Biochanin-A inhibits the activity of androgen receptor mutants to suppress the development of prostate cancer

Biochanin-A inhibits the activity of androgen receptor mutants to suppress the development of prostate cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Biochanin-A inhibits the activity of androgen receptor mutants to suppress the development of prostate cancer Yongnan Chi, Chenyang Wang, Tao Yang, Ying Liu, Denglong Wu, Shengsong Huang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6311929/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Androgen and androgen receptor (AR) were essential for the development of prostate cancer. Biochanin-A (BCA) has been reported to inhibit androgen synthesis to overcome resistance to abiraterone and enzalutamide. However, its direct function on androgen receptor remains unrevealed. Here, we investigated the affinity and biological effect of BCA to different AR mutants to find potential patients suitable for BCA treatment. Stable cell lines expressing different AR mutants in PC3 and LAPC4 cells were established. The affinity and biological effects of BCA on 12 different AR mutations were investigated by isotope competition assay, target gene expression and cell proliferation assay. The affinity of darolutamide to AR mutants were compared with enzalutamide. The inhibitory of darolutamide to AR mutants were compared with BCA. As indicated by the isotope competition experiments, BCA exhibited high affinity to AR T877A and AR W741C . After binding to these AR mutants, BCA suppressed the AR signaling pathway and cell proliferation of LAPC4-AR T877A and LAPC4-AR W741C stable cell lines. Enzalutamide and darolutamide showed different affinity to AR mutants. Darolutamide showed higher affinity to AR W741C and inhibited AR W741C as an antagonist. BCA not only inhibits androgen synthesis, but also directly binds to and suppresses AR T877A and AR W741C mutations. Prostate Cancer Androgen Receptor Mutation Biochanin-A Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Globally, prostate cancer ranks second to lung cancer in incidence and is one of the leading causes of cancer deaths among Western men 1 . Prostate cancer is driven by androgens which binds to the androgen receptor (AR) to activate AR signaling 2 , 3 . Androgen receptor deprivation therapy (ADT) is the front line to treat advanced prostate cancer 4 , 5 . Over the past decade, several new treatments have been developed and the next androgen pathway inhibitors, including abiraterone and enzalutamide, successfully prolonged patient treatment duration and life span. However, drug resistance is inevitable and the discovery of new drugs is essential for further disease management 6 , 7 . The enzyme 3βHSD1 catalyzes the generation of dihydrotestosterone (DHT) from adrenal dehydroepiandrosterone (DHEA) and has been recognized as a promising target to overcome resistance to abiraterone and enzalutamide 8 , 9 . Biochanin-A (BCA) has recently been discovered as a potent inhibitor to 3βHSD1 and suppressed the development of prostate cancer in cell lines and mouse model 10 , 11 . Daidzein, the derivative of BCA, has been reported to reduce PSA levels in patients, supporting the promising role of 3βHSD1 in disease management 12 . Mechanistically, BCA directly inhibits 3βHSD1 and suppresses the conversion of DHEA to DHT 11 . It has been reported that BCA has no direct effect on AR. AR is one of the most mutated genes in advanced prostate cancer. Most mutations locate in the ligand binding domain (LBD) of AR, increasing the affinity to androgens or expand the ligand spectrum 13 , 14 . AR T877A was the earliest reported point mutation. It is the most common mutant with increased sensitivity to androgens. Bicalutamide, an antagonist to wild-type AR, is recognized by AR T877A as an agonist to activate AR signaling 15 – 17 . AR W741C provides bicalutamide resistance 18 , 19 . The reasons for the phenomenon are DNA-polymerase expression from high-fidelity subset to an error-prone subset, decrease in the expression levels of Mis Match Repair (MMR) proteins, and increase in the rate of multiple mutation and overall mutation frequency 20 . AR W741L also provides bicalutamide resistance. The three-dimensional structure has been reported the B ring of R-bicalutamide in the AR W741L mutant is accommodated at the location of the indole ring of Trp-741 in the AR WT bound to dihydrotestosterone 20 . AR F876L detectable in circulating cell-free DNA in patients with Enzalutamide-resistant CRPC, binds to enzalutamide as an agonist 21 . AR H875Y was first detected in CWR22 prostate cancer cells in 1997. 875 is located close to the binding site of enzalutamide, and then mutations in these sites may lead to an altered function of enzalutamide from antagonist to partial agonist or agonist 15 . Other mutations, including AR M750T , AR L702H , et al., are also being detected in Castration-Resistant Prostate Cancer (CRPC) 22 . The effect of BCA on these AR mutants has not been investigated. It is still unclear that patients with these mutations in AR will benefit from BCA or not. Here, we screened the degree to which all 12 common AR mutants respond to BCA. The affinity of BCA to AR mutants and downstream biological effects were evaluated to find patients most suitable for BCA treatment. We found that for AR mutants AR T877A and AR W741C , the drug Biochanin-A may become a new therapeutic after its resistance to drugs such as Enzalutamide. Moreover, the dual pharmacological effects of the drug may be able to become a new prostate cancer treatment. 2. Meterials and Methods 2.1 Cell lines and Cell culture LNCaP, HEK293T, and PC3 cells were cultured in RPMI-1640 (LNCaP, PC3) or DMEM (HEK293T) with 10% or 5% (PC3) fetal bovine serum (Lonsera, China). LAPC4 cells were grown in Iscove’s modified Dulbecco’s medium with IMDM, 10% fetal bovine serum, and 1% L-glutamine (Gibco, Life Technologies). VCaP cells were cultured in DMEM with 10% fetal bovine serum and 1% sodium pyruvate (final concentration 1 mM; Gibco, Life Technologies). Stable PC3 and LAPC4 cell lines with AR overexpression were established using lentiviral plasmids pLVX-tight-puro and pLVX-tet-on. All LNCaP, VCaP, and LAPC4 experiments were performed on plates coated with poly-DL-ornithine (Sigma-Aldrich, St. Louis, MO, USA). Hybribio authenticated all cell lines (Guangzhou, China). RPMI-1640, DMEM, and IMDM were purchased from Sigma-Aldrich. All cell lines were confirmed 10 . 2.2 Steroids and drugs Dehydroepiandrosterone was purchased from Steraoids Inc; Cat#A8500-000; Cas#53-43-0. Dihydrotestosterone, Biochanin A were purchased from MedChem Express (DHT: Cas#521-18-6; Cas#521-18-6; BCA: Cat#HY-14595; Cas#491-80-5). Enzalutimide was purchased from Shanghai Forever Synthesis Co Cas#915087-33-1. Puromycin was purchased from GIBCO Cat#A1113802. Darolutamide was purchased from MedChem Express (Cas#1297538-32-9) 23 . 2.3 Gene expression assay Cells were starved for at least 48h with phenol red-free and 10% Charcoal stripped serum (Lonsera, China) and treated with DHEA, DHT (Steraoids Inc, US), or other drugs for 24h. Then we use Cell to cDNA Kit (EZ Bioscience, China) for cDNA synthesis directly. Real time quantitative PCR (RT-qPCR) experiment was conducted in Bio-Rad CFX96 (Bio-Rad), using EZ Bioscience 2x SYBR Green qPCR master mix (EZ Bioscience, China). The primers for qPCR: RPLP0: F- ATGGCAGCATCTACAACCCT; R- AGGACTCGTTTGTACCCGTT. PSA: F- GCATGGGATGGGGATGAAGTAAG; R- CATCAAATCTGAGGGTTGTCTGGA. TMPRSS2: F- CCATTTGCAGGATCTGTCTG; R- GGATGTGTCTTGGGGAGCAA. FKBP5: F- TAGGCTTCCCTGCCTCTCCAAA; R- GCGAAGGAGAAGACCACGACAT. They have been described in a previous study. All gene expression assays were performed in technical duplication and repeated three times in independent experiments 11 . 2.4 AR competition assay 150,000 cells were seeded in a 12-well plate and starved in phenol red-free medium with 5% CSS for 48 h. The cells were then treated with 1nM [ 3 H] R1881 (PerkinElmer, USA) and other steroids and drugs at specified concentrations for 30 min. After that, the cells were washed three times with PBS. Intracellular radioactivity was measured using the Tri-Carb 5110TR Low Activity Liquid Scintillation Analyzer (PerkinElmer, Waltham, MA, USA), and protein concentration was detected with a microplate reader (BioTeK, Winooski, VT, USA) at an absorbance of 562 nm 10 . 2.5 Cell proliferation assay We seeded 20,000 cells per well in 100 mL aliquots in a 96-well plate. The cells were starved for at least 48 h in phenol red-free medium with 5% charcoal-stripped serum (Lonsera, China) and then treated with steroids and drugs. Cell proliferation was assessed using a cell counting kit-8 (Beyotime, China). After 2 h, the absorbance was measured at 450 nm and 600 nm using a microplate reader (BioTeK, US). The growth curve was calculated using GraphPad Prism 8.0 software (San Diego, CA, US). Results are presented as the mean and standard deviation from one representative experiment. The experiments were conducted in five replicates and repeated independently at least three times 11 . 2.6 Luciferase reporter assay Dr. Jun Yan (Fudan University, Shanghai, China) kindly provided the PSA-luciferase reporter and transfected with Renilla reporter into PC3 stable cells. Cells were treated with R1881 and drugs for 24 h. The Envision system determined luciferase activity. The kit was purchased in Promoga(#E1910), and the assay was done using the protocol. 2.7 Western blotting Total protein was extracted from cells using RIPA buffer containing Pierce™ protease inhibitors (Thermo Fisher Scientific). The ultrasound machine disrupted cells. Total protein was quantified with Pierce™ BCA Protein Assay (Thermo Fisher Scientific). The primary antibodies used were as follows: anti-AR(#sc-7305, 1:1,000, Santa Cruz), anti-FLAG(#ab213519, 1:1,000, abcam), anti-β-actin (#AC038, 1:10,000, ABclonal) 24 . 2.8 Docking To analyze the binding affinities and modes of interaction between the drug candidate and their targets, AutodockVina 1.2.2, a silico protein–ligand docking software was employed. The molecular structure of Biochanin A was retrieved from PubChem Compound ( https://pubchem.ncbi.nlm.nih.gov/ ) [2]. The 3D coordinates of AR (PDB ID, 2PIW) were downloaded from the PDB ( http://www.rcsb.org/pdb/home/home.do ). For docking analysis, all protein and molecular files were converted into PDBQT format with all water molecules excluded and polar hydrogen atoms were added. The grid box was centered to cover each protein's domain and accommodate free molecular movement. PyMOL presented the docked ligand-protein complexes in 3D 11 . 2.9 Mouse xenograft studies All mouse studies were conducted under a protocol approved by the Institutional Animal Care and Use Committee(IACUC: SIBCB-S373-2304-10). Male NOD-SCID mice (aged 6 to 8 weeks) were kept in a specific pathogen free (SPF) facility. A total of 8,000,000 cells were implanted subcutaneously into the right flank of intact mice with Matrigel (#354234, Corning, BD Bio coat). Mice were castrated and implanted with T sustained-released pellets (EZBioscience, China) randomly assigned into different groups when the xenografts reached approximately 150 mm 3 . Water containing 5% sucrose and 2 mg/ml doxycycline was replaced every 2 days. The BCA dose was 50 mg/kg. When the tumor volume reached 1500mm 3 , the mice were sacrificed and counted. 2.10 Statistics All the data were analyzed statistically using Student’s t-test (two groups), *P < 0.05, **P < 0.01, ***P < 0.001 are determined as significance. All analyses were performed using the GraphPad Prism 8.0 software (GraphPad Software, CA, USA). Data represent the mean ± standard deviation (SD), unless indicated otherwise. 3. Results BCA has different effects on different genotypes of prostate cancer cells. To determine the potential effects of BCA on AR mutatnts, LNCaP and VCaP, with AR T877A and wild-type AR, respectively, were treated with BCA with or without DHT. BCA has been reported to inhibit DHEA metabolism but show limited effect on wild-type AR directly (Fig. 1 A) 25 . Consistently, BCA showed limited effect on DHT-induced gene expression in VCaP cells (Fig. 1 B). Surprisingly, BCA of 1 µM inhibited DHT-induced gene expression in LNCaP cells and this effect was more obvious when LNCaP cells were treated with BCA of 10 µM (Fig. 1 C). Enzalutamide, the AR antagonist, inhibited DHT function in both LNCaP and VCaP cells 26 . Consistently, BCA of 10 µM inhibited cell proliferation in LNCaP cells but not VCaP cells (Fig. 1 D and E). To prove the direct effect of BCA on AR mutants, competition assay was performed. LNCaP and VCaP cells were treated with [ 3 H]-R1881 together with BCA or DHT. DHT competed with [ 3 H]-R1881 efficiently in both cell lines. BCA showed related high affinity to AR T877A mutant in LNCaP cells but limited affinity to wild-type AR in VCaP cells (Fig. 1 F and G). These results together demonstrate that BCA directly inhibits AR T877A . Effect of BCA to different AR mutants. The effect of BCA on other AR mutants was further determined. AR mutants which are most frequently detected in patients were stably expressed in PC3 cells which express no endogenous AR. Affinity of BCA to AR mutants were determined by treating PC3 cells expressing different AR mutants with [ 3 H]-R1881 and BCA. It requires 100 µM BCA to block the binding of [ 3 H]-R1881 to wild-type AR, AR L702H , AR W741L , AR M750T , AR V867M , AR H875Y , AR P893S , AR H730P , AR Q903H and AR F876L (Fig. 2 A-J) 27 – 29 . AR T877A and AR W741C were more sensitive to BCA and BCA of 10 µM significantly suppressed the binding of [ 3 H]-R1881 to these two mutants (Fig. 2 K and L). Enzalutamide was also utilized in this system to evaluate the affinity of BCA to AR T877A and AR W741C . Although the inhibitory effect of BCA was less potent, comparing to enzalutamide in PC3 cells expressing AR W741C , the inhibitory effect of BCA is significant enough. Similar results were observed in PC3 cells expressing AR T877A . Together, these data demonstrate that BCA has strong affinity to AR T877A and AR W741C . The biological effect of BCA on AR T877A and AR W741C was further test. PSA-ARE and Renilla luciferase plasmids were co-transfected into PC3 cells expressing AR W741C and AR T877A and treated with BCA and enzalutamide. Consistently, BCA of 1µM showed mild inhibitory effect. With an increase in the concentration of the BCA, the inhibitory effect gradually enhanced. Enzalutamide has the same trend with BCA (Figs. 3 A and B). Together, these results demonstrate that BCA suppresses the function of AR T877A and AR W741C directly in a dose-dependent manner 30 . BCA affects androgen signaling pathway activation and function of AR W741C and AR T877A mutations. Subsequently, the inhibitory effect of BCA on AR mutants was investigated in hormone-sensitive LAPC4 cells. LAPC4-AR W741C and LAPC4-AR T877A were generated in LAPC4 cells with AR W741C and AR T877A , respectively, inducibly expressed by doxycycline (Dox) (Fig. 4 A). DHT enhanced the expression of the AR target gene, PSA. Enzalutamide suppressed DHT function in LAPC4 cells, and BCA of 10 µM showed limited effect on DHT function in LAPC4 cells (Fig. 4 B). Consistently, enzalutamide inhibited DHT-induced cell proliferation, and BCA had no effect on cell proliferation with or without DHT treatment (Fig. 4 C). However, in LAPC4-AR W741C cells, BCA of 10 µM successfully inhibited PSA expression and cell proliferation in LAPC4-AR W741C (Fig. 4 D and E). Furthermore, cell proliferation and PSA expression were suppressed by BCA in LAPC4-AR T877A cells (Fig. 4 F and G). Through the molecular docking model, we found that BCA can bind to some sites of AR proteins. The binding energy was − 7.4 kcal/mol. (Fig. 4 H). Next, we validated it in vivo experiments. Xenograft in mice showed that BCA inhibited tumor growth in the two mutated LAPC4 cell lines (Fig. 4 I and J). Together, these results demonstrate that BCA inhibits the biological function of AR W741C and AR T877A . BCA and enzalutamide and its analogues have different affinities for AR T877A , AR W741C and AR F876L mutations. The different responses of AR mutants to BCA indicate that AR genotype affect the affinity of AR to its substrate. Currently, different AR antagonists have been developed and they might have different affinity to AR mutants. Darolutamide and enzalutamide were selected for competition assay in PC3 cells stably expressing different AR mutants. Enzalutamide and darolutamide have similar affinity to AR H875Y , AR V867M , and AR W741L (Fig. 5 A-C). Enzalutamide is preferentially bound to AR T877A and AR F876L (Fig. 5 D and E). darolutamide is preferentially bound to AR W741C (Fig. 5 F) 18 . Darolutamide and BCA inhibited PSA analogously and AR protein expression (Fig. 5 G and H). These data indicate that patients with AR W741C mutation might benefit more from darolutamide and BCA. 4. Discussion Androgen receptor plays an important role in prostate cancer. Enzalutamide competitively inhibits the binding of androgens to AR for disease treatment. With inevitable drug resistance, 3βHSD1 enzyme has been reported recently as a promising target to overcome enzalutamide resistance and BCA is a potent 3βHSD1 inhibitor to block steroidogenesis 10 , 11 , 24 . What we had done before illustrated that BCA was a potential drug in clinical prostate cancer treatment. Here, we investigated the affinity and direct biology effect of BCA to different AR mutants, to find potential patients most suitable for BCA treatment. Our results demonstrate that BCA directly binds to AR T877A and AR W741C as an antagonist 31 , 32 . Previously, BCA was reported to directly inhibit 3βHSD1 activity but show no direct effect on wild type AR. However, AR is one of the most mutated gene in prostate cancer and AR mutation is an important mechanism for treatment resistance. The most common mutations occurred in AR-LBD and a few in N-terminal domain (NTD). 10–20% of CRPC patients are known to possess somatic AR gene mutations. As mentioned above, AR T877A ; AR W741C ; AR W741L ; AR F876L and AR H875Y , these mutations were also revealed to change the binding affinity of ligands including anti-androgen drugs and steroids and potentially lead to altered responses to AR pathway inhibitors. Our results indicate that patients with AR T877A and AR W741C might benefit from BCA more. In these patients, BCA not only suppresses androgen synthesis, but directly binds to AR mutants to inhibit their biological effects to suppress the development of prostate cancer. Enzalutamide binds to AR to inhibit androgen-induced AR nuclear localization and AR recruitment into DNA. At present, other drugs targeting AR are also being developed. Dalorutamide has a similar structure to enzalutamide and apalutamide, and they all have a high affinity to wild-type AR 28 , 33 , 34 . The different affinities of BCA to AR mutants inspire us to find the difference between darolutamide and enzalutamide when binding to AR mutants. Enzalutamide showed higher affinity to AR T877A and darolutamde preferentially binds to AR W741C . Although enzalutamide also had a strong affinity to AR F876L , AR F876L recognizes enzalutamide as an agonist 35 . Thus, the development of AR inhibitors should pay attention to diverse response in patients with different AR mutants. Today, various small-molecule drugs with different functions are being developed. Small molecules have different mechanisms of AR inhibition. For instance, JJ-450 can inhibit AR independent of LBD 36 , 37 . (+)-JJ-74-138, which has a similar structure to JJ-450, is more potent than JJ-450 in inhibiting androgen-independent AR activity in enzalutamide-resistant cells. ASC-J9 inhibit AR F876L via induction of the mutant AR degradation as an AR degradation enhancer 38 . And EPI-001 can inhibit AR F876L by targeting the N-terminal domain of AR 39 . Exploring the mechanism of targeting AR and its mutations with many different small molecule drugs can provide a new treatment plan for the disease process after endogenous drug resistance. In this paper, we have found the drug BCA, the previously reported 3βHSD1 inhibitor, directly binds to and inhibits AR T877A and AR W741C . Patients with AR W741C expression might benefit from BCA and darolutamide. Data accessibility The data supporting this study's findings are available from the corresponding author [ [email protected] ] upon reasonable request. Abbreviations AR androgen receptor BCA Biochanin-A ADT androgen receptor deprivation therapy DHT dihydrotestosterone DHEA dehydroepiandrosterone LBD ligand binding domain MMR Mis Match Repair CRPC Castration-Resistant Prostate Cancer Dox doxycycline NTD N-terminal domain Declarations Funding Declaration This study was supported by National Natural Science Foundation of China(82372738). Ethics approval and consent to participate All mouse studies were conducted under a protocol approved by the Institutional Animal Care and Use Committee(IACUC: SIBCB-S373-2304-10). And all methods were performed in accordance with the relevant guidelines and regulations of the Basel Declaration. Consent for publication Not applicable. Competing interests The authors declare no competing interests. Author Contribution Y.C and C.W conducted the experiments. Y.C, T.Y and Y.L designed the experiments and analyzed the data. Y.C, D.W and S.S wrote the paper. Acknowledgements Not applicable. Data Availability The data supporting this study's findings are available from the corresponding author [ [email protected] ] upon reasonable request. References Siegel RL, Miller KD, Wagle NS, Jemal A. Cancer statistics, 2023. CA Cancer J Clin. 2023;73:17–48. https://doi.org/10.3322/caac.21763 . Hou Z, Huang S, Li Z. Androgens in prostate cancer: A tale that never ends. Cancer Lett. 2021;516:1–12. https://doi.org/10.1016/j.canlet.2021.04.010 . Sharifi N, Auchus RJ. Steroid biosynthesis and prostate cancer. Steroids. 2012;77:719–26. https://doi.org/10.1016/j.steroids.2012.03.015 . Isbarn H, et al. Androgen deprivation therapy for the treatment of prostate cancer: consider both benefits and risks. Eur Urol. 2009;55:62–75. https://doi.org/10.1016/j.eururo.2008.10.008 . Chen K, et al. Combination treatment in metastatic prostate cancer: is the bar too high or have we fallen short? Nat Rev Urol. 2022. https://doi.org/10.1038/s41585-022-00669-z . de Bono JS, et al. Abiraterone and increased survival in metastatic prostate cancer. N Engl J Med. 2011;364:1995–2005. https://doi.org/10.1056/NEJMoa1014618 . Scher HI, et al. Increased survival with enzalutamide in prostate cancer after chemotherapy. N Engl J Med. 2012;367:1187–97. https://doi.org/10.1056/NEJMoa1207506 . Alyamani M, et al. HSD3B1(1245A > C) variant regulates dueling abiraterone metabolite effects in prostate cancer. J Clin Invest. 2018;128:3333–40. https://doi.org/10.1172/JCI98319 . Hearn JWD, et al. Association of HSD3B1 Genotype With Response to Androgen-Deprivation Therapy for Biochemical Recurrence After Radiotherapy for Localized Prostate Cancer. JAMA Oncol. 2018;4:558–62. https://doi.org/10.1001/jamaoncol.2017.3164 . Hou Z, et al. Inhibiting 3betaHSD1 to eliminate the oncogenic effects of progesterone in prostate cancer. Cell Rep Med. 2022;3:100561. https://doi.org/10.1016/j.xcrm.2022.100561 . Mei Z, et al. Management of prostate cancer by targeting 3betaHSD1 after enzalutamide and abiraterone treatment. Cell Rep Med. 2022;3:100608. https://doi.org/10.1016/j.xcrm.2022.100608 . Singh-Gupta V, et al. Daidzein effect on hormone refractory prostate cancer in vitro and in vivo compared to genistein and soy extract: potentiation of radiotherapy. Pharm Res. 2010;27:1115–27. https://doi.org/10.1007/s11095-010-0107-9 . Nyquist MD, et al. TALEN-engineered AR gene rearrangements reveal endocrine uncoupling of androgen receptor in prostate cancer. Proc Natl Acad Sci U S A. 2013;110:17492–7. https://doi.org/10.1073/pnas.1308587110 . Zhang H, et al. Simulating androgen receptor selection in designer yeast. Synth Syst Biotechnol. 2022;7:1108–16. https://doi.org/10.1016/j.synbio.2022.07.005 . Shiota M, et al. Androgen receptor mutations for precision medicine in prostate cancer. Endocr Relat Cancer. 2022;29:R143–55. https://doi.org/10.1530/ERC-22-0140 . Zhao XY, et al. Glucocorticoids can promote androgen-independent growth of prostate cancer cells through a mutated androgen receptor. Nat Med. 2000;6:703–6. https://doi.org/10.1038/76287 . Veldscholte J, et al. The androgen receptor in LNCaP cells contains a mutation in the ligand binding domain which affects steroid binding characteristics and response to antiandrogens. J Steroid Biochem Mol Biol. 1992;41:665–9. https://doi.org/10.1016/0960-0760(92)90401-4 . Wang A, et al. Design, Synthesis, and Biological Evaluation of Androgen Receptor Degrading and Antagonizing Bifunctional Steroidal Analogs for the Treatment of Advanced Prostate Cancer. J Med Chem. 2022;65:12460–81. https://doi.org/10.1021/acs.jmedchem.2c01164 . Liu H, Han R, Li J, Liu H, Zheng L. Molecular mechanism of R-bicalutamide switching from androgen receptor antagonist to agonist induced by amino acid mutations using molecular dynamics simulations and free energy calculation. J Comput Aided Mol Des. 2016;30:1189–200. https://doi.org/10.1007/s10822-016-9992-2 . Bohl CE, Gao W, Miller DD, Bell CE, Dalton JT. Structural basis for antagonism and resistance of bicalutamide in prostate cancer. Proc Natl Acad Sci U S A. 2005;102:6201–6. https://doi.org/10.1073/pnas.0500381102 . Korpal M, et al. An F876L mutation in androgen receptor confers genetic and phenotypic resistance to MDV3100 (enzalutamide). Cancer Discov. 2013;3:1030–43. https://doi.org/10.1158/2159-8290.CD-13-0142 . Conteduca V, et al. Androgen receptor gene status in plasma DNA associates with worse outcome on enzalutamide or abiraterone for castration-resistant prostate cancer: a multi-institution correlative biomarker study. Ann Oncol. 2017;28:1508–16. https://doi.org/10.1093/annonc/mdx155 . Tan Q, et al. Celastrol recruits UBE3A to recognize and degrade the DNA binding domain of steroid receptors. Oncogene. 2022;41:4754–67. https://doi.org/10.1038/s41388-022-02467-8 . Zhang X, et al. Active DHEA uptake in the prostate gland correlates with aggressive prostate cancer. J Clin Invest. 2023;133. https://doi.org/10.1172/JCI171199 . Ma X, Zhou W, Zou Q, Ouyang P. Structural elucidation of the impurities in Enzalutamide bulk drug and the development, validation of corresponding HPLC method. J Pharm Biomed Anal. 2016;131:436–43. https://doi.org/10.1016/j.jpba.2016.08.036 . Tran C, et al. Development of a second-generation antiandrogen for treatment of advanced prostate cancer. Science. 2009;324:787–90. https://doi.org/10.1126/science.1168175 . Ledet EM, et al. Comprehensive Analysis of AR Alterations in Circulating Tumor DNA from Patients with Advanced Prostate Cancer. Oncologist. 2020;25:327–33. https://doi.org/10.1634/theoncologist.2019-0115 . Borgmann H, et al. Moving Towards Precision Urologic Oncology: Targeting Enzalutamide-resistant Prostate Cancer and Mutated Forms of the Androgen Receptor Using the Novel Inhibitor Darolutamide (ODM-201). Eur Urol. 2018;73:4–8. https://doi.org/10.1016/j.eururo.2017.08.012 . V GA, et al. Clinical, cytogenetic and molecular analysis of androgen insensitivity syndromes from south Indian cohort and detection and in-silico characterization of androgen receptor gene mutations. Clin Chim Acta. 2016;453:123–30. https://doi.org/10.1016/j.cca.2015.12.012 . Han Y et al. Triptolide Inhibits the AR Signaling Pathway to Suppress the Proliferation of Enzalutamide Resistant Prostate Cancer Cells. Theranostics 7, 1914–1927 (2017). https://doi.org/10.7150/thno.17852 Young FP, et al. Biomarkers of Castrate Resistance in Prostate Cancer: Androgen Receptor Amplification and T877A Mutation Detection by Multiplex Droplet Digital PCR. J Clin Med. 2022;11. https://doi.org/10.3390/jcm11010257 . Lundqvist J, Tringali C, Oskarsson A. Resveratrol, piceatannol and analogs inhibit activation of both wild-type and T877A mutant androgen receptor. J Steroid Biochem Mol Biol. 2017;174:161–8. https://doi.org/10.1016/j.jsbmb.2017.08.016 . Chi KN, et al. Apalutamide for Metastatic, Castration-Sensitive Prostate Cancer. N Engl J Med. 2019;381:13–24. https://doi.org/10.1056/NEJMoa1903307 . Yu J, et al. Discovery and biological evaluation of darolutamide derivatives as inhibitors and down-regulators of wild-type AR and the mutants. Eur J Med Chem. 2019;182:111608. https://doi.org/10.1016/j.ejmech.2019.111608 . Prekovic S, et al. The Effect of F877L and T878A Mutations on Androgen Receptor Response to Enzalutamide. Mol Cancer Ther. 2016;15:1702–12. https://doi.org/10.1158/1535-7163.MCT-15-0892 . Wu Z, et al. A novel androgen receptor antagonist JJ-450 inhibits enzalutamide-resistant mutant AR(F876L) nuclear import and function. Prostate. 2020;80:319–28. https://doi.org/10.1002/pros.23945 . Cole RN, et al. (+)-JJ-74-138 is a Novel Noncompetitive Androgen Receptor Antagonist. Mol Cancer Ther. 2022;21:483–92. https://doi.org/10.1158/1535-7163.MCT-21-0432 . Wang R, et al. ASC-J9((R)) suppresses castration resistant prostate cancer progression via degrading the enzalutamide-induced androgen receptor mutant AR-F876L. Cancer Lett. 2016;379:154–60. https://doi.org/10.1016/j.canlet.2016.05.018 . Nicolescu RCB et al. Hybrid Androgen Receptor Inhibitors Outperform Enzalutamide and EPI-001 in in vitro Models of Prostate Cancer Drug Resistance. ChemMedChem , e202200548 (2022). https://doi.org/10.1002/cmdc.202200548 Additional Declarations No competing interests reported. Supplementary Files WBORIGINAL.zip WBOriginalwithBOX.zip WB5Hwithmarker.zip Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6311929","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":462672357,"identity":"adf2747a-7034-4aa5-a527-c1033aafa930","order_by":0,"name":"Yongnan Chi","email":"","orcid":"","institution":"City University of Hong Kong","correspondingAuthor":false,"prefix":"","firstName":"Yongnan","middleName":"","lastName":"Chi","suffix":""},{"id":462672363,"identity":"7f1c68b0-da00-42f9-b4bf-b8648742ef38","order_by":1,"name":"Chenyang Wang","email":"","orcid":"","institution":"Tongji University","correspondingAuthor":false,"prefix":"","firstName":"Chenyang","middleName":"","lastName":"Wang","suffix":""},{"id":462672366,"identity":"22486e95-54cd-4f58-b9b8-009997fc40d3","order_by":2,"name":"Tao Yang","email":"","orcid":"","institution":"Tongji University","correspondingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Yang","suffix":""},{"id":462672368,"identity":"2df4c18a-1d4a-4b09-a70f-1fbfdb314407","order_by":3,"name":"Ying Liu","email":"","orcid":"","institution":"Tongji University","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Liu","suffix":""},{"id":462672370,"identity":"6f80ed2e-48dc-4851-bf65-eef0f4409768","order_by":4,"name":"Denglong Wu","email":"","orcid":"","institution":"Tongji University","correspondingAuthor":false,"prefix":"","firstName":"Denglong","middleName":"","lastName":"Wu","suffix":""},{"id":462672372,"identity":"9a6a92c0-9b35-4a5c-8cf9-d8f691c62a84","order_by":5,"name":"Shengsong Huang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIiWNgGAWjYBACAyD+8ABI8oO5PBJAIoGgFsYZCUBSso00LSDGMbgYAS3m/McfNiQU3JEzvt987OEXGQsGfvYcA4afO3BrsZyRY9iQYPDM2OwYW7qxDNBhkj1vDBh7z+Bx2A0e9gcJBocTtx3jMZOWAGoxuJFjwMzYhkfLeZDDDA7Xb26DarEnqOVAAshhhxMM2HjMJD+AbJEgpOUG2C+HDWccS0uTBgYyj8SZZwUHewk57MOfw/L8zYePSf7sqZPjb0/e+OAnHi0ogJm3h4EHxDhApAZgpP74QbTaUTAKRsEoGEEAAHxvTwVwOLxsAAAAAElFTkSuQmCC","orcid":"","institution":"Tongji University","correspondingAuthor":true,"prefix":"","firstName":"Shengsong","middleName":"","lastName":"Huang","suffix":""}],"badges":[],"createdAt":"2025-03-26 11:38:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6311929/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6311929/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83646368,"identity":"c02564a8-af7c-4095-a188-6ac3b2e8d1bf","added_by":"auto","created_at":"2025-05-30 05:37:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":268256,"visible":true,"origin":"","legend":"\u003cp\u003eBCA directly inhibits \u003cem\u003eAR\u003c/em\u003e function in LNCaP but not VCaP cells.\u003c/p\u003e\n\u003cp\u003e(A) Schema for BCA and enzalutamide function. BCA inhibits the activity of 3βHSD1. BCA may affect the binding of DHT to \u003cem\u003eAR\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e(B) BCA directly inhibits DHT-induced expression of \u003cem\u003eAR\u003c/em\u003e target genes in LNCaP cells. DHT, 1nM; Enz, 1μM;\u003c/p\u003e\n\u003cp\u003e(C) BCA showed no effect on DHT-induced expression of \u003cem\u003eAR\u003c/em\u003e target genes in VCaP cells. DHT 1nM, Enz 1μM, BCA 1μM and 10μM.\u003c/p\u003e\n\u003cp\u003e(D) Cell growth of LNCaP cells when treated with enzalutamide or BCA, with or without 1nM DHT.\u003c/p\u003e\n\u003cp\u003e(E)\u0026nbsp; Cell growth of VCaP cells when treated with enzalutamide or BCA together with DHT 1 nM.\u003c/p\u003e\n\u003cp\u003e(F)\u0026nbsp; Affinity of BCA to \u003cem\u003eAR\u003c/em\u003e\u003csup\u003e\u003cem\u003eT877A\u003c/em\u003e\u003c/sup\u003e in LNCaP cells. DHT and BCA were used to compete 1 nM [\u003csup\u003e3\u003c/sup\u003eH]-R1881 to bind to \u003cem\u003eAR\u003c/em\u003e. Biological replicate, n = 3.\u003c/p\u003e\n\u003cp\u003e(G) Affinity of BCA to \u003cem\u003eAR\u003c/em\u003e in VCaP cells. DHT and BCA was used to compete 1 nM [\u003csup\u003e3\u003c/sup\u003eH]-R1881 to bind to \u003cem\u003eAR\u003c/em\u003e. Biological replicate, n = 3.\u003c/p\u003e\n\u003cp\u003e*p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001. Results are presented as mean ± SD. Experiments were performed at least three times independently.\u003c/p\u003e","description":"","filename":"fig1new.png","url":"https://assets-eu.researchsquare.com/files/rs-6311929/v1/e896446194c69aea4290272f.png"},{"id":83646369,"identity":"e22ac8d6-12c7-44e9-b589-0f300224ebad","added_by":"auto","created_at":"2025-05-30 05:37:25","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":190317,"visible":true,"origin":"","legend":"\u003cp\u003eAffinity of BCA to 12 different LBD mutations.\u003c/p\u003e\n\u003cp\u003e(A-L) 12 different\u003cem\u003e AR\u003c/em\u003e mutants were transfected into PC3 to generate stable cell lines. DHT and BCA were used to compete 1 nM [\u003csup\u003e3\u003c/sup\u003eH]-R1881 to bind to \u003cem\u003eAR\u003c/em\u003e. Biological replicate, n = 3.\u003c/p\u003e\n\u003cp\u003e*p \u0026lt; 0.05; ***p \u0026lt; 0.001. Results are presented as mean ± SD. Experiments were performed at least three times independently.\u003c/p\u003e","description":"","filename":"fig2new.png","url":"https://assets-eu.researchsquare.com/files/rs-6311929/v1/7fa652b88d49c689384d78a0.png"},{"id":83645938,"identity":"c5b4e824-0bd4-4f9d-b343-b58d01565260","added_by":"auto","created_at":"2025-05-30 05:29:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":198628,"visible":true,"origin":"","legend":"\u003cp\u003eBCA inhibits PSA luciferase expression with concentration gradient dependence.\u003c/p\u003e\n\u003cp\u003e(A-B) Plasmids expressing PSA-luciferase were transfected in \u003cem\u003eAR\u003c/em\u003e\u003csup\u003e\u003cem\u003eT877A\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAR\u003c/em\u003e\u003csup\u003e\u003cem\u003eW741C\u003c/em\u003e\u003c/sup\u003e PC3 stable cell lines. Biological replicate, n=3.\u003c/p\u003e\n\u003cp\u003e***p \u0026lt; 0.001. Results are presented as mean ± SD.\u003c/p\u003e","description":"","filename":"fig3new.png","url":"https://assets-eu.researchsquare.com/files/rs-6311929/v1/4b1fdf9c464249ad94886afb.png"},{"id":83645936,"identity":"d29ae3d7-1d52-46ad-8d60-568d3453c480","added_by":"auto","created_at":"2025-05-30 05:29:25","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":235306,"visible":true,"origin":"","legend":"\u003cp\u003eBCA antagonizes the function of \u003cem\u003eAR\u003c/em\u003e\u003csup\u003e\u003cem\u003eT877A\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eAR\u003c/em\u003e\u003csup\u003e\u003cem\u003eW741C\u003c/em\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e(A) \u003cem\u003eAR\u003c/em\u003e expression in LAPC4 stable cell lines induced by doxycycline (Dox); 1 ug/mL.\u003c/p\u003e\n\u003cp\u003e(B-C) BCA shows no effect on wild type \u003cem\u003eAR\u003c/em\u003e function. DHT 1nM, Enz 1μM, BCA 10μM.\u003c/p\u003e\n\u003cp\u003e(D-E) BCA suppressed the function of \u003cem\u003eAR\u003c/em\u003e\u003csup\u003e\u003cem\u003eW741C\u003c/em\u003e\u003c/sup\u003e and cell growth of LAPC4-\u003cem\u003eAR\u003c/em\u003e\u003csup\u003e\u003cem\u003eW741C\u003c/em\u003e\u003c/sup\u003e cells. DHT 1nM, Enz 1μM, BCA 10μM.\u003c/p\u003e\n\u003cp\u003e(F-G) BCA suppressed the function of \u003cem\u003eAR\u003c/em\u003e\u003csup\u003e\u003cem\u003eT877A\u003c/em\u003e\u003c/sup\u003e and cell growth of LAPC4-\u003cem\u003eAR\u003c/em\u003e\u003csup\u003e\u003cem\u003eT877A\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003ecells. BCA can inhibit it. DHT 1nM, Enz 1μM, BCA 10μM.\u003c/p\u003e\n\u003cp\u003e(H) Docking of BCA with the \u003cem\u003eAR\u003c/em\u003e model. BCA: green. Carbon: light blue. Dark blue: nitrogen. Red: Oxygen. Yellow: sulfur.\u003c/p\u003e\n\u003cp\u003e(I-J) Result of LAPC4-\u003cem\u003eAR\u003c/em\u003e mutant Xenograft. Tumor volume, mouse weight, and tumor weight statistics were included. BCA can inhibit the tumor growth.\u003c/p\u003e\n\u003cp\u003e*p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001. Results are presented as mean ± SD. Experiments were performed at least three times independently.\u003c/p\u003e","description":"","filename":"fig4new.png","url":"https://assets-eu.researchsquare.com/files/rs-6311929/v1/87c823167b123ebc441abd79.png"},{"id":83645937,"identity":"b11736e5-39a6-4fa4-b705-073db830ffa5","added_by":"auto","created_at":"2025-05-30 05:29:25","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":210008,"visible":true,"origin":"","legend":"\u003cp\u003eFunction of enzalutamide and darolutamide to different \u003cem\u003eAR\u003c/em\u003e mutants.\u003c/p\u003e\n\u003cp\u003e(A-F) Affinity of enzalutamide and darolutamide to \u003cem\u003eAR\u003c/em\u003e mutants. \u0026nbsp;Different doses of enzalutamide and darolutamide were used to compete 1 nM [\u003csup\u003e3\u003c/sup\u003eH]-R1881 to bind to \u003cem\u003eAR\u003c/em\u003e in different PC3 stable cell lines. Biological replicate, n = 3.\u003c/p\u003e\n\u003cp\u003e(G) Darolutamide and BCA suppressed the function of \u003cem\u003eAR\u003c/em\u003e\u003csup\u003e\u003cem\u003eW741C\u003c/em\u003e\u003c/sup\u003e. DHT 1nM, Daro 1μM, BCA 10μM.\u003c/p\u003e\n\u003cp\u003e(H) Darolutamide and BCA suppressed the AR protein level of \u003cem\u003eAR\u003c/em\u003e\u003csup\u003e\u003cem\u003eW741C\u003c/em\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e**p \u0026lt; 0.01; ***p \u0026lt; 0.001. Results are presented as mean ± SD. Experiments were performed at least three times independently.\u003c/p\u003e","description":"","filename":"fig5new.png","url":"https://assets-eu.researchsquare.com/files/rs-6311929/v1/ebf636a324eacf16730fa0f2.png"},{"id":92717406,"identity":"22b38533-cbfc-43f3-a5cb-8f244953af1e","added_by":"auto","created_at":"2025-10-03 12:46:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1774028,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6311929/v1/5541b6ba-b4bf-4138-a688-e53c66d8fd8b.pdf"},{"id":83645941,"identity":"4ddd23e7-dd94-43f4-bbf9-181bc1050579","added_by":"auto","created_at":"2025-05-30 05:29:26","extension":"zip","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":11755127,"visible":true,"origin":"","legend":"","description":"","filename":"WBORIGINAL.zip","url":"https://assets-eu.researchsquare.com/files/rs-6311929/v1/1f17662fab0d9e52e47dae67.zip"},{"id":83645940,"identity":"3227ed2b-835c-4b89-932f-b28d35e3f950","added_by":"auto","created_at":"2025-05-30 05:29:26","extension":"zip","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":10076450,"visible":true,"origin":"","legend":"","description":"","filename":"WBOriginalwithBOX.zip","url":"https://assets-eu.researchsquare.com/files/rs-6311929/v1/8b84c3bc3e13fcbe0c19b52f.zip"},{"id":83645939,"identity":"51d0450b-dff3-479a-95d7-7f1429f866d3","added_by":"auto","created_at":"2025-05-30 05:29:26","extension":"zip","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1679858,"visible":true,"origin":"","legend":"","description":"","filename":"WB5Hwithmarker.zip","url":"https://assets-eu.researchsquare.com/files/rs-6311929/v1/34a607a86d6929fc5b1b1aaf.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"Biochanin-A inhibits the activity of androgen receptor mutants to suppress the development of prostate cancer","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eGlobally, prostate cancer ranks second to lung cancer in incidence and is one of the leading causes of cancer deaths among Western men\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Prostate cancer is driven by androgens which binds to the androgen receptor (AR) to activate AR signaling\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Androgen receptor deprivation therapy (ADT) is the front line to treat advanced prostate cancer\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Over the past decade, several new treatments have been developed and the next androgen pathway inhibitors, including abiraterone and enzalutamide, successfully prolonged patient treatment duration and life span. However, drug resistance is inevitable and the discovery of new drugs is essential for further disease management\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe enzyme 3βHSD1 catalyzes the generation of dihydrotestosterone (DHT) from adrenal dehydroepiandrosterone (DHEA) and has been recognized as a promising target to overcome resistance to abiraterone and enzalutamide\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Biochanin-A (BCA) has recently been discovered as a potent inhibitor to 3βHSD1 and suppressed the development of prostate cancer in cell lines and mouse model\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Daidzein, the derivative of BCA, has been reported to reduce PSA levels in patients, supporting the promising role of 3βHSD1 in disease management\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Mechanistically, BCA directly inhibits 3βHSD1 and suppresses the conversion of DHEA to DHT\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. It has been reported that BCA has no direct effect on AR.\u003c/p\u003e \u003cp\u003eAR is one of the most mutated genes in advanced prostate cancer. Most mutations locate in the ligand binding domain (LBD) of AR, increasing the affinity to androgens or expand the ligand spectrum\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. AR\u003csup\u003eT877A\u003c/sup\u003e was the earliest reported point mutation. It is the most common mutant with increased sensitivity to androgens. Bicalutamide, an antagonist to wild-type AR, is recognized by AR\u003csup\u003eT877A\u003c/sup\u003e as an agonist to activate AR signaling\u003csup\u003e\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. AR\u003csup\u003eW741C\u003c/sup\u003e provides bicalutamide resistance\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The reasons for the phenomenon are DNA-polymerase expression from high-fidelity subset to an error-prone subset, decrease in the expression levels of Mis Match Repair (MMR) proteins, and increase in the rate of multiple mutation and overall mutation frequency\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. AR\u003csup\u003eW741L\u003c/sup\u003e also provides bicalutamide resistance. The three-dimensional structure has been reported the B ring of R-bicalutamide in the AR\u003csup\u003eW741L\u003c/sup\u003e mutant is accommodated at the location of the indole ring of Trp-741 in the AR\u003csup\u003eWT\u003c/sup\u003e bound to dihydrotestosterone\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. AR\u003csup\u003eF876L\u003c/sup\u003e detectable in circulating cell-free DNA in patients with Enzalutamide-resistant CRPC, binds to enzalutamide as an agonist\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. AR\u003csup\u003eH875Y\u003c/sup\u003e was first detected in CWR22 prostate cancer cells in 1997. 875 is located close to the binding site of enzalutamide, and then mutations in these sites may lead to an altered function of enzalutamide from antagonist to partial agonist or agonist\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Other mutations, including AR\u003csup\u003eM750T\u003c/sup\u003e, AR\u003csup\u003eL702H\u003c/sup\u003e, et al., are also being detected in Castration-Resistant Prostate Cancer (CRPC)\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. The effect of BCA on these AR mutants has not been investigated. It is still unclear that patients with these mutations in AR will benefit from BCA or not.\u003c/p\u003e \u003cp\u003eHere, we screened the degree to which all 12 common AR mutants respond to BCA. The affinity of BCA to AR mutants and downstream biological effects were evaluated to find patients most suitable for BCA treatment.\u003c/p\u003e \u003cp\u003eWe found that for AR mutants AR\u003csup\u003eT877A\u003c/sup\u003e and AR\u003csup\u003eW741C\u003c/sup\u003e, the drug Biochanin-A may become a new therapeutic after its resistance to drugs such as Enzalutamide. Moreover, the dual pharmacological effects of the drug may be able to become a new prostate cancer treatment.\u003c/p\u003e"},{"header":"2. Meterials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Cell lines and Cell culture\u003c/h2\u003e \u003cp\u003eLNCaP, HEK293T, and PC3 cells were cultured in RPMI-1640 (LNCaP, PC3) or DMEM (HEK293T) with 10% or 5% (PC3) fetal bovine serum (Lonsera, China). LAPC4 cells were grown in Iscove\u0026rsquo;s modified Dulbecco\u0026rsquo;s medium with IMDM, 10% fetal bovine serum, and 1% L-glutamine (Gibco, Life Technologies). VCaP cells were cultured in DMEM with 10% fetal bovine serum and 1% sodium pyruvate (final concentration 1 mM; Gibco, Life Technologies). Stable PC3 and LAPC4 cell lines with AR overexpression were established using lentiviral plasmids pLVX-tight-puro and pLVX-tet-on. All LNCaP, VCaP, and LAPC4 experiments were performed on plates coated with poly-DL-ornithine (Sigma-Aldrich, St. Louis, MO, USA). Hybribio authenticated all cell lines (Guangzhou, China). RPMI-1640, DMEM, and IMDM were purchased from Sigma-Aldrich. All cell lines were confirmed\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Steroids and drugs\u003c/h2\u003e \u003cp\u003eDehydroepiandrosterone was purchased from Steraoids Inc; Cat#A8500-000; Cas#53-43-0. Dihydrotestosterone, Biochanin A were purchased from MedChem Express (DHT: Cas#521-18-6; Cas#521-18-6; BCA: Cat#HY-14595; Cas#491-80-5). Enzalutimide was purchased from Shanghai Forever Synthesis Co Cas#915087-33-1. Puromycin was purchased from GIBCO Cat#A1113802. Darolutamide was purchased from MedChem Express (Cas#1297538-32-9)\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Gene expression assay\u003c/h2\u003e \u003cp\u003eCells were starved for at least 48h with phenol red-free and 10% Charcoal stripped serum (Lonsera, China) and treated with DHEA, DHT (Steraoids Inc, US), or other drugs for 24h. Then we use Cell to cDNA Kit (EZ Bioscience, China) for cDNA synthesis directly. Real time quantitative PCR (RT-qPCR) experiment was conducted in Bio-Rad CFX96 (Bio-Rad), using EZ Bioscience 2x SYBR Green qPCR master mix (EZ Bioscience, China). The primers for qPCR: RPLP0: F- ATGGCAGCATCTACAACCCT; R- AGGACTCGTTTGTACCCGTT. PSA: F- GCATGGGATGGGGATGAAGTAAG; R- CATCAAATCTGAGGGTTGTCTGGA. TMPRSS2: F- CCATTTGCAGGATCTGTCTG; R- GGATGTGTCTTGGGGAGCAA. FKBP5: F- TAGGCTTCCCTGCCTCTCCAAA; R- GCGAAGGAGAAGACCACGACAT. They have been described in a previous study. All gene expression assays were performed in technical duplication and repeated three times in independent experiments\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 AR competition assay\u003c/h2\u003e \u003cp\u003e150,000 cells were seeded in a 12-well plate and starved in phenol red-free medium with 5% CSS for 48 h. The cells were then treated with 1nM [\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003eH] R1881 (PerkinElmer, USA) and other steroids and drugs at specified concentrations for 30 min. After that, the cells were washed three times with PBS. Intracellular radioactivity was measured using the Tri-Carb 5110TR Low Activity Liquid Scintillation Analyzer (PerkinElmer, Waltham, MA, USA), and protein concentration was detected with a microplate reader (BioTeK, Winooski, VT, USA) at an absorbance of 562 nm\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Cell proliferation assay\u003c/h2\u003e \u003cp\u003eWe seeded 20,000 cells per well in 100 mL aliquots in a 96-well plate. The cells were starved for at least 48 h in phenol red-free medium with 5% charcoal-stripped serum (Lonsera, China) and then treated with steroids and drugs. Cell proliferation was assessed using a cell counting kit-8 (Beyotime, China). After 2 h, the absorbance was measured at 450 nm and 600 nm using a microplate reader (BioTeK, US). The growth curve was calculated using GraphPad Prism 8.0 software (San Diego, CA, US). Results are presented as the mean and standard deviation from one representative experiment. The experiments were conducted in five replicates and repeated independently at least three times\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Luciferase reporter assay\u003c/h2\u003e \u003cp\u003eDr. Jun Yan (Fudan University, Shanghai, China) kindly provided the PSA-luciferase reporter and transfected with Renilla reporter into PC3 stable cells. Cells were treated with R1881 and drugs for 24 h. The Envision system determined luciferase activity. The kit was purchased in Promoga(#E1910), and the assay was done using the protocol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Western blotting\u003c/h2\u003e \u003cp\u003eTotal protein was extracted from cells using RIPA buffer containing Pierce\u0026trade; protease inhibitors (Thermo Fisher Scientific). The ultrasound machine disrupted cells. Total protein was quantified with Pierce\u0026trade; BCA Protein Assay (Thermo Fisher Scientific). The primary antibodies used were as follows: anti-AR(#sc-7305, 1:1,000, Santa Cruz), anti-FLAG(#ab213519, 1:1,000, abcam), anti-β-actin (#AC038, 1:10,000, ABclonal)\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Docking\u003c/h2\u003e \u003cp\u003eTo analyze the binding affinities and modes of interaction between the drug candidate and their targets, AutodockVina 1.2.2, a silico protein\u0026ndash;ligand docking software was employed. The molecular structure of Biochanin A was retrieved from PubChem Compound (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubchem.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://pubchem.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [2]. The 3D coordinates of AR (PDB ID, 2PIW) were downloaded from the PDB (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.rcsb.org/pdb/home/home.do\u003c/span\u003e\u003cspan address=\"http://www.rcsb.org/pdb/home/home.do\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). For docking analysis, all protein and molecular files were converted into PDBQT format with all water molecules excluded and polar hydrogen atoms were added. The grid box was centered to cover each protein's domain and accommodate free molecular movement. PyMOL presented the docked ligand-protein complexes in 3D\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Mouse xenograft studies\u003c/h2\u003e \u003cp\u003e All mouse studies were conducted under a protocol approved by the Institutional Animal Care and Use Committee(IACUC: SIBCB-S373-2304-10). Male NOD-SCID mice (aged 6 to 8 weeks) were kept in a specific pathogen free (SPF) facility. A total of 8,000,000 cells were implanted subcutaneously into the right flank of intact mice with Matrigel (#354234, Corning, BD Bio coat). Mice were castrated and implanted with T sustained-released pellets (EZBioscience, China) randomly assigned into different groups when the xenografts reached approximately 150 mm\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Water containing 5% sucrose and 2 mg/ml doxycycline was replaced every 2 days. The BCA dose was 50 mg/kg. When the tumor volume reached 1500mm\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e, the mice were sacrificed and counted.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Statistics\u003c/h2\u003e \u003cp\u003eAll the data were analyzed statistically using Student\u0026rsquo;s t-test (two groups), *P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001 are determined as significance. All analyses were performed using the GraphPad Prism 8.0 software (GraphPad Software, CA, USA). Data represent the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD), unless indicated otherwise.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003e \u003cb\u003eBCA has different effects on different genotypes of prostate cancer cells.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo determine the potential effects of BCA on AR mutatnts, LNCaP and VCaP, with AR\u003csup\u003eT877A\u003c/sup\u003e and wild-type AR, respectively, were treated with BCA with or without DHT. BCA has been reported to inhibit DHEA metabolism but show limited effect on wild-type AR directly (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA)\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Consistently, BCA showed limited effect on DHT-induced gene expression in VCaP cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Surprisingly, BCA of 1 \u0026micro;M inhibited DHT-induced gene expression in LNCaP cells and this effect was more obvious when LNCaP cells were treated with BCA of 10 \u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Enzalutamide, the AR antagonist, inhibited DHT function in both LNCaP and VCaP cells\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Consistently, BCA of 10 \u0026micro;M inhibited cell proliferation in LNCaP cells but not VCaP cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD and E). To prove the direct effect of BCA on AR mutants, competition assay was performed. LNCaP and VCaP cells were treated with [\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003eH]-R1881 together with BCA or DHT. DHT competed with [\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003eH]-R1881 efficiently in both cell lines. BCA showed related high affinity to AR\u003csup\u003eT877A\u003c/sup\u003e mutant in LNCaP cells but limited affinity to wild-type AR in VCaP cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF and G). These results together demonstrate that BCA directly inhibits AR\u003csup\u003eT877A\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of BCA to different AR mutants.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe effect of BCA on other AR mutants was further determined. AR mutants which are most frequently detected in patients were stably expressed in PC3 cells which express no endogenous AR. Affinity of BCA to AR mutants were determined by treating PC3 cells expressing different AR mutants with [\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003eH]-R1881 and BCA. It requires 100 \u0026micro;M BCA to block the binding of [\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003eH]-R1881 to wild-type AR, AR\u003csup\u003eL702H\u003c/sup\u003e, AR\u003csup\u003eW741L\u003c/sup\u003e, AR\u003csup\u003eM750T\u003c/sup\u003e, AR\u003csup\u003eV867M\u003c/sup\u003e, AR\u003csup\u003eH875Y\u003c/sup\u003e, AR\u003csup\u003eP893S\u003c/sup\u003e, AR\u003csup\u003eH730P\u003c/sup\u003e, AR\u003csup\u003eQ903H\u003c/sup\u003e and AR\u003csup\u003eF876L\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-J)\u003csup\u003e\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. AR\u003csup\u003eT877A\u003c/sup\u003e and AR\u003csup\u003eW741C\u003c/sup\u003e were more sensitive to BCA and BCA of 10 \u0026micro;M significantly suppressed the binding of [\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003eH]-R1881 to these two mutants (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eK and L). Enzalutamide was also utilized in this system to evaluate the affinity of BCA to AR\u003csup\u003eT877A\u003c/sup\u003e and AR\u003csup\u003eW741C\u003c/sup\u003e. Although the inhibitory effect of BCA was less potent, comparing to enzalutamide in PC3 cells expressing AR\u003csup\u003eW741C\u003c/sup\u003e, the inhibitory effect of BCA is significant enough. Similar results were observed in PC3 cells expressing AR\u003csup\u003eT877A\u003c/sup\u003e. Together, these data demonstrate that BCA has strong affinity to AR\u003csup\u003eT877A\u003c/sup\u003e and AR\u003csup\u003eW741C\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe biological effect of BCA on AR\u003csup\u003eT877A\u003c/sup\u003e and AR\u003csup\u003eW741C\u003c/sup\u003e was further test. PSA-ARE and Renilla luciferase plasmids were co-transfected into PC3 cells expressing AR\u003csup\u003eW741C\u003c/sup\u003e and AR\u003csup\u003eT877A\u003c/sup\u003e and treated with BCA and enzalutamide. Consistently, BCA of 1\u0026micro;M showed mild inhibitory effect. With an increase in the concentration of the BCA, the inhibitory effect gradually enhanced. Enzalutamide has the same trend with BCA (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and B). Together, these results demonstrate that BCA suppresses the function of AR\u003csup\u003eT877A\u003c/sup\u003e and AR\u003csup\u003eW741C\u003c/sup\u003e directly in a dose-dependent manner\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eBCA affects androgen signaling pathway activation and function of AR\u003c/b\u003e \u003csup\u003e \u003cb\u003eW741C\u003c/b\u003e \u003c/sup\u003e \u003cb\u003eand AR\u003c/b\u003e\u003csup\u003e\u003cb\u003eT877A\u003c/b\u003e\u003c/sup\u003e \u003cb\u003emutations.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSubsequently, the inhibitory effect of BCA on AR mutants was investigated in hormone-sensitive LAPC4 cells. LAPC4-AR\u003csup\u003eW741C\u003c/sup\u003e and LAPC4-AR\u003csup\u003eT877A\u003c/sup\u003e were generated in LAPC4 cells with AR\u003csup\u003eW741C\u003c/sup\u003e and AR\u003csup\u003eT877A\u003c/sup\u003e, respectively, inducibly expressed by doxycycline (Dox) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). DHT enhanced the expression of the AR target gene, PSA. Enzalutamide suppressed DHT function in LAPC4 cells, and BCA of 10 \u0026micro;M showed limited effect on DHT function in LAPC4 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Consistently, enzalutamide inhibited DHT-induced cell proliferation, and BCA had no effect on cell proliferation with or without DHT treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). However, in LAPC4-AR\u003csup\u003eW741C\u003c/sup\u003e cells, BCA of 10 \u0026micro;M successfully inhibited PSA expression and cell proliferation in LAPC4-AR\u003csup\u003eW741C\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD and E). Furthermore, cell proliferation and PSA expression were suppressed by BCA in LAPC4-AR\u003csup\u003eT877A\u003c/sup\u003e cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF and G). Through the molecular docking model, we found that BCA can bind to some sites of AR proteins. The binding energy was \u0026minus;\u0026thinsp;7.4 kcal/mol. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). Next, we validated it in vivo experiments. Xenograft in mice showed that BCA inhibited tumor growth in the two mutated LAPC4 cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI and J). Together, these results demonstrate that BCA inhibits the biological function of AR\u003csup\u003eW741C\u003c/sup\u003e and AR\u003csup\u003eT877A\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eBCA and enzalutamide and its analogues have different affinities for AR\u003c/b\u003e \u003csup\u003e \u003cb\u003eT877A\u003c/b\u003e \u003c/sup\u003e, \u003cb\u003eAR\u003c/b\u003e\u003csup\u003e\u003cb\u003eW741C\u003c/b\u003e\u003c/sup\u003e \u003cb\u003eand AR\u003c/b\u003e\u003csup\u003e\u003cb\u003eF876L\u003c/b\u003e\u003c/sup\u003e \u003cb\u003emutations.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe different responses of AR mutants to BCA indicate that AR genotype affect the affinity of AR to its substrate. Currently, different AR antagonists have been developed and they might have different affinity to AR mutants. Darolutamide and enzalutamide were selected for competition assay in PC3 cells stably expressing different AR mutants. Enzalutamide and darolutamide have similar affinity to AR\u003csup\u003eH875Y\u003c/sup\u003e, AR\u003csup\u003eV867M\u003c/sup\u003e, and AR\u003csup\u003eW741L\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-C). Enzalutamide is preferentially bound to AR\u003csup\u003eT877A\u003c/sup\u003e and AR\u003csup\u003eF876L\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD and E). darolutamide is preferentially bound to AR\u003csup\u003eW741C\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF)\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Darolutamide and BCA inhibited PSA analogously and AR protein expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG and H). These data indicate that patients with AR\u003csup\u003eW741C\u003c/sup\u003e mutation might benefit more from darolutamide and BCA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eAndrogen receptor plays an important role in prostate cancer. Enzalutamide competitively inhibits the binding of androgens to AR for disease treatment. With inevitable drug resistance, 3βHSD1 enzyme has been reported recently as a promising target to overcome enzalutamide resistance and BCA is a potent 3βHSD1 inhibitor to block steroidogenesis\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. What we had done before illustrated that BCA was a potential drug in clinical prostate cancer treatment. Here, we investigated the affinity and direct biology effect of BCA to different AR mutants, to find potential patients most suitable for BCA treatment. Our results demonstrate that BCA directly binds to AR\u003csup\u003eT877A\u003c/sup\u003e and AR\u003csup\u003eW741C\u003c/sup\u003e as an antagonist\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePreviously, BCA was reported to directly inhibit 3βHSD1 activity but show no direct effect on wild type AR. However, AR is one of the most mutated gene in prostate cancer and AR mutation is an important mechanism for treatment resistance. The most common mutations occurred in AR-LBD and a few in N-terminal domain (NTD). 10\u0026ndash;20% of CRPC patients are known to possess somatic AR gene mutations. As mentioned above, AR\u003csup\u003eT877A\u003c/sup\u003e; AR\u003csup\u003eW741C\u003c/sup\u003e; AR\u003csup\u003eW741L\u003c/sup\u003e; AR\u003csup\u003eF876L\u003c/sup\u003e and AR\u003csup\u003eH875Y\u003c/sup\u003e, these mutations were also revealed to change the binding affinity of ligands including anti-androgen drugs and steroids and potentially lead to altered responses to AR pathway inhibitors. Our results indicate that patients with AR\u003csup\u003eT877A\u003c/sup\u003e and AR\u003csup\u003eW741C\u003c/sup\u003e might benefit from BCA more. In these patients, BCA not only suppresses androgen synthesis, but directly binds to AR mutants to inhibit their biological effects to suppress the development of prostate cancer.\u003c/p\u003e \u003cp\u003eEnzalutamide binds to AR to inhibit androgen-induced AR nuclear localization and AR recruitment into DNA. At present, other drugs targeting AR are also being developed. Dalorutamide has a similar structure to enzalutamide and apalutamide, and they all have a high affinity to wild-type AR\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. The different affinities of BCA to AR mutants inspire us to find the difference between darolutamide and enzalutamide when binding to AR mutants. Enzalutamide showed higher affinity to AR\u003csup\u003eT877A\u003c/sup\u003e and darolutamde preferentially binds to AR\u003csup\u003eW741C\u003c/sup\u003e. Although enzalutamide also had a strong affinity to AR\u003csup\u003eF876L\u003c/sup\u003e, AR\u003csup\u003eF876L\u003c/sup\u003e recognizes enzalutamide as an agonist\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Thus, the development of AR inhibitors should pay attention to diverse response in patients with different AR mutants.\u003c/p\u003e \u003cp\u003eToday, various small-molecule drugs with different functions are being developed. Small molecules have different mechanisms of AR inhibition. For instance, JJ-450 can inhibit AR independent of LBD\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e,\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. (+)-JJ-74-138, which has a similar structure to JJ-450, is more potent than JJ-450 in inhibiting androgen-independent AR activity in enzalutamide-resistant cells. ASC-J9 inhibit AR\u003csup\u003eF876L\u003c/sup\u003e via induction of the mutant AR degradation as an AR degradation enhancer\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. And EPI-001 can inhibit AR\u003csup\u003eF876L\u003c/sup\u003e by targeting the N-terminal domain of AR\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Exploring the mechanism of targeting AR and its mutations with many different small molecule drugs can provide a new treatment plan for the disease process after endogenous drug resistance.\u003c/p\u003e \u003cp\u003eIn this paper, we have found the drug BCA, the previously reported 3βHSD1 inhibitor, directly binds to and inhibits AR\u003csup\u003eT877A\u003c/sup\u003e and AR\u003csup\u003eW741C\u003c/sup\u003e. Patients with AR\u003csup\u003eW741C\u003c/sup\u003e expression might benefit from BCA and darolutamide.\u003c/p\u003e \u003cp\u003eData accessibility\u003c/p\u003e \u003cp\u003eThe data supporting this study's findings are available from the corresponding author [[email protected]] upon reasonable request.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cb\u003eAR\u003c/b\u003e androgen receptor\u003c/p\u003e\u003cp\u003e\u003cb\u003eBCA\u003c/b\u003e Biochanin-A\u003c/p\u003e\u003cp\u003e\u003cb\u003eADT\u003c/b\u003e androgen receptor deprivation therapy\u003c/p\u003e\u003cp\u003e\u003cb\u003eDHT\u003c/b\u003e dihydrotestosterone\u003c/p\u003e\u003cp\u003e\u003cb\u003eDHEA\u003c/b\u003e dehydroepiandrosterone\u003c/p\u003e\u003cp\u003e\u003cb\u003eLBD\u003c/b\u003e ligand binding domain\u003c/p\u003e\u003cp\u003e\u003cb\u003eMMR\u003c/b\u003e Mis Match Repair\u003c/p\u003e\u003cp\u003e\u003cb\u003eCRPC\u003c/b\u003e Castration-Resistant Prostate Cancer\u003c/p\u003e\u003cp\u003e\u003cb\u003eDox\u003c/b\u003e doxycycline\u003c/p\u003e\u003cp\u003e\u003cb\u003eNTD\u003c/b\u003e N-terminal domain\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eDeclaration\u003c/p\u003e \u003cp\u003eThis study was supported by National Natural Science Foundation of China(82372738).\u003c/p\u003e \u003cp\u003eEthics approval and consent to participate\u003c/p\u003e \u003cp\u003eAll mouse studies were conducted under a protocol approved by the Institutional Animal Care and Use Committee(IACUC: SIBCB-S373-2304-10). And all methods were performed in accordance with the relevant guidelines and regulations of the Basel Declaration.\u003c/p\u003e \u003cp\u003eConsent for publication\u003c/p\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003cp\u003eCompeting interests\u003c/p\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eY.C and C.W conducted the experiments. Y.C, T.Y and Y.L designed the experiments and analyzed the data. Y.C, D.W and S.S wrote the paper.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eNot applicable.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data supporting this study's findings are available from the corresponding author [[email protected]] upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSiegel RL, Miller KD, Wagle NS, Jemal A. Cancer statistics, 2023. CA Cancer J Clin. 2023;73:17\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3322/caac.21763\u003c/span\u003e\u003cspan address=\"10.3322/caac.21763\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHou Z, Huang S, Li Z. Androgens in prostate cancer: A tale that never ends. Cancer Lett. 2021;516:1\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.canlet.2021.04.010\u003c/span\u003e\u003cspan address=\"10.1016/j.canlet.2021.04.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharifi N, Auchus RJ. Steroid biosynthesis and prostate cancer. Steroids. 2012;77:719\u0026ndash;26. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.steroids.2012.03.015\u003c/span\u003e\u003cspan address=\"10.1016/j.steroids.2012.03.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsbarn H, et al. Androgen deprivation therapy for the treatment of prostate cancer: consider both benefits and risks. Eur Urol. 2009;55:62\u0026ndash;75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.eururo.2008.10.008\u003c/span\u003e\u003cspan address=\"10.1016/j.eururo.2008.10.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen K, et al. Combination treatment in metastatic prostate cancer: is the bar too high or have we fallen short? Nat Rev Urol. 2022. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41585-022-00669-z\u003c/span\u003e\u003cspan address=\"10.1038/s41585-022-00669-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Bono JS, et al. Abiraterone and increased survival in metastatic prostate cancer. N Engl J Med. 2011;364:1995\u0026ndash;2005. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1056/NEJMoa1014618\u003c/span\u003e\u003cspan address=\"10.1056/NEJMoa1014618\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScher HI, et al. Increased survival with enzalutamide in prostate cancer after chemotherapy. N Engl J Med. 2012;367:1187\u0026ndash;97. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1056/NEJMoa1207506\u003c/span\u003e\u003cspan address=\"10.1056/NEJMoa1207506\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlyamani M, et al. HSD3B1(1245A\u0026thinsp;\u0026gt;\u0026thinsp;C) variant regulates dueling abiraterone metabolite effects in prostate cancer. J Clin Invest. 2018;128:3333\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1172/JCI98319\u003c/span\u003e\u003cspan address=\"10.1172/JCI98319\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHearn JWD, et al. Association of HSD3B1 Genotype With Response to Androgen-Deprivation Therapy for Biochemical Recurrence After Radiotherapy for Localized Prostate Cancer. JAMA Oncol. 2018;4:558\u0026ndash;62. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1001/jamaoncol.2017.3164\u003c/span\u003e\u003cspan address=\"10.1001/jamaoncol.2017.3164\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHou Z, et al. Inhibiting 3betaHSD1 to eliminate the oncogenic effects of progesterone in prostate cancer. Cell Rep Med. 2022;3:100561. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.xcrm.2022.100561\u003c/span\u003e\u003cspan address=\"10.1016/j.xcrm.2022.100561\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMei Z, et al. Management of prostate cancer by targeting 3betaHSD1 after enzalutamide and abiraterone treatment. Cell Rep Med. 2022;3:100608. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.xcrm.2022.100608\u003c/span\u003e\u003cspan address=\"10.1016/j.xcrm.2022.100608\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh-Gupta V, et al. Daidzein effect on hormone refractory prostate cancer in vitro and in vivo compared to genistein and soy extract: potentiation of radiotherapy. Pharm Res. 2010;27:1115\u0026ndash;27. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11095-010-0107-9\u003c/span\u003e\u003cspan address=\"10.1007/s11095-010-0107-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNyquist MD, et al. TALEN-engineered AR gene rearrangements reveal endocrine uncoupling of androgen receptor in prostate cancer. Proc Natl Acad Sci U S A. 2013;110:17492\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1308587110\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1308587110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H, et al. Simulating androgen receptor selection in designer yeast. Synth Syst Biotechnol. 2022;7:1108\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.synbio.2022.07.005\u003c/span\u003e\u003cspan address=\"10.1016/j.synbio.2022.07.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShiota M, et al. Androgen receptor mutations for precision medicine in prostate cancer. Endocr Relat Cancer. 2022;29:R143\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1530/ERC-22-0140\u003c/span\u003e\u003cspan address=\"10.1530/ERC-22-0140\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao XY, et al. Glucocorticoids can promote androgen-independent growth of prostate cancer cells through a mutated androgen receptor. Nat Med. 2000;6:703\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/76287\u003c/span\u003e\u003cspan address=\"10.1038/76287\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVeldscholte J, et al. The androgen receptor in LNCaP cells contains a mutation in the ligand binding domain which affects steroid binding characteristics and response to antiandrogens. J Steroid Biochem Mol Biol. 1992;41:665\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0960-0760(92)90401-4\u003c/span\u003e\u003cspan address=\"10.1016/0960-0760(92)90401-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang A, et al. Design, Synthesis, and Biological Evaluation of Androgen Receptor Degrading and Antagonizing Bifunctional Steroidal Analogs for the Treatment of Advanced Prostate Cancer. J Med Chem. 2022;65:12460\u0026ndash;81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acs.jmedchem.2c01164\u003c/span\u003e\u003cspan address=\"10.1021/acs.jmedchem.2c01164\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu H, Han R, Li J, Liu H, Zheng L. Molecular mechanism of R-bicalutamide switching from androgen receptor antagonist to agonist induced by amino acid mutations using molecular dynamics simulations and free energy calculation. J Comput Aided Mol Des. 2016;30:1189\u0026ndash;200. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10822-016-9992-2\u003c/span\u003e\u003cspan address=\"10.1007/s10822-016-9992-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBohl CE, Gao W, Miller DD, Bell CE, Dalton JT. Structural basis for antagonism and resistance of bicalutamide in prostate cancer. Proc Natl Acad Sci U S A. 2005;102:6201\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.0500381102\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0500381102\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKorpal M, et al. An F876L mutation in androgen receptor confers genetic and phenotypic resistance to MDV3100 (enzalutamide). Cancer Discov. 2013;3:1030\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/2159-8290.CD-13-0142\u003c/span\u003e\u003cspan address=\"10.1158/2159-8290.CD-13-0142\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConteduca V, et al. Androgen receptor gene status in plasma DNA associates with worse outcome on enzalutamide or abiraterone for castration-resistant prostate cancer: a multi-institution correlative biomarker study. Ann Oncol. 2017;28:1508\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/annonc/mdx155\u003c/span\u003e\u003cspan address=\"10.1093/annonc/mdx155\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan Q, et al. Celastrol recruits UBE3A to recognize and degrade the DNA binding domain of steroid receptors. Oncogene. 2022;41:4754\u0026ndash;67. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41388-022-02467-8\u003c/span\u003e\u003cspan address=\"10.1038/s41388-022-02467-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, et al. Active DHEA uptake in the prostate gland correlates with aggressive prostate cancer. J Clin Invest. 2023;133. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1172/JCI171199\u003c/span\u003e\u003cspan address=\"10.1172/JCI171199\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa X, Zhou W, Zou Q, Ouyang P. Structural elucidation of the impurities in Enzalutamide bulk drug and the development, validation of corresponding HPLC method. J Pharm Biomed Anal. 2016;131:436\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jpba.2016.08.036\u003c/span\u003e\u003cspan address=\"10.1016/j.jpba.2016.08.036\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTran C, et al. Development of a second-generation antiandrogen for treatment of advanced prostate cancer. Science. 2009;324:787\u0026ndash;90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1168175\u003c/span\u003e\u003cspan address=\"10.1126/science.1168175\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLedet EM, et al. Comprehensive Analysis of AR Alterations in Circulating Tumor DNA from Patients with Advanced Prostate Cancer. Oncologist. 2020;25:327\u0026ndash;33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1634/theoncologist.2019-0115\u003c/span\u003e\u003cspan address=\"10.1634/theoncologist.2019-0115\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBorgmann H, et al. Moving Towards Precision Urologic Oncology: Targeting Enzalutamide-resistant Prostate Cancer and Mutated Forms of the Androgen Receptor Using the Novel Inhibitor Darolutamide (ODM-201). Eur Urol. 2018;73:4\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.eururo.2017.08.012\u003c/span\u003e\u003cspan address=\"10.1016/j.eururo.2017.08.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eV GA, et al. Clinical, cytogenetic and molecular analysis of androgen insensitivity syndromes from south Indian cohort and detection and in-silico characterization of androgen receptor gene mutations. Clin Chim Acta. 2016;453:123\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cca.2015.12.012\u003c/span\u003e\u003cspan address=\"10.1016/j.cca.2015.12.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan Y et al. Triptolide Inhibits the AR Signaling Pathway to Suppress the Proliferation of Enzalutamide Resistant Prostate Cancer Cells. \u003cem\u003eTheranostics\u003c/em\u003e 7, 1914\u0026ndash;1927 (2017). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7150/thno.17852\u003c/span\u003e\u003cspan address=\"10.7150/thno.17852\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoung FP, et al. Biomarkers of Castrate Resistance in Prostate Cancer: Androgen Receptor Amplification and T877A Mutation Detection by Multiplex Droplet Digital PCR. J Clin Med. 2022;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/jcm11010257\u003c/span\u003e\u003cspan address=\"10.3390/jcm11010257\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLundqvist J, Tringali C, Oskarsson A. Resveratrol, piceatannol and analogs inhibit activation of both wild-type and T877A mutant androgen receptor. J Steroid Biochem Mol Biol. 2017;174:161\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jsbmb.2017.08.016\u003c/span\u003e\u003cspan address=\"10.1016/j.jsbmb.2017.08.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChi KN, et al. Apalutamide for Metastatic, Castration-Sensitive Prostate Cancer. N Engl J Med. 2019;381:13\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1056/NEJMoa1903307\u003c/span\u003e\u003cspan address=\"10.1056/NEJMoa1903307\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu J, et al. Discovery and biological evaluation of darolutamide derivatives as inhibitors and down-regulators of wild-type AR and the mutants. Eur J Med Chem. 2019;182:111608. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejmech.2019.111608\u003c/span\u003e\u003cspan address=\"10.1016/j.ejmech.2019.111608\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrekovic S, et al. The Effect of F877L and T878A Mutations on Androgen Receptor Response to Enzalutamide. Mol Cancer Ther. 2016;15:1702\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/1535-7163.MCT-15-0892\u003c/span\u003e\u003cspan address=\"10.1158/1535-7163.MCT-15-0892\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Z, et al. A novel androgen receptor antagonist JJ-450 inhibits enzalutamide-resistant mutant AR(F876L) nuclear import and function. Prostate. 2020;80:319\u0026ndash;28. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/pros.23945\u003c/span\u003e\u003cspan address=\"10.1002/pros.23945\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCole RN, et al. (+)-JJ-74-138 is a Novel Noncompetitive Androgen Receptor Antagonist. Mol Cancer Ther. 2022;21:483\u0026ndash;92. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/1535-7163.MCT-21-0432\u003c/span\u003e\u003cspan address=\"10.1158/1535-7163.MCT-21-0432\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang R, et al. ASC-J9((R)) suppresses castration resistant prostate cancer progression via degrading the enzalutamide-induced androgen receptor mutant AR-F876L. Cancer Lett. 2016;379:154\u0026ndash;60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.canlet.2016.05.018\u003c/span\u003e\u003cspan address=\"10.1016/j.canlet.2016.05.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNicolescu RCB et al. Hybrid Androgen Receptor Inhibitors Outperform Enzalutamide and EPI-001 in in vitro Models of Prostate Cancer Drug Resistance. \u003cem\u003eChemMedChem\u003c/em\u003e, e202200548 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/cmdc.202200548\u003c/span\u003e\u003cspan address=\"10.1002/cmdc.202200548\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Prostate Cancer, Androgen Receptor Mutation, Biochanin-A","lastPublishedDoi":"10.21203/rs.3.rs-6311929/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6311929/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAndrogen and androgen receptor (AR) were essential for the development of prostate cancer. Biochanin-A (BCA) has been reported to inhibit androgen synthesis to overcome resistance to abiraterone and enzalutamide. However, its direct function on androgen receptor remains unrevealed. Here, we investigated the affinity and biological effect of BCA to different AR mutants to find potential patients suitable for BCA treatment. Stable cell lines expressing different AR mutants in PC3 and LAPC4 cells were established. The affinity and biological effects of BCA on 12 different AR mutations were investigated by isotope competition assay, target gene expression and cell proliferation assay. The affinity of darolutamide to AR mutants were compared with enzalutamide. The inhibitory of darolutamide to AR mutants were compared with BCA. As indicated by the isotope competition experiments, BCA exhibited high affinity to AR\u003csup\u003eT877A\u003c/sup\u003e and AR\u003csup\u003eW741C\u003c/sup\u003e. After binding to these AR mutants, BCA suppressed the AR signaling pathway and cell proliferation of LAPC4-AR\u003csup\u003eT877A\u003c/sup\u003e and LAPC4-AR\u003csup\u003eW741C\u003c/sup\u003e stable cell lines. Enzalutamide and darolutamide showed different affinity to AR mutants. Darolutamide showed higher affinity to AR\u003csup\u003eW741C\u003c/sup\u003e and inhibited AR\u003csup\u003eW741C\u003c/sup\u003e as an antagonist. BCA not only inhibits androgen synthesis, but also directly binds to and suppresses AR\u003csup\u003eT877A\u003c/sup\u003e and AR\u003csup\u003eW741C\u003c/sup\u003e mutations.\u003c/p\u003e","manuscriptTitle":"Biochanin-A inhibits the activity of androgen receptor mutants to suppress the development of prostate cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-30 05:28:47","doi":"10.21203/rs.3.rs-6311929/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"25f40506-ae83-449f-9c45-a89b0a9392af","owner":[],"postedDate":"May 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-03T12:38:50+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-30 05:28:47","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6311929","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6311929","identity":"rs-6311929","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}