Complete genome sequence of a novel endornavirus from Rhizoctonia solani AG-1 IA isolate MY-JK-1 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Complete genome sequence of a novel endornavirus from Rhizoctonia solani AG-1 IA isolate MY-JK-1 Shanshan Xu, Zhenmeng Zhou, Chengmeng Shen, Li Luo, Genhua Yang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6537303/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract In this paper, we report a new fungal virus, tentatively named “Rhizoctonia solani endornavirus 15” (RsEV 15). The virus is a new type of fungal virus isolated from Rhizoctonia solani AG-1 IA strain MY-JK-1. RsEV 15 is a positive single-stranded RNA (+ssRNA) composed of 18,934 nucleotides and contains two ORFs. ORF 1 encodes a large polypeptide of 5070 amino acids with conserved RNA-dependent RNA polymerase (RdRp) and helicase (Hel) domains. ORF 2 encodes an unknown functional protein composed of 1063 amino acids. The results of BLASTp search showed that the polypeptide sequence encoded by ORF 1 had the highest similarity with other sequences, and the homology with Rhizoctonia solani endornavirus 8 (RsEV 8) was 43.54 %. Multiple sequence alignment and phylogenetic analysis based on RdRp and Hel sequences showed that RsEV 15 may be a new member of Endornavirus. Figures Figure 1 Figure 2 Figure 3 Introduction Rhizoctonia solani Kühn ( R. solani ) is a widely distributed soil-borne pathogen that exists as a species complex comprising multiple genetically divergent lineages . Based on the hyphal anastomosis and nuclear ribosomal DNA internal transcribed spacer (ITS) sequence analysis, they have been categorized into different anastomosis groups (AGs). Currently, there are 14 AGs (AG-1 to AG-13 and AG-BI) in R. solani [1]. Among them, R. solani AG-1 is a particularly destructive subgroup, known to infect a wide range of host plants and cause economically significant diseases, including seed rot, hypocotyl rot, aerial blight, and web blight [2, 3]. To date, dozens of fungal viruses with complete genome sequences have been isolated from Rhizoctonia spp., and mycoviruses isolated from AG-1 IA include: Rhizoctonia solani dsRNA virus 1 (RsRV1) [4], Rhizoctonia solani partitivirus 2 (RsPV2) [5], Rhizoctonia solani dsRNA virus 3 (RsRV3) [6], and Rhizoctonia solani partitivirus 5 (RsPV5) [7] of the family Partitiviridae and Rhizoctonia solani endornavirus 1 (RsEV1) of the family Endornaviridae [8], among others. Endornaviridae is a family of viruses with non-encapsidated RNA genomes that range in size from 9.7-20.2 kb and contains a single ORF encoding a polyprotein [9,10]; the polyprotein has an RNA helicase domain at the N-terminus and conserved RdRp motifs at the C-terminus [11]. Endornaviruses naturally infect fungi, plants, and oomycetes, which are persistent and do not cause obvious symptoms in their host [11-13]. In fungal hosts, endornaviruses are transmitted vertically via sporulation and horizontally via anastomosis [14], whereas in plant hosts they rely on vertical transmission via pollen and ova, since they lack a MP and cannot move from cell to cell [15-17]. Endornaviruses are not encapsidated and do not form true viral particles [11]. The family accommodates two genera, Alphaendornavirus and Betaendornavirus. At present, 14 endornaviruses have been identified and characterized, and their functions are gradually being studied, such as RsEV1 having the ability to spread from the host strain GD-2 to the viral strain GD-118P, resulting in reduced virulence in the isogenic strain GD-118P-V1 [18],RsEV11、RsEV12 a rice-infecting R. solani strain, ZJXD1-1 May enhance the pathogenicity of Fusarium graminearum [19]。In this study, we describe a new endornavirus from R. solani AG-1 IA strain MY-JK-1, designated as "Rhizoctonia solani endornavirus 15" (RsEV15), which function requires further investigation. Provenance of the virus material MY-JK-1 is the R. solani AG-1 IA strain isolated by our research group from rice roots and stems suffering from rice sheath blight in 2022, and stored in a -80 ℃ freezer. Cultivate strain MY-JK-1 on potato glucose agar (PDA) plates for 3 days, then shake it in potato glucose broth (PDB) at 28 ℃ and 100 rpm for 7 days to collect mycelium for extracting double stranded RNA (dsRNA) and total RNA. Sequencing was performed on the Illumina NovaSeq 6000 platform to generate viral contigs (Majorbio, Shanghai, China). The raw data was processed, merged, and compared with sequences in the National Center for Biotechnology Information (NCBI) database to assemble the viral genome sequence, which was validated by specific primer amplification (IFF: ACTCGTGTGGCGTAGTAGGG, IFR: CGATTGTAGTCAGCG). Extract dsRNA of strain MY-JK-1 using CF-11 cellulose (Sigma Aldrich) [20]. Purification was performed using DNase I and S1 nuclease (TaKaRa, Dalian, China) to remove genomic DNA and ssRNA [21,22]. Total RNA was extracted using RNA Easy Fast Plant Tissue Kit (Tiangen, Beijing, China) and used as a template for synthesizing the first strand cDNA. Clone the PCR purified amplicon into the pMD18-T plasmid vector and transform it into E. coli DH5 α competent cells. Select three positive clones for sequencing (Sangon, Shanghai, China). The terminal regions (5' and 3') of potential mycoviruses were identified through RNA-ligase-mediated cDNA end amplification (RLM-RACE) methodology [23]. Double-stranded RNA was purified and subsequently joined to an adapter oligonucleotide (PC3-T7 loop primer: 5ʹ-p-GGATCCCGGGAATTCGGTAATACGACTCACTATATTTTTATAGTGAGTCGTATTA-OH-3ʹ) through incubation at 4°C for 16 hours using T4 RNA ligase (TaKaRa). Following adapter ligation, the dsRNA was isolated and complementary DNA was generated according to established protocols [20]. Terminal sequence determination was performed employing primer PC2 (5ʹ-CCGAATTCCCGGGATCC-3ʹ) along with virus-specific oligonucleotides (5'-ACCACTGCGAGTCAGTTGGA-3' and 5'-TTGGAAGGATCAACGGGGAC-3'). Amplification products underwent purification, cloning, and sequencing as previously outlined. The full-length viral cDNA sequence is available in GenBank with the accession number PQ278121. Open reading frames (ORFs) were identified using the NCBI ORF Finder tool, applying either the standard genetic code or the fungal mitochondrial genetic code. Analysis revealed that RsEV15 contains two ORFs. Conserved functional domains were examined via the Conserved Domain Database (CDD) (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi), demonstrating that ORF1, the larger of the two, encodes both RNA-dependent RNA polymerase (RdRp) and helicase (Hel) domains, while ORF2 encodes a hypothetical 167-amino acid (aa) protein with no known function. Sequence alignments were generated using ClustalX [24], followed by annotation with GeneDoc [25]. Phylogenetic analysis was conducted in MEGA 6.0 [26] using the maximum-likelihood algorithm with 1000 bootstrap replications. Sequence properties The full-length genome of RsEV15 comprises 18,934 nucleotides with the following nucleotide composition: 32.8% adenine (A), 20.7% cytosine (C), 23.8% guanine (G), and 26.3% uracil (U). Bioinformatic analysis identified two untranslated regions (UTRs) at both termini (5′- and 3′-UTRs). The genomic organization is illustrated in Figure 1, revealing two open reading frames (ORFs). ORF1 encodes a high-molecular-weight protein (569.80 kDa, 5070 amino acids), while ORF2 produces a smaller polypeptide (120.25 kDa, 1063 aa). Domain prediction using NCBI databases detected an RNA-dependent RNA polymerase (RdRp) domain (residues 14415-15228) and a helicase domain (aa 4593-5367), consistent with other Entornaviruses [27]. No functional domains were identified in ORF2. Comparative analysis via BLASTp indicated that the ORF1-encoded polyprotein shares the highest similarity (43.54%) with Rhizoctonia solani entornavirus 8 (GenBank: WWD77350.1), despite differences in genome length (16,147 nt vs. 18,934 nt) [27]. Additionally, it exhibits 42.8% identity with Rhizoctonia solani endornavirus 1 (GenBank: QXI69631.2). Comparative sequence analysis was conducted for the RNA-dependent RNA polymerase (RdRp) domain of RsEV15 along with nine additional Entornavirus representatives. The alignment revealed the presence of six characteristic conserved regions (designated motifs A-F) in RsEV15 (Figure 2). Similarly, six analogous conserved motifs (A-F) were identified in the helicase domains of related Rhizoctonia solani endornaviruses. Phylogenetic reconstruction demonstrated that RsEV15 forms a distinct clade with RsEV8 within the Alphanentornaviruses genus, clearly differentiated from Betaenntornaviruses members (Figure 3). Based on the classification criteria established by the International Committee on Taxonomy of Viruses (ICTV; https://talk.ictvonline.org/), RsEV15 exhibits all definitive features characteristic of Entornaviruses. Notably, the protein encoded by ORF1 shows less than 80% sequence similarity to known members, suggesting that RsEV15 likely represents a novel species within the Endornaviridae family. Sequence properties The full-length genome of RsEV15 comprises 18,934 nucleotides with the following nucleotide composition: 32.8% adenine (A), 20.7% cytosine (C), 23.8% guanine (G), and 26.3% uracil (U). Bioinformatic analysis identified two untranslated regions (UTRs) at both termini (5′- and 3′-UTRs). The genomic organization is illustrated in Fig. 1 , revealing two open reading frames (ORFs). ORF1 encodes a high-molecular-weight protein (569.80 kDa, 5070 amino acids), while ORF2 produces a smaller polypeptide (120.25 kDa, 1063 aa). Domain prediction using NCBI databases detected an RNA-dependent RNA polymerase (RdRp) domain (residues 14415–15228) and a helicase domain (aa 4593–5367), consistent with other Entornaviruses [ 27 ]. No functional domains were identified in ORF2. Comparative analysis via BLASTp indicated that the ORF1-encoded polyprotein shares the highest similarity (43.54%) with Rhizoctonia solani entornavirus 8 (GenBank: WWD77350.1), despite differences in genome length (16,147 nt vs. 18,934 nt) [ 27 ]. Additionally, it exhibits 42.8% identity with Rhizoctonia solani endornavirus 1 (GenBank: QXI69631.2). Comparative sequence analysis was conducted for the RNA-dependent RNA polymerase (RdRp) domain of RsEV15 along with nine additional Entornavirus representatives. The alignment revealed the presence of six characteristic conserved regions (designated motifs A-F) in RsEV15 (Fig. 2 ). Similarly, six analogous conserved motifs (A-F) were identified in the helicase domains of related Rhizoctonia solani endornaviruses. Phylogenetic reconstruction demonstrated that RsEV15 forms a distinct clade with RsEV8 within the Alphanentornaviruses genus, clearly differentiated from Betaenntornaviruses members (Fig. 3 ). Based on the classification criteria established by the International Committee on Taxonomy of Viruses (ICTV; https://talk.ictvonline.org/ ), RsEV15 exhibits all definitive features characteristic of Entornaviruses. Notably, the protein encoded by ORF1 shows less than 80% sequence similarity to known members, suggesting that RsEV15 likely represents a novel species within the Endornaviridae family. Declarations Conflict of interest The authors have not disclosed any competing interests. References Gónzalez D, Rodriguez-Carres M, Boekhout T, Stalpers J, Kuramae E E, Nakatani A K, Vilgalys R, Cubeta MA (2016) Phylogenetic relationships of Rhizoctonia fungi within the Cantharellales. Fungal Biol 120(4):603-619. Ogoshi A (1996) Introduction-the genus Rhizoctonia . In. Rhizoctonia species: taxonomy, molecular biology, ecology, pathology and disease control. Eds. Sneh B, Jabaji-Hare S, Neate S and Dijst G. Kluwer Academic Publishers, The Netherlands, pp 1-9. Anderson N A (1982) The genetics and pathology of Rhizoctonia solani . Annu Rev Phytopathol 20:329-347. Zheng L, Liu H, Zhang M, Cao X, Zhou E (2013) The complete genomic sequence of a novel mycovirus from Rhizoctonia solani AG-1 IA strain B275. Arch Virol, 158:1609-1612. Zheng L, Zhang M, Chen Q, Zhu M, Zhou E (2014) A novel mycovirus closely related to viruses in the genus Alphapartitivirus confers hypovirulence in the phytopathogenic fungus Rhizoctonia solani . Virology, 456-457:220-226. Zhang M, Zheng L, Liu C, Shu C, Zhou E (2018) Characterization of a novel dsRNA mycovirus isolated from strain A105 of Rhizoctonia solani AG-1 IA. Arch Virol 163:427-430. Liu C, Zeng M, Zhang M, Shu C, Zhou E (2018) Complete nucleotide sequence of a Partitivirus from Rhizoctonia solani AG-1 IA Strain C24. Viruses 10:703. Zheng L, Shu C, Zhang M, Yang M, Zhou E (2019) Molecular characterization of a novel Endornavirus conferring hypovirulence in rice sheath blight fungus Rhizoctonia solani AG-1 IA strain GD-2. Viruses 11:178. Valverde RA, Khalifa ME, Okada R, Fukuhara T, Sabanadzovic S (2019) ICTV Virus Taxonomy Profile: Endornaviridae. J Gen Virol 100, 1204-1205. Roossinck MJ, Sabanadzovic S, Okada R, Valverde RA (2011) The remarkable evolutionary history of endornaviruses. J Gen Virol 92, 2674-2678. Okada R, Kiyota E, Moriyama H, Fukuhara T, Valverde RA (2017) Molecular and biological properties of an endornavirus infecting winged bean ( Psophocarpus tetragonolobus ). Virus Genes 53, 141-145. Du Z, Lin W, Qiu P, Liu X, Guo L, Wu K, Zhang S, Wu Z (2016) Complete sequence of a double-stranded RNA from the phytopathogenic fungus Erysiphe cichoracearum that might represent a novel endornavirus. Arch Virol 161, 2343-2346. Okada R, Kiyota E, Moriyama H, Toshiyuki F, Valverde RA (2014) A new endornavirus species infecting Malabar spinach ( Basella alba L.). Arch Virol 159, 807-809. Okada R, Yong CK, Valverde RA, Sabanadzovic S, Aoki N, Hotate S, Kiyota E, Moriyama H, Fukuhara T (2013) Molecular characterization of two evolutionarily distinct endornaviruses co-infecting common bean ( Phaseolus vulgaris ). J Gen Virol 94, 220-229. Ikeda KI, Nakamura H, Matsumoto N (2003) Hypovirulent strain of the violet root rot fungus Helicobasidium mompa . J Gen Plant Pathol 69, 385-390. Tuomivirta TT, Kaitera J, Hantula J (2009) A novel putative virus of Gremmeniella abietina type B (Ascomycota: Helotiaceae) has a composite genome with endornavirus affinities. J Gen Virol 90, 2299-2305. Ong JW, Li H, Sivasithamparam K, Dixon KW, Jones MG, Wylie SJ (2016) Novel Endorna-like viruses, including three with two open reading frames, challenge the membership criteria and taxonomy of the Endornaviridae. Virol 499, 203-211. Zheng L, Shu CW, Zhang ML, Yang M, Zhou EX, (2019) Molecular characterization of a novel endornavirus conferring hypovirulence in rice sheath blight fungus Rhizoctonia solani AG-1 IA strain GD-2. Viruses 11, 178. Wang YR, Su JE, Yang ZJ, Zhang J, Li XG, Chen Y, Zhu JZ (2024) A pooled mycoviral resource in a strain of Rhizoctonia solani are regulators of fungal virulence. Pestic Biochem Physiol 204: 106042. Choi YG, Randles JW (1997) Microgranular cellulose improves dsRNA recovery from plant nucleic acid extracts. Biotech 23:610-611. Sun Y, Li YQ, Dong WH, Sun AL, Chen NW, Zhao ZF, Li YQ, Li CY, Yang GH (2021) Molecular characterization of a novel mycovirus isolated from Rhizoctonia solani AG-1 IA strain 9-11. Arch Virol 166(11):3229-3232. Li YQ, Xu P, Zhang LF, Xia ZY, Qin XY, Yang GH, Mo X (2015) Molecular characterization of a novel mycovirus from Rhizoctonia fumigata AG-Ba isolate C-314 Baishi. Arch Virol 160(9):2371-2374. Maan S, Rao S, Maan NS, Anthony SJ, Attoui H, Samuel AR, Mertens PPC (2007) Rapid cDNA synthesis and sequencing techniques for the genetic study of blue tongue and other dsRNA viruses. J Virol Methods 143(2):132-139. Thompson JD, Gibson TJ, Plewniak F (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:4876-4882. Nicholas KB (1997) GeneDoc: analysis and visualization of genetic variation. Embnew News 4:14. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol biol evol 30(12): 2725-2729. Li Y, Huang X, Zhou G, Ye A, Deng Y, Shi L, Zhang R (2024) Characterization of a novel endornavirus isolated from the phytopathogenic fungus Rhizoctonia solani . Arch Virol 169(1): 15. Supplementary Files supplementary.txt Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6537303","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":465495590,"identity":"f45bab10-a1d8-4a47-b294-2a2bef2fdf0e","order_by":0,"name":"Shanshan Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzklEQVRIiWNgGAWjYBACNvb+BwckKmp4+OUfHyBOCx/PGcYHFmeOyUk2pCUQp0VOIofZoLKN2djgQI4BkQ5jyD0mceMMW+LMhjMfb7xhsJPTbSCo5Vya5IwKmcR+xt7NlnMYko3NDhDSwthgJi0BsqWZd5s0D8OBxG0EtTAzmEn/bWNO3HCM5xmRWth4jA0kQd4/w8NGpBYetsQHEqBAnsFmbDnHgAi/yM9/fAASlRLMD2+8qbCTI6gFBUjwEBk1yFpI1TEKRsEoGAUjAgAA3/ZBA/GV/ikAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-1265-930X","institution":"Southwest Forestry University","correspondingAuthor":true,"prefix":"","firstName":"Shanshan","middleName":"","lastName":"Xu","suffix":""},{"id":465495591,"identity":"e5f7fe88-2203-4f01-a01a-584e7df0f85f","order_by":1,"name":"Zhenmeng Zhou","email":"","orcid":"","institution":"Yunnan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhenmeng","middleName":"","lastName":"Zhou","suffix":""},{"id":465495592,"identity":"f6ceeb00-7b49-4235-8755-3ff19c799104","order_by":2,"name":"Chengmeng Shen","email":"","orcid":"","institution":"Yunnan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Chengmeng","middleName":"","lastName":"Shen","suffix":""},{"id":465495593,"identity":"93b88d83-5ce9-43e2-ab30-92e0ef2249eb","order_by":3,"name":"Li Luo","email":"","orcid":"","institution":"Yunnan Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Luo","suffix":""},{"id":465495594,"identity":"7721d89e-9cc7-4a08-b163-ec439479cee9","order_by":4,"name":"Genhua Yang","email":"","orcid":"https://orcid.org/0000-0003-4634-1292","institution":"Yunnan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Genhua","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2025-04-27 01:31:37","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6537303/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6537303/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":84052635,"identity":"c2e962f9-e177-48c7-a09b-8aeca04b41a4","added_by":"auto","created_at":"2025-06-06 08:42:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":41007,"visible":true,"origin":"","legend":"\u003cp\u003eGenome organization of Rhizoctonia solani endornavirus 15 (RsEV 15).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6537303/v1/5949ec9f67dbc13f0bc8fb70.png"},{"id":84053210,"identity":"2c4fb96e-41d3-4c9d-a676-df378597b5b2","added_by":"auto","created_at":"2025-06-06 08:50:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":614406,"visible":true,"origin":"","legend":"\u003cp\u003eMultiple alignment of amino acid sequences of the RdRps of RsEV15 and other similar mitoviruses using the ClustalX program. Four conserved motifs characteristic of RdRps of mitoviruses are indicated by lines above the sequences, and their positions are indicated by A-F. The multiple alignment was highlighted using the GeneDoc application.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6537303/v1/817dd431c5c02903f0d7492a.png"},{"id":84052636,"identity":"09afd9b2-746b-439b-a3f4-96235bbd412e","added_by":"auto","created_at":"2025-06-06 08:42:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":261673,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis of the RdRp domains of RsEV15, other endornavirus, and virus, using the maximum-likelihood method with bootstrapping analysis with 1000 replicates in MEGA 6.0.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6537303/v1/3fb261f9632e4ae9700cc363.png"},{"id":86009748,"identity":"f8318fcb-fa62-49d7-abef-2db62a183d7d","added_by":"auto","created_at":"2025-07-04 09:35:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1121438,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6537303/v1/6ea6227e-e8a5-4f97-a992-6d2a74a941c8.pdf"},{"id":84051732,"identity":"72743c4a-aa60-4f31-a49d-fadc0c0ff686","added_by":"auto","created_at":"2025-06-06 08:34:44","extension":"txt","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":25999,"visible":true,"origin":"","legend":"","description":"","filename":"supplementary.txt","url":"https://assets-eu.researchsquare.com/files/rs-6537303/v1/e9d5e797547ac62a81c7eef1.txt"}],"financialInterests":"","formattedTitle":"Complete genome sequence of a novel endornavirus from Rhizoctonia solani AG-1 IA isolate MY-JK-1","fulltext":[{"header":"Introduction","content":"\u003cp\u003e\u003cem\u003eRhizoctonia solani\u003c/em\u003e Kühn (\u003cem\u003eR. solani\u003c/em\u003e) is a widely distributed soil-borne pathogen that exists as a species complex comprising multiple genetically divergent lineages\u003cem\u003e.\u003c/em\u003e Based on the hyphal anastomosis and nuclear ribosomal DNA internal transcribed spacer (ITS) sequence analysis, they have been categorized into different anastomosis groups (AGs). Currently, there are 14 AGs (AG-1 to AG-13 and AG-BI) in \u003cem\u003eR. solani\u003c/em\u003e [1]. Among them, \u003cem\u003eR. solani\u003c/em\u003e AG-1 is a particularly destructive subgroup, known to infect a wide range of host plants and cause economically significant diseases, including seed rot, hypocotyl rot, aerial blight, and web blight [2, 3]. To date, dozens of fungal viruses with complete genome sequences have been isolated from \u003cem\u003eRhizoctonia\u003c/em\u003e spp., and mycoviruses isolated from AG-1 IA include: Rhizoctonia solani dsRNA virus 1 (RsRV1) [4], Rhizoctonia solani partitivirus 2 (RsPV2) [5], Rhizoctonia solani dsRNA virus 3 (RsRV3) [6], and Rhizoctonia solani partitivirus 5 (RsPV5) [7] of the family \u003cem\u003ePartitiviridae\u003c/em\u003e and Rhizoctonia solani endornavirus 1 (RsEV1) of the family \u003cem\u003eEndornaviridae\u003c/em\u003e [8], among others.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eEndornaviridae\u003c/em\u003e is a family of viruses with non-encapsidated RNA genomes that range in size from 9.7-20.2 kb and contains a single ORF encoding a polyprotein [9,10]; the polyprotein has an RNA helicase domain at the N-terminus and conserved RdRp motifs at the C-terminus [11]. Endornaviruses naturally infect fungi, plants, and oomycetes, which are persistent and do not cause obvious symptoms in their host [11-13]. In fungal hosts, endornaviruses are transmitted vertically via sporulation and horizontally via anastomosis [14], whereas in plant hosts they rely on vertical transmission via pollen and ova, since they lack a MP and cannot move from cell to cell [15-17]. Endornaviruses are not encapsidated and do not form true viral particles [11]. The family accommodates two genera, Alphaendornavirus and Betaendornavirus.\u003c/p\u003e\n\u003cp\u003eAt present, 14 endornaviruses have been identified and characterized, and their functions are gradually being studied, such as RsEV1 having the ability to spread from the host strain GD-2 to the viral strain GD-118P, resulting in reduced virulence in the isogenic strain GD-118P-V1 [18],RsEV11、RsEV12 a rice-infecting R. solani strain, ZJXD1-1 May enhance the pathogenicity of Fusarium graminearum [19]。In this study, we describe a new endornavirus from \u003cem\u003eR. solani\u003c/em\u003e AG-1 IA strain MY-JK-1, designated as \"Rhizoctonia solani endornavirus 15\" (RsEV15), which function requires further investigation.\u003c/p\u003e"},{"header":"Provenance of the virus material","content":"\u003cp\u003eMY-JK-1 is the \u003cem\u003eR. solani\u003c/em\u003e AG-1 IA strain isolated by our research group from rice roots and stems suffering from rice sheath blight in 2022, and stored in a -80\u0026nbsp;℃\u0026nbsp;freezer. Cultivate strain MY-JK-1 on potato glucose agar (PDA) plates for 3 days, then shake it in potato glucose broth (PDB) at 28\u0026nbsp;℃\u0026nbsp;and 100 rpm for 7 days to collect mycelium for extracting double stranded RNA (dsRNA) and total RNA. Sequencing was performed on the Illumina NovaSeq 6000 platform to generate viral contigs (Majorbio, Shanghai, China). The raw data was processed, merged, and compared with sequences in the National Center for Biotechnology Information (NCBI) database to assemble the viral genome sequence, which was validated by specific primer amplification (IFF: ACTCGTGTGGCGTAGTAGGG, IFR: CGATTGTAGTCAGCG). Extract dsRNA of strain MY-JK-1 using CF-11 cellulose (Sigma Aldrich) [20]. Purification was performed using DNase I and S1 nuclease (TaKaRa, Dalian, China) to remove genomic DNA and ssRNA [21,22]. Total RNA was extracted using RNA Easy Fast Plant Tissue Kit (Tiangen, Beijing, China) and used as a template for synthesizing the first strand cDNA. Clone the PCR purified amplicon into the pMD18-T plasmid vector and transform it into \u003cem\u003eE. coli\u003c/em\u003e DH5 \u0026alpha; competent cells. Select three positive clones for sequencing (Sangon, Shanghai, China).\u003c/p\u003e\n\u003cp\u003eThe terminal regions (5\u0026apos; and 3\u0026apos;) of potential mycoviruses were identified through RNA-ligase-mediated cDNA end amplification (RLM-RACE) methodology [23]. Double-stranded RNA was purified and subsequently joined to an adapter oligonucleotide (PC3-T7 loop primer: 5ʹ-p-GGATCCCGGGAATTCGGTAATACGACTCACTATATTTTTATAGTGAGTCGTATTA-OH-3ʹ) through incubation at 4\u0026deg;C for 16 hours using T4 RNA ligase (TaKaRa). Following adapter ligation, the dsRNA was isolated and complementary DNA was generated according to established protocols [20]. Terminal sequence determination was performed employing primer PC2 (5ʹ-CCGAATTCCCGGGATCC-3ʹ) along with virus-specific oligonucleotides (5\u0026apos;-ACCACTGCGAGTCAGTTGGA-3\u0026apos; and 5\u0026apos;-TTGGAAGGATCAACGGGGAC-3\u0026apos;). Amplification products underwent purification, cloning, and sequencing as previously outlined. The full-length viral cDNA sequence is available in GenBank with the accession number PQ278121.\u003c/p\u003e\n\u003cp\u003eOpen reading frames (ORFs) were identified using the NCBI ORF Finder tool, applying either the standard genetic code or the fungal mitochondrial genetic code. Analysis revealed that RsEV15 contains two ORFs. Conserved functional domains were examined via the Conserved Domain Database (CDD) (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi), demonstrating that ORF1, the larger of the two, encodes both RNA-dependent RNA polymerase (RdRp) and helicase (Hel) domains, while ORF2 encodes a hypothetical 167-amino acid (aa) protein with no known function. Sequence alignments were generated using ClustalX [24], followed by annotation with GeneDoc [25]. Phylogenetic analysis was conducted in MEGA 6.0 [26] using the maximum-likelihood algorithm with 1000 bootstrap replications.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSequence properties\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe full-length genome of RsEV15 comprises 18,934 nucleotides with the following nucleotide composition: 32.8% adenine (A), 20.7% cytosine (C), 23.8% guanine (G), and 26.3% uracil (U). Bioinformatic analysis identified two untranslated regions (UTRs) at both termini (5\u0026prime;- and 3\u0026prime;-UTRs). The genomic organization is illustrated in Figure 1, revealing two open reading frames (ORFs). ORF1 encodes a high-molecular-weight protein (569.80 kDa, 5070 amino acids), while ORF2 produces a smaller polypeptide (120.25 kDa, 1063 aa). Domain prediction using NCBI databases detected an RNA-dependent RNA polymerase (RdRp) domain (residues 14415-15228) and a helicase domain (aa 4593-5367), consistent with other Entornaviruses [27]. No functional domains were identified in ORF2. Comparative analysis via BLASTp indicated that the ORF1-encoded polyprotein shares the highest similarity (43.54%) with Rhizoctonia solani entornavirus 8 (GenBank: WWD77350.1), despite differences in genome length (16,147 nt vs. 18,934 nt) [27]. Additionally, it exhibits 42.8% identity with Rhizoctonia solani endornavirus 1 (GenBank: QXI69631.2).\u003c/p\u003e\n\u003cp\u003eComparative sequence analysis was conducted for the RNA-dependent RNA polymerase (RdRp) domain of RsEV15 along with nine additional Entornavirus representatives. The alignment revealed the presence of six characteristic conserved regions (designated motifs A-F) in RsEV15 (Figure 2). Similarly, six analogous conserved motifs (A-F) were identified in the helicase domains of related Rhizoctonia solani endornaviruses. Phylogenetic reconstruction demonstrated that RsEV15 forms a distinct clade with RsEV8 within the Alphanentornaviruses genus, clearly differentiated from Betaenntornaviruses members (Figure 3).\u003c/p\u003e\n\u003cp\u003eBased on the classification criteria established by the International Committee on Taxonomy of Viruses (ICTV; https://talk.ictvonline.org/), RsEV15 exhibits all definitive features characteristic of Entornaviruses. Notably, the protein encoded by ORF1 shows less than 80% sequence similarity to known members, suggesting that RsEV15 likely represents a novel species within the Endornaviridae family.\u003c/p\u003e"},{"header":"Sequence properties","content":"\u003cp\u003eThe full-length genome of RsEV15 comprises 18,934 nucleotides with the following nucleotide composition: 32.8% adenine (A), 20.7% cytosine (C), 23.8% guanine (G), and 26.3% uracil (U). Bioinformatic analysis identified two untranslated regions (UTRs) at both termini (5\u0026prime;- and 3\u0026prime;-UTRs). The genomic organization is illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, revealing two open reading frames (ORFs). ORF1 encodes a high-molecular-weight protein (569.80 kDa, 5070 amino acids), while ORF2 produces a smaller polypeptide (120.25 kDa, 1063 aa). Domain prediction using NCBI databases detected an RNA-dependent RNA polymerase (RdRp) domain (residues 14415\u0026ndash;15228) and a helicase domain (aa 4593\u0026ndash;5367), consistent with other Entornaviruses [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. No functional domains were identified in ORF2. Comparative analysis via BLASTp indicated that the ORF1-encoded polyprotein shares the highest similarity (43.54%) with Rhizoctonia solani entornavirus 8 (GenBank: WWD77350.1), despite differences in genome length (16,147 nt vs. 18,934 nt) [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Additionally, it exhibits 42.8% identity with Rhizoctonia solani endornavirus 1 (GenBank: QXI69631.2).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eComparative sequence analysis was conducted for the RNA-dependent RNA polymerase (RdRp) domain of RsEV15 along with nine additional Entornavirus representatives. The alignment revealed the presence of six characteristic conserved regions (designated motifs A-F) in RsEV15 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Similarly, six analogous conserved motifs (A-F) were identified in the helicase domains of related Rhizoctonia solani endornaviruses. Phylogenetic reconstruction demonstrated that RsEV15 forms a distinct clade with RsEV8 within the Alphanentornaviruses genus, clearly differentiated from Betaenntornaviruses members (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBased on the classification criteria established by the International Committee on Taxonomy of Viruses (ICTV; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://talk.ictvonline.org/\u003c/span\u003e\u003cspan address=\"https://talk.ictvonline.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), RsEV15 exhibits all definitive features characteristic of Entornaviruses. Notably, the protein encoded by ORF1 shows less than 80% sequence similarity to known members, suggesting that RsEV15 likely represents a novel species within the Endornaviridae family.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of interest\u0026nbsp;\u003c/strong\u003eThe authors have not disclosed any competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eG\u0026oacute;nzalez D, Rodriguez-Carres M, Boekhout T, Stalpers J, Kuramae E E, Nakatani A K, Vilgalys R, Cubeta MA (2016) Phylogenetic relationships of \u003cem\u003eRhizoctonia\u003c/em\u003e fungi within the Cantharellales. Fungal Biol 120(4):603-619.\u003c/li\u003e\n\u003cli\u003eOgoshi A (1996) Introduction-the genus \u003cem\u003eRhizoctonia\u003c/em\u003e. In. \u003cem\u003eRhizoctonia\u003c/em\u003e species: taxonomy, molecular biology, ecology, pathology and disease control. Eds. Sneh B, Jabaji-Hare S, Neate S and Dijst G. Kluwer Academic Publishers, The Netherlands, pp 1-9.\u003c/li\u003e\n\u003cli\u003eAnderson N A (1982) The genetics and pathology of \u003cem\u003eRhizoctonia solani\u003c/em\u003e. Annu Rev Phytopathol 20:329-347.\u003c/li\u003e\n\u003cli\u003eZheng L, Liu H, Zhang M, Cao X, Zhou E (2013) The complete genomic sequence of a novel mycovirus from \u003cem\u003eRhizoctonia solani\u003c/em\u003eAG-1 IA strain B275. Arch Virol, 158:1609-1612.\u003c/li\u003e\n\u003cli\u003eZheng L, Zhang M, Chen Q, Zhu M, Zhou E (2014) A novel mycovirus closely related to viruses in the genus Alphapartitivirus confers hypovirulence in the phytopathogenic fungus \u003cem\u003eRhizoctonia solani\u003c/em\u003e. Virology, 456-457:220-226.\u003c/li\u003e\n\u003cli\u003eZhang M, Zheng L, Liu C, Shu C, Zhou E (2018) Characterization of a novel dsRNA mycovirus isolated from strain A105 of \u003cem\u003eRhizoctonia solani\u003c/em\u003e AG-1 IA. Arch Virol 163:427-430.\u003c/li\u003e\n\u003cli\u003eLiu C, Zeng M, Zhang M, Shu C, Zhou E (2018) Complete nucleotide sequence of a Partitivirus from \u003cem\u003eRhizoctonia solani\u003c/em\u003e AG-1 IA Strain C24. Viruses 10:703.\u003c/li\u003e\n\u003cli\u003eZheng L, Shu C, Zhang M, Yang M, Zhou E (2019) Molecular characterization of a novel Endornavirus conferring hypovirulence in rice sheath blight fungus \u003cem\u003eRhizoctonia solani \u003c/em\u003eAG-1 IA strain GD-2. Viruses 11:178.\u003c/li\u003e\n\u003cli\u003eValverde RA, Khalifa ME, Okada R, Fukuhara T, Sabanadzovic S (2019) ICTV Virus Taxonomy Profile: Endornaviridae. J Gen Virol 100, 1204-1205.\u003c/li\u003e\n\u003cli\u003eRoossinck MJ, Sabanadzovic S, Okada R, Valverde RA (2011) The remarkable evolutionary history of endornaviruses. J Gen Virol 92, 2674-2678.\u003c/li\u003e\n\u003cli\u003eOkada R, Kiyota E, Moriyama H, Fukuhara T, Valverde RA (2017) Molecular and biological properties of an endornavirus infecting winged bean (\u003cem\u003ePsophocarpus tetragonolobus\u003c/em\u003e). Virus Genes 53, 141-145.\u003c/li\u003e\n\u003cli\u003eDu Z, Lin W, Qiu P, Liu X, Guo L, Wu K, Zhang S, Wu Z (2016) Complete sequence of a double-stranded RNA from the phytopathogenic fungus \u003cem\u003eErysiphe cichoracearum\u003c/em\u003e that might represent a novel endornavirus. Arch Virol 161, 2343-2346.\u003c/li\u003e\n\u003cli\u003eOkada R, Kiyota E, Moriyama H, Toshiyuki F, Valverde RA (2014) A new endornavirus species infecting Malabar spinach (\u003cem\u003eBasella alba\u003c/em\u003e L.). Arch Virol 159, 807-809.\u003c/li\u003e\n\u003cli\u003eOkada R, Yong CK, Valverde RA, Sabanadzovic S, Aoki N, Hotate S, Kiyota E, Moriyama H, Fukuhara T (2013) Molecular characterization of two evolutionarily distinct endornaviruses co-infecting common bean (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e). J Gen Virol 94, 220-229.\u003c/li\u003e\n\u003cli\u003eIkeda KI, Nakamura H, Matsumoto N (2003) Hypovirulent strain of the violet root rot fungus \u003cem\u003eHelicobasidium mompa\u003c/em\u003e. J Gen Plant Pathol 69, 385-390.\u003c/li\u003e\n\u003cli\u003eTuomivirta TT, Kaitera J, Hantula J (2009) A novel putative virus of \u003cem\u003eGremmeniella abietina\u003c/em\u003e type B (Ascomycota: Helotiaceae) has a composite genome with endornavirus affinities. J Gen Virol 90, 2299-2305.\u003c/li\u003e\n\u003cli\u003eOng JW, Li H, Sivasithamparam K, Dixon KW, Jones MG, Wylie SJ (2016) Novel Endorna-like viruses, including three with two open reading frames, challenge the membership criteria and taxonomy of the Endornaviridae. Virol 499, 203-211.\u003c/li\u003e\n\u003cli\u003eZheng L, Shu CW, Zhang ML, Yang M, Zhou EX, (2019) Molecular characterization of a novel endornavirus conferring hypovirulence in rice sheath blight fungus \u003cem\u003eRhizoctonia solani\u003c/em\u003e AG-1 IA strain GD-2. Viruses 11, 178.\u003c/li\u003e\n\u003cli\u003eWang YR, Su JE, Yang ZJ, Zhang J, Li XG, Chen Y, Zhu JZ (2024) A pooled mycoviral resource in a strain of \u003cem\u003eRhizoctonia solani\u003c/em\u003e are regulators of fungal virulence. Pestic Biochem Physiol 204: 106042.\u003c/li\u003e\n\u003cli\u003eChoi YG, Randles JW (1997) Microgranular cellulose improves dsRNA recovery from plant nucleic acid extracts. Biotech 23:610-611.\u003c/li\u003e\n\u003cli\u003eSun Y, Li YQ, Dong WH, Sun AL, Chen NW, Zhao ZF, Li YQ, Li CY, Yang GH (2021) Molecular characterization of a novel mycovirus isolated from \u003cem\u003eRhizoctonia solani\u003c/em\u003e AG-1 IA strain 9-11. Arch Virol 166(11):3229-3232.\u003c/li\u003e\n\u003cli\u003eLi YQ, Xu P, Zhang LF, Xia ZY, Qin XY, Yang GH, Mo X (2015) Molecular characterization of a novel mycovirus from \u003cem\u003eRhizoctonia fumigata\u003c/em\u003e AG-Ba isolate C-314 Baishi. Arch Virol 160(9):2371-2374.\u003c/li\u003e\n\u003cli\u003eMaan S, Rao S, Maan NS, Anthony SJ, Attoui H, Samuel AR, Mertens PPC (2007) Rapid cDNA synthesis and sequencing techniques for the genetic study of blue tongue and other dsRNA viruses. J Virol Methods 143(2):132-139.\u003c/li\u003e\n\u003cli\u003eThompson JD, Gibson TJ, Plewniak F (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:4876-4882.\u003c/li\u003e\n\u003cli\u003eNicholas KB (1997) GeneDoc: analysis and visualization of genetic variation. Embnew News 4:14.\u003c/li\u003e\n\u003cli\u003eTamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol biol evol 30(12): 2725-2729.\u003c/li\u003e\n\u003cli\u003eLi Y, Huang X, Zhou G, Ye A, Deng Y, Shi L, Zhang R (2024) Characterization of a novel endornavirus isolated from the phytopathogenic fungus \u003cem\u003eRhizoctonia solani\u003c/em\u003e. Arch Virol 169(1): 15.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6537303/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6537303/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn this paper, we report a new fungal virus, tentatively named “Rhizoctonia solani endornavirus 15” (RsEV 15). The virus is a new type of fungal virus isolated from \u003cem\u003eRhizoctonia solani\u003c/em\u003eAG-1 IA strain MY-JK-1. RsEV 15 is a positive single-stranded RNA (+ssRNA) composed of 18,934 nucleotides and contains two ORFs. ORF 1 encodes a large polypeptide of 5070 amino acids with conserved RNA-dependent RNA polymerase (RdRp) and helicase (Hel) domains. ORF 2 encodes an unknown functional protein composed of 1063 amino acids. The results of BLASTp search showed that the polypeptide sequence encoded by ORF 1 had the highest similarity with other sequences, and the homology with Rhizoctonia solani endornavirus 8 (RsEV 8) was 43.54 %. Multiple sequence alignment and phylogenetic analysis based on RdRp and Hel sequences showed that RsEV 15 may be a new member of Endornavirus.\u003c/p\u003e","manuscriptTitle":"Complete genome sequence of a novel endornavirus from Rhizoctonia solani AG-1 IA isolate MY-JK-1","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-06 08:34:39","doi":"10.21203/rs.3.rs-6537303/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c4f3316b-19b5-46e0-8923-fca06f03aa6d","owner":[],"postedDate":"June 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-07-04T09:26:55+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-06 08:34:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6537303","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6537303","identity":"rs-6537303","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.