A guide to selecting high-performing antibodies for Alpha-1-antitrypsin (UniProt ID: P01009) for use in western blot, immunoprecipitation and flow cytometry

preprint OA: closed
Full text JSON View at publisher

Abstract

Alpha-1-antitrypsin (A1AT), encoded by the SERPINA1 gene, is a circulating serine protease inhibitor that protects the lung from neutrophil elastase–mediated tissue damage. Mutations in SERPINA1 cause alpha-1-antitrypsin deficiency, one of the most common hereditary causes of respiratory disease, leading to early-onset emphysema and chronic obstructive pulmonary disease, as well as hepatic complications. Given the clinical significance of A1AT and its widespread use as a biomarker, there is a critical need for high-quality antibodies to ensure reliable detection and mechanistic insights. Here we systematically characterised eighteen commercial antibodies for western blot, immunoprecipitation, and flow cytometry using a standardized knockout validation approach in human Hep G2 cells, comparing readouts in a SERPINA1 knockout line with its isogenic parental control. This work is part of a broader collaborative initiative aimed at addressing antibody reproducibility by characterising commercial antibodies for human proteins and openly sharing the results with the community. While antibody use and protocols vary between laboratories, we encourage readers to use this report as a guide to select the most appropriate antibodies for their specific experimental needs.
Full text 118,076 characters · extracted from preprint-html · click to expand
A guide to selecting high-performing antibodies... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/15-73" }, "headline": "A guide to selecting high-performing antibodies...", "datePublished": "2026-01-19T07:13:28", "dateModified": "2026-01-19T07:13:28", "author": [ { "@type": "Person", "name": "Jemma Cooper" }, { "@type": "Person", "name": "Carolyn Jones" }, { "@type": "Person", "name": "Katie Dixon" }, { "@type": "Person", "name": "Bibek Gooptu" }, { "@type": "Person", "name": "Harvinder Virk" }, { "@type": "Person", "name": "Michael Biddle" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": "Alpha-1-antitrypsin (A1AT), encoded by the SERPINA1 gene, is a circulating serine protease inhibitor that protects the lung from neutrophil elastase–mediated tissue damage. Mutations in SERPINA1 cause alpha-1-antitrypsin deficiency, one of the most common hereditary causes of respiratory disease, leading to early-onset emphysema and chronic obstructive pulmonary disease, as well as hepatic complications. Given the clinical significance of A1AT and its widespread use as a biomarker, there is a critical need for high-quality antibodies to ensure reliable detection and mechanistic insights. Here we systematically characterised eighteen commercial antibodies for western blot, immunoprecipitation, and flow cytometry using a standardized knockout validation approach in human Hep G2 cells, comparing readouts in a SERPINA1 knockout line with its isogenic parental control. This work is part of a broader collaborative initiative aimed at addressing antibody reproducibility by characterising commercial antibodies for human proteins and openly sharing the results with the community. While antibody use and protocols vary between laboratories, we encourage readers to use this report as a guide to select the most appropriate antibodies for their specific experimental needs." } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/15-73", "name": "A guide to selecting high-performing antibodies forAlpha-1-antitrypsin(UniProtID:P01009)..." } } ] } Home Browse A guide to selecting high-performing antibodies forAlpha-1-antitrypsin(UniProtID:P01009)... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Cooper J, Jones C, Dixon K et al. A guide to selecting high-performing antibodies for Alpha-1-antitrypsin (UniProt ID: P01009) for use in western blot, immunoprecipitation and flow cytometry [version 1; peer review: 2 approved] . F1000Research 2026, 15 :73 ( https://doi.org/10.12688/f1000research.175969.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Data Note A guide to selecting high-performing antibodies for Alpha-1-antitrypsin (UniProt ID: P01009) for use in western blot, immunoprecipitation and flow cytometry [version 1; peer review: 2 approved] Jemma Cooper https://orcid.org/0009-0007-8915-379X 1 , Carolyn Jones 2 , Katie Dixon 1 , Bibek Gooptu 1 , Harvinder Virk https://orcid.org/0000-0002-9739-9593 1 , Michael Biddle https://orcid.org/0000-0002-9853-8815 1 Jemma Cooper https://orcid.org/0009-0007-8915-379X 1 , Carolyn Jones 2 , [...] Katie Dixon 1 , Bibek Gooptu 1 , Harvinder Virk https://orcid.org/0000-0002-9739-9593 1 , Michael Biddle https://orcid.org/0000-0002-9853-8815 1 PUBLISHED 19 Jan 2026 Author details Author details 1 University of Leicester College of Life Sciences, Leicester, England, UK 2 Institute for Precision Health, University of Leicester, Leicester, England, UK Jemma Cooper Roles: Investigation, Methodology, Visualization, Writing – Review & Editing Carolyn Jones Roles: Investigation, Methodology, Writing – Review & Editing Katie Dixon Roles: Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Bibek Gooptu Roles: Supervision, Writing – Review & Editing Harvinder Virk Roles: Conceptualization, Funding Acquisition, Resources, Supervision, Writing – Review & Editing Michael Biddle Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the YCharOS (Antibody Characterization through Open Science) gateway. Abstract Alpha-1-antitrypsin (A1AT), encoded by the SERPINA1 gene, is a circulating serine protease inhibitor that protects the lung from neutrophil elastase–mediated tissue damage. Mutations in SERPINA1 cause alpha-1-antitrypsin deficiency, one of the most common hereditary causes of respiratory disease, leading to early-onset emphysema and chronic obstructive pulmonary disease, as well as hepatic complications. Given the clinical significance of A1AT and its widespread use as a biomarker, there is a critical need for high-quality antibodies to ensure reliable detection and mechanistic insights. Here we systematically characterised eighteen commercial antibodies for western blot, immunoprecipitation, and flow cytometry using a standardized knockout validation approach in human Hep G2 cells, comparing readouts in a SERPINA1 knockout line with its isogenic parental control. This work is part of a broader collaborative initiative aimed at addressing antibody reproducibility by characterising commercial antibodies for human proteins and openly sharing the results with the community. While antibody use and protocols vary between laboratories, we encourage readers to use this report as a guide to select the most appropriate antibodies for their specific experimental needs. READ ALL READ LESS Keywords P01009, alpha-1-antitrypsin, SERPINA1, A1AT, serine protease inhibitor, antibody validation, western blot, immunoprecipitation, flow cytometry Corresponding Author(s) Harvinder Virk ( [email protected] ) Michael Biddle ( [email protected] ) Close Corresponding authors: Harvinder Virk, Michael Biddle Competing interests: For this project, the authors developed partnerships with leading antibody manufacturers and KO cell line providers. The partners provide antibodies and KO cell lines to this project at no cost. These partners include: Abcam, ABCD antibodies, ABclonal, Addgene, Aviva Systems Biology, BioTechne, Cell Signaling Technology, Developmental Studies Hybridoma Bank, GeneTex, Horizon Discovery, Institute for Protein Innovation, MilliporeSigma, Proteintech, Synaptic Systems, Thermo Fisher Scientific. Grant information: This work was supported by a grant from the National Centre for the Replacement, Refinement and Reduction of Animals in Research (NC3Rs) and MRC (NC3Rs Ref: NC/NAM0019/1, MRC UKRI076) alongside support from the Leicester Institute for Precision Health. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2026 Cooper J et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Cooper J, Jones C, Dixon K et al. A guide to selecting high-performing antibodies for Alpha-1-antitrypsin (UniProt ID: P01009) for use in western blot, immunoprecipitation and flow cytometry [version 1; peer review: 2 approved] . F1000Research 2026, 15 :73 ( https://doi.org/10.12688/f1000research.175969.1 ) First published: 19 Jan 2026, 15 :73 ( https://doi.org/10.12688/f1000research.175969.1 ) Latest published: 19 Jan 2026, 15 :73 ( https://doi.org/10.12688/f1000research.175969.1 ) Introduction Alpha-1-antitrypsin (A1AT) deficiency is a hereditary disorder caused by mutations in the SERPINA1 gene, leading to reduced circulating levels of functional A1AT, a serine protease inhibitor primarily synthesized in the liver. 1 Under normal conditions, A1AT diffuses into the lungs where it neutralises neutrophil elastase, thereby preserving the protease–antiprotease balance essential for alveolar integrity. 1 , 2 In individuals with A1AT deficiency, insufficient inhibition of neutrophil elastase results in progressive alveolar wall destruction and panacinar emphysema, particularly in the lower lobes of the lungs. 2 , 3 Clinically, this manifests as early-onset emphysema, chronic obstructive pulmonary disease (COPD), and chronic bronchitis, with disease severity strongly influenced by environmental factors such as cigarette smoking. 4 , 5 In addition to pulmonary complications, A1AT deficiency has important hepatic consequences. Mutant A1AT proteins, such as the Z allele (Glu342Lys), misfold within the endoplasmic reticulum of hepatocytes and form toxic aggregates that are poorly secreted into circulation. 1 , 6 This intracellular accumulation predisposes to a spectrum of liver disease and increases the risk of hepatocellular carcinoma in adulthood. 6 For the robust assessment of A1AT biology, the use of well-characterised experimental tools is essential. Given the widespread use of immunoassays and immunohistochemistry to detect A1AT expression, 7 , 8 antibody validation is critical to ensure specificity and reproducibility. Poorly validated antibodies can lead to misleading findings regarding A1AT levels, distribution, and misfolding, thereby obscuring the disease mechanisms and hindering the development of effective diagnostics and therapies. 9 – 11 This research is part of a broader collaborative initiative in which academics, funders and commercial antibody manufacturers are working together to address antibody reproducibility issues by characterising commercial antibodies for human proteins using standardized protocols 12 and openly sharing the data. 13 Here we evaluated the performance of eighteen commercial antibodies for A1AT for use in western blot, immunoprecipitation and flow cytometry, enabling biochemical and cellular assessment of A1AT properties and function. The platform for antibody characterisation used to carry out this study was endorsed by a committee of industry academic representatives. It consists of identifying human cell lines with adequate target protein expression and the development/contribution of equivalent knockout (KO) cell lines, followed by antibody characterisation procedures using most commercially available renewable antibodies against the corresponding protein. The standardised consensus antibody characterisation protocols are openly available on Protocols.io (DOI: dx.doi.org/10.21203/rs.3.pex-2607/v1 ). The authors do not engage in result analysis or offer explicit antibody recommendations. Our primary aim is to deliver top-tier data to the scientific community, grounded in Open Science principles. This empowers experts to interpret the characterisation data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Guidelines on how to interpret the antibody characterisation data found in this study are featured on the YCharOS gateway. 14 Results and discussion Our standard protocol involves comparing readouts from WT (wild type) and KO cells. 15 , 16 The first step is to identify a cell line(s) that expresses sufficient levels of a given protein to generate a measurable signal using antibodies. To this end, we examined the DepMap transcriptomics database to identify all cell lines that express the target at levels greater than 2.5 log 2 (transcript per million “TPM” + 1), which we have found to be a suitable cut-off (Cancer Dependency Map Portal, RRID:SCR_017655). The cell line Hep G2 expresses the SERPINA1 transcript at 12.5 log 2 (TPM+1) and thus was identified as a suitable cell line and was modified by CRISPR/Cas9 to KO the corresponding SERPINA1 gene ( Table 1 ). Table 1. Summary of the cell lines used. Institution Catalogue number RRID (Cellosaurus) Cell line Genotype Sigma Aldrich 85011430-1VL CVCL_0027 HepG2 WT University of Leicester - CVCL_F0RL HepG2 SERPINA1 KO According to the UniProt database, A1AT is secreted into the extracellular space. As such, clarified concentrated medium from both Hep G2 WT control and SERPINA1 KO cell lines was run on SDS-PAGE, transferred onto nitrocellulose membranes and probed in parallel with eighteen A1AT antibodies ( Figure 1 ). Antibodies were then assessed for their ability to detect intracellular A1AT using protein lysates from WT control and SERPINA1 knockout cells ( Figure 2 ). A1AT expression was detected in the protein lysates but required a longer exposure time, indicating that A1AT is predominantly secreted by Hep G2 cells. Therefore, the performance of antibodies by immunofluorescence was not evaluated in this study. Figure 1. Alpha-1-antitrypsin antibody screening by western blot using concentrated conditioned culture media. Culture media from Hep G2 WT and SERPINA1 KO cells were collected, and 30μg of protein was processed for western blot with the indicated Alpha-1-antitrypsin antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO samples. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Antibody dilutions used: ab133642** at 1/1000, ab166610** at 1/1000, ab167414** at 1/1000, ab207303** at 1 in 5000, ABCD_AU751** at 1/5, ABCD_AU752** at 1/85, ABCD_AW383** at 1/35, ARP59239_P050 at 1/500, ARP96977_P050 at 1/500, AVARP00015_T100 at 1/800, MAB1268* at 1/500, NBP1-47957* at 1/1000, GTX112707 at 1/3000, 66135-1-Ig* at 1/5000, 82918-1-RR** at 1/2000, A0409 at 1/15000, 702047** at 1/500 and 711079** at 1/500. Predicted band size: 46.7 kDa. *Monoclonal antibody; **Recombinant antibody. Figure 2. Alpha-1-antitrypsin antibody screening by western blot using protein lysates. Protein lysates from Hep G2 WT and SERPINA1 KO cells were collected, and 30μg of protein was used for western blot with the indicated Alpha-1-antitrypsin antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO samples. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Antibody dilutions used: ab133642** at 1/1000, ab166610** at 1/1000, ab167414** at 1/1000, ab207303** at 1 in 5000, ABCD_AU751** at 1/5, ABCD_AU752** at 1/85, ABCD_AW383** at 1/35, ARP59239_P050 at 1/500, ARP96977_P050 at 1/500, AVARP00015_T100 at 1/800, MAB1268* at 1/500, NBP1-47957* at 1/1000, GTX112707 at 1/3000, 66135-1-Ig* at 1/5000, 82918-1-RR** at 1/2000, A0409 at 1/15000, 702047** at 1/500 and 711079** at 1/500. Predicted band size: 46.7 kDa. *Monoclonal antibody; **Recombinant antibody. We next assessed the ability of all eighteen antibodies to capture A1AT from Hep G2 culture medium by immunoprecipitation, followed by western blot analysis. For the immunoblot, a specific A1AT antibody identified previously ( Figure 1 ) was used. Equal amounts of the starting material (SM) and unbound fraction (UB), along with the complete immunoprecipitated (IP) eluate, were separated by SDS-PAGE ( Figure 3 ). Figure 3. Alpha-1-antitrypsin antibody screening by immunoprecipitation of culture medium. Conditioned culture medium was collected from Hep G2 WT cells, and immunoprecipitation was performed for 18 hours using 0.5 mg of protein and 2.0 μg of the indicated Alpha-1-antitrypsin antibodies pre-coupled to Dynabeads protein A or protein G. Samples were washed and processed for western blot with the anti- Alpha-1-antitrypsin antibody ab207303** diluted at 1/5000. The Ponceau stained transfers of each blot are shown. SM=4% starting material; UB = 4% unbound fraction; IP = immunoprecipitate. *Monoclonal antibody; **Recombinant antibody. For flow cytometry, Hep G2 WT and SERPINA1 KO cells were labelled with distinct fluorescent dyes and combined at a 1:1 ratio. Both cell lines were fixed, permeabilised and blocked in the same tube prior to antibody staining to reduce bias. Eighteen A1AT antibodies were then evaluated, with fluorescent intensity assessed using the Attune NxT flow cytometer. Antibody staining in both WT and KO line was then quantified using FlowJo software, with representative histograms presented in Figure 4 . Figure 4. Alpha-1-antitrypsin antibody screening by flow cytometry. Hep G2 WT and SERPINA1 KO cells were labelled with a green or violet, fluorescent dye, respectively. WT and KO cells were mixed in a 1:1 ratio, fixed in 4% PFA and permeabilized in 0.1% saponin. 400,000 cells were stained with the indicated alpha-1-antitrypsin antibodies and corresponding Multi-rAb CoraLite ® Plus 647 secondary antibodies. Antibody staining was quantified using the Attune NxT Flow Cytometer with representative images showing the staining intensity in the KO population (pink histogram, dashed line) compared to the WT cells (green histogram, solid line). Histograms with dotted lines represent secondary antibody-only controls in both WT and KO cells. Antibody dilutions used: ab133642** at 1/1050, ab166610** at 1/237, ab167414** at 1/277, ab207303** at 1/999, ABCD_AU751**at 1/5, ABCD_AU752** at 1/850, ABCD_AW383** at 1/35, ARP59239_P050 at 1/5000, ARP96977_P050 at 1/5000, AVARP00015_T100 at 1/1000, MAB1268* at 1/500, NBP1-47957* at 1/100, GTX112707 at 1/810, 66135-1-Ig* at 1/1600, 82918-1-RR** at 1/8000, A0409 at 1/1000, 702047** at 1/500, 711079** at 1/500. *Monoclonal antibody; **Recombinant antibody. In conclusion, we have screened eighteen A1AT commercial antibodies by western blot, immunoprecipitation and flow cytometry by comparing the signal produced using human Hep G2 WT and SERPINA1 KO cells. High-quality and renewable antibodies capable of successfully detecting A1AT were identified. Limitations Inherent limitations are associated with the antibody characterization platform used in this study. Firstly, the YCharOS project focuses on renewable (recombinant and monoclonal) antibodies and does not test all commercially available A1AT antibodies. YCharOS partners provide approximately 80% of all renewable antibodies, but some top-cited polyclonal antibodies may not be available through these partners. We encourage readers to consult vendor documentation to identify the specific antigen each antibody is raised against, where such information is available. Secondly, the YCharOS effort employs a non-biased approach that is agnostic to the protein for which antibodies have been characterized. The aim is to provide objective data on antibody performance without preconceived notions about how antibodies should perform or the molecular weight that should be observed in western blot. As the authors are not experts in A1AT, only a brief overview of the protein’s function and its relevance in disease is provided. A1AT experts are invited to analyse and interpret observed banding patterns in western blots. Thirdly, YCharOS experiments are not performed in replicates primarily due to the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line, confirms the lack of protein expression in the KO cell line and supports conclusions regarding the specificity of the other antibodies. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In instances where antibodies yield no signal, a repeat experiment is conducted following titration. Additionally, our independent data is performed subsequently to the antibody manufacturers internal validation process, therefore making our characterization process a repeat. Lastly, as comprehensive and standardized procedures are respected, any conclusions remain confined to the experimental conditions and cell line used for this study. The use of a single cell type for evaluating antibody performance poses as a limitation, as factors such as target protein abundance significantly impact results. Additionally, the use of cancer cell lines containing gene mutations poses a potential challenge, as these mutations may be within the epitope coding sequence or other regions of the gene responsible for the intended target. Such alterations can impact the binding affinity of antibodies. This represents an inherent limitation of any approach that employs cancer cell lines. Methods The standardized protocols used to carry out this KO cell line-based antibody characterisation platform was established and approved by a collaborative group of academics, industry researchers and antibody manufacturers. The detailed materials and step-by-step protocols used to characterize antibodies in western blot, immunoprecipitation and immunofluorescence are openly available on Protocols.io (DOI: dx.doi.org/10.21203/rs.3.pex-2607/v1 ). Antibodies All A1AT antibodies are listed in Table 2 , together with their corresponding Research Resource Identifiers (RRID), to ensure antibodies are cited properly. 17 Secondary antibodies used in this study are provided in Table 3 . To ensure consistency with manufacturer recommendations and account for proprietary formulations (where antibody concentrations are not disclosed), antibody usage is reported as dilution ratios rather than absolute concentrations. Table 2. Summary of the Alpha-1-antitrypsin antibodies tested. Company Catalogue number Lot number RRID (Antibody registry) Clonality Clone ID Host Stock concentration (μg/mL) Vendor recommended applications Abcam ab133642 ** 1014123-6 AB_3668811 Recombinant Monoclonal EPSISR16 Rabbit 105 IP, WB Abcam ab166610 ** 1082313-4 AB_3665876 Recombinant Monoclonal EPR9090 Rabbit 237 ICC/IF, WB Abcam ab167414 ** 1091979-5 AB_3665875 Recombinant Monoclonal EPR10832(B) Rabbit 277 IP, WB Abcam ab207303 ** 1088914-2 AB_3665874 Recombinant Monoclonal EPR17087-50 Rabbit 999 ICC/IF, IHC, IP, WB ABCD Antibodies ABCD_AU751 ** 10/06/2024 AB_3712954 Recombinant Monoclonal SCFV4B12 Rabbit 5 - ABCD Antibodies ABCD_AU752 ** 10/06/2024 AB_3712955 Recombinant Monoclonal SCFV9D5 Rabbit 85 - ABCD Antibodies ABCD_AW383 ** 10/06/2024 AB_3712956 Recombinant Monoclonal anti-A1AT-2H2 Rabbit 35 - Aviva Systems Biology ARP59239_P050 QC30148-43483 AB_3668851 Polyclonal - Rabbit 500 WB Aviva Systems Biology ARP96977_P050 QC67938-43131 AB_3668852 Polyclonal - Rabbit 500 WB Aviva Systems Biology AVARP00015_T100 QC0199-20150424 AB_841679 Polyclonal - Rabbit 1000 IHC, WB Bio-Techne MAB1268 * 202808 AB_2301508 Monoclonal 202808 Mouse 500 ICC/IF, IHC, IP, WB Bio-Techne NBP1-47957 * F002 AB_10010955 Monoclonal OTI9A1 Mouse 1000 FC, IHC, IP, WB GeneTex GTX112707 40492 AB_11161999 Polyclonal - Rabbit 810 IHC, WB Proteintech 66135-1-Ig * 10003372 AB_2881534 Monoclonal 1A9G6 Mouse 1600 ICC/IF, IHC, IP, FC-Intra, WB Proteintech 82918-1-RR ** 23006677 AB_3668844 Recombinant Monoclonal 230109A8 Rabbit 800 IHC, FC-Intra, WB Sigma-Aldrich A0409 - AB_257883 Polyclonal - Rabbit NA ELISA, WB Thermo Fisher Scientific 702047 ** 2092596 AB_2689472 Recombinant Monoclonal 8H10L18 Rabbit 500 WB Thermo Fisher Scientific 711079 ** 2799570 AB_2662337 Recombinant Polyclonal - Rabbit 500 ICC/IF, WB * Monoclonal antibody. ** Recombinant antibody. Table 3. Summary of the secondary antibodies used. Company Secondary antibody Catalogue number RRID (Antibody registry) Clonality Application Stock concentration (μg/mL) Working concentration (μg/mL) Proteintech HRP-Goat Anti-Rabbit Secondary Antibody (H+L) RGAR001 AB_3073505 Recombinant Polyclonal Western blot 1000 0.1 Proteintech HRP-Goat Anti-Mouse Secondary Antibody (H+L) RGAM001 AB_3068333 Recombinant Polyclonal Western blot 1000 0.1 Abcam Veriblot ab131366 AB_2892718 Not specified Immunoprecipitation 40 0.04 Proteintech CoraLite-Plus-647-Goat Anti-Rabbit Secondary Antibody (H+L) RGAR005 AB_3073509 Recombinant Polyclonal Flow cytometry 500 0.625 Proteintech CoraLite-Plus-647-Goat Anti-Mouse Secondary Antibody (H+L) RGAM005 AB_3073503 Recombinant Polyclonal Flow cytometry 500 0.625 Cell culture All cell lines used in this study are listed in Table 1 , alongside their corresponding RRIDs, to ensure proper citation. 18 Cells were cultured in Minimum Essential Medium (MEM) Eagle (Sigma-Aldrich #M0325-500ML) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific #A5256801), 1% sodium pyruvate (Thermo Fisher Scientific #11360070), and 1% antibiotic/antimycotic solution (Capricorn Scientific #AAS-B). All cell lines used in this study were routinely tested for mycoplasma contamination and were confirmed to be mycoplasma-free. CRISPR/Cas9 genome editing The Hep G2 SERPINA1 KO clone was generated using low-passage cells. Prior to ribonucleoprotein transfection, 20,000 cells were plated in each well of a 48-well plate and incubated overnight to allow attachment. in vitro guide RNA was generated with the HighYield T7 sgRNA synthesis kit (Jena Bioscience #RNT-105), followed by incubation with DNase I-XT (New England Biolabs #M0570) and quick CIP (New England Biolabs #M0525) to remove DNA and 5′ phosphorylation respectively. RNA was purified using the Monarch spin RNA cleanup kit (New England Biolabs #T2040) and 125ng of guide RNA (target sequence: CACTCACGATGAAATCCTGG) was combined with 625ng of spCas9. Ribonucleoprotein transfection was then carried out using the Lipofectamine CRISPRMAX Cas9 transfection reagent (Thermo Fisher Scientific #CMAX000008) according to the manufacturer’s protocol. The culture medium was replaced the following day, and single-cell isolation was performed on day three. Single cells were plated into 96-well plates and clonally expanded. Antibody screening by western blot Hep G2 WT and SERPINA1 KO cells were washed three times in Hanks’ balanced salt solution (HBSS) (Capricorn Scientific #HBSS-2A) and serum deprived for 48-hours in MEM media without phenol red (Thermo Fisher Scientific #51200046) supplemented with 1% sodium pyruvate, 1% antibiotic/antimycotic solution and 1% L-glutamine (Thermo Fisher Scientific #A2916801). Culture medium was then collected and centrifuged for 500 × g , for 10 minutes at 4°C to eliminate cells and larger contaminants, then for 4500 × g , for 10 minutes at 4°C to eliminate smaller contaminants. Conditioned medium was then concentrated by centrifugation at 4000 × g for 30 minutes at 4°C using Amicon Ultra 15mL centrifugal filters with a 3 kDa molecular weight cut off (Sigma Aldrich #UFC900396). Culture media was then supplemented with 1× protease inhibitor cocktail (Cell Signaling Technology #7012). For lysate preparation, Hep G2 WT and SERPINA1 KO cells were washed three times in phosphate buffered saline (PBS) (Thermo Fisher Scientific #70011044) and lysed in RIPA buffer containing 1× of protease inhibitor cocktail, sodium orthovanadate and phenylmethylsulfonyl fluoride (Santa Cruz Biotechnology #sc-24948). Lysates were sonicated (40% amplitude for 5 seconds) three times and incubated for 30 minutes on ice prior to centrifugation at 20,000 × g for 1 hour at 4°C. Protein concentration was quantified using the Pierce BCA protein assay (Thermo Fisher Scientific #23225) and 30 μg of protein was used for both protein lysates and concentrated cell culture medium. Samples were combined with Laemmli sample buffer (Bio-Rad #1610747) containing 2-mercaptoethanol (final concentration 355 mM) (Sigma Aldrich #M7522) before being heated at 65°C for 10 minutes. Samples were then loaded in precast 4-20% WedgeWell Tris-Glycine Plus midi gels (Thermo Fisher Scientific #WTG42020BOX) alongside Prime-Step prestained broad range protein ladder (BioLegend #773302). SDS-PAGE was then performed in SureLock Tandem Midi Gel tanks (Thermo Fisher Scientific #STM1001) and run at 200V for 1 hour with Tris/Glycine/SDS buffer (Bio-Rad #1610772). Proteins were then transferred to 0.2μm supported nitrocellulose membranes (Cytiva #10600015) using a Criterion blotter with plate electrodes (Bio-Rad #17004070) run at 85V for 45 minutes. Proteins on the blot were then visualised with Ponceau S staining (Thermo Fisher Scientific #161470250) which was scanned to show alongside individual western blots. Blots were blocked with 5% milk for 1 hour in Tris-buffered saline containing 1% Tween 20 (TBST) (Thermo Fisher Scientific #J77500.K2). Primary antibodies were then incubated overnight at 4°C in 5% milk TBST with gentle shaking. Following three ten-minute washes with TBST, horseradish peroxidase (HRP) conjugated secondary antibodies were incubated at a dilution of 1/10000 (0.1μg/mL) in TBST with 5% milk for 1 hour at room temperature followed by three ten-minute washes with TBST. Membranes were then incubated with either Pierce ECL (Thermo Fisher Scientific #32106) for 1 minute or Clarity Western ECL substrate (Bio-Rad #1705061) for 5 minutes prior to detection with the ImageQuant LAS 4000. Antibody screening by immunoprecipitation Antibody-bead conjugates were prepared by adding 2 μg of antibody to 1 mL of Pierce IP Lysis Buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol) (Thermo Fisher Scientific #87788) in a microcentrifuge tube, together with 30 μL of protein A (for rabbit antibodies) or protein G (for mouse antibodies) (Thermo Fisher Scientific #10002D and #10004D respectively). Tubes were rocked for 1 hour at 4°C followed by two washes to remove unbound antibody. Culture media from Hep G2 WT were collected as described in the western section above. 0.5 mL aliquots at 1mg/mL of culture medium were incubated with an antibody-bead conjugate for 18 hours at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 mL of IP buffer and processed for SDS-PAGE and western blot on precast midi 4-20% Tris-Glycine polyacrylamide gels. Antibody screening by flow cytometry Hep G2 WT and SERPINA1 KO cells were detached, and five million cells were labelled with CellTracker green or violet fluorescent dyes, respectively (Thermo Fisher Scientific, #C7025 and #C10094). WT and KO cells were then centrifuged at 300 × g , for 10 minutes and resuspended in PBS containing 1% bovine serum albumin (BSA) (Sigma-Aldrich, A9647). Cell populations were then combined at a 1:1 ratio, centrifuged and fixed on ice for 20 minutes using 800 μL of 4% PFA in PBS (Thermo Fisher Scientific #J19943.K2). Following fixation, 1.2 mL of 1% BSA in PBS was added to the tube, vortexed and centrifuged at 600 × g for 15 minutes at 4°C. Cells were then permeabilised in 400 μL PBS with 0.1% Saponin (Sigma-Aldrich #558255) for 10 minutes at room temperature, centrifuged at 600 × g for 15 minutes at 4°C and then blocked with 5% goat serum (Sigma-Aldrich #G6767), 1% BSA, 0.1% saponin in PBS for 30 minutes on ice. After the blocking step 400,000 cells were aliquoted into individually labelled tubes, centrifuged at 600 × g for 15 minutes at 4°C and incubated in 150 μL of 1% BSA, 0.1% Saponin PBS with primary A1AT antibodies for 30 minutes on ice. 500 μL of 1% BSA, 0.1% saponin PBS was then added to each tube, vortexed and centrifuged at 600 × g for 15 minutes at 4°C. Cells were then incubated with their corresponding Multi-rAb CoraLite ® Plus 647 secondary antibodies (0.83 μg/ml) (Proteintech #RGAR005 and #RGAM005) in 150 μL of 1% BSA, 0.1% saponin PBS for 30 minutes on ice. 500 μL of 1% BSA, 0.1% saponin PBS was then added to each tube, vortexed and centrifuged 600 × g for 15 minutes at 4°C. Tubes were then resuspended in 1 ml of 1% BSA in PBS and data was acquired using the Attune NxT flow cytometer. Data was analysed using FlowJo with the following gates. The cell population was first gated on FSC-A vs SSC-A, within that gate single cells were selected by FSC-A vs FSC-H and then KO and WT cells were isolated by BL1-A vs VL1-A using a quadrat gate. Quantification of antibody staining was then observed in the RL1-A channel and histograms merged to demonstrate the staining intensity between the two populations compared to the two secondary only controls. The figure was then assembled using Adobe Illustrator 2024. Data availability Underlying data Zenodo: Dataset for the Alpha-1-antitrypsin antibody screening study, this contains the underlying data included in a study which characterized eighteen commercially available antibodies against Alpha-1-antitrypsin (SERPINA1) by immunoblot (Western blot), immunoprecipitation and flow cytometry, using a knockout based validation. This corresponds to all the data within the figures for this article. https://doi.org/10.5281/zenodo.17925190 . Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). Acknowledgments This is a summary of independent research funded by both the NC3Rs and MRC and carried out at the National Institute for Health and Care Research (NIHR) Leicester Biomedical Research Centre (BRC). The views expressed are those of the author(s) and not necessarily those of the NC3Rs, the MRC, the NIHR or the Department of Health and Social Care. We gratefully acknowledge the support of Dr. Carl Laflamme and Dr. Riham Ayoubi, whose technical expertise were invaluable to this work. References 1. Stoller JK, Aboussouan LS: α1-antitrypsin deficiency. Lancet. 2005 Jun 23; 365 (9478): 2225–2236. PubMed Abstract | Publisher Full Text 2. Stoller JK, Aboussouan LS: A Review of α1-Antitrypsin Deficiency. Am. J. Respir. Crit. Care Med. 2011 Sep 13; 185 (3): 246–259. PubMed Abstract | Publisher Full Text 3. Needham M, Stockley R: Exacerbations in 1-antitrypsin deficiency. Eur. Respir. J. 2005 Jun 1; 25 (6): 992–1000. PubMed Abstract | Publisher Full Text 4. Gooptu B, Ekeowa UI, Lomas DA: Mechanisms of emphysema in alpha1-antitrypsin deficiency: molecular and cellular insights. Eur. Respir. J. 2009 Jul 31; 34 (2): 475–488. PubMed Abstract | Publisher Full Text 5. Senn O, Russi EW, Imboden M, et al. : α1-Antitrypsin deficiency and lung disease: risk modification by occupational and environmental inhalants. Eur. Respir. J. 2005 Nov 1; 26 (5): 909–917. PubMed Abstract | Publisher Full Text 6. Strnad P, McElvaney NG, Lomas DA: Alpha1-Antitrypsin Deficiency. Longo DL, editor. N. Engl. J. Med. 2020 Apr 8; 382 (15): 1443–1455. PubMed Abstract | Publisher Full Text 7. Ruiz-Duque B, Bañuls L, Reinoso-Arija R, et al. : Methodologies for the Determination of Blood Alpha1 Antitrypsin Levels: A Systematic Review. J. Clin. Med. 2021 Oct 31; 10 (21): 5132. Publisher Full Text 8. Borel F, Mueller C: Alpha-1 antitrypsin deficiency: methods and protocols. New York, Ny: Humana Press; 2017. 9. Uhlen M, Bandrowski A, Carr S, et al. : A proposal for validation of antibodies. Nat. Methods. 2016 Sep 5; 13 (10): 823–827. PubMed Abstract | Publisher Full Text 10. Biddle M, Stylianou P, Rekas M, et al. : Improving the integrity and reproducibility of research that uses antibodies: a technical, data sharing, behavioral and policy challenge. MAbs. 2024 Mar 6; 16 (1). Publisher Full Text 11. Virk HS, Rekas MZ, Biddle MS, et al. : Validation of antibodies for the specific detection of human TRPA1. Sci. Rep. 2019 Dec 6; 9 (1). Publisher Full Text 12. Ayoubi R, Ryan J, Bolivar SG, et al. : A consensus platform for antibody characterization. Nat. Protoc. 2024 Dec 17. 13. Ayoubi R, Ryan J, Biddle MS, et al. : Scaling of an antibody validation procedure enables quantification of antibody performance in major research applications. elife. 2023 Nov 5; 12 . Publisher Full Text 14. Biddle MS, Virk HS: YCharOS open antibody characterisation data: Lessons learned and progress made. F1000Res. 2023 Oct 16; 12 . Publisher Full Text 15. Biddle MS, Alende C, Fotouhi M, et al. : A guide to selecting high-performing antibodies for Synaptotagmin-1 (Uniprot ID P21579) for use in western blot, immunoprecipitation, immunofluorescence and flow cytometry. F1000Res. 2024 Jul 19; 13 : 817–817. Publisher Full Text 16. Alshalfie W, Biddle M, Fotouhi M, et al. : The identification of high-performing antibodies for FUS (Uniprot ID: P35637) for use in western blot, immunoprecipitation, immunofluorescence and flow cytometry. F1000Res. 2024 Sep 24; 12 : 376–376. Publisher Full Text 17. Bandrowski A, Pairish M, Eckmann P, et al. : The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023 Jan 6; 51 (D1): D358–D367. PubMed Abstract | Publisher Full Text 18. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018 May 10; 29 (2): 25–38. PubMed Abstract | Publisher Full Text Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 19 Jan 2026 ADD YOUR COMMENT Comment Author details Author details 1 University of Leicester College of Life Sciences, Leicester, England, UK 2 Institute for Precision Health, University of Leicester, Leicester, England, UK Jemma Cooper Roles: Investigation, Methodology, Visualization, Writing – Review & Editing Carolyn Jones Roles: Investigation, Methodology, Writing – Review & Editing Katie Dixon Roles: Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Bibek Gooptu Roles: Supervision, Writing – Review & Editing Harvinder Virk Roles: Conceptualization, Funding Acquisition, Resources, Supervision, Writing – Review & Editing Michael Biddle Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Competing interests For this project, the authors developed partnerships with leading antibody manufacturers and KO cell line providers. The partners provide antibodies and KO cell lines to this project at no cost. These partners include: Abcam, ABCD antibodies, ABclonal, Addgene, Aviva Systems Biology, BioTechne, Cell Signaling Technology, Developmental Studies Hybridoma Bank, GeneTex, Horizon Discovery, Institute for Protein Innovation, MilliporeSigma, Proteintech, Synaptic Systems, Thermo Fisher Scientific. Grant information This work was supported by a grant from the National Centre for the Replacement, Refinement and Reduction of Animals in Research (NC3Rs) and MRC (NC3Rs Ref: NC/NAM0019/1, MRC UKRI076) alongside support from the Leicester Institute for Precision Health. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (1) version 1 Published: 19 Jan 2026, 15:73 https://doi.org/10.12688/f1000research.175969.1 Copyright © 2026 Cooper J et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Cooper J, Jones C, Dixon K et al. A guide to selecting high-performing antibodies for Alpha-1-antitrypsin (UniProt ID: P01009) for use in western blot, immunoprecipitation and flow cytometry [version 1; peer review: 2 approved] . F1000Research 2026, 15 :73 ( https://doi.org/10.12688/f1000research.175969.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 1 VERSION 1 PUBLISHED 19 Jan 2026 Views 0 Cite How to cite this report: Evans SE. Reviewer Report For: A guide to selecting high-performing antibodies for Alpha-1-antitrypsin (UniProt ID: P01009) for use in western blot, immunoprecipitation and flow cytometry [version 1; peer review: 2 approved] . F1000Research 2026, 15 :73 ( https://doi.org/10.5256/f1000research.193994.r459390 ) The direct URL for this report is: https://f1000research.com/articles/15-73/v1#referee-response-459390 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 05 Mar 2026 Sian E. Evans , University of Leicester, Leicester, England, UK Approved VIEWS 0 https://doi.org/10.5256/f1000research.193994.r459390 The data note describes the characterisation and specification of 18 commercially available antibodies for Alpha-1-antitrypsin (A1AT) for use in western blot, immunoprecipitation and flow cytometry. The aim is to assess antibody specificity for A1AT using the Hep ... Continue reading READ ALL The data note describes the characterisation and specification of 18 commercially available antibodies for Alpha-1-antitrypsin (A1AT) for use in western blot, immunoprecipitation and flow cytometry. The aim is to assess antibody specificity for A1AT using the Hep G2 cell line, and to compare readouts from wild-type and CRISPR/Cas9 knockout (KO) cells, using standardised experimental protocols that are openly available online. The results and discussion section is concise and coherent. All images and tables are presented clearly. The authors justify their choice of using the Hep G2 cell line and reference the database they used to identify it. A couple of minor suggestions would be: 1. To include a table or image which demonstrates the distinction between successful and unsuccessful antibody performance in each of the techniques described. I have come across this in other data notes of this kind and found it extremely useful when interpreting the data. 2. To demonstrate how you confirmed the successful KO of SERPINA1. 3. Further explain why two different ECL reagents were used. Is the rationale for creating the dataset(s) clearly described? Yes Are the protocols appropriate and is the work technically sound? Yes Are sufficient details of methods and materials provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Using multiplexed immunofluorescence techniques on patient-derived explants, cell biology, and assay development. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Evans SE. Reviewer Report For: A guide to selecting high-performing antibodies for Alpha-1-antitrypsin (UniProt ID: P01009) for use in western blot, immunoprecipitation and flow cytometry [version 1; peer review: 2 approved] . F1000Research 2026, 15 :73 ( https://doi.org/10.5256/f1000research.193994.r459390 ) The direct URL for this report is: https://f1000research.com/articles/15-73/v1#referee-response-459390 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Jean S. Reviewer Report For: A guide to selecting high-performing antibodies for Alpha-1-antitrypsin (UniProt ID: P01009) for use in western blot, immunoprecipitation and flow cytometry [version 1; peer review: 2 approved] . F1000Research 2026, 15 :73 ( https://doi.org/10.5256/f1000research.193994.r451626 ) The direct URL for this report is: https://f1000research.com/articles/15-73/v1#referee-response-451626 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 06 Feb 2026 Steve Jean , Université de Sherbrooke,, Sherbrooke, QC, Canada Approved VIEWS 0 https://doi.org/10.5256/f1000research.193994.r451626 In this manuscript by Cooper et al., the authors use standardized approaches to assess the specificity of 18 commercial Alpha‑1‑antitrypsin antibodies across three applications (western blot, immunoprecipitation, and FACS). The manuscript is clear, well structured, and contributes to the ... Continue reading READ ALL In this manuscript by Cooper et al., the authors use standardized approaches to assess the specificity of 18 commercial Alpha‑1‑antitrypsin antibodies across three applications (western blot, immunoprecipitation, and FACS). The manuscript is clear, well structured, and contributes to the broader antibody characterization effort led by the YCharOS initiative. I am particularly impressed that all original data, along with detailed protocols, are openly available on a Zenodo webpage. I have only two minor suggestions that could further improve the clarity and interpretation of the presented data: Provide the genomic sequence of the KO clone used in the study. CRISPR/Cas9 editing commonly results in diverse indels or insertions. Including the sequence of the affected genomic region in the SERPINA1 KO clone used throughout the manuscript would help readers fully interpret the antibody‑validation results and understand the nature of the knockout. Clarify exposure conditions for western blot images. From the raw data, it appears that multiple exposures were acquired on the LAS4000 and that most antibodies were tested simultaneously. Indicating whether all figures were generated using the same exposure time, or specifying the exposure times when they differ, would facilitate more accurate comparison across antibodies. Is the rationale for creating the dataset(s) clearly described? Yes Are the protocols appropriate and is the work technically sound? Yes Are sufficient details of methods and materials provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Cell biology, proteomics, membrane trafficking I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Jean S. Reviewer Report For: A guide to selecting high-performing antibodies for Alpha-1-antitrypsin (UniProt ID: P01009) for use in western blot, immunoprecipitation and flow cytometry [version 1; peer review: 2 approved] . F1000Research 2026, 15 :73 ( https://doi.org/10.5256/f1000research.193994.r451626 ) The direct URL for this report is: https://f1000research.com/articles/15-73/v1#referee-response-451626 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 19 Jan 2026 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 Version 1 19 Jan 26 read read Steve Jean , Université de Sherbrooke,, Sherbrooke, QC, Canada Sian E. Evans , University of Leicester, Leicester, UK Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Evans S. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 05 Mar 2026 | for Version 1 Sian E. Evans , University of Leicester, Leicester, England, UK 0 Views copyright © 2026 Evans S. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The data note describes the characterisation and specification of 18 commercially available antibodies for Alpha-1-antitrypsin (A1AT) for use in western blot, immunoprecipitation and flow cytometry. The aim is to assess antibody specificity for A1AT using the Hep G2 cell line, and to compare readouts from wild-type and CRISPR/Cas9 knockout (KO) cells, using standardised experimental protocols that are openly available online. The results and discussion section is concise and coherent. All images and tables are presented clearly. The authors justify their choice of using the Hep G2 cell line and reference the database they used to identify it. A couple of minor suggestions would be: 1. To include a table or image which demonstrates the distinction between successful and unsuccessful antibody performance in each of the techniques described. I have come across this in other data notes of this kind and found it extremely useful when interpreting the data. 2. To demonstrate how you confirmed the successful KO of SERPINA1. 3. Further explain why two different ECL reagents were used. Is the rationale for creating the dataset(s) clearly described? Yes Are the protocols appropriate and is the work technically sound? Yes Are sufficient details of methods and materials provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Using multiplexed immunofluorescence techniques on patient-derived explants, cell biology, and assay development. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Evans SE. Peer Review Report For: A guide to selecting high-performing antibodies for Alpha-1-antitrypsin (UniProt ID: P01009) for use in western blot, immunoprecipitation and flow cytometry [version 1; peer review: 2 approved] . F1000Research 2026, 15 :73 ( https://doi.org/10.5256/f1000research.193994.r459390) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/15-73/v1#referee-response-459390 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Jean S. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 06 Feb 2026 | for Version 1 Steve Jean , Université de Sherbrooke,, Sherbrooke, QC, Canada 0 Views copyright © 2026 Jean S. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions In this manuscript by Cooper et al., the authors use standardized approaches to assess the specificity of 18 commercial Alpha‑1‑antitrypsin antibodies across three applications (western blot, immunoprecipitation, and FACS). The manuscript is clear, well structured, and contributes to the broader antibody characterization effort led by the YCharOS initiative. I am particularly impressed that all original data, along with detailed protocols, are openly available on a Zenodo webpage. I have only two minor suggestions that could further improve the clarity and interpretation of the presented data: Provide the genomic sequence of the KO clone used in the study. CRISPR/Cas9 editing commonly results in diverse indels or insertions. Including the sequence of the affected genomic region in the SERPINA1 KO clone used throughout the manuscript would help readers fully interpret the antibody‑validation results and understand the nature of the knockout. Clarify exposure conditions for western blot images. From the raw data, it appears that multiple exposures were acquired on the LAS4000 and that most antibodies were tested simultaneously. Indicating whether all figures were generated using the same exposure time, or specifying the exposure times when they differ, would facilitate more accurate comparison across antibodies. Is the rationale for creating the dataset(s) clearly described? Yes Are the protocols appropriate and is the work technically sound? Yes Are sufficient details of methods and materials provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Cell biology, proteomics, membrane trafficking I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Jean S. Peer Review Report For: A guide to selecting high-performing antibodies for Alpha-1-antitrypsin (UniProt ID: P01009) for use in western blot, immunoprecipitation and flow cytometry [version 1; peer review: 2 approved] . F1000Research 2026, 15 :73 ( https://doi.org/10.5256/f1000research.193994.r451626) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/15-73/v1#referee-response-451626 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "A guide to selecting high-performing antibodies...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/15-73/v1" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/15-73/v1&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/15-73/v1" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Cooper J et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/15-73/v1/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/15-73", templates : { twitter : "A guide to selecting high-performing antibodies for\u00A0Alpha-1-antitrypsin\u00A0(UniProt\u00A0ID:\u00A0P01009).... Cooper J et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/15-73/v1" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/175969/193994") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "193994"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "459390": 3, "451626": 2, "451627": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "d7fa3092-0508-4f26-afb0-93b0e22e687e"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00