeo MK, Sun P, Lee D, Kim DK, Lee SI, Chung C, Kang DH, Lee JE. Cathepsin C regulates tumor progression via the Yes-associated protein signaling pathway in non-small cell lung cancer. Am J cancer Res. 2024;14(1):97–113. Korkmaz B, Lamort AS, Domain R, Beauvillain C, Gieldon A, Yildirim A, Stathopoulos GT, Rhimi M, Jenne DE, Kettritz R. Cathepsin C inhibition as a potential treatment strategy in cancer. Biochem Pharmacol. 2021;194:114803. 10.1016/j.bcp.2021.114803 . Li Q, Wan C, Zhang Z, Liu G, Wang S. CTSC promoted the migration and invasion of glioma cells via activation of STAT3/SERPINA3 axis. Gene. 2024;893:147948. 10.1016/j.gene.2023.147948 . Liu Q, Zhang Y, Liu S, Liu Y, Yang X, Liu G, Shimizu T, Ikenaka K, Fan K, Ma J. Cathepsin C promotes microglia M1 polarization and aggravates neuroinflammation via activation of Ca(2+)-dependent PKC/p38MAPK/NF-κB pathway. J Neuroinflamm. 2019;16(1):10. 10.1186/s12974-019-1398-3 . Miller KD, Nogueira L, Devasia T, Mariotto AB, Yabroff KR, Jemal A, Kramer J, Siegel RL. (2022) Cancer treatment and survivorship statistics, 2022. CA: a cancer journal for clinicians 72 (5):409–36. 10.3322/caac.21731 . Nagy N, Vályi P, Csoma Z, Sulák A, Tripolszki K, Farkas K, Paschali E, Papp F, Tóth L, Fábos B, Kemény L, Nagy K, Széll M. CTSC and Papillon-Lefèvre syndrome: detection of recurrent mutations in Hungarian patients, a review of published variants and database update. Mol Genet Genom Med. 2014;2(3):217–28. 10.1002/mgg3.61 . Pietzak EJ, Bagrodia A, Cha EK, Drill EN, Iyer G, Isharwal S, Ostrovnaya I, Baez P, Li Q, Berger MF, Zehir A, Schultz N, Rosenberg JE, Bajorin DF, Dalbagni G, Al-Ahmadie H, Solit DB, Bochner BH. Next-generation Sequencing of Nonmuscle Invasive Bladder Cancer Reveals Potential Biomarkers and Rational Therapeutic Targets. Eur Urol. 2017;72(6):952–9. 10.1016/j.eururo.2017.05.032 . Powles T, Bellmunt J, Comperat E, De Santis M, Huddart R, Loriot Y, Necchi A, Valderrama BP, Ravaud A, Shariat SF, Szabados B, van der Heijden MS, Gillessen S. Bladder cancer: ESMO Clinical Practice Guideline for diagnosis, treatment and follow-up. Annals oncology: official J Eur Soc Med Oncol. 2022;33(3):244–58. 10.1016/j.annonc.2021.11.012 . Reiser J, Adair B, Reinheckel T. Specialized roles for cysteine cathepsins in health and disease. J Clin Investig. 2010;120(10):3421–31. 10.1172/jci42918 . Sanchez Klose FP, Björnsdottir H, Dahlstrand Rudin A, Persson T, Khamzeh A, Sundqvist M, Thorbert-Mros S, Dieckmann R, Christenson K, Bylund J. A rare CTSC mutation in Papillon-Lefèvre Syndrome results in abolished serine protease activity and reduced NET formation but otherwise normal neutrophil function. PLoS ONE. 2021;16(12):e0261724. 10.1371/journal.pone.0261724 . Turk V, Turk B, Turk D. Lysosomal cysteine proteases: facts and opportunities. EMBO J. 2001;20(17):4629–33. 10.1093/emboj/20.17.4629 . Xiao Y, Cong M, Li J, He D, Wu Q, Tian P, Wang Y, Yang S, Liang C, Liang Y, Wen J, Liu Y, Luo W, Lv X, He Y, Cheng DD, Zhou T, Zhao W, Zhang P, Zhang X, Xiao Y, Qian Y, Wang H, Gao Q, Yang QC, Yang Q, Hu G. Cathepsin C promotes breast cancer lung metastasis by modulating neutrophil infiltration and neutrophil extracellular trap formation. Cancer Cell. 2021;39(3):423–e437427. 10.1016/j.ccell.2020.12.012 . Xu X, Zhang M, Xu F, Jiang S. Wnt signaling in breast cancer: biological mechanisms, challenges and opportunities. Mol Cancer. 2020;19(1):165. 10.1186/s12943-020-01276-5 . Yu F, Yu C, Li F, Zuo Y, Wang Y, Yao L, Wu C, Wang C, Ye L. Wnt/β-catenin signaling in cancers and targeted therapies. Signal Transduct Target therapy. 2021;6(1):307. 10.1038/s41392-021-00701-5 . Zhang GP, Yue X, Li SQ. Cathepsin C Interacts with TNF-α/p38 MAPK Signaling Pathway to Promote Proliferation and Metastasis in Hepatocellular Carcinoma. Cancer Res Treat. 2020;52(1):10–23. 10.4143/crt.2019.145 . Zhao H, Ming T, Tang S, Ren S, Yang H, Liu M, Tao Q, Xu H. Wnt signaling in colorectal cancer: pathogenic role and therapeutic target. Mol Cancer. 2022;21(1):144. 10.1186/s12943-022-01616-7 . Additional Declarations No competing interests reported. Supplementary Files supplementaryfileforreviewpurposeonly.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4389779","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":302810171,"identity":"21aeb363-16e4-4b23-9673-0fa3f0267a3f","order_by":0,"name":"Xinsheng Wang","email":"","orcid":"","institution":"Tianjin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xinsheng","middleName":"","lastName":"Wang","suffix":""},{"id":302810172,"identity":"7ffb5afc-068d-46e3-8b07-50dc1e98b096","order_by":1,"name":"Yong Jia","email":"","orcid":"","institution":"Qingdao Municipal Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Jia","suffix":""},{"id":302810173,"identity":"432cd04d-1c1d-46f7-adb3-9344a1ebab59","order_by":2,"name":"Dawen Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYDCCAzAGe2Pjww+kaeE53GwsQZoWifQ2AR5idPAdP2P4uLDNLk8+8mEbgwSDnZxuAwEtkmdyjI1ntiUXG95ObHtQwJBsbHaAgBaDA7nbpHm3MSdunJ3YbiDBcCBxG0Et599u/827rT5x48yDbRI8RGm5kbuNmXfb4cT5EoxEapG88f6zNO+/44kbeBKBgWxAhF/4zqclfuY5U504v/34w4cfKuzkCGpBuBCs0oBY5SAg30CK6lEwCkbBKBhRAACyJEfqDXQ7yQAAAABJRU5ErkJggg==","orcid":"","institution":"Qingdao Municipal Hospital","correspondingAuthor":true,"prefix":"","firstName":"Dawen","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-05-08 13:55:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4389779/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4389779/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":56770593,"identity":"8368e780-c184-4cd6-9bb7-819db0974860","added_by":"auto","created_at":"2024-05-20 09:10:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":407461,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCTSC was expressed at a high level in BCa tissues and cells.\u003c/strong\u003e(A) The expression of CTSC was examined as per the data from the TCGA dataset (\u003ca href=\"https://portal.gdc.com/\"\u003ehttps://portal.gdc.com\u003c/a\u003e) and the GTEx dataset (\u003ca href=\"https://www.gtexportal.org/home/datasets\"\u003ehttps://www.gtexportal.org/home/datasets\u003c/a\u003e). (B) The overall survival was established by the Kaplan Meier plotter tool (\u003ca href=\"http://kmplot.com/analysis/\"\u003ehttp://kmplot.com/analysis/\u003c/a\u003e). (C) Relative mRNA level of CTSC in thirty paired normal and BCa tissues was detected by RT-qPCR. (D) Representative IHC images showed the expression of CTSC in normal and BCa tissues. (E) Western blotting analysis was involved in detecting the expression of CTSC in normal and BCa tissues. (F) Western blotting analysis was involved in detecting the expression of CTSC in a non-cancerous immortalized urothelial cell line SV-Huc-1 and BCa cell lines J82, T24, UMUC3, and 5637. **p \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4389779/v1/d749242d640d9b905b46d23b.png"},{"id":56770592,"identity":"8620c100-a741-4a1f-aefa-058e6d55497b","added_by":"auto","created_at":"2024-05-20 09:10:15","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2012148,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCTSC enhanced the cell proliferation, migration, and invasion of BCa cells.\u003c/strong\u003e (A) CCK-8 assay detecting the cell viability affected by changing the expression of CTSC. (B) Colony formation assay detecting the cell proliferation abilities. (C) Quantitation the colony number in (B). (D and E) Transwell assay detecting the ability of cell migration and invasion. *p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001; ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4389779/v1/be63f239105d0532fc922698.png"},{"id":56770596,"identity":"6e385fb9-7b50-4c6e-bf43-88377772e29f","added_by":"auto","created_at":"2024-05-20 09:10:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":336098,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCTSC promoted the tumorigenesis in vivo. \u003c/strong\u003e(A) CTSC was stably expressed in T24 cells, then the cells were injected into a nude mice model subcutaneously for 21 days, and tumors were isolated. (B and C) Tumor size and weight were measured after the isolation of tumors. **p \u0026lt; 0.01; ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4389779/v1/15a3d7467560befb7509ba72.png"},{"id":56770597,"identity":"441f21bd-982f-4721-a74e-9732037b39e2","added_by":"auto","created_at":"2024-05-20 09:10:16","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":423533,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWnt/β-Catenin signaling activation was controlled by CTSC.\u003c/strong\u003e(A) GSEA analysis implied that CTSC was positively linked to the Wnt/β-Catenin signaling pathway. (B) Western blotting analysis detected the key proteins of the Wnt/β-Catenin signaling pathway. (C - E) Quantification of the protein expression levels in (B). *p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001; ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4389779/v1/a3d131d4d07cb641221c5161.png"},{"id":56770595,"identity":"efdeed4b-4a62-4aa4-860d-38d04a72f1b7","added_by":"auto","created_at":"2024-05-20 09:10:15","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":485257,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCTSC was positively corrected with DIAPH3.\u003c/strong\u003e(A) GEPIA analysis showed that CTSC was positively related to DIAPH3. (B) The expression of DIAPH3 was examined as per the data from the TCGA dataset and GTEx dataset. (C) The overall survival was analyzed by the Kaplan Meier plotter tool. (D) RT-qPCR ascertained the mRNA level of DIAPH3 in thirty paired BCa tissues. (E) A positive correction was observed by detecting the mRNA levels of DIAPH3 and CTSC in 30 paired BCa tissues. (F) Western blotting analysis ascertained the protein level of DIAPH3. (G) Quantification of the level of the protein expression of DIAPH3 in (F). *p \u0026lt; 0.05; **p \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-4389779/v1/66dac365160762eb942ba552.png"},{"id":56770594,"identity":"2669ee07-983e-4c5a-8860-8e6d9d7b658c","added_by":"auto","created_at":"2024-05-20 09:10:15","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1347309,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCTSC acted as oncogene role and activation of Wnt/β-Catenin signaling via regulation of DIAPH3.\u003c/strong\u003eJ82 and T24 cells were transfected with pcDNA3+ pSilencer 2.1, CTSC + pSilencer 2.1, and CTSC + pshR-DIAPH3, then the cell viability (A), (B) cell proliferation abilities, Transwell migration (C) and invasion (D) were detected. (D) Western blotting analysis ascertained the protein level of CTSC, DIAPH3, β-Catenin, and p-β-Catenin. (E - H) Quantification of the level of protein expression levels (D) *p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001; ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-4389779/v1/afe1c8d5370b2c04022fdc93.png"},{"id":56899696,"identity":"a099ad0e-d198-45c6-a350-85d7355ea1cf","added_by":"auto","created_at":"2024-05-22 01:35:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6012630,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4389779/v1/793e27cd-90fa-4613-99b4-55a45894c6c2.pdf"},{"id":56770598,"identity":"3b8bffb1-0ee4-4faf-aaef-aab288299683","added_by":"auto","created_at":"2024-05-20 09:10:16","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":1238554,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfileforreviewpurposeonly.docx","url":"https://assets-eu.researchsquare.com/files/rs-4389779/v1/b4debfdfbfe346821508ae0b.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"CTSC promotes tumorigenesis in bladder cancer by activating Wnt/β-Catenin signaling","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eA prevalent tumor that affects the urology system, bladder cancer (BCa), in recent years, gradually tends to be younger and the incidence is rising (Miller et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The prognosis of patients is poor due to the tendency of metastasis and recurrence after clinical treatment (Powles et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Borhani et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Consequently, an expedition is needed to conduct a thorough investigation of the molecular process underlying the onset and progression of BCa, to provide powerful clues for the early diagnosis or to explore novel targets for the therapeutic management of BCa.\u003c/p\u003e \u003cp\u003eCathepsins are a vast class of proteolytic proteases markedly expressed in lysosomes. So far, at least 20 kinds of cathepsins have been found to exhibit 11 kinds of human cathepsins (cathepsin B, C, F, H, K, L, O, S, V, W, and X)(Turk et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Cathepsin C (CTSC), also denoted as the dipeptide base peptidase I (DPPI), belongs to the cysteine protease categories of organization, and its main physiological function is to promote inflammatory response by activating pro-inflammatory granule-associated serine proteases(Guay et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). More data has emerged recently affirming that CTSC expresses a remarkable function in the occurrence and development of tumors. Growing evidence has implied that the expression level of CTSC in several tissues and cells gleaned from tumors is different from that in normal adjacent tissues and cells, and its mechanism of action is markedly linked to the occurrence, development, metastasis, and recurrence of cancers, including breast cancer(Xiao et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), colorectal cancer(Dang et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), glioma(Cheng et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), and hepatocellular carcinoma(Zhang et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Pharmacological suppression of CTSC is considered a possible strategy in cancer treatment(Abideen et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In 2024, the latest research found that CTSC could promote tumor development in non-small cell lung cancer by activating the Yes-associated protein signaling pathway(Kim et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Although CTSC acts as an oncogene in several cancers, howeverthe study of CTSC in BCa is rare, and its function is unknown.\u003c/p\u003e \u003cp\u003eThis study explores the CTSC expression level in BCa and the impact on BCa cell proliferation, migration, and invasion, and further studies the molecular mechanism of CTSC may play a role, to provide more basis for BCa pathogenesis research.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Clinical samples\u003c/h2\u003e \u003cp\u003eThirty paired BCa tissues and corresponding para-cancerous tissues were obtained from patients admitted to Tianjin First Central Hospital from January 2021 to January 2023. All of them were diagnosed by pathological diagnosis. The patients were not subjected to anti-tumor treatment like radiotherapy, chemotherapy, immunotherapy, and other malignant tumors before surgery. All the patients and their families provided informed consent which was signed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Cell culture\u003c/h2\u003e \u003cp\u003eThe Chinese Academy of Sciences (Shanghai, China) supplied human normal urinary tract epithelial cells (SV-HUC-1) and BCa cells (UMUC3, J82, 5637, and T24). SV-HUC-1 was cultured in Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM-F12) medium (Solarbio, Beijing, China) containing fetal bovine serum (FBS; Gibco, Carlsbad, USA) and 1% Penicillin-Streptomycin (Solarbio, Beijing, China), and BCa cells (T24, J82,5637, and UMUC3) were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Solarbio, Beijing, China) supplemented with 10% FBS and 1% Penicillin-Streptomycin with 37℃ and 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Plasmid construction and cell transfection\u003c/h2\u003e \u003cp\u003eThe CTSC gene was synthesized by Anhui General Biological Company and cloned into the pcDNA3 vector to obtain pcDNA3-CTSC (CTSC). Construction of CTSC knockdown plasmid, CTSC forward and reverse sequence (shR-CTSC sense: 5'-GATCCG CAGGAAAGTACGCCCAAGATCTCGAGATCTTGGGCGTACTTTCCTGCTTTTTGA-3'; shR-CTSC antisense: 5'-AGCTTCAAAAAGCAGGAAAGTA CGCCCAAG ATCTCGAGATCTTGGGCGTACTTTCCTGCG-3') were synthesized by Anhui General Biological Company. The annealed product was cloned into pSilencer 2.1neo, generating pshR-CTSC. Construction of DIAPH3 knockdown plasmid, DIAPH3 forward and reverse sequence (shR-DIAPH3 sense: 5'-GATCCGTGACAAAGA TGTCCAGATTTCTCGAGAAATCTGGACATCTTTGTCACTTTTTGA-3'; shR-DIAPH3 antisense: 5'-AGCTTCAAAAAGTGACAAAGATGTCCAGATTTCTCGA GAAATCTGGACATCTTTGTCACG-3') were synthesized and annealed, then the product was cloned into pSilencer 2.1neo, generating pshR-DIAPH3.\u003c/p\u003e \u003cp\u003eJ82 and T24 cells in the logarithmic phase were collected, digested utilizing trypsin, and seeded in 6-well plates at 5\u0026times;10\u003csup\u003e5\u003c/sup\u003e/well. Transfection was executed as per the instructions of the Lipofectamine\u0026trade; 3000 kit (Invitrogen, USA) when the cell growth and fusion attained 80%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Quantitative reverse transcription polymerase chain reaction (RT-qPCR)\u003c/h2\u003e \u003cp\u003eThe Trizol method extracted total RNA from the cells and tissues with BCa and then reverse-transcribed into cDNA. The PCR reaction system was configured and RT-qPCR was performed. GAPDH was utilized as an internal control, and the 2\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e method was utilized to calculate the relative expressions of target genes. The primer sequences are as follows: CTSC: an upstream primer: 5'-TTACTGCAACGAGACAATGACTG-3', a downstream primer: 5'-AGGTGTGCTGTGTTGACATAC-3'; DIAPH3: an upstream primer: 5'-TGCAAGTAGCTTGTATGCAGC-3', a downstream primer: 5'-GGCGATG GGATAACTCAAACA-3'; GAPDH: upstream primer: 5'- ACAACCGTGCGTCTGA TTTC-3', downstream primer: 5'- AGCCTTCATGCACAGTGTTC-3'.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.5. CCK-8\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eTransfected cells in each group were prepared into a cell suspension and seeded in a 96-well plate at 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells per milliliter for each well, and there were 3 multiple wells in each group. Then, 10 \u0026micro;l CCK-8 solution was introduced into every well and incubated in the dark for a duration of 2 h, and the absorbance value (A value) was detected at 450 nm by a microplate reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Colony formation assay\u003c/h2\u003e \u003cp\u003eA density of 350 cells/well was adopted to seed the transfected BCa cells in 6-well plates after preparation. At the end of 2 weeks (14 days) of culture, the medium was removed, The cells were fixed utilizing a 4% paraformaldehyde for \u0026frac12; h. and stained utilizing a 0.4% crystal violet for \u0026frac14; h. The cell clones were visualized via a microscope and photographed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Transwell assay\u003c/h2\u003e \u003cp\u003eFor cell invasion assay, Matrigel underwent dilution utilizing a precooled RPMI1640 medium at a ratio of 1:8, and 100 \u0026micro;L was introduced into the Transwell chamber on the upper chamber portion. The transfected cells were diluted into a cell density of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cell/mL, and this was followed by an introduction of a suspension of 200 \u0026micro;L cells into the aforementioned upper chamber. Then, 600 \u0026micro;L RPMI1640 with 20% FBS was added to the bottom. Cells were continued to be cultured for 48 h and a 4% paraformaldehyde was utilized to fix them for 20 min. Then, they were stained utilizing crystal violet, washed, and dried. A microscope photographed the cells and the quantity of transmembrane cells was tallied. The Transwell chamber was not utilized together with Matrigel gel for cell migration assays, and the remaining steps were identical to those in the cell invasion assay, and the experiment was triplicated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Western blotting analysis\u003c/h2\u003e \u003cp\u003eLysis of the samples was executed utilizing the RIPA-enriched with phosphatase inhibitors at 4\u0026deg;C for 20 min, and centrifugation was performed to collect the supernatant. SDS-PAGE separated proteins and then changed to a PVDF membrane. The membrane was blocked utilizing 5% skim milk at room temperature (RT). The primary antibody was introduced and incubated overnight at 4\u0026deg;C. On the other hand, the secondary antibody was introduced and incubated at RT for 1 h on the following day. The proteins were probed by the ECL chemiluminescence method, and Image J software examined the protein gray value.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Statistical analysis\u003c/h2\u003e \u003cp\u003eSPSS 26. 0 statistical software and Student\u0026rsquo;s t-test executed statistical analysis and the data difference assessment between the two groups, respectively. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0. 05 connoted statistical significance.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.1. CTSC was upregulated in BCa and linked to poor prognosis\u003c/h2\u003e \u003cp\u003eTo determine the function of CTSC in BCa, we first analyzed the mRNA levels of CTSC in bladder urothelial carcinoma (BLCA) tissues and normal tissues in The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) databases, and the findings inferred that the expression level of CTSC in BLCA tissues was markedly higher than that in adjacent normal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). In addition, we also affirmed that BLCA patients with enhanced CTSC expression had a remarkably lesser overall survival in comparison to those with low CTSC expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). To confirm the aforementioned analysis findings, we evaluated the expression of CTSC in 30 BCa tissues and adjacent tissues. The findings of RT-qPCR implied a substantial expression level of CTSC in BCa tissues than adjacent normal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), which was in line with the prediction of bioinformatics. The findings of Western blot deduced that the expression level of CTSC in tissues obtained from BCa was greater than those of normal bladder tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Finally, we explored the expression levels of CTSC in normal bladder epithelial cells alongside four distinct BCa cells. Our analysis affirmed a remarkable elevation in the expression levels of CTSC in BCa cells in comparison to normal bladder cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.2. CTSC acted as an oncogene in vitro and in vivo\u003c/h2\u003e \u003cp\u003eTo delve further into the mechanisms of CTSC, we evaluated the impact of altered CTSC expression on BCa cells via colony formation assay, CCK-8, and Transwell migration and invasion assay. In comparison to the control group, the findings inferred that overexpression of CTSC markedly enhanced the colony formation capacity, cell viability, Transwell migration, and invasion ability of BCa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA \u0026ndash; \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). When CTSC was knockdown, on the contrary, we found that BCa cell activity and colony formation capability, Transwell migration, and invasion ability significantly declined (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA \u0026ndash; \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). In addition, we analyzed the impact of CTSC overexpression on the tumorigenic potential of J82 cells in nude mice. The findings implied that CTSC overexpression significantly enhanced the tumorigenic capability of J82 cells in vivo, with a remarkable increase in tumor volume as well as weight (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA \u0026ndash; \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). The results suggested that CTSC may exhibit a certain function in promoting BCa progression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e3.3. CTSC activated Wnt/β-Catenin signaling in BCa cells\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eTo examine the molecular mechanisms of CTSC, we performed GSEA analysis using the TCGA database, the findings affirmed a remarkable level of CTSC that was positively linked to an enrichment of Wnt/β - Catenin signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). To demonstrate the link between CTSC and the above signaling pathway, the levels of proteins with key molecules in this pathway were ascertained by Western blotting analysis after overexpression or knockdown of CTSC. The findings implied that overexpression of CTSC markedly heightened the level of β-Catenin while repressing its phosphorylated form. Additionally, the knockdown of CTSC reduced β-Catenin levels but increased p-β-Catenin levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). These findings suggested that Wnt/β-Catenin signaling was activated by CTSC in BCa cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.4. In BCa cells, CTSC increased the expression of DIAPH3\u003c/h2\u003e \u003cp\u003eOur experiments demonstrated for the first time that CTSC can activate Wnt/β-Catenin signaling, but the molecular mechanism remains unclear. To further investigate the molecular mechanism, we analyzed the genes associated with CTSC expression in the TCGA database, and DIAPH3, a gene positively correlated with CTSC, was selected for further study (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). DIAPH3 has been shown to be involved in HCC progression by blocking the interaction between GSK3β and HSP90, thus activating Wnt/β - Catenin signaling (Dong et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). TCGA database analysis inferred that the level of DIAPH3 in BCa expression was markedly heightened than that in adjacent normal tissues, and the survival time of patients with BCa with high DIAPH3 expression was markedly shorter than those with low DIAPH3 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). We further confirmed that DIAPH3 was substantially expressed in the tumor tissues of BCa patients by detecting 30 clinical specimens, and verified that CTSC was positively correlated with DIAPH3 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Moreover, we overexpressed or knocked down CTSC in BCa cells, and Western blotting results confirmed that CTSC positively regulated DIAPH3 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.5. In BCa cells, CTSC upregulated DIAPH3 to activate Wnt/β-Catenin signaling\u003c/h2\u003e \u003cp\u003eAlthough our demonstrations that CTSC can activate Wnt/β-Catenin signaling and positively regulate DIAPH3 expression, whether the up-regulation of DIAPH3 expression by CTSC was related to Wnt/β-Catenin signaling activation was still unknown. To prove our hypothesis, we demonstrated that CTSC overexpression could significantly enhance cell viability, proliferation, migration, and invasion, while co-transfection of CTSC overexpression and DIAPH3 knockdown plasmids significantly thwarted the effects produced by CTSC expression (Fig.\u0026nbsp;6A-6C). In addition, Western blot studies showed that DIAPH3 knockdown could also counteract the activation of Wnt/β-Catenin signaling activated by CTSC (Fig.\u0026nbsp;6D-6H). The above results implied that CTSC activated Wnt/β-Catenin signaling via DIAPH3-mediated molecular mechanism in BCa.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eRecently, the incidence of BCa has gradually increased with high metastasis and recurrence rates(Jin et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Pietzak et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In addition, there is still a dearth of effective targets as well as markers for clinical diagnosis and treatment, and the prognosis is unsatisfactory (Bruchbacher et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). As a result, it is paramount to provide accurate biomarkers for BCa early diagnosis and potential targets for therapy drugs or to elucidate the molecular mechanism of key genes affecting the pathogenesis of BCa.\u003c/p\u003e \u003cp\u003eAt first, the main role of CTSC is to degrade unwanted proteins in cells and activate serine proteases in immune and inflammatory cells(Reiser et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Recent studies affirmed that CTSC functions in a variety of diseases, including the \u003cem\u003ectsc\u003c/em\u003e gene locus mutation in recessive hereditary diseases as usual chromosome Papillon-Lef\u0026egrave;vre syndrome(Nagy et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Sanchez Klose et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), nerve inflammation reaction process(Liu et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), malignant tumors(Korkmaz et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), etc. Herein, we ascertained that CTSC was expressed at a high level in BCa and linked to poor prognosis. We performed in vitro and in vivo functional studies on the role of CTSC in BCa. In vitro, overexpression of CTSC amplified the proliferation, migration, and invasion of BCa cells, whereas impeding of CTSC expression showed a tendency towards inhibition. In vivo experiments also confirmed the function of CTSC in promoting tumor formation. Our results show that CTSC plays an oncogene role in BCa, which is consistent with the function of CTSC in tumors reported in literature(Kim et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, the molecular mechanism of CTSC promoting tumors may have new regulatory pathways that have not yet been found in BCa.\u003c/p\u003e \u003cp\u003eIn terms of regulatory mechanisms, it has been reported that CTSC causes immune evasion by upregulating CSF1, and then promotes the metastasis of colorectal cancer(Dang et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In addition, CTSC promotes breast cancer to lung metastasis by regulating the PR3-IL-1β axis(Xiao et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Li et al. inferred that CTSC promotes the proliferation as well as metastasis of hepatocellular carcinoma via interacting with the TNF-α/p38 MAPK signaling pathway(Zhang et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, our study found that CTSC can activate the Wnt/β-catenin signaling pathway by upregulating DIAPH3. The activation and shutdown of this pathway participate in the modulation of tumorigenesis and cell proliferation (Yu et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; He and Tang \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). According to recent studies, activation of the Wnt/β-catenin signaling pathway is demonstrated in lots of malignancies including colorectal cancer(Zhao et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), breast cancer(Xu et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), BCa(Katoh \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), etc. Currently, the molecular mechanism by which CTSC can activate the Wnt/β-Catenin signaling pathway is not well understood, however, our findings provide an explanation for this mechanism. We have found that CTSC may lead to the Wnt/β-Catenin signaling pathway activation by promoting DIAPH3 expression. Since reports have shown that DIAPH3 can interact with GSK3β and HSP90 to activate Wnt/β-Catenin signaling(Dong et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), our conclusions provide a preliminary explanation of the molecular mechanism why CTSC can activate the Wnt/β-Catenin signaling pathway, making our results and findings more reliable At present, our study has certain limitations, such as the molecular mechanism underlying upregulation of DIAPH3 by CTSC is unknown. Therefore, I think it is of great significance to further study this molecular mechanism in the future research.\u003c/p\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eOur study showed the oncogenic roles of CTSC in BCa. Mechanically, CTSC could upregulate DIAPH3 expression and thus leading toWnt/β-Catenin signaling pathway activation in BCa. Our findings might culminate in the development of BCa.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eEthics Statement\u003c/h2\u003e \u003cp\u003eThe Institutional Research Human or Animal Ethics Committee of Qingdao Municipal Hospital approved the study (Ethics No.: 15153287667).\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eDeclaration Of Competing Interest\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis study was supported by the China Postdoctoral Science Foundation (Grant No.2018M640243) and the Tianjin Key Medical Discipline (Specialty) Construction Project.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eXW and DW conceived this study. XW and DW performed the experiment. XW, DW, and YJ evaluated the data. XW and DW wrote the manuscript. All authors discussed the findings and made contributions to the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eNone.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbideen SA, Khan M, Al-Harbi AI, Ahmad S. Pharmacological inhibition of cathepsin C (CatC) as a potential approach for cancer therapeutics. J Biomol Struct Dyn. 2022;1\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/07391102.2022.2135603\u003c/span\u003e\u003cspan address=\"10.1080/07391102.2022.2135603\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBorhani S, Borhani R, Kajdacsy-Balla A. Artificial intelligence: A promising frontier in bladder cancer diagnosis and outcome prediction. Crit Rev Oncol/Hematol. 2022;171:103601. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.critrevonc.2022.103601\u003c/span\u003e\u003cspan address=\"10.1016/j.critrevonc.2022.103601\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruchbacher A, Soria F, Hassler M, Shariat SF, D'Andrea D. (2018) Tissue biomarkers in nonmuscle-invasive bladder cancer: any role in clinical practice? Current opinion in urology 28 (6):584\u0026ndash;90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/mou.0000000000000546\u003c/span\u003e\u003cspan address=\"10.1097/mou.0000000000000546\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng X, Ren Z, Liu Z, Sun X, Qian R, Cao C, Liu B, Wang J, Wang H, Guo Y, Gao Y. Cysteine cathepsin C: a novel potential biomarker for the diagnosis and prognosis of glioma. Cancer Cell Int. 2022;22(1):53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12935-021-02417-6\u003c/span\u003e\u003cspan address=\"10.1186/s12935-021-02417-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDang YZ, Chen XJ, Yu J, Zhao SH, Cao XM, Wang Q. Cathepsin C promotes colorectal cancer metastasis by regulating immune escape through upregulating CSF1. Neoplasma. 2023;70(1):123\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4149/neo_2023_220726N757\u003c/span\u003e\u003cspan address=\"10.4149/neo_2023_220726N757\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong L, Li Z, Xue L, Li G, Zhang C, Cai Z, Li H, Guo R. DIAPH3 promoted the growth, migration and metastasis of hepatocellular carcinoma cells by activating beta-catenin/TCF signaling. Mol Cell Biochem. 2018;438(1\u0026ndash;2):183\u0026ndash;90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11010-017-3125-7\u003c/span\u003e\u003cspan address=\"10.1007/s11010-017-3125-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuay D, Beaulieu C, Percival MD. Therapeutic utility and medicinal chemistry of cathepsin C inhibitors. Curr Top Med Chem. 2010;10(7):708\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2174/156802610791113469\u003c/span\u003e\u003cspan address=\"10.2174/156802610791113469\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe S, Tang S. WNT/β-catenin signaling in the development of liver cancers. Biomed pharmacotherapy = Biomedecine pharmacotherapie. 2020;132:110851. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2020.110851\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2020.110851\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin YH, Zeng XT, Liu TZ, Bai ZM, Dou ZL, Ding DG, Fan ZL, Han P, Huang YR, Huang X, Li M, Li XD, Li YN, Li XH, Liang CZ, Liu JM, Ma HS, Qi J, Shi JQ, Wang J, Wang DL, Wang ZP, Wang YY, Wang YB, Wei Q, Xia HB, Xing JC, Yan SY, Zhang XP, Zheng GY, Xing NZ, He DL, Wang XH. Treatment and surveillance for non-muscle-invasive bladder cancer: a clinical practice guideline (2021 edition). Military Med Res. 2022;9(1):44. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s40779-022-00406-y\u003c/span\u003e\u003cspan address=\"10.1186/s40779-022-00406-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKatoh M. Multi\u0026ndash;layered prevention and treatment of chronic inflammation, organ fibrosis and cancer associated with canonical WNT/β\u0026ndash;catenin signaling activation (Review). Int J Mol Med. 2018;42(2):713\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/ijmm.2018.3689\u003c/span\u003e\u003cspan address=\"10.3892/ijmm.2018.3689\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim N, Yeo MK, Sun P, Lee D, Kim DK, Lee SI, Chung C, Kang DH, Lee JE. Cathepsin C regulates tumor progression via the Yes-associated protein signaling pathway in non-small cell lung cancer. Am J cancer Res. 2024;14(1):97\u0026ndash;113.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKorkmaz B, Lamort AS, Domain R, Beauvillain C, Gieldon A, Yildirim A, Stathopoulos GT, Rhimi M, Jenne DE, Kettritz R. Cathepsin C inhibition as a potential treatment strategy in cancer. Biochem Pharmacol. 2021;194:114803. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bcp.2021.114803\u003c/span\u003e\u003cspan address=\"10.1016/j.bcp.2021.114803\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Q, Wan C, Zhang Z, Liu G, Wang S. CTSC promoted the migration and invasion of glioma cells via activation of STAT3/SERPINA3 axis. Gene. 2024;893:147948. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.gene.2023.147948\u003c/span\u003e\u003cspan address=\"10.1016/j.gene.2023.147948\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Q, Zhang Y, Liu S, Liu Y, Yang X, Liu G, Shimizu T, Ikenaka K, Fan K, Ma J. Cathepsin C promotes microglia M1 polarization and aggravates neuroinflammation via activation of Ca(2+)-dependent PKC/p38MAPK/NF-κB pathway. J Neuroinflamm. 2019;16(1):10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12974-019-1398-3\u003c/span\u003e\u003cspan address=\"10.1186/s12974-019-1398-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiller KD, Nogueira L, Devasia T, Mariotto AB, Yabroff KR, Jemal A, Kramer J, Siegel RL. (2022) Cancer treatment and survivorship statistics, 2022. CA: a cancer journal for clinicians 72 (5):409\u0026ndash;36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3322/caac.21731\u003c/span\u003e\u003cspan address=\"10.3322/caac.21731\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagy N, V\u0026aacute;lyi P, Csoma Z, Sul\u0026aacute;k A, Tripolszki K, Farkas K, Paschali E, Papp F, T\u0026oacute;th L, F\u0026aacute;bos B, Kem\u0026eacute;ny L, Nagy K, Sz\u0026eacute;ll M. CTSC and Papillon-Lef\u0026egrave;vre syndrome: detection of recurrent mutations in Hungarian patients, a review of published variants and database update. Mol Genet Genom Med. 2014;2(3):217\u0026ndash;28. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/mgg3.61\u003c/span\u003e\u003cspan address=\"10.1002/mgg3.61\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePietzak EJ, Bagrodia A, Cha EK, Drill EN, Iyer G, Isharwal S, Ostrovnaya I, Baez P, Li Q, Berger MF, Zehir A, Schultz N, Rosenberg JE, Bajorin DF, Dalbagni G, Al-Ahmadie H, Solit DB, Bochner BH. Next-generation Sequencing of Nonmuscle Invasive Bladder Cancer Reveals Potential Biomarkers and Rational Therapeutic Targets. Eur Urol. 2017;72(6):952\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.eururo.2017.05.032\u003c/span\u003e\u003cspan address=\"10.1016/j.eururo.2017.05.032\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePowles T, Bellmunt J, Comperat E, De Santis M, Huddart R, Loriot Y, Necchi A, Valderrama BP, Ravaud A, Shariat SF, Szabados B, van der Heijden MS, Gillessen S. Bladder cancer: ESMO Clinical Practice Guideline for diagnosis, treatment and follow-up. Annals oncology: official J Eur Soc Med Oncol. 2022;33(3):244\u0026ndash;58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.annonc.2021.11.012\u003c/span\u003e\u003cspan address=\"10.1016/j.annonc.2021.11.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReiser J, Adair B, Reinheckel T. Specialized roles for cysteine cathepsins in health and disease. J Clin Investig. 2010;120(10):3421\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/jci42918\u003c/span\u003e\u003cspan address=\"10.1172/jci42918\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanchez Klose FP, Bj\u0026ouml;rnsdottir H, Dahlstrand Rudin A, Persson T, Khamzeh A, Sundqvist M, Thorbert-Mros S, Dieckmann R, Christenson K, Bylund J. A rare CTSC mutation in Papillon-Lef\u0026egrave;vre Syndrome results in abolished serine protease activity and reduced NET formation but otherwise normal neutrophil function. PLoS ONE. 2021;16(12):e0261724. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0261724\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0261724\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurk V, Turk B, Turk D. Lysosomal cysteine proteases: facts and opportunities. EMBO J. 2001;20(17):4629\u0026ndash;33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/emboj/20.17.4629\u003c/span\u003e\u003cspan address=\"10.1093/emboj/20.17.4629\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao Y, Cong M, Li J, He D, Wu Q, Tian P, Wang Y, Yang S, Liang C, Liang Y, Wen J, Liu Y, Luo W, Lv X, He Y, Cheng DD, Zhou T, Zhao W, Zhang P, Zhang X, Xiao Y, Qian Y, Wang H, Gao Q, Yang QC, Yang Q, Hu G. Cathepsin C promotes breast cancer lung metastasis by modulating neutrophil infiltration and neutrophil extracellular trap formation. Cancer Cell. 2021;39(3):423\u0026ndash;e437427. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ccell.2020.12.012\u003c/span\u003e\u003cspan address=\"10.1016/j.ccell.2020.12.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu X, Zhang M, Xu F, Jiang S. Wnt signaling in breast cancer: biological mechanisms, challenges and opportunities. Mol Cancer. 2020;19(1):165. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12943-020-01276-5\u003c/span\u003e\u003cspan address=\"10.1186/s12943-020-01276-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu F, Yu C, Li F, Zuo Y, Wang Y, Yao L, Wu C, Wang C, Ye L. Wnt/β-catenin signaling in cancers and targeted therapies. Signal Transduct Target therapy. 2021;6(1):307. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-021-00701-5\u003c/span\u003e\u003cspan address=\"10.1038/s41392-021-00701-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang GP, Yue X, Li SQ. Cathepsin C Interacts with TNF-α/p38 MAPK Signaling Pathway to Promote Proliferation and Metastasis in Hepatocellular Carcinoma. Cancer Res Treat. 2020;52(1):10\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4143/crt.2019.145\u003c/span\u003e\u003cspan address=\"10.4143/crt.2019.145\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao H, Ming T, Tang S, Ren S, Yang H, Liu M, Tao Q, Xu H. Wnt signaling in colorectal cancer: pathogenic role and therapeutic target. Mol Cancer. 2022;21(1):144. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12943-022-01616-7\u003c/span\u003e\u003cspan address=\"10.1186/s12943-022-01616-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"CTSC, bladder cancer, Wnt/β-Catenin signaling pathway, DIAPH3","lastPublishedDoi":"10.21203/rs.3.rs-4389779/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4389779/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e Cathepsin C (CTSC) participates in the development of numerous cancers. The function of bladder cancer (BCa) is still largely unknown. Bioinformatics prediction, RT-qPCR assay, and Western blotting assay determined the level of expression of CTSC in BCa tissues, para-cancer tissues, BCa cells, and normal uroepithelial cells (SV-HUC-1). Colony formation assay, CCK-8 assay, and Transwell assay were utilized to ascertain the involvement of CTSC in BCa. In addition, the effect of CTSC on BCa was further studied by animal experiments in vivo. The findings affirmed that CTSC exhibited a heightened expression level in BCa cells and tissues, and the overexpression of CTSC substantially enhanced the activity, proliferation, migration, and invasion of BCa cells, while suppression of CTSC repressed the above biological phenotypes. CTSC could both activate the Wnt/β-Catenin signaling pathway and up-regulate DIAPH3 expression. Overexpression of CTSC combined with knockdown of DIAPH3 could partially reverse the impact of CTSC on the biological behavior of BCa cells and the Wnt/β-Catenin signaling pathway activation. CTSC could up-regulate DIAPH3 and activate the aforementioned pathway to enhance the activity, proliferation, migration, and invasion of cells from BCa.\u003c/p\u003e","manuscriptTitle":"CTSC promotes tumorigenesis in bladder cancer by activating Wnt/β-Catenin signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-20 09:10:11","doi":"10.21203/rs.3.rs-4389779/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b9f27b58-d923-4941-a4ca-bad80e7941ea","owner":[],"postedDate":"May 20th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-05-22T01:27:26+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-20 09:10:11","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4389779","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4389779","identity":"rs-4389779","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}