Protein restriction during pregnancy alters Cdkn1c silencing, dopamine circuitry and behaviour in offspring without wholescale disruption of neuronal gene expression

Protein restriction during pregnancy alters Cdkn1c silencing, dopamine circuitry and behaviour in offspring without wholescale disruption of neuronal gene expression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Help Center Sign In Submit a Preprint Cite Share Download PDF Article Protein restriction during pregnancy alters Cdkn1c silencing, dopamine circuitry and behaviour in offspring without wholescale disruption of neuronal gene expression Chiara Prodani, Elaine E. Irvine, Alessandro Sardini, Hannah J. Gleneadie, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3428617/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Apr, 2024 Read the published version in Scientific Reports → Version 1 posted 11 You are reading this latest preprint version Abstract We tracked the consequences of in utero protein restriction in mice throughout their development and life course using a luciferase-based allelic reporter of imprinted Cdkn1c . Exposure to gestational low-protein diet (LPD) results in the inappropriate expression of paternally inherited Cdkn1c in the brains of embryonic and juvenile mice. These animals were characterised by a developmental delay in motor skills, and by behavioural alterations indicative of reduced anxiety. Exposure to LPD in utero resulted in significantly more tyrosine hydroxylase positive (dopaminergic) neurons in the midbrain of adult offspring as compared to age-matched, control-diet equivalents. Positron emission tomography (PET) imaging revealed an increase in striatal dopamine synthesis capacity in LPD-exposed offspring, where elevated levels of dopamine correlated with an enhanced sensitivity to cocaine. These data highlight a profound sensitivity of the developing epigenome to gestational protein restriction. Our data also suggest that loss of Cdkn1c imprinting and p57 KIP2 upregulation alter the cellular composition of the developing midbrain, compromises dopamine circuitry, and thereby provokes behavioural abnormalities in early postnatal life. Molecular analyses revealed that despite this phenotype, exposure to LPD solely during pregnancy did not cause a gross perturbation in neuronal- or dopamine-associated gene expression that was sustained into adulthood. Biological sciences/Biological techniques/Behavioural methods Biological sciences/Biological techniques/Imaging/Bioluminescence imaging Biological sciences/Biological techniques/Imaging/Positron emission tomography Biological sciences/Biological techniques/Gene expression analysis Biological sciences/Biological techniques/Experimental organisms/Model vertebrates/Mouse Biological sciences/Developmental biology/Epigenetic memory Biological sciences/Molecular biology/Epigenetics/Imprinting Biological sciences/Developmental biology/Intrauterine growth Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The transition from one cell-cycle-phase to another is regulated by activation and inhibition of heterodimeric cyclin/cyclin-dependent kinase (CDK) complexes [ 1 , 2 ]. These complexes are themselves regulated by cyclin-dependent kinase inhibitors (CKI), partners that can prevent or limit CDK activity [ 3 , 4 ]. Achieving a balance between quiescence and cell cycle progression is an essential feature of organismal biology. It is important for preserving stem cell populations as well as the differentiation of committed precursors, and deregulated in many types of cancer [ 5 , 6 , 7 , 8 ]. The CiP/KiP family of CKIs, which includes p21, p27 and p57, are able to bind all CDK and cyclin subunits. They exert a major influence on cell cycle control and influence adult physiology, embryogenesis, and pathology, through diverse interactions that extend to factors that are not strictly cell cycle-associated [ 9 , 10 ]. Here we examine the impacts of dietary-induced p57 KIP2 overexpression in utero , and in particular, the consequences this exposure has on the midbrain and behaviour of offspring. p57 KIP2 is encoded by Cdkn1c , a maternally-expressed imprinted gene that lies within the imprinting cluster 2 (IC2) of mouse chromosome 7 [ 11 ]. In development, Cdkn1c is expressed transiently, being particularly abundant in neural and skeleto-muscular tissue of mid-gestation embryos [ 12 ] and marking cells that exit from proliferative cycles [ 13 , 14 ]. Cdkn1c is heavily implicated in regulating foetal growth and placental development [ 15 , 16 , 17 , 18 ], is critical for tuning radial glial progenitor-mediated neuron output [ 8 , 19 ] and can exert profound effects on physiology and behaviour when upregulated as little as two-fold [ 20 , 21 , 22 ]. Among the myriad of experimental phenotypes that are reported to arise from tissue-specific Cdkn1c deletion, or modest increases in Cdkn1c expression, many are assumed to reflect the role of p57 KIP2 as a negative regulator of cell proliferation [ 13 ]. However, recently some studies have challenged this view, implicating Cdkn1c in promoting cortical development [ 23 , 24 ] and showing that deletions in paternal alleles within the central nervous system can result in reduced neural stem and progenitor cell abundance, and a deficit in upper layer neurons of the cortex [ 25 , 26 ]. Exposure to diets that are low in protein during pregnancy is known to enhance Cdkn1c expression in embryos, eroding DNA methylation across important regulatory regions, such as the somatic differentially methylated region (sDMR) of the locus [ 27 , 28 , 29 ]. Although the exact timing of this sensitivity to dietary challenge remains uncertain, monoallelic Cdkn1c expression is evident in mouse embryos from E6.5 onwards [ 30 ], while pre-implantation exposure (E3.5) to low protein diet is reported to be sufficient to trigger a permanent reduction in neural stem cell numbers in the foetal brain [ 31 ], as well as reducing bone growth at later gestational stages [ 32 ]. Early life exposure to low protein diet has also been linked to altered behaviour [ 29 , 33 ], including changes in dopamine-dependent reward-processing and locomotor activity [ 27 ]. To longitudinally monitor allelic Cdkn1c expression in vivo , we previously developed a novel mouse reporter where imprinted gene expression can be visualised by bioluminescence imaging [ 28 ]. This model, where Fluc and lacZ genes are non-disruptively targeted into the 3’UTR of the endogenous Cdkn1c locus, uses T2A sites to simultaneously generate p57 KIP2 (Cdkn1c), luciferase and β-galactosidase proteins from reporter-derived transcripts. With this reporter we previously showed that a low protein diet (LPD) fed to dams during pregnancy resulted in the loss of imprinting (LOI) of Cdkn1c in embryos, including in the midbrain, with sustained and inappropriate expression of paternal Cdkn1c into adulthood [ 28 ]. To better understand the consequences of this exposure-induced loss of Cdkn1c imprinting, here we assess the behaviours and phenotypes of offspring as they mature postnatally from juveniles to adults. Our results show that exposure to LPD in utero generates offspring with increased numbers of tyrosine hydroxylase (TH)-positive neurons in the midbrain, altered dopamine circuitry and distinct behaviours. Despite this clear phenotype, LPD-exposed and non-exposed offspring showed broadly similar patterns of gene expression in the brain. These results reveal that in utero exposures that elicit paternal Cdkn1c de-repression in the developing embryonic brain alter its longer-term function through an increase in the abundance of TH-positive neurons, rather than by a sustained corruption in the intrinsic programs of neuronal gene expression. Results Paternal Cdkn1c is expressed selectively in embryos exposed to LPD in utero We used the Cdkn1c-Fluc-lacZ reporter mouse line to track paternal Cdkn1c expression in vivo . This reporter line has been characterised in detail previously [ 28 ], and was used here to visualise paternal Cdkn1c de-repression in embryos exposed to LPD. Briefly, wildtype (WT) females were mated with heterozygote ( Cdkn1c-Fluc-lacZ +/− ) male reporter mice, to generate offspring that were either WT, or inherited Cdkn1c-Fluc-lacZ paternally (KI Pat ) (Fig. 1 A). Pregnant dams were injected with the luciferase substrate D-luciferin, and whole-body imaging was used to detect and quantify bioluminescence signal (Fig. 1 B). Consistent with Cdkn1c being almost exclusively maternally-expressed [ 11 , 25 ], and correct paternal Cdkn1c-Fluc-lacZ silencing in developing embryos [ 28 ], bioluminescence signal was not detected in pregnant females carrying WT or KI Pat E11.5 embryos fed a normal control diet (CD). Bioluminescent signal was, however, detected in pregnant dams fed a calorie matched LPD (compare representative images shown in left and right panels of Fig. 1 B). Among embryos isolated from these mice, bioluminescence was exclusively detected in KI Pat foetuses derived from mothers fed LPD during pregnancy (Fig. 1 C, left), and quantification of signal among all KI Pat individuals confirmed a significant increase in LPD-exposed embryos as compared to controls (Fig. 1 C, right). Similar results were seen at later stages of development (E14.5) in pregnant dams (Fig. 1 D) and isolated embryos (Fig. 1 E). Luciferase signal was prominent in the embryo head, consistent with previous results [ 28 ], and confirmed that protein restriction during gestation induces paternally-derived Cdkn1c misexpression and LOI in embryos. Elevated numbers of midbrain TH-positive neurons in offspring exposed in utero to LPD De-repression of paternal Cdkn1c-Fluc-lacZ initiated early in gestation can continue beyond birth and long after LPD exposure, whilst gestational sensitivity to LPD is ameliorated by supplementation of maternal LPD with folate, which effectively restores correct DNA methylation across the sDMR [ 28 ]. Independent studies by others have also shown that folate depletion in pregnancy impacts brain development in adults [ 27 , 31 , 34 ] and that Cdkn1c upregulation can alter the proliferation and differentiation of developing dopaminergic neurons within the midbrain [ 20 , 27 , 29 ]. We therefore examined the brains and the behaviours of juvenile and adult offspring that had experienced gestational LPD exposure. Tyrosine Hydroxylase (TH) is the rate-limiting enzyme in dopamine synthesis, and the most commonly used marker of dopaminergic neurons. As illustrated in Fig. 1 F, a significant increase in the number of TH-positive neurons was detected in the midbrain of offspring at 4 and 9 weeks of age following in utero LPD exposure, compared to matched CD exposed offspring. Figure 1 F (left) shows representative anti-TH immunofluorescence labelling (green) of midbrain sections at low magnification (with higher magnification insets) to enumerate TH-positive neurons. Quantification of the number of TH-positive cell bodies, provided in the accompanying plots (Fig. 1 F, right), demonstrated that gestational exposure to LPD resulted in significant increases in the abundance of TH-neurons in the midbrain of reporter mice sampled at both 4 and 9 weeks of age (24% and 25% increases in TH-neurons, respectively). Altered behaviours in offspring previously exposed to LPD in utero To gauge the behavioural impacts of in utero LPD exposure and paternal Cdkn1c mis-expression, we subjected juvenile (4–5 week old) and adult (9–10 week old) offspring to an array of tasks designed to evaluate basic motor functions, as well as anxiety-related and cognitive functions. Motor coordination, motor skill learning and balance were assessed using an accelerating rotarod, a tool often used to dissect motor capabilities from cognitive function [ 35 , 36 ]. LPD-exposed offspring underperformed in rotarod tests as compared to CD-exposed animals at 4–5 weeks of age (Fig. 2 A, dashed lines) but interestingly, showed a significant improvement by 9–10 weeks of age (Fig. 2 A, solid lines). This could be partially explained by LPD-exposed mice being slightly heavier than CD-exposed mice at 4 weeks of age, a difference which normalises as they mature (Supplementary Fig. S1 A). While juvenile LPD and CD exposed animals showed similar marble burying capacity, a test that has often been used to assess dopaminergic and glutaminergic circuits [ 37 ] or infer autistic-like behaviours [ 38 ], a significant increase in this behaviour was evident in LPD-exposed offspring as they matured from 4–5 to 9–10 weeks of age (Fig. 2 B). Open field testing showed that although movement was indistinguishable between juvenile LPD- or CD-exposed mice (4–5 weeks of age), increased locomotor activity was evident in the LPD group as they matured (Fig. 2 C). In particular, an increase in distance moved (upper panel), rather than velocity (lower panel), was seen in LPD mice at 9–10 weeks. To investigate whether this increased activity might reflect enhanced exploratory behaviour, reduced anxiety, or short-term memory-related deficits, mice were subjected to Y-maze (Fig. 2 D) and elevated O-maze (EOM) (Fig. 2 E) testing. Y-maze assessment showed that the percentages of spontaneous alteration entries (ABC) (Fig. 2 D, upper panel) and same arm entries (ABA) (Fig. 2 D, lower panel) for animals over a 5-minute test period were similar between juvenile and adult CD and LPD-exposed offspring. In contrast, in EOM tests, adult LPD-exposed offspring exhibited increased exploration (illustrated by representative heatmaps in Fig. 2 E, left). In particular, LPD-exposed adults spent significantly more time in the open areas than age-matched CD-exposed mice or LPD-exposed juveniles (Fig. 2 E, middle), and made significantly more open area entries as they matured (Fig. 2 E, right). Dietary-exposure also had a significant overall effect on the distance travelled and velocity (Supplementary Fig. S1 B), although individual pairwise comparisons were not significant for these metrics (see figure legends for details). Taken together these data show that offspring arising from in utero exposure to maternal LPD display specific behavioural phenotypes. Interestingly, underperformance in motor skill tests by juveniles, which could reflect a developmental delay in response to LPD, was fully restored as these mice matured. By 9–10 weeks, LPD-exposed offspring showed increased locomotor capacity and behaviours that might indicate a reduced level of anxiety relative to controls. Increased dopamine synthesis capacity and sensitivity to cocaine in LPD-exposed offspring Dopaminergic cells in the midbrain are involved in movement regulation and pharmacological stimulation of the dopamine system results in increased extracellular dopamine concentration and hyperactivity in rodents [ 39 ]. Overexpression of Cdkn1c can alter dopamine circuitry in mice [ 20 , 27 , 29 ] and has been associated with hyperactivity in humans [ 40 ]. To explore this, we examined the responses of CD- or LPD-exposed offspring to cocaine. Cocaine binds to the dopamine transporter (DAT) and thereby blocks the removal of extracellular dopamine at the synapse. Previous studies had indicated that cocaine elicits a heightened locomotor response in mice that had been exposed to protein restriction throughout gestation and lactation [ 27 ]. Adult male mice that had been exposed to LPD or CD in utero were injected daily with cocaine for 5 consecutive days (as shown schematically in Fig. 3 A). This regime of administration enables cocaine sensitisation to be determined by analysing the impact of repeat challenge, relative to initial responses to cocaine. During habituation, prior to cocaine exposure, both sets of adult mice showed broadly similar locomotor activity as shown in Fig. 3 B (left) and Supplementary Videos S1 and S2, and quantified in Fig. 3 C. Following cocaine injection (20 mg/kg) CD-exposed animals showed enhanced locomotor activity, as judged by an increase in distance moved (Fig. 3 C), while LPD animals (orange) did not. This is also evident in the heatmap comparisons shown in Fig. 3 B (right) and the accompanying Supplementary Videos S3 and S4. While this observation was unanticipated, a closer inspection of the movements of LPD mice after cocaine administration revealed a propensity for stereotypic tight circling behaviour (exemplified in Supplementary Video S4). Rotation of this sort was uncommon during habituation in either LPD or CD animals, but increased in both groups upon exposure to cocaine (Supplementary Fig. S2 A), and was higher in LPD-exposed mice compared to controls. Importantly, although LPD animals showed reduced movement immediately following administration of 20 mg/cocaine (Supplementary Fig. S2 B), LPD mice were more responsive than their CD counterparts to a lower dose (15 mg/kg, Supplementary Fig. S2 C) and showed significantly higher movement across a 5-day treatment regime (Fig. 3 D). Taken together, these observations prompted us to revise our initial interpretation; rather than being less sensitive, LPD animals appear hypersensitive to cocaine administration. The tight-circling behaviour that is associated with gestationally LPD-exposed offspring has been described by others using higher amphetamine and cocaine doses (40 mg/kg) than administered here [ 41 , 42 ], and stereotypical behaviours have been associated with the offspring of dams exposed to LPD for 5 weeks prior to mating and through pregnancy [ 43 ]. To ask whether this increased sensitivity reflects elevated dopamine synthesis capacity in LPD-exposed animals, we used micro-positron emission tomography (PET) imaging with the radiolabelled tracer [ 18 F]FDOPA to examine twelve adult mice, six for each gestational exposure. [ 18 F]FDOPA PET imaging has been widely used to interrogate dopamine synthesis capacity in a variety of neurological and neuropsychiatric disorders, and is a validated approach to assess nigrostriatal dopamine circuit integrity [ 44 , 45 ], including in mice [ 46 , 47 ]. Briefly, PET and CT scans were aligned and 3-dimensional regions of interest drawn manually around the left and right striata, midbrain and cerebellum (which served as a control for non-specific uptake) (illustrated in Fig. 4 A). Time activity curves were extracted from the data (Fig. 4 B) and modelled by Gjedde-Patlak analysis [ 48 ] to derive multiple measures of dopaminergic activity, including the rate constant, K i mod , for the striatal uptake of [ 18 F]FDOPA and its conversion to [ 18 F]fluorodopamine corrected for dopamine turnover during the scan (Fig. 4 C and Supplementary Figs. S3A and S3B, summarised in Fig. 4 D). LPD-exposed mice showed a significant increase in K i mod relative to controls (Fig. 4 C), and K loss (an index of dopamine turnover) was also significantly increased in these animals. K i std values, which estimate dopamine synthesis capacity but do not correct for loss of radioactive metabolites over the two-hour period of data collection, were not significantly different between the groups, likely because of the higher K loss in LPD-exposed mice. Together these data confirm that gestationally LPD-exposed mice show increased striatal dopamine synthesis capacity and dopamine turnover, indexed by [ 18 F]FDOPA imaging, relative to animals gestationally exposed to control diet. Comparing gene expression in the brains of adult mice following in utero LPD or CD exposure To better understand the biological basis of increased dopamine synthesis capacity in LPD animals, we examined the expression of a panel of genes that characterise different cell types within the adult brain using quantitative RT-PCR. As shown in Fig. 5 A, expression of Tubb3 and NeuN (which distinguish immature and mature neurons) was similar in the midbrain of LPD and CD-derived samples. Similarly, we saw no significant differences in expression of Gfap, Cnp and Itgam , markers of astrocytes, oligodendrocytes and microglia, respectively. Perhaps surprisingly, we did not see a significant increase in Th or Cdkn1c expression in LPD- as compared to CD-exposed midbrain samples (Fig. 5 A). Furthermore, expression levels of these genes in LPD- and CD-exposed samples derived from other regions of the brain (cortex, cerebellum and striatum) were similar (Supplementary Figs. S4A-S4C), and were broadly equivalent in animals subjected to behavioural tests (depicted as open symbols) or naïve to testing (closed symbols, Fig. 5 A). Previous studies in which maternal LPD exposure extends throughout breeding, pregnancy and lactation have reported a > 6-fold elevation in Th expression in all regions of the brain examined, as well as upregulation of DAT ( SLC6A3 ) and DARPP-32 [ 27 ]. Here we show that exposure to LPD solely during gestation was, in contrast, insufficient to cause such sustained increases in Th expression, despite inducing increases in the number of TH-positive midbrain neurons. To investigate this further we analysed the expression of a panel of genes implicated in dopamine synthesis and metabolism, such as DDC ( Aadc ), SLC6A3 ( DAT ), dopamine receptors DRD1, DRD2, DRD3, DR4 and DRD5 , or genes implicated in interactions with Cdkn1c /p57 KIP2 , such as NR4A2 ( Nurr1 ), in both striatum and midbrain (Figs. 5 B and 5 C). We observed a very modest increase in DRD5 expression in LPD-derived midbrain, together with a slightly reduced expression of SLC6A3 ( DAT ). Overall, wholesale changes in the expression of most neuronal- or dopamine-associated genes were not detected. By normalising gene expression to different housekeeping controls (for example 18S , Tbp and Gapdh , rather than β-actin ), small differences in gene expression between LPD and CD samples were in some cases statistically significant (as shown for Cdkn1c in Supplementary Fig. S4 D left; DARPP-32 expression was unaffected by this, as shown in Supplementary Fig. S4 D right). In addition, we noted that SLC6A3 ( DAT ) and DRD5 expression were not significantly altered by dietary exposure in a separate cohort of animals (Supplementary Fig. S4 E). In conclusion, the scale of gene expression changes detected herein appear vanishingly low in comparison with those previously reported, where offspring were exposed to maternal LPD for much longer periods of time, notably throughout gestation, early prenatal life and lactation [ 27 ]. Discussion Numerous studies in the last few decades have examined the impact of early life adversity on offspring health and the possible mechanisms that underlie an increased susceptibility to neuropsychiatric and metabolic disorders. In rat models, protein restriction during pregnancy has been shown to result in elevated levels of dopamine in the brain of offspring [ 49 , 50 ], increased TH activity [ 49 ] and altered dopamine receptor binding [ 51 ]. Similarly, studies in mice have shown a sustained overexpression of Th (6 to 8-fold) in the ventral tegmental area (VTA), nucleus accumbens, prefrontal cortex and hypothalamus of adult mice that were exposed to LPD throughout prenatal development and postnatally until weaning [ 27 ]. Here we show that in offspring exposed to LPD only during gestation, there are much more modest changes in gene expression and the levels of most neuronal or dopamine-associated genes tested remained relatively unchanged. In light of prior studies, these data were unanticipated. It is possible that differences in the scale of gene expression changes herein, compared with those described previously [ 27 ], reflect differences in mouse husbandry, genetic background, or microbiomes, but perhaps more likely, reflect the different durations of dietary exposure. Susceptibility to dietary challenge changes during mouse ontogeny; since the timing of LPD exposure was different between these studies, longer exposure incorporating lactation (as in [ 27 ]) may serve to stabilize or even increase epigenetic changes in gene activity. In this regard, we have previously shown that female mice injected with chromatin modifying drugs such as 5’azacytidine or Trichostatin A mid-way through pregnancy displayed overt paternal Cdkn1c de-repression in embryos, but this was transient and not retained postnatally [ 28 ]. In contrast, dietary exposure to LPD or to a high fat diet (HFD) throughout pregnancy has been shown to provoke more long-lasting epigenetic changes, exemplified by a sustained loss of Cdkn1c or Dlk1-Dio3 imprinting respectively, that persists long after dietary challenge is withdrawn [ 28 , 52 ]. Following in utero HFD exposure we have shown altered phenotypes among immediate offspring, as well as their progeny, illustrating a surprising durability of some exposure-induced epigenetic change [ 52 ]. It is conceivable that extended maternal exposure to LPD after birth and during lactation, a period of development in the mouse that correlates with the final trimester of human foetal development, serves to heighten or reinforce changes in gene expression initiated much earlier in development. Whatever the explanation, we have shown here that exposure to LPD solely in utero prompts elevated dopamine synthesis capacity judged by micro-PET imaging. These animals have increased numbers of TH-positive cells and display behaviours consistent with altered dopamine circuits in adolescent and adult animals. While it is difficult to unequivocally prove that LPD-induced loss of Cdkn1c imprinting drives these outcomes, several pieces of evidence now implicate a causal role for Cdkn1c /p57 KIP2 . Firstly, ourselves and others have shown that protein deprivation in pregnancy results in an erosion of DNA methylation across the sDMR in embryonic brain, with inappropriate re-expression of paternal Cdkn1c by cells already expressing maternally-derived Cdkn1c [ 27 , 28 ]. Supplementation of maternal LPD with folate as a source of methyl-donors, corrects methylation across the sDMR and substantially reduces Cdkn1c misexpression in the resulting offspring [ 28 ]. These results show some similarity to prior genetic experiments where relatively mild over-expression of Cdkn1c was shown to be sufficient to provoke increased numbers of TH-positive cells in the periventricular hypothalamus and VTA, and a range of behavioural abnormalities that included altered reward-related and social dominance behaviours [ 20 , 21 , 22 , 29 ]. Taken together, these studies support a fundamental role for Cdkn1c in the developing brain, where mild mis-expression has long-term consequences for the development and fine-tuning of neural stem and progenitor populations and the dopamine circuitry that ensues. At the level of individual cells, over-expression of Cdkn1c might not be considered advantageous, since p57 KIP2 negatively regulates cell proliferation. However, reports showing that low level Cdkn1c expression restrains apoptosis in the neocortex [ 25 ], and that interactions between Cdkn1c /p57 KIP2 and Nurr1 can promote postmitotic differentiation of dopamine neurons [ 53 , 54 ] and may influence oxidative stress and survival [ 55 , 56 , 57 ], suggest that LPD-induced paternal Cdkn1c expression may influence neuron number, both by cell cycle-dependent and cycle-independent mechanisms. Furthermore, the observation that in utero exposure to LPD induces an increased number of dopamine neurons in offspring, coupled with increased locomotor activity, reduced anxiety and a greater propensity to explore, is intriguing, particularly as this phenotype could offer distinct survival advantages for animals born into a nutritionally-deprived environment. In this setting prenatal epigenetic modifications that are environmentally induced, such as paternal Cdkn1c de-repression, would remain intrinsically reversible but could alter postnatal behaviour to enhance offspring survival, without requiring the genome to be changed or compromised. Altered TH-positive cell number, dopamine circuitry and changes in offspring behaviour are consistent features described herein and in other studies of protein restriction in pregnancy. Our data align with results showing that BAC- Cdkn1c transgenic mice are hypersensitive to amphetamine and display changes in behaviour that are routed in the mesolimbic dopaminergic system [ 20 ] and underscore the potential of maternal nutrition to transform the long-term physiology and neurobehavioral outcomes of offspring. These demonstrations also raise concerns about similar potential vulnerabilities during human pregnancy. Changes in dopamine levels and circuitry are linked to perturbations in reward processing, threat responses and hyperactivity, as well as increasing the risk of neuropsychiatric impairments [ 58 ]. Elevated dopamine synthesis capacity has, for example, been observed in the striata of people at risk of or who have schizophrenia [ 59 , 60 ] and in the prefrontal cortex of people with attention deficit hyperactivity disorder (ADHD) [ 61 ]. Preclinical models that allow epigenetic changes to be longitudinally tracked for the first time in living animals [ 28 , 52 ], such as the Cdkn1c-Fluc-lacZ reporter line described herein, enable the impacts of environmental challenges to be visualised, monitored and potentially mitigated, from in utero sensitivity through perinatal development, adolescence, adulthood and ultimately across generations. In conjunction with detailed epidemiologic data, these models can offer an appealing route to systematically uncover the mechanisms and aetiology that link prenatal adversity with later life outcomes, and test protective strategies for ameliorating the negative impacts of such exposures. Materials and Methods Animals All animal procedures were undertaken in accordance with the UK Animals (Scientific Procedures) Act 1986, were approved by the Imperial College AWERB committee, and were performed under a UK Home Office project license. Findings and experiments described in this paper were designed and reported following the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines. The Cdkn1c-Fluc-lacZ reporter mouse line was genetically engineered by Taconic Biosciences and mice were genotyped as described previously [ 28 ]. All mice were maintained on a 129S2/SvHsd background. Mice were housed groups of 4–6 in pathogen-free barrier facilities, and maintained under a controlled environment (12 h light/dark cycle, 21+/-2 ◦ C and 45–65% humidity) with food and water ad libitum . The cage environment was enriched with Aspen bedding, tissues for nesting, wooden chew blocks and tunnels. In the breeding cages the tunnels were replaced with cardboard mouse houses. For timed matings, 2–6-month-old males were set up with up to 3 females of a similar age with daily inspections for vaginal plug. Females were removed from the cage upon vaginal plug discovery, which was considered E0.5 for embryonic development. Diet Mice were given regular rat and mouse Nr.3 (RM3) breeding chow (801700, 22.45% protein, 2.99ppm folic acid, Special Diet Services) for general breeding purposes. For the in utero dietary exposure experiments, after discovery of a vaginal plug, females were randomly assigned either low protein diet (8.5% protein purified diet, 4.1 ppm folic acid, 5769, TestDiet) or a calorie-matched control diet (18.6% protein basal diet, 5755, TestDiet) and kept on that diet until birth, when animals were returned to a regular chow diet. Animal transfers Mice were transferred to designated imaging suites for bioluminescent imaging and PET scanning in transport boxes with tissue and food from the original cage to reduce stress and make the transfer more familiar. Transfers were performed at least 30 minutes before the start of the bioluminescent imaging experiments, and at least 2 hours before the start of the PET scans, to ensure the animals were habituated to the new environment. For behavioural experiments, mice were transferred to a different animal facility at least a week before the first behavioural test. Bioluminescent imaging Adult mice were injected (intraperitoneal (IP) injection) with D-luciferin (D-luc) (Perkin Elmer) at a dose of 0.15 mg/g and then anaesthetised with isoflurane. 10 minutes after D-luc injection mice were imaged on an IVIS Spectrum (Perkin Elmer) using 180 s exposure, Bin 8, and FOV C or D depending on the number of mice. Images were acquired and analysed on the Living Image software (Perkin Elmer, version 4.7.3). For quantification of bioluminescent signal, identical surface area regions of interest (ROIs) were drawn around the subjects and total flux (p/s) was plotted. Pregnant dams were imaged 5 minutes after D-luc injection and then culled by cervical dislocation. Embryos were dissected and placed in multi-well plates for bioluminescent imaging. The embryos were imaged for 60 s, FOV A-C, Bin 4, focus 1 cm. No additional D-luc was used for embryonic imaging. Micro-PET imaging [ 18 F]FDOPA was produced by Invicro (London, UK) as previously described [ 62 ] in a subatomic particle accretor, the cyclotron. [ 18 F]FDOPA had to be over 95% pure to be used for in vivo applications. Male 8–12 week-old mice were allowed to habituate for at least 2 hours in the imaging facility before the scanning procedure. Mice were anaesthetised with 5% isoflurane, underwent external jugular vein cannulation and were maintained under terminal 1.5–2.5% isoflurane anaesthesia. Mice were injected IP with the COMT and AADC inhibitors entacapone (40 mg/kg) and benserazide hydrochloride (10 mg/kg) 45 minutes and 30 minutes respectively, prior to the [ 18 F]FDOPA scan to reduce peripheral radiotracer uptake and improve uptake in the brain [ 48 ]. In total, 12 male mice were scanned (6 for each diet). One LPD mouse was subsequently excluded because the scan data was not of sufficient quality to be analysed/quantified. Scans were acquired with a Siemens Inveon µCT/PET scanner. A 20-minute CT scan was performed prior to the injection of the radiotracer for attenuation correction. A dynamic PET scan was performed directly after intravenous administration of a minimum of 2 MBq [ 18 F]FDOPA in the external jugular vein. Emission data was acquired for 2 hours and split into 43 frames with increasing time duration. At the end of the scan, the subject was quickly removed from the CT/PET scanner and culled via cervical dislocation. Throughout the scanning period, the body temperature of the subject was monitored with a rectal thermometer and maintained at 37 ◦ C with the help of a heating lamp when necessary. The respiration rate of the animal was monitored using the BioVet software (BioVet software; m2m Imaging Corp, Cleveland, OH, USA), and the isoflurane percentage was adjusted between 1.5–2.5% to maintain a steady breathing rate. Radioactivity of [ 18 F]FDOPA was measured before dosing. Leftover radioactivity (post-dose) as well as radioactivity lost on gloves and used syringe (waste) was also measured and accounted for when calculating the injected dose. PET image analysis Images acquired from PET scan were analysed with the Inveon Research Workplace software. The CT and PET scan images were aligned and 3D ROIs were drawn manually around the right and left striata (0.07 cm 3 ), as well as the cerebellum (0.1 cm 3 ). The cerebellum was used as a reference region to account for non-specific uptake of [ 18 F]FDOPA, given the insignificant dopaminergic projections [ 48 ]. Time-activity curves were extracted from the PET data and modelled by Gjedde-Patlak analysis to derive multiple measures of dopamine synthesis capacity [ 48 , 63 ]. K i std represents the influx rate constant of the uptake and conversion of [ 18 F]FDOPA to [ 18 F]fluorodopamine in the striatum relative to the cerebellum, using the scan data acquired between 10 and 60 minutes [ 48 ]. The other measure of dopamine synthesis capacity, K i mod , was calculated through an extended Gjedde-Patlak analysis that uses the radioactivity profile from 20 minutes to 90 minutes after tracer administration adjusted for the catabolism of [ 18 F]fluorodopamine during the course of the scan [ 48 ]. This analysis also derived an estimate of the rate constant for the breakdown of [ 18 F]fluorodopamine to its metabolites, termed K loss , representing turnover of dopamine [ 48 , 64 ]. Data were analysed after all scans were completed. Behavioural testing All behavioural tests were carried out during daytime and were carried out in a dimly lit room, free from visual and auditory disruptions, to ensure similar conditions for each animal. Both females and males were used for behavioural testing. Animals were allowed to habituate for at least 10 minutes in the behaviour room prior to testing, and no more than 8 animals were kept in the room at one time. 9 week-old females were not exposed to cocaine; otherwise all animals underwent all behavioural tests unless they showed signs of sickness or were found dead (2 mice in total out of 104), in the same order (open field, rotarod, elevated O-maze, marble burying, Y-maze and cocaine sensitisation), with a 1–2 day break between experiments. Experimenters were blinded to group identity during data collection and early stages of analysis for all behaviour experiments. Open field testing Mice were habituated in the designated room for 10 minutes before the start of the experiment. They were then placed in the centre of individual open-field arenas (45 cm 3 ) filled with 1 cm of sawdust, and assessed for baseline locomotor activity in batches of 4. Activity was recorded for 60 minutes on the EthoVision XT tracking system (Noldus Information Technologies, Leesburg, VA, USA). Total distance travelled and speed of movement for each mouse were calculated in 5 minute bins as well as hour-long totals. Rotarod Mice were trained on a rotarod (47600, Ugo Basile, Italy) using a protocol of 3 trials per day with and inter-trial interval of 1-hour intervals for 3 consecutive days. The rotarod accelerated from 5 to 60 rpm over a period of 10 minutes. Latency to fall and rod speed at the moment of fall were recorded for each mouse. Average latency to fall per trial and per day were calculated. Y-maze Mice were tested in an opaque Y-shaped maze with 3 arms positioned at 120 ◦ from each other. Mice were individually placed at the end of an arm facing away from the centre of the maze, alternating between starting arms with each mouse to account for any bias. Arm exploration was observed for 5 minutes, and spontaneous alternation (ABC pattern), alternate arm entries (ABA pattern) and same arm entries (ABB pattern) were recorded. Speed of movement and total distance travelled were also recorded with the EthoVision XT video tracking system. Elevated O-maze A 5.5 cm wide ring-shaped runway with an outer diameter of 46 cm was placed 40 cm above the floor. Two opposing 90 ◦ sectors were protected by 16 cm high inner and outer white walls (closed sectors). The remaining two 90 ◦ sectors were without walls (open sectors). Animals were released at the edge of one of the closed arms facing inwards and observed for 5 min. The EthoVision XT video tracking system was used to record time each mouse spent on open and closed arms and number of entries in open and closed sectors. An entry was defined as an animal entering that specific sector with all 3 body parts (head, centre and base of tail). Marble burying Mice were put in an open field arena filled with 10 cm of sawdust, where 20 glass marbles had been previously overlaid in a 4x5 arrangement, and were tested for 20 minutes in batches of 4 and after removing the mice, the coverage of marbles was scored. The intensity of behaviour was scored by counting the buried marbles at the end of the task. Marbles were considered buried if they were more than 2/3 covered. The results were confirmed by a second observer; there were no disagreements. Cocaine challenge Cocaine sensitisation experiments were carried out over 5 successive days (starting at 10 am), treating 4 animals simultaneously. Each day, mice were weighed and then allowed to habituate for 20 minutes in the open field. After 20 minutes, they were each given IP injections of cocaine (Sigma-Aldrich, C5776) at 20 mg/kg or 15 mg/kg, in a solution of 4 mg/ml. Their horizontal locomotor activity was recorded in the open field for 60 minutes with EthoVision XT. Two LPD-exposed mice administered with 20 mg/kg cocaine exhibiting outlier locomotor behaviour were excluded from the analysis. EthoVision software was used to quantify (clockwise and counter clockwise) rotations, tracking the mouse centre-point movement and fine-tuning parameters to capture tight circling. Molecular analysis of gene expression Mouse tissues were dissected on ice [ 65 ], flash frozen in liquid nitrogen, and stored at -80 ◦ C. For RNA extraction, samples were transferred on dry ice, homogenised on the TissueLyserII (Qiagen, 85300), with the addition of a stainless-steel bead (5mm, Qiagen, 69989) and then were processed with the AllPrep DNA/RNA Mini Kit (Qiagen, 80204). DNase treatment (RNase-free DNase Kit, Qiagen, 79254) was incorporated in the RNA extraction process. To produce cDNA, 500 ng of RNA was used in a reverse transcription reaction. RNA, random primers, RNAse-free H 2 O and dNTPs were mixed and heated to 55 ◦ C for 5 minutes, and then the samples were cooled on ice. The buffer, DTT, RNaseOUT and SuperScript III (SuperScript™ III Reverse Transcriptase, Thermo Fisher, 18080085) were then added as a master mix, and the samples were transferred back to the thermocycler, incubated at 25 ◦ C for 5 minutes, at 50 ◦ C for 50 minutes and the reaction was inactivated at 70 ◦ C for 15 minutes. The cDNA was diluted 1:5 for quantification by qPCR, using 2 µl of cDNA per reaction and two technical replicates per sample. Relative expression of each candidate gene was calculated by normalising to endogenous mouse control genes that are ubiquitously expressed, such as β-actin , Tbp, 18S and Gapdh as indicated in the figure legends. The primers used are shown in Table 1 . Tissue fixation, sectioning and immunofluorescence Mice were culled via cervical dislocation, and the brain dissected quickly on ice and fixed in 4% paraformaldehyde at 4 ◦ C for 48–72 hours with gentle shaking. Tissue was washed in PBS, transferred to a 30% sucrose solution, incubated in an OCT:30% sucrose solution (1:1 ratio) for 1 hour in RT, before being frozen in OCT over dry ice and stored for later use at -80 ◦ C. After calibration in the Leica CM1800 cryostat (Leica Microsystems) chamber for 20 minutes, tissue was sectioned at -22 ◦ C to -18 ◦ C to generate 35 µm sections. For immunofluorescence, sections were gently transferred into 10% Normal Goat Serum blocking buffer for 1 hour in RT, incubated in 0.2% phosphate-buffered serum with 0.1% TritonX (PBSTx) with 2% NGS with TH antibody (Abcam ab76442, 1:1000) overnight at 4 ◦ C with shaking. The next day, sections were washed in PBS 3 times for 10 minutes, and then incubated for 1 hour 45 minutes in 0.2% PBSTx with 2% NGS and secondary antibody (Invitrogen A-11039, Alexa 488, goat anti-chicken, 1:1000). Sections were washed in PBS twice for 10 minutes, incubated with DAPI for 30 min and washed again in PBS twice for 10 minutes. The sections were then floated in a larger basin with PBS and mounted on negatively charged slides, sealed with Vectashield, and left overnight in the dark before being examined. Confocal microscopy and image analysis All images were acquired on a Leica SP8 microscope. Three slides were simultaneously imaged on a 3-slide holder to streamline the imaging process. Images of whole slides were initially acquired at 2.5x magnification at low resolution (256x256) to locate the sections. Images of each section were then acquired with a 5x objective at a higher resolution (1024x1024) to identify regions with TH signal. Lastly, tile scans of the substantia nigra (SN) and VTA were acquired with a 20x objective at medium resolution (512x512), acquiring Z-stacks at 2 µm intervals through the entire tissue section. Sections spanning the VTA and SN (approximately between Bregma − 3.34 and − 3.66, based on reference to the Allen Mouse Brain Atlas, http://mouse.brain-map.org/ ) were used for cell body counts, using the central 20 µm of the acquired Z-stack. TH + neurons were identified and counted in 3D using the Imaris software, with manual curation to correct for any mislabelled cells. At least two tissue sections were imaged and quantified per animal, and a minimum 3 animals were scored per condition. Both females and males were used for dopaminergic midbrain neuron counts. Representative images of the SN and VTA were processed in Fiji/Image J. Statistical analysis All statistical tests were executed in GraphPad Prism (version 10.0.2) with details provided in the figure legends. No statistical methods were used to predetermine sample sizes. The behaviour data for each diet group passed the D’Agostino-Pearson normality test. No interaction was observed between sex and diet when analysing data from each timepoint separately, and therefore males and females were combined for all behaviour tests. For PET scans, Cohen’s d effect size was calculated using an online calculator ( https://www.socscistatistics.com/effectsize/default3.aspx ). Declarations Author contributions The study was initially conceived by AGF, MAU and CP with input from MM, and was written by CP, AGF, AD and HJG. RJ and MVdP provided specialist advice on early life adversity and Cdkn1c , and helped in characterising the Cdkn1c-Fluc-lacZ mouse reporter line. Mouse behavioural experiments were conducted by CP and EEI with advice from DJW. Bioluminescent imaging was undertaken by CP, AS and AD and molecular analysis was performed by CP and HJG. PET imaging experiments were performed by CP, supervised by OH. Statistical analyses were performed by CP, EEI, AD and HJG. Acknowledgements We would like to thank Chad Whilding for assistance with immunofluorescence image analysis and Justyna Glegola for advice on mouse behavioural testing. We would like to thank David Bonsall, Sac-Pham Tang and the rest of the radiochemistry and biology teams at Invicro for assistance with F-DOPA imaging. This work was supported by funding from the Medical Research Council (MC_U120027516 (AGF and MM), MC_UP_1605/12 (AGF), MC_UP_1605/11 (MM) and MC-A654-5QB40 (DJW). For the purpose of open access, the author has applied a CC BY public copyright licence to any Author Accepted Manuscript version arising from this submission. Competing interests The authors declare no competing interests. Data Availability All data generated during this study are included in the article and its supplementary files or are available from the corresponding author on reasonable request. References Ishidate, T., Elewa, A., Kim, S., Mello, C.C., and Shirayama, M. Divide and differentiate: CDK/Cyclins and the art of development . Cell Cycle 13, 1384-91; 10.4161/cc.28656 (2014). Morgan, D.O. Cyclin-dependent kinases: engines, clocks, and microprocessors . Annu Rev Cell Dev Biol 13, 261-91; 10.1146/annurev.cellbio.13.1.261 (1997). Campbell, G.J., Hands, E.L., and Van de Pette, M. The Role of CDKs and CDKIs in Murine Development . Int. J. Mol. Sci. 21 ; 10.3390/ijms21155343 (2020). Sherr, C.J. and Roberts, J.M. CDK inhibitors: positive and negative regulators of G1-phase progression . Genes Dev 13, 1501-12; 10.1101/gad.13.12.1501 (1999). Malumbres, M. and Barbacid, M. Cell cycle, CDKs and cancer: a changing paradigm . Nat. Rev. Cancer 9, 153-66; 10.1038/nrc2602 (2009). Hindley, C. and Philpott, A. The cell cycle and pluripotency . Biochem. J. 451, 135-43; 10.1042/BJ20121627 (2013). Liu, L. , et al. G1 cyclins link proliferation, pluripotency and differentiation of embryonic stem cells . Nat. Cell Biol. 19, 177-188; 10.1038/ncb3474 (2017). Furutachi, S., Matsumoto, A., Nakayama, K.I., and Gotoh, Y. p57 controls adult neural stem cell quiescence and modulates the pace of lifelong neurogenesis . EMBO J. 32, 970-81; 10.1038/emboj.2013.50 (2013). Besson, A., Dowdy, S.F., and Roberts, J.M. CDK inhibitors: cell cycle regulators and beyond . Dev. Cell 14, 159-69; 10.1016/j.devcel.2008.01.013 (2008). Tury, A., Mairet-Coello, G., and DiCicco-Bloom, E. The multiple roles of the cyclin-dependent kinase inhibitory protein p57(KIP2) in cerebral cortical neurogenesis . Dev. Neurobiol. 72, 821-42; 10.1002/dneu.20999 (2012). Hatada, I. and Mukai, T. Genomic imprinting of p57KIP2, a cyclin-dependent kinase inhibitor, in mouse . Nat. Genet. 11, 204-6; 10.1038/ng1095-204 (1995). Westbury, J., Watkins, M., Ferguson-Smith, A.C., and Smith, J. Dynamic temporal and spatial regulation of the cdk inhibitor p57(kip2) during embryo morphogenesis . Mech. Dev. 109, 83-9; 10.1016/s0925-4773(01)00512-3 (2001). Matsuoka, S. , et al. p57KIP2, a structurally distinct member of the p21CIP1 Cdk inhibitor family, is a candidate tumor suppressor gene . Genes Dev 9, 650-62; 10.1101/gad.9.6.650 (1995). Lee, M.H., Reynisdottir, I., and Massague, J. Cloning of p57KIP2, a cyclin-dependent kinase inhibitor with unique domain structure and tissue distribution . Genes Dev 9, 639-49; 10.1101/gad.9.6.639 (1995). Andrews, S.C. , et al. Cdkn1c (p57Kip2) is the major regulator of embryonic growth within its imprinted domain on mouse distal chromosome 7 . BMC Dev. Biol. 7, 53; 10.1186/1471-213X-7-53 (2007). Zhang, P. , et al. Altered cell differentiation and proliferation in mice lacking p57KIP2 indicates a role in Beckwith-Wiedemann syndrome . Nature 387, 151-8; 10.1038/387151a0 (1997). Yan, Y., Frisen, J., Lee, M.H., Massague, J., and Barbacid, M. Ablation of the CDK inhibitor p57Kip2 results in increased apoptosis and delayed differentiation during mouse development . Genes Dev 11, 973-83; 10.1101/gad.11.8.973 (1997). Tunster, S.J., Van de Pette, M., and John, R.M. Fetal overgrowth in the Cdkn1c mouse model of Beckwith-Wiedemann syndrome . Dis. Model. Mech. 4, 814-21; 10.1242/dmm.007328 (2011). Mairet-Coello, G. , et al. p57(KIP2) regulates radial glia and intermediate precursor cell cycle dynamics and lower layer neurogenesis in developing cerebral cortex . Development 139, 475-87; 10.1242/dev.067314 (2012). McNamara, G.I. , et al. Dopaminergic and behavioural changes in a loss-of-imprinting model of Cdkn1c . Genes Brain Behav. 17, 149-157; 10.1111/gbb.12422 (2018). McNamara, G.I., John, R.M., and Isles, A.R. Territorial Behavior and Social Stability in the Mouse Require Correct Expression of Imprinted Cdkn1c . Front. Behav. Neurosci. 12, 28; 10.3389/fnbeh.2018.00028 (2018). McNamara, G.I., Davis, B.A., Dwyer, D.M., John, R.M., and Isles, A.R. Behavioural abnormalities in a novel mouse model for Silver Russell Syndrome . Hum. Mol. Genet. 25, 5407-5417; 10.1093/hmg/ddw357 (2016). Laukoter, S. , et al. Imprinted Cdkn1c genomic locus cell-autonomously promotes cell survival in cerebral cortex development . Nat Commun 11, 195; 10.1038/s41467-019-14077-2 (2020). Laukoter, S. , et al. Cell-Type Specificity of Genomic Imprinting in Cerebral Cortex . Neuron 107, 1160-1179 e9; 10.1016/j.neuron.2020.06.031 (2020). Imaizumi, Y. , et al. Role of the imprinted allele of the Cdkn1c gene in mouse neocortical development . Sci. Rep. 10, 1884; 10.1038/s41598-020-58629-9 (2020). Creff, J. and Besson, A. Functional Versatility of the CDK Inhibitor p57(Kip2) . Front Cell Dev Biol 8, 584590; 10.3389/fcell.2020.584590 (2020). Vucetic, Z. , et al. Early life protein restriction alters dopamine circuitry . Neuroscience 168, 359-70; 10.1016/j.neuroscience.2010.04.010 (2010). Van de Pette, M. , et al. Visualizing Changes in Cdkn1c Expression Links Early-Life Adversity to Imprint Mis-regulation in Adults . Cell Rep. 18, 1090-1099; 10.1016/j.celrep.2017.01.010 (2017). Isles, A.R., McNamara, G.I., and John, R.M. Genomic imprinting and neurobehavioral programming by adverse early life environments: evidence from studying Cdkn1c . Current Opinion in Behavioral Sciences 25, 31-35; 10.1016/j.cobeha.2018.06.008 (2019). Bhogal, B., Arnaudo, A., Dymkowski, A., Best, A., and Davis, T.L. Methylation at mouse Cdkn1c is acquired during postimplantation development and functions to maintain imprinted expression . Genomics 84, 961-70; 10.1016/j.ygeno.2004.08.004 (2004). Gould, J.M. , et al. Mouse maternal protein restriction during preimplantation alone permanently alters brain neuron proportion and adult short-term memory . Proc. Natl. Acad. Sci. U. S. A. 115, E7398-E7407; 10.1073/pnas.1721876115 (2018). Lanham, S.A. , et al. Periconception maternal low-protein diet adversely affects male mouse fetal bone growth and mineral density quality in late gestation . J. Dev. Orig. Health Dis. 12, 384-395; 10.1017/S204017442000046X (2021). Bale, T.L. , et al. Early life programming and neurodevelopmental disorders . Biol. Psychiatry 68, 314-9; 10.1016/j.biopsych.2010.05.028 (2010). Langie, S.A. , et al. Maternal folate depletion and high-fat feeding from weaning affects DNA methylation and DNA repair in brain of adult offspring . FASEB J. 27, 3323-34; 10.1096/fj.12-224121 (2013). Shiotsuki, H. , et al. A rotarod test for evaluation of motor skill learning . J. Neurosci. Methods 189, 180-5; 10.1016/j.jneumeth.2010.03.026 (2010). Deacon, R.M. Measuring motor coordination in mice . J Vis Exp e2609; 10.3791/2609 (2013). Dixit, P.V., Sahu, R., and Mishra, D.K. Marble-burying behavior test as a murine model of compulsive-like behavior . J Pharmacol Toxicol Methods 102, 106676; 10.1016/j.vascn.2020.106676 (2020). DiCarlo, G.E. , et al. Autism-linked dopamine transporter mutation alters striatal dopamine neurotransmission and dopamine-dependent behaviors . J. Clin. Invest. 129, 3407-3419; 10.1172/JCI127411 (2019). Beninger, R.J. The Role of Dopamine in Locomotor-Activity and Learning . Brain Res. Rev. 6, 173-196; 10.1016/0165-0173(83)90038-3 (1983). Wakeling, E.L. , et al. Diagnosis and management of Silver-Russell syndrome: first international consensus statement . Nat. Rev. Endocrinol. 13, 105-124; 10.1038/nrendo.2016.138 (2017). Tilley, M.R. and Gu, H.H. Dopamine transporter inhibition is required for cocaine-induced stereotypy . Neuroreport 19, 1137-40; 10.1097/WNR.0b013e3283063183 (2008). Tang, C. , et al. Dose- and rate-dependent effects of cocaine on striatal firing related to licking . J Pharmacol Exp Ther 324, 701-13; 10.1124/jpet.107.129734 (2008). Shultz, P.L., Galler, J.R., and Tonkiss, J. Prenatal protein restriction increases sensitization to cocaine-induced stereotypy . Behav. Pharmacol. 10, 379-87; 10.1097/00008877-199907000-00005 (1999). Garnett, S., Firnau, G., Nahmias, C., and Chirakal, R. Striatal dopamine metabolism in living monkeys examined by positron emission tomography . Brain Res. 280, 169-71; 10.1016/0006-8993(83)91187-3 (1983). Vingerhoets, F.J. , et al. Positron emission tomographic evidence for progression of human MPTP-induced dopaminergic lesions . Ann. Neurol. 36, 765-70; 10.1002/ana.410360513 (1994). Halff, E.F. , et al. Evaluation of Intraperitoneal [F-18]-FDOPA Administration for Micro-PET Imaging in Mice and Assessment of the Effect of Subchronic Ketamine Dosing on Dopamine Synthesis Capacity . Mol. Imaging 2022 ; 10.1155/2022/4419221 (2022). Kokkinou, M. , et al. Reproducing the dopamine pathophysiology of schizophrenia and approaches to ameliorate it: a translational imaging study with ketamine . Mol. Psychiatry 26, 2562-2576; 10.1038/s41380-020-0740-6 (2021). Kumakura, Y. and Cumming, P. PET Studies of Cerebral Levodopa Metabolism: A Review of Clinical Findings and Modeling Approaches . Neuroscientist 15, 635-650; 10.1177/1073858409338217 (2009). Marichich, E.S., Molina, V.A., and Orsingher, O.A. Persistent Changes in Central Catecholaminergic System after Recovery of Perinatally Undernourished Rats . J. Nutr. 109, 1045-1050; 10.1093/jn/109.6.1045 (1979). Chen, J.C., Turiak, G., Galler, J., and Volicer, L. Postnatal changes of brain monoamine levels in prenatally malnourished and control rats . Int. J. Dev. Neurosci. 15, 257-263; 10.1016/S0736-5748(96)00121-9 (1997). Palmer, A.A. , et al. Prenatal protein deprivation alters dopamine-mediated behaviors and dopaminergic and glutamatergic receptor binding . Brain Res. 1237, 62-74; 10.1016/j.brainres.2008.07.089 (2008). Van de Pette, M. , et al. Epigenetic changes induced by in utero dietary challenge result in phenotypic variability in successive generations of mice . Nat Commun 13, 2464; 10.1038/s41467-022-30022-2 (2022). Joseph, B. , et al. p57(Kip2) cooperates with Nurr1 in developing dopamine cells . Proc. Natl. Acad. Sci. U. S. A. 100, 15619-24; 10.1073/pnas.2635658100 (2003). Perlmann, T. and Wallen-Mackenzie, A. Nurr1, an orphan nuclear receptor with essential functions in developing dopamine cells . Cell Tissue Res 318, 45-52; 10.1007/s00441-004-0974-7 (2004). Kadkhodaei, B. , et al. Nurr1 is required for maintenance of maturing and adult midbrain dopamine neurons . J. Neurosci. 29, 15923-32; 10.1523/JNEUROSCI.3910-09.2009 (2009). Sousa, K.M. , et al. Microarray analyses support a role for Nurr1 in resistance to oxidative stress and neuronal differentiation in neural stem cells . Stem Cells 25, 511-9; 10.1634/stemcells.2006-0238 (2007). Al-Nusaif, M., Lin, Y.S., Li, T.B., Cheng, C., and Le, W.D. Advances in NURR1-Regulated Neuroinflammation Associated with Parkinson's Disease . Int. J. Mol. Sci. 23 ; 10.3390/ijms232416184 (2022). DeCapo, M., Thompson, J.R., Dunn, G., and Sullivan, E.L. Perinatal Nutrition and Programmed Risk for Neuropsychiatric Disorders: A Focus on Animal Models . Biol. Psychiatry 85, 122-134; 10.1016/j.biopsych.2018.08.006 (2019). Jauhar, S. , et al. A Test of the Transdiagnostic Dopamine Hypothesis of Psychosis Using Positron Emission Tomographic Imaging in Bipolar Affective Disorder and Schizophrenia . Jama Psychiatry 74, 1206-1213; 10.1001/jamapsychiatry.2017.2943 (2017). Rogdaki, M. , et al. Striatal dopaminergic alterations in individuals with copy number variants at the 22q11.2 genetic locus and their implications for psychosis risk: a [18F]-DOPA PET study (Jun, 2021, 10.1038/s41380-02101108-y) . Mol. Psychiatry ; 10.1038/s41380-021-01192-0 (2021). Ernst, M. , et al. Neural substrates of decision making in adults with attention deficit hyperactivity disorder . Am. J. Psychiatry 160, 1061-70; 10.1176/appi.ajp.160.6.1061 (2003). Fuchtner, F., Zessin, J., Mading, P., and Wust, F. Aspects of 6-[18F]fluoro-L-DOPA preparation. Deuterochloroform as a substitute solvent for Freon 11 . Nuklearmedizin 47, 62-4(2008). Patlak, C.S. and Blasberg, R.G. Graphical evaluation of blood-to-brain transfer constants from multiple-time uptake data. Generalizations . J. Cereb. Blood Flow Metab. 5, 584-90; 10.1038/jcbfm.1985.87 (1985). Walker, M.D. , et al. In-vivo measurement of LDOPA uptake, dopamine reserve and turnover in the rat brain using [18F]FDOPA PET . J. Cereb. Blood Flow Metab. 33, 59-66; 10.1038/jcbfm.2012.120 (2013). Spijker, S., Dissection of Rodent Brain Regions , in Neuroproteomics . 2011. p. 13-26. Momeni, S., Segerstrom, L., and Roman, E. Supplier-dependent differences in intermittent voluntary alcohol intake and response to naltrexone in Wistar rats . Front. Neurosci. 9 ; 10.3389/fnins.2015.00424 (2015). Table Table 1 Primers used in qRT-PCR analysis. Target Forward primer sequence Reverse primer sequence Tubb3 TAGACCCCAGCGGCAACTAT GTTCCAGGTTCCAAGTCCACC NeuN GTAGAGGGACGGAAAATTGAGG GTGGGGTAGGGGAAACTGG Th CCAAGGTTCATTGGACGGC CTCTCCTCGAATACCACAGCC Gfap CGGAGACGCATCACCTCTG AGGGAGTGGAGGAGTCATTCG Cnp TTTACCCGCAAAAGCCACACA CACCGTGTCCTCATCTTGAAG Itgam CCATGACCTTCCAAGAGAATGC ACCGGCTTGTGCTGTAGTC Cdkn1c AGAGAACTGCGCAGGAGAAC TCTGGCCGTTAGCCTCTAAA DDC (Aadc) TAGCTGACTATCTGGATGGCAT GTCCTCGTATGTTTCTGGCTC VMAT2 ATGCTGCTCACCGTCGTAG GGACAGTCGTGTTGGTCACAG SLC6A3 (DAT) AAATGCTCCGTGGGACCAATG GTCTCCCGCTCTTGAACCTC DRD1 ATGGCTCCTAACACTTCTACCA GGGTATTCCCTAAGAGAGTGGAC DRD2 ACCTGTCCTGGTACGATGATG GCATGGCATAGTAGTTGTAGTGG DRD3 CCTCTGAGCCAGATAAGCAGC AGACCGTTGCCAAAGATGATG DRD4 GCCTGGAGAACCGAGACTATG CGGCTGTGAAGTTTGGTGTG DRD5 CTCGGCAACGTCCTAGTGTG AATGCCACGAAGAGGTCTGAG MAOA GCCCAGTATCACAGGCCAC CGGGCTTCCAGAACCAAGA MAOB ATGAGCAACAAAAGCGATGTGA TCCTAATTGTGTAAGTCCTGCCT COMT CTGGGGGTTGGTGGCTATTG CCCACTCCTTCTCTGAGCAG NR4A2 (Nurr1) GTGTTCAGGCGCAGTATGG TGGCAGTAATTTCAGTGTTGGT DARPP-32 cccatcactgaaagctgtgc tcccgaagctcccctaactc β-actin CATCCGTAAAGACCTCTATGCCAAC ATGGAGCCACCGATCCACA 18S GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG Tbp GAAGAACAATCCAGACTAGCAGCA CCTTATAGGGAACTTCACATCACAG Gapdh AAGAGAGGCCCTATCCCAACTC TTGTGGGTGCAGCGAACTTTATTG All data generated during this study are included in the article and its supplementary files or are available from the corresponding author on reasonable request. Additional Declarations No competing interests reported. Supplementary Files CPSupplementaryInformation.pdf SupplementaryVideoS1CDD2Hab.mov SupplementaryVideoS2LPD2Hab.mov SupplementaryVideoS3CDD2Coc.mov SupplementaryVideoS4LPD2Coc.mov Cite Share Download PDF Status: Published Journal Publication published 12 Apr, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 06 Feb, 2024 Reviews received at journal 09 Jan, 2024 Reviewers agreed at journal 29 Dec, 2023 Reviews received at journal 20 Nov, 2023 Reviewers agreed at journal 12 Nov, 2023 Reviewers agreed at journal 09 Nov, 2023 Reviewers invited by journal 18 Oct, 2023 Editor assigned by journal 18 Oct, 2023 Editor invited by journal 18 Oct, 2023 Submission checks completed at journal 18 Oct, 2023 First submitted to journal 10 Oct, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3428617","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":240969801,"identity":"66ccc1b4-3799-40ff-87d0-3b6114df20ea","order_by":0,"name":"Chiara Prodani","email":"","orcid":"","institution":"MRC LMS, Imperial College London","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chiara","middleName":"","lastName":"Prodani","suffix":""},{"id":240969802,"identity":"39fb12d6-6754-4c92-8e7a-e1c95b80fef3","order_by":1,"name":"Elaine E. Irvine","email":"","orcid":"","institution":"MRC LMS, Imperial College London","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Elaine","middleName":"E.","lastName":"Irvine","suffix":""},{"id":240969803,"identity":"6e8baf0b-7552-4863-b826-18a682db984c","order_by":2,"name":"Alessandro Sardini","email":"","orcid":"","institution":"MRC LMS, Imperial College London","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alessandro","middleName":"","lastName":"Sardini","suffix":""},{"id":240969804,"identity":"4791243c-f306-4b5f-8edf-0351c9427e23","order_by":3,"name":"Hannah J. Gleneadie","email":"","orcid":"","institution":"MRC LMS, Imperial College London","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hannah","middleName":"J.","lastName":"Gleneadie","suffix":""},{"id":240969805,"identity":"7e97b9a4-4ae4-458f-a342-7a349895dcdb","order_by":4,"name":"Andrew Dimond","email":"","orcid":"","institution":"MRC LMS, Imperial College London","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Andrew","middleName":"","lastName":"Dimond","suffix":""},{"id":240969806,"identity":"f90a429f-226f-40d5-bee7-147f70b10191","order_by":5,"name":"Mathew Van de Pette","email":"","orcid":"","institution":"University of Cambridge","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mathew","middleName":"Van","lastName":"de Pette","suffix":""},{"id":240969807,"identity":"a1f665c1-1816-47d9-9e5c-89d6a770229d","order_by":6,"name":"Rosalind John","email":"","orcid":"","institution":"Cardiff University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rosalind","middleName":"","lastName":"John","suffix":""},{"id":240969808,"identity":"1520a5bf-feb0-43e3-98f6-309463dd7da5","order_by":7,"name":"Oliver Howes","email":"","orcid":"","institution":"MRC LMS, Imperial College London","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Oliver","middleName":"","lastName":"Howes","suffix":""},{"id":240969809,"identity":"52bae067-ac3f-4913-9aa1-f58b3bd90d46","order_by":8,"name":"Dominic J. Withers","email":"","orcid":"","institution":"MRC LMS, Imperial College London","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Dominic","middleName":"J.","lastName":"Withers","suffix":""},{"id":240969810,"identity":"5f4500b2-e894-4369-86e6-854fba49abb0","order_by":9,"name":"Mark A. Ungless","email":"","orcid":"","institution":"MRC LMS, Imperial College London","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mark","middleName":"A.","lastName":"Ungless","suffix":""},{"id":240969811,"identity":"ea044796-ae09-4166-bef4-aad191c230d3","order_by":10,"name":"Matthias Merkenschlager","email":"","orcid":"","institution":"MRC LMS, Imperial College London","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Matthias","middleName":"","lastName":"Merkenschlager","suffix":""},{"id":240969812,"identity":"eca2a9a8-fa74-457d-9d0c-705d3f84b6a6","order_by":11,"name":"Amanda G. Fisher","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABIElEQVRIiWNgGAWjYLACHgYGfjYQyVBxgAfMhQJmfFok28Aqz5CipQFEMrYdYCCohX/a4WcP3tQwSPDxnz34uHLeHRl+9rMHGD62McjzN/AYG2DRInE7zdxwzjEGCTaJvGTDs9ue8Uj25CUwzjjDYDjjAI9xAjZrbieYSfOwMdSxSfCYSTZuO8xjcIPHgJmngoFxAwOP8QEsOuRvp3+T5vkHtIX/jPnPxjkwLQYM9ri0GNzOMZPmbQNqYcgxY2xsQNiSCNKCzWGGt3PKJOf2SQD9kmMs2XAM5Jccg4MzzkgkzzjMVozN+3K307dJvPlmIyHff8bwY0PNHXt+9jOGDz622dj2tzdvlsDmfWjAoXIPgEVwR+QoGAWjYBSMAgIAAIdBV12rIkiUAAAAAElFTkSuQmCC","orcid":"","institution":"University of Oxford","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Amanda","middleName":"G.","lastName":"Fisher","suffix":""}],"badges":[],"createdAt":"2023-10-10 17:59:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3428617/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3428617/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-59083-7","type":"published","date":"2024-04-12T15:01:51+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":44941902,"identity":"29b96358-0139-496e-b8b1-c02ede099953","added_by":"auto","created_at":"2023-10-19 18:00:12","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":165508,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eIn utero\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e exposure to LPD results in paternal \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCdkn1c\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e re-expression during embryonic development and elevated numbers of dopaminergic neurons in adult midbrain.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u0026nbsp; \u003c/strong\u003eSchematic illustrating how \u003cem\u003eCdkn1c-Fluc-lacZ \u003c/em\u003epaternal knock-in (KI\u003csup\u003epat\u003c/sup\u003e) and wildtype (WT) offspring were generated, together with the gestational dietary regimes used and the timepoints of experimental sampling.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B)\u0026nbsp;\u0026nbsp; \u003c/strong\u003eWhole-body bioluminescent imaging of 11.5 dpc pregnant dams exposed to control diet (CD) or low protein diet (LPD) during pregnancy.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C)\u0026nbsp;\u0026nbsp; \u003c/strong\u003e\u003cem\u003eEx-vivo \u003c/em\u003ebioluminescence imaging of KI\u003csup\u003epat\u003c/sup\u003e and WT E11.5 embryos and placentas exposed to CD or LPD during gestation. Graph (right) shows quantification of total flux in KI\u003csup\u003epat\u003c/sup\u003e embryos. CD n=9, LPD n=9; error bars=SEM; two-tailed unpaired t-test (**p=0.0077).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D)\u0026nbsp; \u003c/strong\u003eBioluminescence imaging of 14.5 dpc pregnant dams exposed to CD or LPD through pregnancy.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E)\u0026nbsp;\u0026nbsp; \u003c/strong\u003e\u003cem\u003eEx-vivo \u003c/em\u003ebioluminescence imaging of KI\u003csup\u003epat\u003c/sup\u003e and WT E14.5 embryos and placentas exposed to CD or LPD during gestation. Graph (right) shows quantification of total flux in KI\u003csup\u003epat\u003c/sup\u003e embryos. CD n=10, LPD n=3; error bars=SEM; two-tailed unpaired t-test (***p=0.0002).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F)\u0026nbsp;\u0026nbsp;\u0026nbsp; \u003c/strong\u003eImmunofluorescence detection of tyrosine hydroxylase (TH) positive cells (green) in representative midbrain tissue sections of juvenile and adult mice (4-5 and 9-10 weeks of age, respectively) exposed to CD or LPD \u003cem\u003ein utero\u003c/em\u003e. Scale bars represent 100 µm. Right-hand graphs show the average number of TH positive cells in each condition. N=3 animals per condition and \u003cem\u003e≥\u003c/em\u003e2 tissue sections averaged per animal; error bars=SD; Two-way ANOVA (Diet p=0.0007, Age p=0.9524, Interaction p=0.7399) with Sidak’s multiple comparisons test (**padj=0.0079, *padj=0.0159; 2 comparisons only).\u003c/p\u003e","description":"","filename":"CPMainFiguresPage1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3428617/v1/a1f83e31fa7efce48653cf42.jpg"},{"id":44941901,"identity":"23ea2d6a-31e9-4d3d-95af-6118ebf30132","added_by":"auto","created_at":"2023-10-19 18:00:12","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1944841,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eIn utero\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eexposure to LPD results in both transient and sustained changes in offspring behaviour.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Time course trials of rotarod latency (time to fall) in juvenile (4-5 weeks old, open symbols) and adult (9-10 weeks old, filled symbols) CD- (blue) or LPD- (orange) exposed mice. Two-way repeated measures ANOVA revealed a significant difference between the 4 groups (p=0.0339). Sidak’s multiple comparisons test (main group effect) revealed a significant difference between LPD juveniles and adults (*padj=0.0165; 4 pre-selected comparisons). CD 4-5 weeks n=23, LPD 4-5 weeks n=24, CD 9-10 weeks n=27, LPD 9-10 weeks n=23; error bars=SEM.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B)\u003c/strong\u003e Analysis of\u003cstrong\u003e \u003c/strong\u003emarble burying in juvenile and adult CD- (blue) and LPD- (orange) exposed offspring, quantifying the number of marbles out of 20 which were \u0026gt;2/3 buried after 20 min. Two-way ANOVA (Age p=0.0003, Diet p=0.6396, Interaction p=0.1494) with Sidak’s multiple comparisons test (***padj=0.0009; 2 families of 2 comparisons). CD 4-5 weeks n=23, LPD 4-5 weeks n=24, CD 9-10 weeks n=27, LPD 9-10 weeks n=23; error bars=SEM.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C)\u003c/strong\u003e Open field assessment of juvenile and adult CD- and LPD-exposed offspring over 60 minutes, quantifying total distance moved (upper) and velocity (lower). Two-way ANOVAs: Distance (Age p=0.0405, Diet p=0.4028, Interaction p=0.0181), Velocity (Age p=0.3943, Diet p=0.7514, Interaction p=0.1711); Sidak’s multiple comparisons tests (*padj=0.0421, **padj=0.0045; 2 families of 2 comparisons per analysis). CD 4-5 weeks n=22, LPD 4-5 weeks n=24, CD 9-10 weeks n=27, LPD 9-10 weeks n=23; error bars=SEM.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D)\u003c/strong\u003e Y-maze performance of juvenile and adult CD- or LPD-exposed offspring, assessed as the percentage of spontaneous arm entries (ABC pattern, upper) and alternate arm entries (ABA pattern, lower). Two-way ANOVA analyses revealed no significant effects on %ABC entries (Diet p=0.9842; Age p=0.9404; Interaction p=0.9772) or %ABA entries (Diet p=0.8309, Age p=0.9866, Interaction p=0.9627). CD 4-5 weeks n=23, LPD 4-5 weeks n=24, CD 9-10 weeks n=27, LPD 9-10 weeks n=23; error bars = SEM. Schematics adapted from [66] (CC BY 4.0; \u003ca href=\"http://creativecommons.org/licenses/by/4.0/\"\u003ehttp://creativecommons.org/licenses/by/4.0/\u003c/a\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E)\u003c/strong\u003e Elevated O-maze testing of juvenile and adult CD- or LPD-exposed mice. Representative occupancy heatmaps (left) illustrate movement of 4 individual CD and LPD adults. Open area occupancy was quantified by time spent (middle) or number of entries (right). Diet had a significant impact on open area occupancy by both measures (Two-way ANOVAs: Time spent (Diet p=0.0423, Age p=0.0028, Interaction p=0.0235), Entries (Diet p=0.0271, Age p=0.0109, Interaction p=0.3957); Sidak’s multiple comparisons tests (*padj=0.0347, **padj=0.0044, ***padj=0.0006; 2 families of 2 comparisons per analysis). CD 4-5 weeks n=23, LPD 4-5 weeks n=24, CD 9-10 weeks n=27, LPD 9-10 weeks n=24; error bars=SEM.\u003c/p\u003e","description":"","filename":"CPMainFiguresPage2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3428617/v1/65ee1db5f007a30c540de8e5.jpg"},{"id":44941904,"identity":"cfde8fe6-0ed7-41e4-9f45-719d2c2d825f","added_by":"auto","created_at":"2023-10-19 18:00:12","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":734040,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIncreased cocaine sensitivity in offspring exposed to LPD \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein utero\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Diagram illustrating 5-day cocaine administration and observation regime.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B)\u003c/strong\u003e Representative occupancy heatmaps showing locomotor activity of 4 CD- and 4 LPD-exposed adult mice before and after cocaine injection on Day 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C)\u003c/strong\u003e Quantification of distance moved during a 5-day trial involving daily administration of 20 mg/kg cocaine, for CD- (blue) or LPD- (orange) gestationally exposed adult offspring. Two-way repeated measures ANOVA revealed a significant interaction between diet and cocaine over the 5-day regime (p=0.0010). Sidak’s multiple comparisons test confirmed no differences during habituation on any days (padj\u0026gt;0.05) but revealed significantly decreased activity in LPD mice post-cocaine on days 1 and 2 (**padj=0.0039, *padj=0.0165; 10 comparisons in total). CD n=14, LPD n=9; error bars=SEM.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D)\u003c/strong\u003e Quantification of distance moved during a 5-day trial involving daily administration of 15 mg/kg cocaine, for CD- or LPD-gestationally exposed adult offspring. Two-way repeated measures ANOVA revealed a significant interaction between diet and cocaine (p=0.0052), with Sidak’s multiple comparisons test revealing no differences during habituation on any days (padj\u0026gt;0.05), but significantly increased activity in LPD mice post-cocaine on days 2 (**padj=0. 0058), 3 (*padj=0. 0104) and 5 (*padj=0.0382). CD n=4, LPD n=4; error bars=SEM.\u003c/p\u003e","description":"","filename":"CPMainFiguresPage3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3428617/v1/bd8afd69a8751fb6d711f55c.jpg"},{"id":44942353,"identity":"f30367c5-2762-4c97-b5b3-7fda47d420f7","added_by":"auto","created_at":"2023-10-19 18:08:12","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1250776,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAltered striatal dopamine function in offspring exposed to LPD\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e in utero\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, measured by PET imaging.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u0026nbsp; \u003c/strong\u003eRepresentative PET images of axial, coronal and sagittal views of adult male CD- or LPD-exposed mouse brains showing regions of interest drawn around the striatum and cerebellum.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B)\u0026nbsp;\u0026nbsp; \u003c/strong\u003eTime activity curves of mean striatal (filled shapes) and cerebellar (open shapes) [\u003csup\u003e18\u003c/sup\u003eF]FDOPA radioactivity signal in CD-exposed (circles) or LPD-exposed male mice (triangles), sampled during a 2-hour PET scan. Radioactivity is presented as standardised uptake values (SUVs), corrected for mouse body weight, injected radiotracer dose and time of injection. CD n=6, LPD n=5; error bars=SEM.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C)\u0026nbsp;\u0026nbsp; \u003c/strong\u003eComparison of CD and LPD K\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e\u003csup\u003emod\u003c/sup\u003e values, a measure of striatal dopamine synthesis capacity which corrects for loss of radioactive metabolites from the striatum throughout the scan. Each data point represents an animal (CD n=6, LPD n=5, with 2 striatal values averaged per animal); error bars=SEM; two-tailed unpaired t-test (*p=0.0325); large effect size (Cohen’s d=1.495).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D)\u0026nbsp; \u003c/strong\u003eSummary of μPET Parameters. CD n=6, LPD n=5; two-tailed unpaired t-tests (*p\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"CPMainFiguresPage4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3428617/v1/55b84ef266933283ea245627.jpg"},{"id":44942354,"identity":"0a6c6cdf-1048-49b5-91b3-77a1280d0d2b","added_by":"auto","created_at":"2023-10-19 18:08:13","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":778113,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eComparison of gene expression in adult mouse brain of offspring exposed to CD or LPD during gestation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Quantitative RT-PCR analysis of \u003cem\u003eTubb3\u003c/em\u003e (immature neurons), \u003cem\u003eNeuN\u003c/em\u003e (mature neurons), \u003cem\u003eTh\u003c/em\u003e (dopaminergic neurons), \u003cem\u003eGfap\u003c/em\u003e (astrocytes), \u003cem\u003eCnp\u003c/em\u003e(oligodendrocytes), \u003cem\u003eItgam\u003c/em\u003e (microglia) and \u003cem\u003eCdkn1c\u003c/em\u003e transcript expression in dissected adult midbrain of mice that had been exposed to LPD (orange) or CD (blue) \u003cem\u003ein utero\u003c/em\u003e. Expression was normalised to \u003cem\u003eb-actin\u003c/em\u003e and is plotted relative to CD. Results combine animals previously subjected to behavioural challenge (CD n=6, LPD n=6, open symbols) and those not previously exposed (CD n=4, LPD n=3, filled symbols). Bars show geometric mean; error bars=geometric SD; unpaired t-tests were used to compare CD with LPD, no significant differences were detected (p\u0026gt;0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B,C)\u003c/strong\u003e Relative expression of genes encoding proteins that are particularly relevant to dopamine uptake and metabolism in adult mouse striatal (\u003cstrong\u003eB\u003c/strong\u003e) and midbrain samples (\u003cstrong\u003eC\u003c/strong\u003e) are shown. Expression is shown as average delta-CT relative to \u003cem\u003eb-actin.\u003c/em\u003eDecreased expression of \u003cem\u003eSLC6A3, \u003c/em\u003eencoding\u003cem\u003e \u003c/em\u003eDAT (*p=0.0298), and increased expression of \u003cem\u003eDRD5\u003c/em\u003e, encoding\u003cem\u003e \u003c/em\u003edopamine receptor D5 (**p=0.0050), was detected (two-tailed unpaired t-tests; n=6 for each diet group; error bars=SD).\u003c/p\u003e","description":"","filename":"CPMainFiguresPage5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3428617/v1/014e518245bfd3a0400bb2d0.jpg"},{"id":54712709,"identity":"e04c3654-7d2e-4c90-8730-7d9af8f990bf","added_by":"auto","created_at":"2024-04-15 15:12:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1166362,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3428617/v1/b2b82f63-7afb-4ee5-a08a-1595ae13dd75.pdf"},{"id":44941907,"identity":"d2c2acb5-ea7c-4391-a10a-27fbf3da5790","added_by":"auto","created_at":"2023-10-19 18:00:13","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2199063,"visible":true,"origin":"","legend":"","description":"","filename":"CPSupplementaryInformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3428617/v1/0b2ed4862dc8b3b7f632218d.pdf"},{"id":44941905,"identity":"cfd9a143-55cd-4d9a-bb86-5e17b4513072","added_by":"auto","created_at":"2023-10-19 18:00:13","extension":"mov","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":4759705,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryVideoS1CDD2Hab.mov","url":"https://assets-eu.researchsquare.com/files/rs-3428617/v1/3f1e0be9dd8207e6505c89a4.mov"},{"id":44941911,"identity":"e51a34e2-e598-48fe-bd2a-d05b8e81e579","added_by":"auto","created_at":"2023-10-19 18:00:13","extension":"mov","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":3835652,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryVideoS2LPD2Hab.mov","url":"https://assets-eu.researchsquare.com/files/rs-3428617/v1/c8609287b9466dda489eb0e1.mov"},{"id":44941910,"identity":"7aff1d49-efa4-499f-a1a4-a990e7be9ea4","added_by":"auto","created_at":"2023-10-19 18:00:13","extension":"mov","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":4566250,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryVideoS3CDD2Coc.mov","url":"https://assets-eu.researchsquare.com/files/rs-3428617/v1/7b2cb0216f8684a81ba0d11b.mov"},{"id":44941908,"identity":"a49f8c5b-95b9-4410-9edd-4ba8fa4a3b0c","added_by":"auto","created_at":"2023-10-19 18:00:13","extension":"mov","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":3002358,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryVideoS4LPD2Coc.mov","url":"https://assets-eu.researchsquare.com/files/rs-3428617/v1/9460258d926e12b7e954a4e8.mov"}],"financialInterests":"No competing interests reported.","formattedTitle":"Protein restriction during pregnancy alters Cdkn1c silencing, dopamine circuitry and behaviour in offspring without wholescale disruption of neuronal gene expression","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe transition from one cell-cycle-phase to another is regulated by activation and inhibition of heterodimeric cyclin/cyclin-dependent kinase (CDK) complexes [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. These complexes are themselves regulated by cyclin-dependent kinase inhibitors (CKI), partners that can prevent or limit CDK activity [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Achieving a balance between quiescence and cell cycle progression is an essential feature of organismal biology. It is important for preserving stem cell populations as well as the differentiation of committed precursors, and deregulated in many types of cancer [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe CiP/KiP family of CKIs, which includes p21, p27 and p57, are able to bind all CDK and cyclin subunits. They exert a major influence on cell cycle control and influence adult physiology, embryogenesis, and pathology, through diverse interactions that extend to factors that are not strictly cell cycle-associated [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Here we examine the impacts of dietary-induced p57\u003csup\u003eKIP2\u003c/sup\u003e overexpression \u003cem\u003ein utero\u003c/em\u003e, and in particular, the consequences this exposure has on the midbrain and behaviour of offspring. p57\u003csup\u003eKIP2\u003c/sup\u003e is encoded by \u003cem\u003eCdkn1c\u003c/em\u003e, a maternally-expressed imprinted gene that lies within the imprinting cluster 2 (IC2) of mouse chromosome 7 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In development, \u003cem\u003eCdkn1c\u003c/em\u003e is expressed transiently, being particularly abundant in neural and skeleto-muscular tissue of mid-gestation embryos [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] and marking cells that exit from proliferative cycles [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. \u003cem\u003eCdkn1c\u003c/em\u003e is heavily implicated in regulating foetal growth and placental development [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], is critical for tuning radial glial progenitor-mediated neuron output [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] and can exert profound effects on physiology and behaviour when upregulated as little as two-fold [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Among the myriad of experimental phenotypes that are reported to arise from tissue-specific \u003cem\u003eCdkn1c\u003c/em\u003e deletion, or modest increases in \u003cem\u003eCdkn1c\u003c/em\u003e expression, many are assumed to reflect the role of p57\u003csup\u003eKIP2\u003c/sup\u003e as a negative regulator of cell proliferation [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. However, recently some studies have challenged this view, implicating \u003cem\u003eCdkn1c\u003c/em\u003e in promoting cortical development [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] and showing that deletions in paternal alleles within the central nervous system can result in reduced neural stem and progenitor cell abundance, and a deficit in upper layer neurons of the cortex [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eExposure to diets that are low in protein during pregnancy is known to enhance \u003cem\u003eCdkn1c\u003c/em\u003e expression in embryos, eroding DNA methylation across important regulatory regions, such as the somatic differentially methylated region (sDMR) of the locus [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Although the exact timing of this sensitivity to dietary challenge remains uncertain, monoallelic \u003cem\u003eCdkn1c\u003c/em\u003e expression is evident in mouse embryos from E6.5 onwards [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], while pre-implantation exposure (E3.5) to low protein diet is reported to be sufficient to trigger a permanent reduction in neural stem cell numbers in the foetal brain [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], as well as reducing bone growth at later gestational stages [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Early life exposure to low protein diet has also been linked to altered behaviour [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], including changes in dopamine-dependent reward-processing and locomotor activity [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. To longitudinally monitor allelic \u003cem\u003eCdkn1c\u003c/em\u003e expression \u003cem\u003ein vivo\u003c/em\u003e, we previously developed a novel mouse reporter where imprinted gene expression can be visualised by bioluminescence imaging [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. This model, where \u003cem\u003eFluc\u003c/em\u003e and \u003cem\u003elacZ\u003c/em\u003e genes are non-disruptively targeted into the 3\u0026rsquo;UTR of the endogenous \u003cem\u003eCdkn1c\u003c/em\u003e locus, uses T2A sites to simultaneously generate p57\u003csup\u003eKIP2\u003c/sup\u003e (Cdkn1c), luciferase and β-galactosidase proteins from reporter-derived transcripts. With this reporter we previously showed that a low protein diet (LPD) fed to dams during pregnancy resulted in the loss of imprinting (LOI) of \u003cem\u003eCdkn1c\u003c/em\u003e in embryos, including in the midbrain, with sustained and inappropriate expression of paternal \u003cem\u003eCdkn1c\u003c/em\u003e into adulthood [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo better understand the consequences of this exposure-induced loss of \u003cem\u003eCdkn1c\u003c/em\u003e imprinting, here we assess the behaviours and phenotypes of offspring as they mature postnatally from juveniles to adults. Our results show that exposure to LPD \u003cem\u003ein utero\u003c/em\u003e generates offspring with increased numbers of tyrosine hydroxylase (TH)-positive neurons in the midbrain, altered dopamine circuitry and distinct behaviours. Despite this clear phenotype, LPD-exposed and non-exposed offspring showed broadly similar patterns of gene expression in the brain. These results reveal that \u003cem\u003ein utero\u003c/em\u003e exposures that elicit paternal \u003cem\u003eCdkn1c\u003c/em\u003e de-repression in the developing embryonic brain alter its longer-term function through an increase in the abundance of TH-positive neurons, rather than by a sustained corruption in the intrinsic programs of neuronal gene expression.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003ePaternal\u003c/b\u003e \u003cb\u003eCdkn1c\u003c/b\u003e \u003cb\u003eis expressed selectively in embryos exposed to LPD\u003c/b\u003e \u003cb\u003ein utero\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe used the \u003cem\u003eCdkn1c-Fluc-lacZ\u003c/em\u003e reporter mouse line to track paternal \u003cem\u003eCdkn1c\u003c/em\u003e expression \u003cem\u003ein vivo\u003c/em\u003e. This reporter line has been characterised in detail previously [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], and was used here to visualise paternal \u003cem\u003eCdkn1c\u003c/em\u003e de-repression in embryos exposed to LPD. Briefly, wildtype (WT) females were mated with heterozygote (\u003cem\u003eCdkn1c-Fluc-lacZ\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e) male reporter mice, to generate offspring that were either WT, or inherited \u003cem\u003eCdkn1c-Fluc-lacZ\u003c/em\u003e paternally (KI\u003csup\u003ePat\u003c/sup\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Pregnant dams were injected with the luciferase substrate D-luciferin, and whole-body imaging was used to detect and quantify bioluminescence signal (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Consistent with \u003cem\u003eCdkn1c\u003c/em\u003e being almost exclusively maternally-expressed [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], and correct paternal \u003cem\u003eCdkn1c-Fluc-lacZ\u003c/em\u003e silencing in developing embryos [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], bioluminescence signal was not detected in pregnant females carrying WT or KI\u003csup\u003ePat\u003c/sup\u003e E11.5 embryos fed a normal control diet (CD). Bioluminescent signal was, however, detected in pregnant dams fed a calorie matched LPD (compare representative images shown in left and right panels of Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Among embryos isolated from these mice, bioluminescence was exclusively detected in KI\u003csup\u003ePat\u003c/sup\u003e foetuses derived from mothers fed LPD during pregnancy (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, left), and quantification of signal among all KI\u003csup\u003ePat\u003c/sup\u003e individuals confirmed a significant increase in LPD-exposed embryos as compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, right). Similar results were seen at later stages of development (E14.5) in pregnant dams (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD) and isolated embryos (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Luciferase signal was prominent in the embryo head, consistent with previous results [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], and confirmed that protein restriction during gestation induces paternally-derived \u003cem\u003eCdkn1c\u003c/em\u003e misexpression and LOI in embryos.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eElevated numbers of midbrain TH-positive neurons in offspring exposed\u003c/b\u003e \u003cb\u003ein utero\u003c/b\u003e \u003cb\u003eto LPD\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDe-repression of paternal \u003cem\u003eCdkn1c-Fluc-lacZ\u003c/em\u003e initiated early in gestation can continue beyond birth and long after LPD exposure, whilst gestational sensitivity to LPD is ameliorated by supplementation of maternal LPD with folate, which effectively restores correct DNA methylation across the sDMR [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Independent studies by others have also shown that folate depletion in pregnancy impacts brain development in adults [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] and that \u003cem\u003eCdkn1c\u003c/em\u003e upregulation can alter the proliferation and differentiation of developing dopaminergic neurons within the midbrain [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. We therefore examined the brains and the behaviours of juvenile and adult offspring that had experienced gestational LPD exposure.\u003c/p\u003e \u003cp\u003eTyrosine Hydroxylase (TH) is the rate-limiting enzyme in dopamine synthesis, and the most commonly used marker of dopaminergic neurons. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF, a significant increase in the number of TH-positive neurons was detected in the midbrain of offspring at 4 and 9 weeks of age following \u003cem\u003ein utero\u003c/em\u003e LPD exposure, compared to matched CD exposed offspring. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF (left) shows representative anti-TH immunofluorescence labelling (green) of midbrain sections at low magnification (with higher magnification insets) to enumerate TH-positive neurons. Quantification of the number of TH-positive cell bodies, provided in the accompanying plots (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF, right), demonstrated that gestational exposure to LPD resulted in significant increases in the abundance of TH-neurons in the midbrain of reporter mice sampled at both 4 and 9 weeks of age (24% and 25% increases in TH-neurons, respectively).\u003c/p\u003e \u003cp\u003e \u003cb\u003eAltered behaviours in offspring previously exposed to LPD\u003c/b\u003e \u003cb\u003ein utero\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo gauge the behavioural impacts of \u003cem\u003ein utero\u003c/em\u003e LPD exposure and paternal \u003cem\u003eCdkn1c\u003c/em\u003e mis-expression, we subjected juvenile (4\u0026ndash;5 week old) and adult (9\u0026ndash;10 week old) offspring to an array of tasks designed to evaluate basic motor functions, as well as anxiety-related and cognitive functions. Motor coordination, motor skill learning and balance were assessed using an accelerating rotarod, a tool often used to dissect motor capabilities from cognitive function [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. LPD-exposed offspring underperformed in rotarod tests as compared to CD-exposed animals at 4\u0026ndash;5 weeks of age (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, dashed lines) but interestingly, showed a significant improvement by 9\u0026ndash;10 weeks of age (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, solid lines). This could be partially explained by LPD-exposed mice being slightly heavier than CD-exposed mice at 4 weeks of age, a difference which normalises as they mature (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA). While juvenile LPD and CD exposed animals showed similar marble burying capacity, a test that has often been used to assess dopaminergic and glutaminergic circuits [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] or infer autistic-like behaviours [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], a significant increase in this behaviour was evident in LPD-exposed offspring as they matured from 4\u0026ndash;5 to 9\u0026ndash;10 weeks of age (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Open field testing showed that although movement was indistinguishable between juvenile LPD- or CD-exposed mice (4\u0026ndash;5 weeks of age), increased locomotor activity was evident in the LPD group as they matured (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). In particular, an increase in distance moved (upper panel), rather than velocity (lower panel), was seen in LPD mice at 9\u0026ndash;10 weeks. To investigate whether this increased activity might reflect enhanced exploratory behaviour, reduced anxiety, or short-term memory-related deficits, mice were subjected to Y-maze (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD) and elevated O-maze (EOM) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE) testing. Y-maze assessment showed that the percentages of spontaneous alteration entries (ABC) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, upper panel) and same arm entries (ABA) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, lower panel) for animals over a 5-minute test period were similar between juvenile and adult CD and LPD-exposed offspring. In contrast, in EOM tests, adult LPD-exposed offspring exhibited increased exploration (illustrated by representative heatmaps in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, left). In particular, LPD-exposed adults spent significantly more time in the open areas than age-matched CD-exposed mice or LPD-exposed juveniles (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, middle), and made significantly more open area entries as they matured (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, right). Dietary-exposure also had a significant overall effect on the distance travelled and velocity (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB), although individual pairwise comparisons were not significant for these metrics (see figure legends for details). Taken together these data show that offspring arising from \u003cem\u003ein utero\u003c/em\u003e exposure to maternal LPD display specific behavioural phenotypes. Interestingly, underperformance in motor skill tests by juveniles, which could reflect a developmental delay in response to LPD, was fully restored as these mice matured. By 9\u0026ndash;10 weeks, LPD-exposed offspring showed increased locomotor capacity and behaviours that might indicate a reduced level of anxiety relative to controls.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eIncreased dopamine synthesis capacity and sensitivity to cocaine in LPD-exposed offspring\u003c/h2\u003e \u003cp\u003eDopaminergic cells in the midbrain are involved in movement regulation and pharmacological stimulation of the dopamine system results in increased extracellular dopamine concentration and hyperactivity in rodents [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Overexpression of \u003cem\u003eCdkn1c\u003c/em\u003e can alter dopamine circuitry in mice [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] and has been associated with hyperactivity in humans [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. To explore this, we examined the responses of CD- or LPD-exposed offspring to cocaine. Cocaine binds to the dopamine transporter (DAT) and thereby blocks the removal of extracellular dopamine at the synapse. Previous studies had indicated that cocaine elicits a heightened locomotor response in mice that had been exposed to protein restriction throughout gestation and lactation [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Adult male mice that had been exposed to LPD or CD \u003cem\u003ein utero\u003c/em\u003e were injected daily with cocaine for 5 consecutive days (as shown schematically in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). This regime of administration enables cocaine sensitisation to be determined by analysing the impact of repeat challenge, relative to initial responses to cocaine. During habituation, prior to cocaine exposure, both sets of adult mice showed broadly similar locomotor activity as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB (left) and Supplementary Videos S1 and S2, and quantified in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC. Following cocaine injection (20 mg/kg) CD-exposed animals showed enhanced locomotor activity, as judged by an increase in distance moved (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), while LPD animals (orange) did not. This is also evident in the heatmap comparisons shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB (right) and the accompanying Supplementary Videos S3 and S4. While this observation was unanticipated, a closer inspection of the movements of LPD mice after cocaine administration revealed a propensity for stereotypic tight circling behaviour (exemplified in Supplementary Video S4). Rotation of this sort was uncommon during habituation in either LPD or CD animals, but increased in both groups upon exposure to cocaine (Supplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA), and was higher in LPD-exposed mice compared to controls. Importantly, although LPD animals showed reduced movement immediately following administration of 20 mg/cocaine (Supplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eB), LPD mice were more responsive than their CD counterparts to a lower dose (15 mg/kg, Supplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eC) and showed significantly higher movement across a 5-day treatment regime (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Taken together, these observations prompted us to revise our initial interpretation; rather than being less sensitive, LPD animals appear hypersensitive to cocaine administration. The tight-circling behaviour that is associated with gestationally LPD-exposed offspring has been described by others using higher amphetamine and cocaine doses (40 mg/kg) than administered here [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], and stereotypical behaviours have been associated with the offspring of dams exposed to LPD for 5 weeks prior to mating and through pregnancy [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo ask whether this increased sensitivity reflects elevated dopamine synthesis capacity in LPD-exposed animals, we used micro-positron emission tomography (PET) imaging with the radiolabelled tracer [\u003csup\u003e18\u003c/sup\u003eF]FDOPA to examine twelve adult mice, six for each gestational exposure. [\u003csup\u003e18\u003c/sup\u003eF]FDOPA PET imaging has been widely used to interrogate dopamine synthesis capacity in a variety of neurological and neuropsychiatric disorders, and is a validated approach to assess nigrostriatal dopamine circuit integrity [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], including in mice [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Briefly, PET and CT scans were aligned and 3-dimensional regions of interest drawn manually around the left and right striata, midbrain and cerebellum (which served as a control for non-specific uptake) (illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Time activity curves were extracted from the data (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB) and modelled by Gjedde-Patlak analysis [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] to derive multiple measures of dopaminergic activity, including the rate constant, K\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e\u003csup\u003emod\u003c/sup\u003e, for the striatal uptake of [\u003csup\u003e18\u003c/sup\u003eF]FDOPA and its conversion to [\u003csup\u003e18\u003c/sup\u003eF]fluorodopamine corrected for dopamine turnover during the scan (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and Supplementary Figs. S3A and S3B, summarised in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). LPD-exposed mice showed a significant increase in K\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e\u003csup\u003emod\u003c/sup\u003e relative to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC), and K\u003csub\u003e\u003cem\u003eloss\u003c/em\u003e\u003c/sub\u003e (an index of dopamine turnover) was also significantly increased in these animals. K\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e\u003csup\u003estd\u003c/sup\u003e values, which estimate dopamine synthesis capacity but do not correct for loss of radioactive metabolites over the two-hour period of data collection, were not significantly different between the groups, likely because of the higher K\u003csub\u003e\u003cem\u003eloss\u003c/em\u003e\u003c/sub\u003e in LPD-exposed mice. Together these data confirm that gestationally LPD-exposed mice show increased striatal dopamine synthesis capacity and dopamine turnover, indexed by [\u003csup\u003e18\u003c/sup\u003eF]FDOPA imaging, relative to animals gestationally exposed to control diet.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eComparing gene expression in the brains of adult mice following\u003c/b\u003e \u003cb\u003ein utero\u003c/b\u003e \u003cb\u003eLPD or CD exposure\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo better understand the biological basis of increased dopamine synthesis capacity in LPD animals, we examined the expression of a panel of genes that characterise different cell types within the adult brain using quantitative RT-PCR. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, expression of \u003cem\u003eTubb3\u003c/em\u003e and \u003cem\u003eNeuN\u003c/em\u003e (which distinguish immature and mature neurons) was similar in the midbrain of LPD and CD-derived samples. Similarly, we saw no significant differences in expression of \u003cem\u003eGfap, Cnp\u003c/em\u003e and \u003cem\u003eItgam\u003c/em\u003e, markers of astrocytes, oligodendrocytes and microglia, respectively. Perhaps surprisingly, we did not see a significant increase in \u003cem\u003eTh\u003c/em\u003e or \u003cem\u003eCdkn1c\u003c/em\u003e expression in LPD- as compared to CD-exposed midbrain samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Furthermore, expression levels of these genes in LPD- and CD-exposed samples derived from other regions of the brain (cortex, cerebellum and striatum) were similar (Supplementary Figs. S4A-S4C), and were broadly equivalent in animals subjected to behavioural tests (depicted as open symbols) or na\u0026iuml;ve to testing (closed symbols, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Previous studies in which maternal LPD exposure extends throughout breeding, pregnancy and lactation have reported a\u0026thinsp;\u0026gt;\u0026thinsp;6-fold elevation in \u003cem\u003eTh\u003c/em\u003e expression in all regions of the brain examined, as well as upregulation of \u003cem\u003eDAT\u003c/em\u003e (\u003cem\u003eSLC6A3\u003c/em\u003e) and \u003cem\u003eDARPP-32\u003c/em\u003e [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Here we show that exposure to LPD solely during gestation was, in contrast, insufficient to cause such sustained increases in \u003cem\u003eTh\u003c/em\u003e expression, despite inducing increases in the number of TH-positive midbrain neurons. To investigate this further we analysed the expression of a panel of genes implicated in dopamine synthesis and metabolism, such as \u003cem\u003eDDC\u003c/em\u003e (\u003cem\u003eAadc\u003c/em\u003e), \u003cem\u003eSLC6A3\u003c/em\u003e (\u003cem\u003eDAT\u003c/em\u003e), dopamine receptors \u003cem\u003eDRD1, DRD2, DRD3, DR4 and DRD5\u003c/em\u003e, or genes implicated in interactions with \u003cem\u003eCdkn1c\u003c/em\u003e/p57\u003csup\u003eKIP2\u003c/sup\u003e, such as \u003cem\u003eNR4A2\u003c/em\u003e (\u003cem\u003eNurr1\u003c/em\u003e), in both striatum and midbrain (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). We observed a very modest increase in \u003cem\u003eDRD5\u003c/em\u003e expression in LPD-derived midbrain, together with a slightly reduced expression of \u003cem\u003eSLC6A3\u003c/em\u003e (\u003cem\u003eDAT\u003c/em\u003e). Overall, wholesale changes in the expression of most neuronal- or dopamine-associated genes were not detected. By normalising gene expression to different housekeeping controls (for example \u003cem\u003e18S\u003c/em\u003e, \u003cem\u003eTbp\u003c/em\u003e and \u003cem\u003eGapdh\u003c/em\u003e, rather than \u003cem\u003eβ-actin\u003c/em\u003e), small differences in gene expression between LPD and CD samples were in some cases statistically significant (as shown for \u003cem\u003eCdkn1c\u003c/em\u003e in Supplementary Fig. \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003eD left; \u003cem\u003eDARPP-32\u003c/em\u003e expression was unaffected by this, as shown in Supplementary Fig. \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003eD right). In addition, we noted that \u003cem\u003eSLC6A3\u003c/em\u003e (\u003cem\u003eDAT\u003c/em\u003e) and DRD5 expression were not significantly altered by dietary exposure in a separate cohort of animals (Supplementary Fig. \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003eE). In conclusion, the scale of gene expression changes detected herein appear vanishingly low in comparison with those previously reported, where offspring were exposed to maternal LPD for much longer periods of time, notably throughout gestation, early prenatal life and lactation [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eNumerous studies in the last few decades have examined the impact of early life adversity on offspring health and the possible mechanisms that underlie an increased susceptibility to neuropsychiatric and metabolic disorders. In rat models, protein restriction during pregnancy has been shown to result in elevated levels of dopamine in the brain of offspring [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], increased TH activity [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e] and altered dopamine receptor binding [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Similarly, studies in mice have shown a sustained overexpression of \u003cem\u003eTh\u003c/em\u003e (6 to 8-fold) in the ventral tegmental area (VTA), nucleus accumbens, prefrontal cortex and hypothalamus of adult mice that were exposed to LPD throughout prenatal development and postnatally until weaning [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Here we show that in offspring exposed to LPD only during gestation, there are much more modest changes in gene expression and the levels of most neuronal or dopamine-associated genes tested remained relatively unchanged. In light of prior studies, these data were unanticipated. It is possible that differences in the scale of gene expression changes herein, compared with those described previously [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], reflect differences in mouse husbandry, genetic background, or microbiomes, but perhaps more likely, reflect the different durations of dietary exposure. Susceptibility to dietary challenge changes during mouse ontogeny; since the timing of LPD exposure was different between these studies, longer exposure incorporating lactation (as in [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]) may serve to stabilize or even increase epigenetic changes in gene activity. In this regard, we have previously shown that female mice injected with chromatin modifying drugs such as 5\u0026rsquo;azacytidine or Trichostatin A mid-way through pregnancy displayed overt paternal \u003cem\u003eCdkn1c\u003c/em\u003e de-repression in embryos, but this was transient and not retained postnatally [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In contrast, dietary exposure to LPD or to a high fat diet (HFD) throughout pregnancy has been shown to provoke more long-lasting epigenetic changes, exemplified by a sustained loss of \u003cem\u003eCdkn1c\u003c/em\u003e or \u003cem\u003eDlk1-Dio3\u003c/em\u003e imprinting respectively, that persists long after dietary challenge is withdrawn [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Following \u003cem\u003ein utero\u003c/em\u003e HFD exposure we have shown altered phenotypes among immediate offspring, as well as their progeny, illustrating a surprising durability of some exposure-induced epigenetic change [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. It is conceivable that extended maternal exposure to LPD after birth and during lactation, a period of development in the mouse that correlates with the final trimester of human foetal development, serves to heighten or reinforce changes in gene expression initiated much earlier in development.\u003c/p\u003e \u003cp\u003eWhatever the explanation, we have shown here that exposure to LPD solely \u003cem\u003ein utero\u003c/em\u003e prompts elevated dopamine synthesis capacity judged by micro-PET imaging. These animals have increased numbers of TH-positive cells and display behaviours consistent with altered dopamine circuits in adolescent and adult animals. While it is difficult to unequivocally prove that LPD-induced loss of \u003cem\u003eCdkn1c\u003c/em\u003e imprinting drives these outcomes, several pieces of evidence now implicate a causal role for \u003cem\u003eCdkn1c\u003c/em\u003e/p57\u003csup\u003eKIP2\u003c/sup\u003e. Firstly, ourselves and others have shown that protein deprivation in pregnancy results in an erosion of DNA methylation across the sDMR in embryonic brain, with inappropriate re-expression of paternal \u003cem\u003eCdkn1c\u003c/em\u003e by cells already expressing maternally-derived \u003cem\u003eCdkn1c\u003c/em\u003e [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Supplementation of maternal LPD with folate as a source of methyl-donors, corrects methylation across the sDMR and substantially reduces \u003cem\u003eCdkn1c\u003c/em\u003e misexpression in the resulting offspring [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. These results show some similarity to prior genetic experiments where relatively mild over-expression of \u003cem\u003eCdkn1c\u003c/em\u003e was shown to be sufficient to provoke increased numbers of TH-positive cells in the periventricular hypothalamus and VTA, and a range of behavioural abnormalities that included altered reward-related and social dominance behaviours [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Taken together, these studies support a fundamental role for \u003cem\u003eCdkn1c\u003c/em\u003e in the developing brain, where mild mis-expression has long-term consequences for the development and fine-tuning of neural stem and progenitor populations and the dopamine circuitry that ensues. At the level of individual cells, over-expression of \u003cem\u003eCdkn1c\u003c/em\u003e might not be considered advantageous, since p57\u003csup\u003eKIP2\u003c/sup\u003e negatively regulates cell proliferation. However, reports showing that low level \u003cem\u003eCdkn1c\u003c/em\u003e expression restrains apoptosis in the neocortex [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], and that interactions between \u003cem\u003eCdkn1c\u003c/em\u003e/p57\u003csup\u003eKIP2\u003c/sup\u003e and Nurr1 can promote postmitotic differentiation of dopamine neurons [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e] and may influence oxidative stress and survival [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e], suggest that LPD-induced paternal \u003cem\u003eCdkn1c\u003c/em\u003e expression may influence neuron number, both by cell cycle-dependent and cycle-independent mechanisms. Furthermore, the observation that \u003cem\u003ein utero\u003c/em\u003e exposure to LPD induces an increased number of dopamine neurons in offspring, coupled with increased locomotor activity, reduced anxiety and a greater propensity to explore, is intriguing, particularly as this phenotype could offer distinct survival advantages for animals born into a nutritionally-deprived environment. In this setting prenatal epigenetic modifications that are environmentally induced, such as paternal \u003cem\u003eCdkn1c\u003c/em\u003e de-repression, would remain intrinsically reversible but could alter postnatal behaviour to enhance offspring survival, without requiring the genome to be changed or compromised.\u003c/p\u003e \u003cp\u003eAltered TH-positive cell number, dopamine circuitry and changes in offspring behaviour are consistent features described herein and in other studies of protein restriction in pregnancy. Our data align with results showing that BAC-\u003cem\u003eCdkn1c\u003c/em\u003e transgenic mice are hypersensitive to amphetamine and display changes in behaviour that are routed in the mesolimbic dopaminergic system [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] and underscore the potential of maternal nutrition to transform the long-term physiology and neurobehavioral outcomes of offspring. These demonstrations also raise concerns about similar potential vulnerabilities during human pregnancy. Changes in dopamine levels and circuitry are linked to perturbations in reward processing, threat responses and hyperactivity, as well as increasing the risk of neuropsychiatric impairments [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Elevated dopamine synthesis capacity has, for example, been observed in the striata of people at risk of or who have schizophrenia [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e] and in the prefrontal cortex of people with attention deficit hyperactivity disorder (ADHD) [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. Preclinical models that allow epigenetic changes to be longitudinally tracked for the first time in living animals [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e], such as the \u003cem\u003eCdkn1c-Fluc-lacZ\u003c/em\u003e reporter line described herein, enable the impacts of environmental challenges to be visualised, monitored and potentially mitigated, from \u003cem\u003ein utero\u003c/em\u003e sensitivity through perinatal development, adolescence, adulthood and ultimately across generations. In conjunction with detailed epidemiologic data, these models can offer an appealing route to systematically uncover the mechanisms and aetiology that link prenatal adversity with later life outcomes, and test protective strategies for ameliorating the negative impacts of such exposures.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003e All animal procedures were undertaken in accordance with the UK Animals (Scientific Procedures) Act 1986, were approved by the Imperial College AWERB committee, and were performed under a UK Home Office project license. Findings and experiments described in this paper were designed and reported following the Animal Research: Reporting of \u003cem\u003eIn Vivo\u003c/em\u003e Experiments (ARRIVE) guidelines.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eCdkn1c-Fluc-lacZ\u003c/em\u003e reporter mouse line was genetically engineered by Taconic Biosciences and mice were genotyped as described previously [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. All mice were maintained on a 129S2/SvHsd background. Mice were housed groups of 4–6 in pathogen-free barrier facilities, and maintained under a controlled environment (12 h light/dark cycle, 21+/-2\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003eC and 45–65% humidity) with food and water \u003cem\u003ead libitum\u003c/em\u003e. The cage environment was enriched with Aspen bedding, tissues for nesting, wooden chew blocks and tunnels. In the breeding cages the tunnels were replaced with cardboard mouse houses. For timed matings, 2–6-month-old males were set up with up to 3 females of a similar age with daily inspections for vaginal plug. Females were removed from the cage upon vaginal plug discovery, which was considered E0.5 for embryonic development.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eDiet\u003c/h2\u003e \u003cp\u003eMice were given regular rat and mouse Nr.3 (RM3) breeding chow (801700, 22.45% protein, 2.99ppm folic acid, Special Diet Services) for general breeding purposes. For the \u003cem\u003ein utero\u003c/em\u003e dietary exposure experiments, after discovery of a vaginal plug, females were randomly assigned either low protein diet (8.5% protein purified diet, 4.1 ppm folic acid, 5769, TestDiet) or a calorie-matched control diet (18.6% protein basal diet, 5755, TestDiet) and kept on that diet until birth, when animals were returned to a regular chow diet.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAnimal transfers\u003c/h2\u003e \u003cp\u003eMice were transferred to designated imaging suites for bioluminescent imaging and PET scanning in transport boxes with tissue and food from the original cage to reduce stress and make the transfer more familiar. Transfers were performed at least 30 minutes before the start of the bioluminescent imaging experiments, and at least 2 hours before the start of the PET scans, to ensure the animals were habituated to the new environment. For behavioural experiments, mice were transferred to a different animal facility at least a week before the first behavioural test.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eBioluminescent imaging\u003c/h2\u003e \u003cp\u003eAdult mice were injected (intraperitoneal (IP) injection) with D-luciferin (D-luc) (Perkin Elmer) at a dose of 0.15 mg/g and then anaesthetised with isoflurane. 10 minutes after D-luc injection mice were imaged on an IVIS Spectrum (Perkin Elmer) using 180 s exposure, Bin 8, and FOV C or D depending on the number of mice. Images were acquired and analysed on the Living Image software (Perkin Elmer, version 4.7.3). For quantification of bioluminescent signal, identical surface area regions of interest (ROIs) were drawn around the subjects and total flux (p/s) was plotted. Pregnant dams were imaged 5 minutes after D-luc injection and then culled by cervical dislocation. Embryos were dissected and placed in multi-well plates for bioluminescent imaging. The embryos were imaged for 60 s, FOV A-C, Bin 4, focus 1 cm. No additional D-luc was used for embryonic imaging.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eMicro-PET imaging\u003c/h2\u003e \u003cp\u003e[\u003csup\u003e18\u003c/sup\u003eF]FDOPA was produced by Invicro (London, UK) as previously described [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e] in a subatomic particle accretor, the cyclotron. [\u003csup\u003e18\u003c/sup\u003eF]FDOPA had to be over 95% pure to be used for \u003cem\u003ein vivo\u003c/em\u003e applications. Male 8–12 week-old mice were allowed to habituate for at least 2 hours in the imaging facility before the scanning procedure. Mice were anaesthetised with 5% isoflurane, underwent external jugular vein cannulation and were maintained under terminal 1.5–2.5% isoflurane anaesthesia. Mice were injected IP with the COMT and AADC inhibitors entacapone (40 mg/kg) and benserazide hydrochloride (10 mg/kg) 45 minutes and 30 minutes respectively, prior to the [\u003csup\u003e18\u003c/sup\u003eF]FDOPA scan to reduce peripheral radiotracer uptake and improve uptake in the brain [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. In total, 12 male mice were scanned (6 for each diet). One LPD mouse was subsequently excluded because the scan data was not of sufficient quality to be analysed/quantified.\u003c/p\u003e \u003cp\u003eScans were acquired with a Siemens Inveon µCT/PET scanner. A 20-minute CT scan was performed prior to the injection of the radiotracer for attenuation correction. A dynamic PET scan was performed directly after intravenous administration of a minimum of 2 MBq [\u003csup\u003e18\u003c/sup\u003eF]FDOPA in the external jugular vein. Emission data was acquired for 2 hours and split into 43 frames with increasing time duration. At the end of the scan, the subject was quickly removed from the CT/PET scanner and culled via cervical dislocation. Throughout the scanning period, the body temperature of the subject was monitored with a rectal thermometer and maintained at 37\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003eC with the help of a heating lamp when necessary. The respiration rate of the animal was monitored using the BioVet software (BioVet software; m2m Imaging Corp, Cleveland, OH, USA), and the isoflurane percentage was adjusted between 1.5–2.5% to maintain a steady breathing rate. Radioactivity of [\u003csup\u003e18\u003c/sup\u003eF]FDOPA was measured before dosing. Leftover radioactivity (post-dose) as well as radioactivity lost on gloves and used syringe (waste) was also measured and accounted for when calculating the injected dose.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePET image analysis\u003c/h2\u003e \u003cp\u003eImages acquired from PET scan were analysed with the Inveon Research Workplace software. The CT and PET scan images were aligned and 3D ROIs were drawn manually around the right and left striata (0.07 cm\u003csup\u003e3\u003c/sup\u003e), as well as the cerebellum (0.1 cm\u003csup\u003e3\u003c/sup\u003e). The cerebellum was used as a reference region to account for non-specific uptake of [\u003csup\u003e18\u003c/sup\u003eF]FDOPA, given the insignificant dopaminergic projections [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Time-activity curves were extracted from the PET data and modelled by Gjedde-Patlak analysis to derive multiple measures of dopamine synthesis capacity [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. K\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e\u003csup\u003estd\u003c/sup\u003e represents the influx rate constant of the uptake and conversion of [\u003csup\u003e18\u003c/sup\u003eF]FDOPA to [\u003csup\u003e18\u003c/sup\u003eF]fluorodopamine in the striatum relative to the cerebellum, using the scan data acquired between 10 and 60 minutes [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. The other measure of dopamine synthesis capacity, K\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e\u003csup\u003emod\u003c/sup\u003e, was calculated through an extended Gjedde-Patlak analysis that uses the radioactivity profile from 20 minutes to 90 minutes after tracer administration adjusted for the catabolism of [\u003csup\u003e18\u003c/sup\u003eF]fluorodopamine during the course of the scan [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. This analysis also derived an estimate of the rate constant for the breakdown of [\u003csup\u003e18\u003c/sup\u003eF]fluorodopamine to its metabolites, termed K\u003cem\u003eloss\u003c/em\u003e, representing turnover of dopamine [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. Data were analysed after all scans were completed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eBehavioural testing\u003c/h2\u003e \u003cp\u003eAll behavioural tests were carried out during daytime and were carried out in a dimly lit room, free from visual and auditory disruptions, to ensure similar conditions for each animal. Both females and males were used for behavioural testing. Animals were allowed to habituate for at least 10 minutes in the behaviour room prior to testing, and no more than 8 animals were kept in the room at one time. 9 week-old females were not exposed to cocaine; otherwise all animals underwent all behavioural tests unless they showed signs of sickness or were found dead (2 mice in total out of 104), in the same order (open field, rotarod, elevated O-maze, marble burying, Y-maze and cocaine sensitisation), with a 1–2 day break between experiments. Experimenters were blinded to group identity during data collection and early stages of analysis for all behaviour experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eOpen field testing\u003c/h2\u003e \u003cp\u003eMice were habituated in the designated room for 10 minutes before the start of the experiment. They were then placed in the centre of individual open-field arenas (45 cm\u003csup\u003e3\u003c/sup\u003e) filled with 1 cm of sawdust, and assessed for baseline locomotor activity in batches of 4. Activity was recorded for 60 minutes on the EthoVision XT tracking system (Noldus Information Technologies, Leesburg, VA, USA). Total distance travelled and speed of movement for each mouse were calculated in 5 minute bins as well as hour-long totals.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eRotarod\u003c/h2\u003e \u003cp\u003eMice were trained on a rotarod (47600, Ugo Basile, Italy) using a protocol of 3 trials per day with and inter-trial interval of 1-hour intervals for 3 consecutive days. The rotarod accelerated from 5 to 60 rpm over a period of 10 minutes. Latency to fall and rod speed at the moment of fall were recorded for each mouse. Average latency to fall per trial and per day were calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eY-maze\u003c/h2\u003e \u003cp\u003eMice were tested in an opaque Y-shaped maze with 3 arms positioned at 120\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003e from each other. Mice were individually placed at the end of an arm facing away from the centre of the maze, alternating between starting arms with each mouse to account for any bias. Arm exploration was observed for 5 minutes, and spontaneous alternation (ABC pattern), alternate arm entries (ABA pattern) and same arm entries (ABB pattern) were recorded. Speed of movement and total distance travelled were also recorded with the EthoVision XT video tracking system.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eElevated O-maze\u003c/h2\u003e \u003cp\u003eA 5.5 cm wide ring-shaped runway with an outer diameter of 46 cm was placed 40 cm above the floor. Two opposing 90\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003e sectors were protected by 16 cm high inner and outer white walls (closed sectors). The remaining two 90\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003e sectors were without walls (open sectors). Animals were released at the edge of one of the closed arms facing inwards and observed for 5 min. The EthoVision XT video tracking system was used to record time each mouse spent on open and closed arms and number of entries in open and closed sectors. An entry was defined as an animal entering that specific sector with all 3 body parts (head, centre and base of tail).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eMarble burying\u003c/h2\u003e \u003cp\u003eMice were put in an open field arena filled with 10 cm of sawdust, where 20 glass marbles had been previously overlaid in a 4x5 arrangement, and were tested for 20 minutes in batches of 4 and after removing the mice, the coverage of marbles was scored. The intensity of behaviour was scored by counting the buried marbles at the end of the task. Marbles were considered buried if they were more than 2/3 covered. The results were confirmed by a second observer; there were no disagreements.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eCocaine challenge\u003c/h2\u003e \u003cp\u003eCocaine sensitisation experiments were carried out over 5 successive days (starting at 10 am), treating 4 animals simultaneously. Each day, mice were weighed and then allowed to habituate for 20 minutes in the open field. After 20 minutes, they were each given IP injections of cocaine (Sigma-Aldrich, C5776) at 20 mg/kg or 15 mg/kg, in a solution of 4 mg/ml. Their horizontal locomotor activity was recorded in the open field for 60 minutes with EthoVision XT. Two LPD-exposed mice administered with 20 mg/kg cocaine exhibiting outlier locomotor behaviour were excluded from the analysis. EthoVision software was used to quantify (clockwise and counter clockwise) rotations, tracking the mouse centre-point movement and fine-tuning parameters to capture tight circling.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eMolecular analysis of gene expression\u003c/h2\u003e \u003cp\u003eMouse tissues were dissected on ice [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e], flash frozen in liquid nitrogen, and stored at -80\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003eC. For RNA extraction, samples were transferred on dry ice, homogenised on the TissueLyserII (Qiagen, 85300), with the addition of a stainless-steel bead (5mm, Qiagen, 69989) and then were processed with the AllPrep DNA/RNA Mini Kit (Qiagen, 80204). DNase treatment (RNase-free DNase Kit, Qiagen, 79254) was incorporated in the RNA extraction process. To produce cDNA, 500 ng of RNA was used in a reverse transcription reaction. RNA, random primers, RNAse-free H\u003csub\u003e2\u003c/sub\u003eO and dNTPs were mixed and heated to 55\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003eC for 5 minutes, and then the samples were cooled on ice. The buffer, DTT, RNaseOUT and SuperScript III (SuperScript™ III Reverse Transcriptase, Thermo Fisher, 18080085) were then added as a master mix, and the samples were transferred back to the thermocycler, incubated at 25\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003eC for 5 minutes, at 50\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003eC for 50 minutes and the reaction was inactivated at 70\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003eC for 15 minutes. The cDNA was diluted 1:5 for quantification by qPCR, using 2 µl of cDNA per reaction and two technical replicates per sample. Relative expression of each candidate gene was calculated by normalising to endogenous mouse control genes that are ubiquitously expressed, such as \u003cem\u003eβ-actin\u003c/em\u003e, \u003cem\u003eTbp, 18S\u003c/em\u003e and \u003cem\u003eGapdh\u003c/em\u003e as indicated in the figure legends. The primers used are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eTissue fixation, sectioning and immunofluorescence\u003c/h2\u003e \u003cp\u003eMice were culled via cervical dislocation, and the brain dissected quickly on ice and fixed in 4% paraformaldehyde at 4\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003eC for 48–72 hours with gentle shaking. Tissue was washed in PBS, transferred to a 30% sucrose solution, incubated in an OCT:30% sucrose solution (1:1 ratio) for 1 hour in RT, before being frozen in OCT over dry ice and stored for later use at -80\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003eC. After calibration in the Leica CM1800 cryostat (Leica Microsystems) chamber for 20 minutes, tissue was sectioned at -22\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003eC to -18\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003eC to generate 35 µm sections.\u003c/p\u003e \u003cp\u003eFor immunofluorescence, sections were gently transferred into 10% Normal Goat Serum blocking buffer for 1 hour in RT, incubated in 0.2% phosphate-buffered serum with 0.1% TritonX (PBSTx) with 2% NGS with TH antibody (Abcam ab76442, 1:1000) overnight at 4\u003csup\u003e\u003cem\u003e◦\u003c/em\u003e\u003c/sup\u003eC with shaking. The next day, sections were washed in PBS 3 times for 10 minutes, and then incubated for 1 hour 45 minutes in 0.2% PBSTx with 2% NGS and secondary antibody (Invitrogen A-11039, Alexa 488, goat anti-chicken, 1:1000). Sections were washed in PBS twice for 10 minutes, incubated with DAPI for 30 min and washed again in PBS twice for 10 minutes. The sections were then floated in a larger basin with PBS and mounted on negatively charged slides, sealed with Vectashield, and left overnight in the dark before being examined.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eConfocal microscopy and image analysis\u003c/h2\u003e \u003cp\u003eAll images were acquired on a Leica SP8 microscope. Three slides were simultaneously imaged on a 3-slide holder to streamline the imaging process. Images of whole slides were initially acquired at 2.5x magnification at low resolution (256x256) to locate the sections. Images of each section were then acquired with a 5x objective at a higher resolution (1024x1024) to identify regions with TH signal. Lastly, tile scans of the substantia nigra (SN) and VTA were acquired with a 20x objective at medium resolution (512x512), acquiring Z-stacks at 2 µm intervals through the entire tissue section. Sections spanning the VTA and SN (approximately between Bregma − 3.34 and − 3.66, based on reference to the Allen Mouse Brain Atlas, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://mouse.brain-map.org/\u003c/span\u003e\u003cspan address=\"http://mouse.brain-map.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) were used for cell body counts, using the central 20 µm of the acquired Z-stack. TH + neurons were identified and counted in 3D using the Imaris software, with manual curation to correct for any mislabelled cells. At least two tissue sections were imaged and quantified per animal, and a minimum 3 animals were scored per condition. Both females and males were used for dopaminergic midbrain neuron counts. Representative images of the SN and VTA were processed in Fiji/Image J.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical tests were executed in GraphPad Prism (version 10.0.2) with details provided in the figure legends. No statistical methods were used to predetermine sample sizes. The behaviour data for each diet group passed the D’Agostino-Pearson normality test. No interaction was observed between sex and diet when analysing data from each timepoint separately, and therefore males and females were combined for all behaviour tests. For PET scans, Cohen’s d effect size was calculated using an online calculator (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.socscistatistics.com/effectsize/default3.aspx\u003c/span\u003e\u003cspan address=\"https://www.socscistatistics.com/effectsize/default3.aspx\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was initially conceived by AGF, MAU and CP with input from MM, and was written by CP, AGF, AD and HJG. RJ and MVdP provided specialist advice on early life adversity and \u003cem\u003eCdkn1c\u003c/em\u003e, and helped in characterising the \u003cem\u003eCdkn1c-Fluc-lacZ\u003c/em\u003e mouse reporter line. Mouse behavioural experiments were conducted by CP and EEI with advice from DJW. Bioluminescent imaging was undertaken by CP, AS and AD and molecular analysis was performed by CP and HJG. PET imaging experiments were performed by CP, supervised by OH. Statistical analyses were performed by CP, EEI, AD and HJG.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank Chad Whilding for assistance with immunofluorescence image analysis and Justyna Glegola for advice on mouse behavioural testing. We would like to thank David Bonsall, Sac-Pham Tang and the rest of the radiochemistry and biology teams at Invicro for assistance with F-DOPA imaging. This work was supported by funding from the Medical Research Council (MC_U120027516 (AGF and MM), MC_UP_1605/12 (AGF), MC_UP_1605/11 (MM) and MC-A654-5QB40 (DJW). For the purpose of open access, the author has applied a CC BY public copyright licence to any Author Accepted Manuscript version arising from this submission.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated during this study are included in the article and its supplementary files or are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eIshidate, T., Elewa, A., Kim, S., Mello, C.C., and Shirayama, M. Divide and differentiate: CDK/Cyclins and the art of development\u003cem\u003e.\u003c/em\u003e \u003cem\u003eCell Cycle\u003c/em\u003e \u003cstrong\u003e13,\u003c/strong\u003e 1384-91; 10.4161/cc.28656 (2014).\u003c/li\u003e\n\u003cli\u003eMorgan, D.O. Cyclin-dependent kinases: engines, clocks, and microprocessors\u003cem\u003e.\u003c/em\u003e \u003cem\u003eAnnu Rev Cell Dev Biol\u003c/em\u003e \u003cstrong\u003e13,\u003c/strong\u003e 261-91; 10.1146/annurev.cellbio.13.1.261 (1997).\u003c/li\u003e\n\u003cli\u003eCampbell, G.J., Hands, E.L., and Van de Pette, M. The Role of CDKs and CDKIs in Murine Development\u003cem\u003e.\u003c/em\u003e \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e; 10.3390/ijms21155343 (2020).\u003c/li\u003e\n\u003cli\u003eSherr, C.J. and Roberts, J.M. CDK inhibitors: positive and negative regulators of G1-phase progression\u003cem\u003e.\u003c/em\u003e \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e13,\u003c/strong\u003e 1501-12; 10.1101/gad.13.12.1501 (1999).\u003c/li\u003e\n\u003cli\u003eMalumbres, M. and Barbacid, M. Cell cycle, CDKs and cancer: a changing paradigm\u003cem\u003e.\u003c/em\u003e \u003cem\u003eNat. Rev. Cancer\u003c/em\u003e \u003cstrong\u003e9,\u003c/strong\u003e 153-66; 10.1038/nrc2602 (2009).\u003c/li\u003e\n\u003cli\u003eHindley, C. and Philpott, A. The cell cycle and pluripotency\u003cem\u003e.\u003c/em\u003e \u003cem\u003eBiochem. J.\u003c/em\u003e \u003cstrong\u003e451,\u003c/strong\u003e 135-43; 10.1042/BJ20121627 (2013).\u003c/li\u003e\n\u003cli\u003eLiu, L.\u003cem\u003e, et al.\u003c/em\u003e G1 cyclins link proliferation, pluripotency and differentiation of embryonic stem cells\u003cem\u003e.\u003c/em\u003e \u003cem\u003eNat. Cell Biol.\u003c/em\u003e \u003cstrong\u003e19,\u003c/strong\u003e 177-188; 10.1038/ncb3474 (2017).\u003c/li\u003e\n\u003cli\u003eFurutachi, S., Matsumoto, A., Nakayama, K.I., and Gotoh, Y. p57 controls adult neural stem cell quiescence and modulates the pace of lifelong neurogenesis\u003cem\u003e.\u003c/em\u003e \u003cem\u003eEMBO J.\u003c/em\u003e \u003cstrong\u003e32,\u003c/strong\u003e 970-81; 10.1038/emboj.2013.50 (2013).\u003c/li\u003e\n\u003cli\u003eBesson, A., Dowdy, S.F., and Roberts, J.M. CDK inhibitors: cell cycle regulators and beyond\u003cem\u003e.\u003c/em\u003e \u003cem\u003eDev. Cell\u003c/em\u003e \u003cstrong\u003e14,\u003c/strong\u003e 159-69; 10.1016/j.devcel.2008.01.013 (2008).\u003c/li\u003e\n\u003cli\u003eTury, A., Mairet-Coello, G., and DiCicco-Bloom, E. The multiple roles of the cyclin-dependent kinase inhibitory protein p57(KIP2) in cerebral cortical neurogenesis\u003cem\u003e.\u003c/em\u003e \u003cem\u003eDev. Neurobiol.\u003c/em\u003e \u003cstrong\u003e72,\u003c/strong\u003e 821-42; 10.1002/dneu.20999 (2012).\u003c/li\u003e\n\u003cli\u003eHatada, I. and Mukai, T. Genomic imprinting of p57KIP2, a cyclin-dependent kinase inhibitor, in mouse\u003cem\u003e.\u003c/em\u003e \u003cem\u003eNat. Genet.\u003c/em\u003e \u003cstrong\u003e11,\u003c/strong\u003e 204-6; 10.1038/ng1095-204 (1995).\u003c/li\u003e\n\u003cli\u003eWestbury, J., Watkins, M., Ferguson-Smith, A.C., and Smith, J. Dynamic temporal and spatial regulation of the cdk inhibitor p57(kip2) during embryo morphogenesis\u003cem\u003e.\u003c/em\u003e \u003cem\u003eMech. Dev.\u003c/em\u003e \u003cstrong\u003e109,\u003c/strong\u003e 83-9; 10.1016/s0925-4773(01)00512-3 (2001).\u003c/li\u003e\n\u003cli\u003eMatsuoka, S.\u003cem\u003e, et al.\u003c/em\u003e p57KIP2, a structurally distinct member of the p21CIP1 Cdk inhibitor family, is a candidate tumor suppressor gene\u003cem\u003e.\u003c/em\u003e \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e9,\u003c/strong\u003e 650-62; 10.1101/gad.9.6.650 (1995).\u003c/li\u003e\n\u003cli\u003eLee, M.H., Reynisdottir, I., and Massague, J. Cloning of p57KIP2, a cyclin-dependent kinase inhibitor with unique domain structure and tissue distribution\u003cem\u003e.\u003c/em\u003e \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e9,\u003c/strong\u003e 639-49; 10.1101/gad.9.6.639 (1995).\u003c/li\u003e\n\u003cli\u003eAndrews, S.C.\u003cem\u003e, et al.\u003c/em\u003e Cdkn1c (p57Kip2) is the major regulator of embryonic growth within its imprinted domain on mouse distal chromosome 7\u003cem\u003e.\u003c/em\u003e \u003cem\u003eBMC Dev. Biol.\u003c/em\u003e \u003cstrong\u003e7,\u003c/strong\u003e 53; 10.1186/1471-213X-7-53 (2007).\u003c/li\u003e\n\u003cli\u003eZhang, P.\u003cem\u003e, et al.\u003c/em\u003e Altered cell differentiation and proliferation in mice lacking p57KIP2 indicates a role in Beckwith-Wiedemann syndrome\u003cem\u003e.\u003c/em\u003e \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e387,\u003c/strong\u003e 151-8; 10.1038/387151a0 (1997).\u003c/li\u003e\n\u003cli\u003eYan, Y., Frisen, J., Lee, M.H., Massague, J., and Barbacid, M. Ablation of the CDK inhibitor p57Kip2 results in increased apoptosis and delayed differentiation during mouse development\u003cem\u003e.\u003c/em\u003e \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e11,\u003c/strong\u003e 973-83; 10.1101/gad.11.8.973 (1997).\u003c/li\u003e\n\u003cli\u003eTunster, S.J., Van de Pette, M., and John, R.M. Fetal overgrowth in the Cdkn1c mouse model of Beckwith-Wiedemann syndrome\u003cem\u003e.\u003c/em\u003e \u003cem\u003eDis. Model. Mech.\u003c/em\u003e \u003cstrong\u003e4,\u003c/strong\u003e 814-21; 10.1242/dmm.007328 (2011).\u003c/li\u003e\n\u003cli\u003eMairet-Coello, G.\u003cem\u003e, et al.\u003c/em\u003e p57(KIP2) regulates radial glia and intermediate precursor cell cycle dynamics and lower layer neurogenesis in developing cerebral cortex\u003cem\u003e.\u003c/em\u003e \u003cem\u003eDevelopment\u003c/em\u003e \u003cstrong\u003e139,\u003c/strong\u003e 475-87; 10.1242/dev.067314 (2012).\u003c/li\u003e\n\u003cli\u003eMcNamara, G.I.\u003cem\u003e, et al.\u003c/em\u003e Dopaminergic and behavioural changes in a loss-of-imprinting model of Cdkn1c\u003cem\u003e.\u003c/em\u003e \u003cem\u003eGenes Brain Behav.\u003c/em\u003e \u003cstrong\u003e17,\u003c/strong\u003e 149-157; 10.1111/gbb.12422 (2018).\u003c/li\u003e\n\u003cli\u003eMcNamara, G.I., John, R.M., and Isles, A.R. Territorial Behavior and Social Stability in the Mouse Require Correct Expression of Imprinted Cdkn1c\u003cem\u003e.\u003c/em\u003e \u003cem\u003eFront. Behav. Neurosci.\u003c/em\u003e \u003cstrong\u003e12,\u003c/strong\u003e 28; 10.3389/fnbeh.2018.00028 (2018).\u003c/li\u003e\n\u003cli\u003eMcNamara, G.I., Davis, B.A., Dwyer, D.M., John, R.M., and Isles, A.R. Behavioural abnormalities in a novel mouse model for Silver Russell Syndrome\u003cem\u003e.\u003c/em\u003e \u003cem\u003eHum. Mol. Genet.\u003c/em\u003e \u003cstrong\u003e25,\u003c/strong\u003e 5407-5417; 10.1093/hmg/ddw357 (2016).\u003c/li\u003e\n\u003cli\u003eLaukoter, S.\u003cem\u003e, et al.\u003c/em\u003e Imprinted Cdkn1c genomic locus cell-autonomously promotes cell survival in cerebral cortex development\u003cem\u003e.\u003c/em\u003e \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e11,\u003c/strong\u003e 195; 10.1038/s41467-019-14077-2 (2020).\u003c/li\u003e\n\u003cli\u003eLaukoter, S.\u003cem\u003e, et al.\u003c/em\u003e Cell-Type Specificity of Genomic Imprinting in Cerebral Cortex\u003cem\u003e.\u003c/em\u003e \u003cem\u003eNeuron\u003c/em\u003e \u003cstrong\u003e107,\u003c/strong\u003e 1160-1179 e9; 10.1016/j.neuron.2020.06.031 (2020).\u003c/li\u003e\n\u003cli\u003eImaizumi, Y.\u003cem\u003e, et al.\u003c/em\u003e Role of the imprinted allele of the Cdkn1c gene in mouse neocortical development\u003cem\u003e.\u003c/em\u003e \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cstrong\u003e10,\u003c/strong\u003e 1884; 10.1038/s41598-020-58629-9 (2020).\u003c/li\u003e\n\u003cli\u003eCreff, J. and Besson, A. Functional Versatility of the CDK Inhibitor p57(Kip2)\u003cem\u003e.\u003c/em\u003e \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e \u003cstrong\u003e8,\u003c/strong\u003e 584590; 10.3389/fcell.2020.584590 (2020).\u003c/li\u003e\n\u003cli\u003eVucetic, Z.\u003cem\u003e, et al.\u003c/em\u003e Early life protein restriction alters dopamine circuitry\u003cem\u003e.\u003c/em\u003e \u003cem\u003eNeuroscience\u003c/em\u003e \u003cstrong\u003e168,\u003c/strong\u003e 359-70; 10.1016/j.neuroscience.2010.04.010 (2010).\u003c/li\u003e\n\u003cli\u003eVan de Pette, M.\u003cem\u003e, et al.\u003c/em\u003e Visualizing Changes in Cdkn1c Expression Links Early-Life Adversity to Imprint Mis-regulation in Adults\u003cem\u003e.\u003c/em\u003e \u003cem\u003eCell Rep.\u003c/em\u003e \u003cstrong\u003e18,\u003c/strong\u003e 1090-1099; 10.1016/j.celrep.2017.01.010 (2017).\u003c/li\u003e\n\u003cli\u003eIsles, A.R., McNamara, G.I., and John, R.M. Genomic imprinting and neurobehavioral programming by adverse early life environments: evidence from studying Cdkn1c\u003cem\u003e.\u003c/em\u003e \u003cem\u003eCurrent Opinion in Behavioral Sciences\u003c/em\u003e \u003cstrong\u003e25,\u003c/strong\u003e 31-35; 10.1016/j.cobeha.2018.06.008 (2019).\u003c/li\u003e\n\u003cli\u003eBhogal, B., Arnaudo, A., Dymkowski, A., Best, A., and Davis, T.L. Methylation at mouse Cdkn1c is acquired during postimplantation development and functions to maintain imprinted expression\u003cem\u003e.\u003c/em\u003e \u003cem\u003eGenomics\u003c/em\u003e \u003cstrong\u003e84,\u003c/strong\u003e 961-70; 10.1016/j.ygeno.2004.08.004 (2004).\u003c/li\u003e\n\u003cli\u003eGould, J.M.\u003cem\u003e, et al.\u003c/em\u003e Mouse maternal protein restriction during preimplantation alone permanently alters brain neuron proportion and adult short-term memory\u003cem\u003e.\u003c/em\u003e \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e115,\u003c/strong\u003e E7398-E7407; 10.1073/pnas.1721876115 (2018).\u003c/li\u003e\n\u003cli\u003eLanham, S.A.\u003cem\u003e, et al.\u003c/em\u003e Periconception maternal low-protein diet adversely affects male mouse fetal bone growth and mineral density quality in late gestation\u003cem\u003e.\u003c/em\u003e \u003cem\u003eJ. Dev. Orig. Health Dis.\u003c/em\u003e \u003cstrong\u003e12,\u003c/strong\u003e 384-395; 10.1017/S204017442000046X (2021).\u003c/li\u003e\n\u003cli\u003eBale, T.L.\u003cem\u003e, et al.\u003c/em\u003e Early life programming and neurodevelopmental disorders\u003cem\u003e.\u003c/em\u003e \u003cem\u003eBiol. Psychiatry\u003c/em\u003e \u003cstrong\u003e68,\u003c/strong\u003e 314-9; 10.1016/j.biopsych.2010.05.028 (2010).\u003c/li\u003e\n\u003cli\u003eLangie, S.A.\u003cem\u003e, et al.\u003c/em\u003e Maternal folate depletion and high-fat feeding from weaning affects DNA methylation and DNA repair in brain of adult offspring\u003cem\u003e.\u003c/em\u003e \u003cem\u003eFASEB J.\u003c/em\u003e \u003cstrong\u003e27,\u003c/strong\u003e 3323-34; 10.1096/fj.12-224121 (2013).\u003c/li\u003e\n\u003cli\u003eShiotsuki, H.\u003cem\u003e, et al.\u003c/em\u003e A rotarod test for evaluation of motor skill learning\u003cem\u003e.\u003c/em\u003e \u003cem\u003eJ. Neurosci. Methods\u003c/em\u003e \u003cstrong\u003e189,\u003c/strong\u003e 180-5; 10.1016/j.jneumeth.2010.03.026 (2010).\u003c/li\u003e\n\u003cli\u003eDeacon, R.M. Measuring motor coordination in mice\u003cem\u003e.\u003c/em\u003e \u003cem\u003eJ Vis Exp\u003c/em\u003e e2609; 10.3791/2609 (2013).\u003c/li\u003e\n\u003cli\u003eDixit, P.V., Sahu, R., and Mishra, D.K. Marble-burying behavior test as a murine model of compulsive-like behavior\u003cem\u003e.\u003c/em\u003e \u003cem\u003eJ Pharmacol Toxicol Methods\u003c/em\u003e \u003cstrong\u003e102,\u003c/strong\u003e 106676; 10.1016/j.vascn.2020.106676 (2020).\u003c/li\u003e\n\u003cli\u003eDiCarlo, G.E.\u003cem\u003e, et al.\u003c/em\u003e Autism-linked dopamine transporter mutation alters striatal dopamine neurotransmission and dopamine-dependent behaviors\u003cem\u003e.\u003c/em\u003e \u003cem\u003eJ. Clin. Invest.\u003c/em\u003e \u003cstrong\u003e129,\u003c/strong\u003e 3407-3419; 10.1172/JCI127411 (2019).\u003c/li\u003e\n\u003cli\u003eBeninger, R.J. The Role of Dopamine in Locomotor-Activity and Learning\u003cem\u003e.\u003c/em\u003e \u003cem\u003eBrain Res. Rev.\u003c/em\u003e \u003cstrong\u003e6,\u003c/strong\u003e 173-196; 10.1016/0165-0173(83)90038-3 (1983).\u003c/li\u003e\n\u003cli\u003eWakeling, E.L.\u003cem\u003e, et al.\u003c/em\u003e Diagnosis and management of Silver-Russell syndrome: first international consensus statement\u003cem\u003e.\u003c/em\u003e \u003cem\u003eNat. Rev. Endocrinol.\u003c/em\u003e \u003cstrong\u003e13,\u003c/strong\u003e 105-124; 10.1038/nrendo.2016.138 (2017).\u003c/li\u003e\n\u003cli\u003eTilley, M.R. and Gu, H.H. Dopamine transporter inhibition is required for cocaine-induced stereotypy\u003cem\u003e.\u003c/em\u003e \u003cem\u003eNeuroreport\u003c/em\u003e \u003cstrong\u003e19,\u003c/strong\u003e 1137-40; 10.1097/WNR.0b013e3283063183 (2008).\u003c/li\u003e\n\u003cli\u003eTang, C.\u003cem\u003e, et al.\u003c/em\u003e Dose- and rate-dependent effects of cocaine on striatal firing related to licking\u003cem\u003e.\u003c/em\u003e \u003cem\u003eJ Pharmacol Exp Ther\u003c/em\u003e \u003cstrong\u003e324,\u003c/strong\u003e 701-13; 10.1124/jpet.107.129734 (2008).\u003c/li\u003e\n\u003cli\u003eShultz, P.L., Galler, J.R., and Tonkiss, J. Prenatal protein restriction increases sensitization to cocaine-induced stereotypy\u003cem\u003e.\u003c/em\u003e \u003cem\u003eBehav. Pharmacol.\u003c/em\u003e \u003cstrong\u003e10,\u003c/strong\u003e 379-87; 10.1097/00008877-199907000-00005 (1999).\u003c/li\u003e\n\u003cli\u003eGarnett, S., Firnau, G., Nahmias, C., and Chirakal, R. Striatal dopamine metabolism in living monkeys examined by positron emission tomography\u003cem\u003e.\u003c/em\u003e \u003cem\u003eBrain Res.\u003c/em\u003e \u003cstrong\u003e280,\u003c/strong\u003e 169-71; 10.1016/0006-8993(83)91187-3 (1983).\u003c/li\u003e\n\u003cli\u003eVingerhoets, F.J.\u003cem\u003e, et al.\u003c/em\u003e Positron emission tomographic evidence for progression of human MPTP-induced dopaminergic lesions\u003cem\u003e.\u003c/em\u003e \u003cem\u003eAnn. Neurol.\u003c/em\u003e \u003cstrong\u003e36,\u003c/strong\u003e 765-70; 10.1002/ana.410360513 (1994).\u003c/li\u003e\n\u003cli\u003eHalff, E.F.\u003cem\u003e, et al.\u003c/em\u003e Evaluation of Intraperitoneal [F-18]-FDOPA Administration for Micro-PET Imaging in Mice and Assessment of the Effect of Subchronic Ketamine Dosing on Dopamine Synthesis Capacity\u003cem\u003e.\u003c/em\u003e \u003cem\u003eMol. Imaging\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e; 10.1155/2022/4419221 (2022).\u003c/li\u003e\n\u003cli\u003eKokkinou, M.\u003cem\u003e, et al.\u003c/em\u003e Reproducing the dopamine pathophysiology of schizophrenia and approaches to ameliorate it: a translational imaging study with ketamine\u003cem\u003e.\u003c/em\u003e \u003cem\u003eMol. Psychiatry\u003c/em\u003e \u003cstrong\u003e26,\u003c/strong\u003e 2562-2576; 10.1038/s41380-020-0740-6 (2021).\u003c/li\u003e\n\u003cli\u003eKumakura, Y. and Cumming, P. PET Studies of Cerebral Levodopa Metabolism: A Review of Clinical Findings and Modeling Approaches\u003cem\u003e.\u003c/em\u003e \u003cem\u003eNeuroscientist\u003c/em\u003e \u003cstrong\u003e15,\u003c/strong\u003e 635-650; 10.1177/1073858409338217 (2009).\u003c/li\u003e\n\u003cli\u003eMarichich, E.S., Molina, V.A., and Orsingher, O.A. Persistent Changes in Central Catecholaminergic System after Recovery of Perinatally Undernourished Rats\u003cem\u003e.\u003c/em\u003e \u003cem\u003eJ. Nutr.\u003c/em\u003e \u003cstrong\u003e109,\u003c/strong\u003e 1045-1050; 10.1093/jn/109.6.1045 (1979).\u003c/li\u003e\n\u003cli\u003eChen, J.C., Turiak, G., Galler, J., and Volicer, L. Postnatal changes of brain monoamine levels in prenatally malnourished and control rats\u003cem\u003e.\u003c/em\u003e \u003cem\u003eInt. J. Dev. Neurosci.\u003c/em\u003e \u003cstrong\u003e15,\u003c/strong\u003e 257-263; 10.1016/S0736-5748(96)00121-9 (1997).\u003c/li\u003e\n\u003cli\u003ePalmer, A.A.\u003cem\u003e, et al.\u003c/em\u003e Prenatal protein deprivation alters dopamine-mediated behaviors and dopaminergic and glutamatergic receptor binding\u003cem\u003e.\u003c/em\u003e \u003cem\u003eBrain Res.\u003c/em\u003e \u003cstrong\u003e1237,\u003c/strong\u003e 62-74; 10.1016/j.brainres.2008.07.089 (2008).\u003c/li\u003e\n\u003cli\u003eVan de Pette, M.\u003cem\u003e, et al.\u003c/em\u003e Epigenetic changes induced by in utero dietary challenge result in phenotypic variability in successive generations of mice\u003cem\u003e.\u003c/em\u003e \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e13,\u003c/strong\u003e 2464; 10.1038/s41467-022-30022-2 (2022).\u003c/li\u003e\n\u003cli\u003eJoseph, B.\u003cem\u003e, et al.\u003c/em\u003e p57(Kip2) cooperates with Nurr1 in developing dopamine cells\u003cem\u003e.\u003c/em\u003e \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e100,\u003c/strong\u003e 15619-24; 10.1073/pnas.2635658100 (2003).\u003c/li\u003e\n\u003cli\u003ePerlmann, T. and Wallen-Mackenzie, A. Nurr1, an orphan nuclear receptor with essential functions in developing dopamine cells\u003cem\u003e.\u003c/em\u003e \u003cem\u003eCell Tissue Res\u003c/em\u003e \u003cstrong\u003e318,\u003c/strong\u003e 45-52; 10.1007/s00441-004-0974-7 (2004).\u003c/li\u003e\n\u003cli\u003eKadkhodaei, B.\u003cem\u003e, et al.\u003c/em\u003e Nurr1 is required for maintenance of maturing and adult midbrain dopamine neurons\u003cem\u003e.\u003c/em\u003e \u003cem\u003eJ. Neurosci.\u003c/em\u003e \u003cstrong\u003e29,\u003c/strong\u003e 15923-32; 10.1523/JNEUROSCI.3910-09.2009 (2009).\u003c/li\u003e\n\u003cli\u003eSousa, K.M.\u003cem\u003e, et al.\u003c/em\u003e Microarray analyses support a role for Nurr1 in resistance to oxidative stress and neuronal differentiation in neural stem cells\u003cem\u003e.\u003c/em\u003e \u003cem\u003eStem Cells\u003c/em\u003e \u003cstrong\u003e25,\u003c/strong\u003e 511-9; 10.1634/stemcells.2006-0238 (2007).\u003c/li\u003e\n\u003cli\u003eAl-Nusaif, M., Lin, Y.S., Li, T.B., Cheng, C., and Le, W.D. Advances in NURR1-Regulated Neuroinflammation Associated with Parkinson\u0026apos;s Disease\u003cem\u003e.\u003c/em\u003e \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e; 10.3390/ijms232416184 (2022).\u003c/li\u003e\n\u003cli\u003eDeCapo, M., Thompson, J.R., Dunn, G., and Sullivan, E.L. Perinatal Nutrition and Programmed Risk for Neuropsychiatric Disorders: A Focus on Animal Models\u003cem\u003e.\u003c/em\u003e \u003cem\u003eBiol. Psychiatry\u003c/em\u003e \u003cstrong\u003e85,\u003c/strong\u003e 122-134; 10.1016/j.biopsych.2018.08.006 (2019).\u003c/li\u003e\n\u003cli\u003eJauhar, S.\u003cem\u003e, et al.\u003c/em\u003e A Test of the Transdiagnostic Dopamine Hypothesis of Psychosis Using Positron Emission Tomographic Imaging in Bipolar Affective Disorder and Schizophrenia\u003cem\u003e.\u003c/em\u003e \u003cem\u003eJama Psychiatry\u003c/em\u003e \u003cstrong\u003e74,\u003c/strong\u003e 1206-1213; 10.1001/jamapsychiatry.2017.2943 (2017).\u003c/li\u003e\n\u003cli\u003eRogdaki, M.\u003cem\u003e, et al.\u003c/em\u003e Striatal dopaminergic alterations in individuals with copy number variants at the 22q11.2 genetic locus and their implications for psychosis risk: a [18F]-DOPA PET study (Jun, 2021, 10.1038/s41380-02101108-y)\u003cem\u003e.\u003c/em\u003e \u003cem\u003eMol. Psychiatry\u003c/em\u003e; 10.1038/s41380-021-01192-0 (2021).\u003c/li\u003e\n\u003cli\u003eErnst, M.\u003cem\u003e, et al.\u003c/em\u003e Neural substrates of decision making in adults with attention deficit hyperactivity disorder\u003cem\u003e.\u003c/em\u003e \u003cem\u003eAm. J. Psychiatry\u003c/em\u003e \u003cstrong\u003e160,\u003c/strong\u003e 1061-70; 10.1176/appi.ajp.160.6.1061 (2003).\u003c/li\u003e\n\u003cli\u003eFuchtner, F., Zessin, J., Mading, P., and Wust, F. Aspects of 6-[18F]fluoro-L-DOPA preparation. Deuterochloroform as a substitute solvent for Freon 11\u003cem\u003e.\u003c/em\u003e \u003cem\u003eNuklearmedizin\u003c/em\u003e \u003cstrong\u003e47,\u003c/strong\u003e 62-4(2008).\u003c/li\u003e\n\u003cli\u003ePatlak, C.S. and Blasberg, R.G. Graphical evaluation of blood-to-brain transfer constants from multiple-time uptake data. Generalizations\u003cem\u003e.\u003c/em\u003e \u003cem\u003eJ. Cereb. Blood Flow Metab.\u003c/em\u003e \u003cstrong\u003e5,\u003c/strong\u003e 584-90; 10.1038/jcbfm.1985.87 (1985).\u003c/li\u003e\n\u003cli\u003eWalker, M.D.\u003cem\u003e, et al.\u003c/em\u003e In-vivo measurement of LDOPA uptake, dopamine reserve and turnover in the rat brain using [18F]FDOPA PET\u003cem\u003e.\u003c/em\u003e \u003cem\u003eJ. Cereb. Blood Flow Metab.\u003c/em\u003e \u003cstrong\u003e33,\u003c/strong\u003e 59-66; 10.1038/jcbfm.2012.120 (2013).\u003c/li\u003e\n\u003cli\u003eSpijker, S., \u003cem\u003eDissection of Rodent Brain Regions\u003c/em\u003e, in \u003cem\u003eNeuroproteomics\u003c/em\u003e. 2011. p. 13-26.\u003c/li\u003e\n\u003cli\u003eMomeni, S., Segerstrom, L., and Roman, E. Supplier-dependent differences in intermittent voluntary alcohol intake and response to naltrexone in Wistar rats\u003cem\u003e.\u003c/em\u003e \u003cem\u003eFront. Neurosci.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e; 10.3389/fnins.2015.00424 (2015).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003ePrimers used in qRT-PCR analysis.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTarget\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eForward primer sequence\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReverse primer sequence\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTubb3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTAGACCCCAGCGGCAACTAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTTCCAGGTTCCAAGTCCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eNeuN\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTAGAGGGACGGAAAATTGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTGGGGTAGGGGAAACTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTh\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCAAGGTTCATTGGACGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCTCCTCGAATACCACAGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eGfap\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGAGACGCATCACCTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGGGAGTGGAGGAGTCATTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCnp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTTACCCGCAAAAGCCACACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCACCGTGTCCTCATCTTGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eItgam\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCATGACCTTCCAAGAGAATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACCGGCTTGTGCTGTAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCdkn1c\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGAGAACTGCGCAGGAGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCTGGCCGTTAGCCTCTAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eDDC (Aadc)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTAGCTGACTATCTGGATGGCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTCCTCGTATGTTTCTGGCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eVMAT2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGCTGCTCACCGTCGTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGACAGTCGTGTTGGTCACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eSLC6A3 (DAT)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAAATGCTCCGTGGGACCAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTCTCCCGCTCTTGAACCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eDRD1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGGCTCCTAACACTTCTACCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGGTATTCCCTAAGAGAGTGGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eDRD2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACCTGTCCTGGTACGATGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCATGGCATAGTAGTTGTAGTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eDRD3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCTCTGAGCCAGATAAGCAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGACCGTTGCCAAAGATGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eDRD4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCTGGAGAACCGAGACTATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGCTGTGAAGTTTGGTGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eDRD5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCGGCAACGTCCTAGTGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAATGCCACGAAGAGGTCTGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eMAOA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCCAGTATCACAGGCCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGGCTTCCAGAACCAAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eMAOB\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGAGCAACAAAAGCGATGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCTAATTGTGTAAGTCCTGCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCOMT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTGGGGGTTGGTGGCTATTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCCACTCCTTCTCTGAGCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eNR4A2 (Nurr1)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTGTTCAGGCGCAGTATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGGCAGTAATTTCAGTGTTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eDARPP-32\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ecccatcactgaaagctgtgc\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003etcccgaagctcccctaactc\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCATCCGTAAAGACCTCTATGCCAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGGAGCCACCGATCCACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e18S\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTAACCCGTTGAACCCCATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCATCCAATCGGTAGTAGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTbp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAAGAACAATCCAGACTAGCAGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCTTATAGGGAACTTCACATCACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eGapdh\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAAGAGAGGCCCTATCCCAACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTGTGGGTGCAGCGAACTTTATTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eAll data generated during this study are included in the article and its supplementary files or are available from the corresponding author on reasonable request.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3428617/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3428617/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eWe tracked the consequences of \u003cem\u003ein utero\u003c/em\u003e protein restriction in mice throughout their development and life course using a luciferase-based allelic reporter of imprinted \u003cem\u003eCdkn1c\u003c/em\u003e. Exposure to gestational low-protein diet (LPD) results in the inappropriate expression of paternally inherited \u003cem\u003eCdkn1c\u003c/em\u003e in the brains of embryonic and juvenile mice. These animals were characterised by a developmental delay in motor skills, and by behavioural alterations indicative of reduced anxiety. Exposure to LPD \u003cem\u003ein utero\u003c/em\u003e resulted in significantly more tyrosine hydroxylase positive (dopaminergic) neurons in the midbrain of adult offspring as compared to age-matched, control-diet equivalents. Positron emission tomography (PET) imaging revealed an increase in striatal dopamine synthesis capacity in LPD-exposed offspring, where elevated levels of dopamine correlated with an enhanced sensitivity to cocaine. These data highlight a profound sensitivity of the developing epigenome to gestational protein restriction. Our data also suggest that loss of \u003cem\u003eCdkn1c\u003c/em\u003e imprinting and p57\u003csup\u003eKIP2\u003c/sup\u003e upregulation alter the cellular composition of the developing midbrain, compromises dopamine circuitry, and thereby provokes behavioural abnormalities in early postnatal life. Molecular analyses revealed that despite this phenotype, exposure to LPD solely during pregnancy did not cause a gross perturbation in neuronal- or dopamine-associated gene expression that was sustained into adulthood.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Protein restriction during pregnancy alters Cdkn1c silencing, dopamine circuitry and behaviour in offspring without wholescale disruption of neuronal gene expression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-10-19 18:00:07","doi":"10.21203/rs.3.rs-3428617/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-02-06T17:57:05+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-01-09T11:00:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"fe16316b-897f-4f68-b9eb-54eceb1ef05c","date":"2023-12-29T15:50:50+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2023-11-20T19:22:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"11ec32c6-3249-4650-98c6-3c86e6d8f458","date":"2023-11-13T00:02:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"bb75a4dd-7267-4343-a1c1-a0c29440c5bc","date":"2023-11-09T19:31:43+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2023-10-18T12:29:11+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-10-18T12:21:06+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2023-10-18T04:58:02+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2023-10-18T04:53:54+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2023-10-10T17:57:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"03a2d74f-3b45-42de-9119-aa6067774a30","owner":[],"postedDate":"October 19th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":25462178,"name":"Biological sciences/Biological techniques/Behavioural methods"},{"id":25462179,"name":"Biological sciences/Biological techniques/Imaging/Bioluminescence imaging"},{"id":25462180,"name":"Biological sciences/Biological techniques/Imaging/Positron emission tomography"},{"id":25462181,"name":"Biological sciences/Biological techniques/Gene expression analysis"},{"id":25462182,"name":"Biological sciences/Biological techniques/Experimental organisms/Model vertebrates/Mouse"},{"id":25462183,"name":"Biological sciences/Developmental biology/Epigenetic memory"},{"id":25462184,"name":"Biological sciences/Molecular biology/Epigenetics/Imprinting"},{"id":25462185,"name":"Biological sciences/Developmental biology/Intrauterine growth"}],"tags":[],"updatedAt":"2024-04-15T15:05:45+00:00","versionOfRecord":{"articleIdentity":"rs-3428617","link":"https://doi.org/10.1038/s41598-024-59083-7","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-04-12 15:01:51","publishedOnDateReadable":"April 12th, 2024"},"versionCreatedAt":"2023-10-19 18:00:07","video":"","vorDoi":"10.1038/s41598-024-59083-7","vorDoiUrl":"https://doi.org/10.1038/s41598-024-59083-7","workflowStages":[]},"version":"v1","identity":"rs-3428617","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3428617","identity":"rs-3428617","version":["v1"]},"buildId":"pf3fE39SIOqb-0xH_OWvX","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}