The Role and Mechanism of Exosome-Mediated miR-875-3p in Targeting SLC39A14 to Regulate Ferroptosis in Osteosarcoma Proliferation, Migration, and Invasion

preprint OA: closed
Full text JSON View at publisher
Full text 175,607 characters · extracted from preprint-html · click to expand
The Role and Mechanism of Exosome-Mediated miR-875-3p in Targeting SLC39A14 to Regulate Ferroptosis in Osteosarcoma Proliferation, Migration, and Invasion | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Role and Mechanism of Exosome-Mediated miR-875-3p in Targeting SLC39A14 to Regulate Ferroptosis in Osteosarcoma Proliferation, Migration, and Invasion Jie Huang, Jiaqi He, Liuru Lu, Yongheng Dai, Chengjun Sun, Sichang Wu, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8181974/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 25 Apr, 2026 Read the published version in Journal of Orthopaedic Surgery and Research → Version 1 posted 8 You are reading this latest preprint version Abstract Background Osteosarcoma is a common primary bone malignancy with a complex pathogenesis and poor prognosis. Dysregulated expression of multiple microRNAs (miRNAs) has been observed in osteosarcoma tissues and cells, where they regulate proliferation, apoptosis, invasion, and metastasis. The results reveal that miRNAs may serve as diagnostic biomarkers and therapeutic targets, providing new opportunities for early diagnosis and personalized treatment of osteosarcoma. Methods We first employed bioinformatics analyses combined with dual-luciferase reporter assays and reverse transcription quantitative polymerase chain reaction (RT-qPCR) to identify and validate key miRNAs and mRNAs in osteosarcoma (OS). Transmission electron microscopy (TEM) and western blotting (WB) were used to explore and confirm exosomes. Lentiviral (LV) and adenoviral (ADV) transfection were applied to downregulate candidate miRNAs and mRNAs, followed by in vitro functional assays in OS cell lines. Cell viability, migration, and invasion were evaluated using CCK-8 and wound-healing assays. GSH/GSSG ratio, Fe²⁺, ROS, and MDA levels were measured with commercial kits, while RT-qPCR and WB were used to detect ferroptosis-related mRNA and protein expression. Finally, a nude mouse xenograft model was established to assess the effects of miRNA and mRNA downregulation on tumorigenesis in vivo. Results In osteosarcoma (OS) cell lines and tissues, miR-875-3p was found to be upregulated, whereas SLC39A14 was downregulated. Knockdown of miR-875-3p promoted ferroptosis and inhibited the proliferation, invasion, and migration of OS cells, while knockdown of SLC39A14 exerted the opposite effects. Moreover, RT-qPCR analysis showed a negative correlation between SLC39A14 and miR-875-3p expression, confirming their regulatory relationship. Conclusions miR-875-3p inhibits ferroptosis by downregulating SLC39A14 expression, thereby affecting the proliferation, migration, and invasion of osteosarcoma (OS) cells both in vivo and in vitro. Osteosarcoma Exosomes MiR-875-3p SLC39A14 Ferroptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Osteosarcoma is the leading type of primary malignant bone cancer, representing roughly 11.7% of all bone tumors. Epidemiological studies indicate that the disease exhibits a distinct age clustering pattern, with about three-quarters of cases occurring in adolescents and young adults aged 15–25 years, and is associated with high disability rates and poor prognosis [ 1 ]. Notably, at the time of clinical diagnosis, 15%-20% of patients already present with distant metastases, among which pulmonary metastases are detected in up to 82% of cases [ 2 ]. Although current treatment strategies combining adjuvant chemotherapy and wide tumor excision have improved the five-year survival rate to around 60% [ 3 ], key factors such as postoperative recurrence, multidrug resistance, and secondary organ damage continue to adversely affect prognosis [ 4 ]. Given the high genomic heterogeneity and complex regulatory networks of osteosarcoma, in-depth exploration of its molecular mechanisms and the development of novel biomarker detection systems have become crucial research directions to overcome existing therapeutic limitations. In recent years, with rapid advances in targeted therapies, molecular targeted treatment for osteosarcoma has shown promising prospects, including IGF-R/IGF-1R inhibitors, TP53 inhibitors [ 5 ], and multi-target tyrosine kinase inhibitors designed against receptor tyrosine kinases [ 6 ]. However, due to the high heterogeneity and intricate molecular regulatory mechanisms of osteosarcoma, selecting appropriate targets for related research remains challenging. Therefore, elucidating the molecular regulatory mechanisms of osteosarcoma and identifying new biomarkers are essential to achieve more effective clinical treatments. Recent studies have shown that microRNAs (miRNAs), small single-stranded RNAs transcribed from genes, play a role in the pathophysiology of tumors and the process of distant metastasis [ 7 ].miRNAs are endogenous non-coding RNA molecules, typically 21–25 nucleotides long, that regulate gene expression post-transcriptionally by binding specifically to the 3' untranslated region (3'-UTR) of target mRNAs[ 8 ]. MiRNAs play crucial roles in regulating essential biological processes like cell proliferation, differentiation, and apoptosis, and are key players in the development and progression of cancer. Research has shown that miR-875-3p acts as a potent tumor suppressor in solid tumors, including colorectal cancer and non-small cell lung cancer[ 9 , 10 ]. Particularly in the field of osteosarcoma, Zhang et al. demonstrated through functional experiments that the circular RNA hsa_circ_0069117 can competitively bind to miR-875-3p to regulate PF4V1 expression, thereby inhibiting the proliferation and migration of osteosarcoma cell lines (MG-63 and U2OS) [ 11 ]. This suggests that miR-875-3p may serve as a potential biomarker for targeted therapy in osteosarcoma. However, key scientific questions regarding the dynamic regulatory mechanisms of miR-875-3p in the osteosarcoma microenvironment, especially its interactions with critical signaling pathways such as PI3K/AKT and Wnt/β-catenin, remain to be elucidated. Notably, extracellular vesicles such as exosomes can deliver functional non-coding RNAs to target cells. This miRNA-based intercellular communication mechanism may contribute to the invasive and metastatic processes of osteosarcoma by remodeling the tumor microenvironment. Therefore, we are particularly interested in all forms of regulatory non-coding RNAs, especially those associated with protein complexes in biological fluids or encapsulated within extracellular bioactive factors such as microvesicles or exosomes—with particular emphasis on exosomes due to their excellent cellular penetration capacity and biocompatibility. Exosomes are tiny extracellular vesicles that carry various biomolecules, including DNA, mRNA, miRNA, cytoplasmic proteins, and lipids. They serve as important vehicles for the transfer of bioactive molecules within and between organisms, and are released into the extracellular microenvironment via exocytosis. Cancer cells actively synthesize and secrete exosomes, which contribute to tumor progression through mechanisms such as immune evasion. Current studies indicate that osteosarcoma cells utilize exosomes for pathological communication to promote tumor growth and proliferation. For example: Liu et al. Indicated that M2-type tumor-associated macrophages (M2-TAMs) deliver miR-221-3p via exosomes to osteosarcoma cells (143B and Saos2), promoting tumor cell proliferation in vivo [ 12 ]; Li et al. reported that YES1 is transported by exosomes into osteosarcoma cells, where it activates ERK signaling and mediates the MAPK pathway, thereby boosting tumor cell migration, proliferation, and invasion; Raimondi and his colleagues found that exosomes from osteosarcoma cells stimulate endothelial cells to produce pro-angiogenic molecules such as VEGF-A, IL-6 and IL-8, thereby promoting blood vessel formation and influencing the development of osteosarcoma [ 13 ]. Z and his team demonstrated through laboratory and animal models that osteosarcoma cells can enhance the proliferation and invasion capabilities of 143B cells by releasing exosomes containing miR-195- 3p [ 14 ]; Wang et al. found that exosomes secreted by cancer-associated fibroblasts deliver miR-1228 to osteosarcoma (OS) cells, promoting migration and invasion by suppressing the expression of SCAI, an endogenous inhibitor of cancer cell invasion [ 15 ]. Ferroptosis, newly dentified form of cell death introduced by Dixon et al. in 2012. [16] , has gained increasing research attention in recent years. It is a distinct non-apoptotic cell death process driven by iron-dependent lipid peroxide accumulation. [17] , marked by glutathione (GSH) depletion, lipid peroxidation, and iron accumulation. The cysteine-glutathione synthesis pathway is crucial for triggering ferroptosis. Glutathione peroxidase (GPX) is a classical enzyme family involved in this process. Cystine is imported into cells via the glutamate-cystine transporter (system xc⁻), where it is utilized for the synthesis of GSH and GPX4. GSH acts as a key cofactor in protecting cells from oxidative damage, meanwhile, GPX4 catalyzes the conversion of lipid peroxides into alcohols[ 18 ]. Inhibition of the glutamate-cystine transporter system (system xc⁻) located on the cell membrane—particularly associated with transferrin receptor-1 (TFR-1)—reduces the uptake of cystine into the cell. This leads to decreased synthesis of glutathione (GSH), diminished catalytic activity of GPX4, and consequent accumulation of lipid peroxides, ultimately triggering ferroptosis. Therefore, the accumulation of lipid oxides is an important characteristic of ferroptosis. Lipid peroxidation products and polyunsaturated fatty acids (PUFAs) increase membrane fluidity. PUFAs such as linoleic acid and arachidonic acid are susceptible to oxidation by intracellular reactive oxygen species (ROS), resulting in the generation of lipid peroxidation breakdown products that promote ferroptosis induced by GSH inhibitors such as RSL3 [ 19 ]. Ferroptosis is uniquely different from conventional forms of cell death, like apoptosis and necrosis. Morphologically, it is characterized by cell shrinkage, mitochondrial condensation, intact plasma membranes, and organelle swelling. Salaroli et al. conducted a study examining the cytotoxic effects of artemisinin extracts on two canine osteosarcoma cell lines (OSCA-8 and OSCA-40). The study found elevated total iron levels, the buildup of lipid peroxides, and "ballooning"-like cell death, all of which indicate ferroptosis as a mechanism of cell death in osteosarcoma (OS) cells. This highlights ferroptosis as a potential cell death pathway in OS cells. [ 20 ]. Recently, researchers worldwide have extensively investigated the ion transport function and physiological roles of SLC39A14. Wang et al. identified SLC39A14 as a key transporter responsible for tissue iron overload, facilitating the uptake of non-transferrin-bound iron (NTBI) across the plasma membrane into cells, where it participates in various physiological and metabolic processes [ 21 ]. Furthermore, a study by P et al. demonstrated that inhibiting SLC39A14 significantly suppresses the cellular entry of NTBI, further supporting its crucial role in ferroptosis (doi: 10.1038/s41418-023-01230-0 ). However, there have been few reports on SLC39A14-mediated ferroptosis in osteosarcoma (OS), suggesting its potential as a novel therapeutic target worthy of further investigation. In this study, we employed exosomes as carriers for miRNA-875-3p and SLC39A14. After validating exosome functionality, we utilized both in vitro and in vivo experimental approaches to analyze the regulatory interplay between miRNA-875-3p and SLC39A14 in the context of ferroptosis in osteosarcoma cells under knockdown conditions. Our aim is to elucidate the complex interaction network between them, examine the relationship between miRNA-875-3p-mediated SLC39A14 expression and ferroptosis-related characteristics in OS, and explore the underlying mechanisms. These findings could offer a fresh elucidates osteosarcoma pathogenesis and could pave the way for novel therapies. Methods All related procedures were conducted according to the flowchart. Transfection groups: Group I (miR-875-3p knockdown control), Group II (miR-875-3p knockdown), Group III (SLC39A14 knockdown control), Group IV (SLC39A14 knockdown). Cell culture The H143B human osteosarcoma cells were acquired from Cyagen BioSciences. The cells were grown in a medium called Dulbecco's Modified Eagle Medium (DMEM), which was supplemented with 10% fetal bovine serum (FBS) and 100U/ml penicillin-streptomycin. The temperature of the cell incubator is maintained at 37°C with 5% carbon dioxide (CO ˇ). Human specimen collection The research received Ethics Committee approval from Guangxi Medical University and adhered to the Declaration of Helsinki guidelines, as well as China's 'Administrative Measures for Ethical Review of Biomedical Research Involving Humans. Osteosarcoma samples were collected from patients who attended From January 2024 to December 2024, see patients in the orthopedics or oncology department at the First Affiliated Hospital of Guangxi Medical University. All patients were histopathologically diagnosed with osteosarcoma (ICD: C40, C41). He had not received radiotherapy, chemotherapy or targeted therapy before collecting the samples. Tumor samples and corresponding non-cancerous adjacent tissues (located > 5 cm from the tumor margin) were obtained intraoperatively. A total of three paired osteosarcoma and corresponding adjacent non-cancerous tissue samples were obtained for the study. Animal preparation We used 36 healthy BALB/c nude mice, all 4 weeks old, weighing between 18 and 20 grams, and the number of males and females was equal. These experimental mice were purchased from the Animal Experiment Center at Guangxi Medical University and kept in a dedicated SPF (Specific Pathogen Free) environment. Bioinformatic analysis Exosomal miRNA expression data related to human osteosarcoma were obtained using an exosome microarray technique. We used the R package "DESeq2" to perform differential expression analysis and identify important miRNAs. Next, miRDB was used to predict the mRNAs that these miRNAs might correspond to. Finally, a survival analysis was performed using SPSS to see if these key mRNAs were related to the patient's prognosis. Extraction of exosome in H143B cell H143B cells were cultured in high-sugar DMEM medium (Corning, 10-013-CV) supplemented with 10% fetal bovine serum (FBS; Gibco, A2720801). They were placed in an incubator (Thermo Scientific, Heracell 150i) at 37°C and 5% CO ˇ. We use an inverted microscope (Olympus, CKX53) every day to see how the cells are growing, and when they are almost 70% old, we replace them with a new medium. Cells were then incubated for an additional 72 h to promote exosome secretion. Conditioned medium was sequentially subjected to low- and high-speed centrifugation to remove cells and debris, followed by filtration.After 90 min of ultracentfugation, we resuspended the pellet in PBS and centrifuged it again. The exosome pellet was then collected and resuspended, and its protein concentration was measured using the BCA Protein Assay Kit (Thermo, 23225). Finally, the exosome samples were dispensed into low-protein-binding tubes (Axygen, MCT-175-L-C) and immediately frozen in a refrigerator at-80°C (Thermo, 902-UP). Exosome integrity was further verified by nanoparticle tracking analysis (Malvern, NanoSight NS300) and Western blotting using CD63 and TSG101 antibodies (Abcam, ab59479/ab125011). Transmission electron microscopy (TEM) observation We used transmission electron microscopy to observe exosomes isolated from H143B cells and recorded their structural characteristics, as the internal structure of the mitochondria changes, as seen under the 200 nm/50 nm and 500 nm scales. Exosome microarray Exosomal microarray analysis was performed using human osteosarcoma tissues with corresponding adjacent non-tumorous tissues to determine expression profiles of key mRNAs in osteosarcoma-derived exosomes. Tissue samples were dissociated into single-cell suspensions, and exosomes were subsequently isolated using the aforementioned protocol. Total RNA was purified and quality-controlled use R Neasy Mi-ni Kit ( Qiagen, p/n 74104). After complete drying, miRNA Complete Labeling and Hyb Kits together with a hybridization oven rotator were employed for labeling and hybridization. Microarray washing was performed using Gene Expression Wash Solution System (Agilent, p/n 5188–5327). Ultimately, array scanning utilized a microarray device (e.g., Agilent G2505C) under optimized photomultiplier tube (PMT) gain settings, and raw data were extracted via Agilent Feature Extraction. Dual-luciferase reporter assay We performed a dual luciferase reporting experiment according to the instructions of the Dual-Lucifer® Reporter Assay Kit (Promega, E1941). The specific steps are as follows: We used Human Embryonic Kidney 293T cells (ATCC, CRL-3216) for transfection experiments. These cells were grown in 24-well plates (Corning, 3524) with 1 × 10 cells per well and grown in high-sugar DMEM medium (HyClone, SH30244.01) supplemented with 10% fetal bovine serum (FBS; Gibco, A2720801), and experiments were conducted when they were approximately 70% full. For vector construction, normal SLC39A14 3'UTR sequence (GenBank accession no. NM_001135146.3) was cloned into the pGL3-control vector (Hanheng, HH-Luc-003). Plasmid quantity was assessed via NanoDrop 2000 spectrophotometer (Thermo Scientific), ensuring a final concentration of 250 ng/µL with an A260/A280 ratio of 1.89. A mutant plasmid, in which the key binding site CAGUGAA was substituted with GUCACUU, was also constructed as a control. For transfection complex preparation, 0.16 µg plasmid DNA (80 ng/µL working concentration), 5 pmol hsa-miR-875-3p mimics (RiboBio, miR10000444-1-5), and 10 µL Opti-MEM medium (Gibco, 31985070) were added into Tube 1 (Eppendorf, 30120003). In Tube 2, 10 µL Opti-MEM medium and 0.3 µL LipoFiter 3.0 transfection reagent (Hanheng, HH-LF300) were mixed. Both tubes were vortexed for 5 s ,Plasmid quantity was assessed via NanoDrop 2000 a further 5 min, and then combined by gentle pipetting (15 times). The mixture was incubated under light-protected conditions for 20 min to form liposome–nucleic acid complexes. To add the transfection reagent, we first sucked away the original medium, and then replaced it with 500 µL of fresh medium, which added 50 µL of the transfection mixture. The cells were then incubated in a humidified incubator (Thermo, Heracell 150i) at 37°C and 5% CO ˇ for 48 h. After incubation, we discarded the medium and gently washed the cells twice with cold DPBS (HyClone, SH30256.01). Then add 100 µL of 1× Passive Lysis Buffer (Promega, E1941) to each well, place the culture plate on a shaker (TS-1, Qijing), and shake at 80 rpm for 15 minutes at room temperature. The lysate was then allowed to become clear by centrifugation with a centrifuge (Eppendorf 5424R) at 12,000 rpm (approximately 13,400 × g) for 1 minute. Finally, 20 µL of the clear supernatant was taken and transferred to a white 96-well plate (Costar, 3917). We measured the luminous intensity using a GloMax Navigator device (Promega, GM3000). For each well, 100 µL Luciferase Assay Reagent II was automatically injected to measure firefly luciferase activity, followed by 100 µL Stop & Glo Reagent to measure Renilla luciferase activity. The integration time was set to 2 s/well. We used the luciferase activity ratio of firefly and Renilla (fLuc/rLuc) to adjust the relative luciferase values. Each group was assayed in six biological replicates. Statistical comparisons between wild-type and mutant groups GraphPad Prism 9.0 software was used to conduct two-tailed Student's t-test, and the significance threshold was set at P < 0.01. considered statistically significant. Western blot (WB) We extracted proteins from exosome, osteosarcoma cell, osteosarcoma tissue and adjacent tissue samples that were kept on ice and then lysed. The lysed liquid was centrifuged at 12,000 rpm for 5 minutes, and the supernatant was taken and reserved for subsequent experiments. We separated equal amounts of protein with 10% or 15% SDS-PAGE gel and then transferred them to a PVDF membrane using a wet transfer system. Next, the membrane was sealed in a bag and incubated at 4°C with appropriately diluted primary antibodies.This stage took place for a 12 h period with gentle agitation. Thereafter, they were washed thoroughly use Tris-buffered saline with Tween-20 (TBST) to wash off those antibodies that do not stick to it. Then, soak the membrane in diluted secondary antibodies should be stored at a temperature of 4°C for 90 min under gentle shaking. Following the incubation process, the membranes were subjected to a second wash with TBST, a step designed to ensure the removal of any excess secondary antibodies. We used the ECL Plus system to display protein bands to detection reagent (WBKLS0500, Thermo Fisher Scientific). The membranes were exposed to the reagent in a dark chamber, and chemiluminescent signals corresponding to protein–antibody complexes were detected. Capture of the images was conducted utilising a Bio-Rad's ChemiDoc XRS + equipment, and analysis of band signal intensity was carried out by means of ImageJ software. Thus, relative expression levels of target proteins were determined between different samples. Transcription-quantitative polymerase chain reaction (RT-qPCR) Preparation of lysates osteosarcoma (OS) cells from each group was undertaken prior to extraction of total RNA using a modified TRIzol method (Invitrogen, 15596026). We used a NanoDrop 2000 spectrophotometer produced by Thermo Scientific to measure the concentration and purity of RNA, and the purity of the 28S/18S rRNA bands was confirmed by running them through a 1% agarose gel and using electric current to separate them. RNA samples that satisfied the established quality criteria (total amount ≥ 1 µg) were then subjected to cDNA was synthesized using HiScript® III RT SuperMix (Vazyme, R323-01), which also removes gDNA in the meantime, resulting in the generation of a 20 µL reaction mixture. The ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711-02) was utilized for quantitative PCR.This was in a 20 µL reaction system. The system used was a StepOnePlus real-time PCR system (Applied Biosystems). We got the cycle threshold (Ct) values during the exponential phase, and we used StepOne Software v2.3 to get them. We then calculated relative expression levels target genes use something called 2^-ΔΔCt and made them normal to something called GAPDH, which is like an internal reference. LV and ADV transfection The construction of the miR-875-3p/SLC39A14 knockdown lentivirus involved the initial utilisation of the PEI transfection method for viral packaging. First, we seeded the HEK293T cells in DMEM and then we let them grow at 37°C with 5% CO₂ until they were 70–80% full. The preparation of the DNA mixture involved the mixing of the target plasmids (10 µg) and the packaging plasmids (psPAX2:pMD2.G at a ratio of 3:1, totalling 10 µg) in 500 µL of serum-free DMEM.Addition PEI (1 mg/mL) DNA:PEI ratio 1:3, followed by vortexing, incubation normal temperature 15 min, resulted in formation of transfection complexes. Subsequently, the transfection complexes were introduced to HEK293T cells in DMEM. Following a 6 h incubation period,culture medium was replaced with DMEM supplemented with 10% fetal bovine serum. Supernatants were collected 48 and 72 hours after transfection, then filtered using a 0.45 µm filter.and subjected to brief centrifugation at 70,000 × g at 4°C. Viral pellets located at the base of the tube were resuspended in DMEM containing 10% FBS, thus preparing viral working solutions. The exponentially growing H143B cells were subjected to trypsin digestion, neutralisation, and resuspension prior to seeding. The cells were then infected with the prepared lentivirus. 72 h after infection, the level of infection was evaluated using a microscope that uses light to reveal hidden structures, and the proportion of positive cells was used to judge the success of the infection for the following experiments. Cell counting kit-8 (CCK-8) assay During the exponential growth phase of cells, we treated them with 0.25% trypsin at 37°C for 1.5 to 2 min. Process of digestion was brought to a conclusion by the addition of 2 mL of pre-warmed complete medium containing 10% fetal bovine serum, which occurred when cell edges began to shrink visibly. The cells were then detached from their substrate by means of gentle pipetting, a process which was repeated 30 times using a 1 mL pipette tip that had been sterilised in accordance with the relevant protocols. This process was carried out with the utmost care to avoid the formation of bubbles, thereby ensuring the integrity of the cells and their subsequent viability. A 200-mesh cell strainer was used to filter the resulting cell suspension, and cell density was adjusted to 5 × 10³ cells/mL using an automated cell counter. Each well of PLL-96WP was seeded 100 µL the cell suspension. The plates were subjected to a low-speed shaking process for a duration of 5 min, with the objective of ensuring uniform cell distribution. Thereafter, the plates were placed into a 37°C/5% CO₂ incubator and humidity level of 5%, in the presence of 5% CO₂. The incubation process was continued for a period of 24 h. The efficacy of cell attachment was subsequently evaluated through the utilisation of an inverted phase-contrast microscope, with the requirement for > 90% adherence being met. On the next day, 10 µL of CCK-8 solution was added to each well using a special tool that can pipette very small amounts, cells were then incubated period of 3 h. Absorbance measurements will taken 0, 24, 48, 72, and 96 h by microplate reader. The wells containing medium and CCK-8 without cells were used as blank controls, using untreated cells on negative controls. Dual-wavelength detection process was conducted at a primary at 450/630 nm. Each group was assayed in six replicates, and readings were averaged over three independent experiments. Y is the measured response, X is the independent variable, and A is the baseline.Growth kinetics over time were analysed by fitting sigmoid curves to the data. Transwell assay Employing Matrigel (Corning, NY, USA). The Matrigel was subjected to a process of thawing, dilution, and centrifugation at 2,000 rpm, 30 s ,with objective of ensuring the homogeneity of the mixture. 60 µL of the diluted Matrigel added to the centre polycarbonate membrane in each Transwell insert. This was then spread evenly with a sterile cell scraper to form a uniform gel layer of approximately 6 mm in diameter. Subsequently, by placing the inserts at 37°C within a controlled environment containing 5% CO₂ and a humidity level of 95% for a duration of 3.5 h. This step was undertaken to facilitate the process of gel polymerisation. Subsequently, 200 µL of pre-warmed serum-free medium was added to the upper chamber,Prior to the assay, inserts were hydrated for 1 h in the incubator after the addition of 600 µL of medium to the lower chamber. Rapidly propagating H143B cells were treated with 0.25% trypsin-EDTA solution at 37°C for 2 minutes and 15 seconds to separate them. To stop the action of this enzyme, we added complete growth medium containing 10% fetal bovine serum. Next, the cell mixture was filtered through a 40 µm nylon mesh to obtain a uniform single cell population. We then carefully added 200 µL of the cell suspension to the Matrigel layer in the upper compartment. After allowing the cells to stand for 10 minutes, 600 µL of complete medium containing 20% fetal bovine serum (FBS) was added to the lower compartment. with the purpose of serving as a chemoattractant. The inserts were then subjected to an incubation period in a humidified incubator, with a relative humidity level of greater than 95%, for a duration of 48 h. Subsequent to the conclusion of the incubation period, residual medium on upper chamber was meticulously removed, the inserts were immersed in pre-chilled PBS (4°C).Cells treated with a modified cross-fixation method, comprising an initial fixation step with 4% paraformaldehyde (pH 7.4, pre-chilled at 4°C ,15 min) This was followed by a subsequent fixation step with fresh fixative at room temperature for a period of 10 min. This approach was adopted to ensure the preservation of cell morphology in deeper layers. Fixed inserts were washed with Phosphate Buffered Saline (PBS), permeabilized with 0.1% Triton X-100 for a period of 8 min, and stained with 0.01% crystal violet solution for a further 25 min in dark. In order to reduce background interference,The inserts underwent dehydration in 70%, 95%, and 100% ethanol (2 min per step) with subsequent air-drying overnight (12 h) under a laminar flow hood.Following image acquisition (20×), migrated/invaded cells were quantified (ImageJ). wound healing assay Stable H143B cells expressing the target gene were routinely cultured and washed, then synchronized in the G0/G1 phase. For scratch preparation, use sterile 200 µL pipette tip (Axygen, T-200) under inverted microscope. The tip was advanced perpendicularly to the dish bottom at 0.5 mm/s along straightedge to create a linear scratch with a width of 800 ± 50 µm. The plate was then tilted at a 45° angle, and pre-chilled PBS (4°C) was gently flushed along the scratch at a rate of 2 mL/min in three sequential washes. After initial processing, five fixed observation points were selected under an inverted fluorescence microscope (Nikon, Eclipse Ti2). Images were captured continuously over 72 h using a 10× objective and the NIS-Elements AR 5.11 imaging system, with both bright-field and fluorescence channels acquired automatically every 6 h. Image analysis was performed using ImageJ 1.53t software. Scratch edges were measured at each time point using the “Straight line” tool, and the cell migration area was binarized with the “Threshold” algorithm. Malondialdehyde (MDA) assay Levels of malondialdehyde (MDA), a quantitative biomarker of ferroptosis, the measurement of the parameters was conducted as per manufacturer's protocol, employing commercial MDA assay kit (Jiancheng Bioengineering, China).The transfected cells amalgamated with the kit reagents in order to prepare the reaction solution. Subsequent to the conclusion of the reaction, the sample tubes were placed in an ice-water bath for a period of 10 min, with the objective of terminating the reaction. The samples were then centrifuged at 3,500 × g, 10 min, a duration of 15 min, with the purpose of separating precipitates. The analysis of the sample was conducted using a pre-warmed BioTek Synergy H1 multifunctional microplate reader, with the measurement of the sample's extinction coefficient at 532 nm ( the primary wavelength) and 593 nm (the reference wavelength) undertaken under automatic path-length correction mode. A standard curve was generated using MDA a series of standard solutions (0 to 20 µM), processed in parallel, and fitted using a four-parameter logistic model. The calculation of sample MDA concentrations was performed by incorporating the dilution factor (1:3) and the reaction volume correction coefficient (200 µL/150 µL). Each sample was measured in triplicate, and background correction was performed using blank controls containing only lysis buffer. The acquisition and processing of data was conducted using SoftMax Pro 7.0 software, and mean values were reported for each sample. Reactive oxygen species (ROS) assay We measured ROS levels with a commercial kit (C1300, Solarbio).The cells were collected and prepared as a single-cell suspension. Following centrifugation at 3,500 rpm (~ 2,200 × g), the cell pellet was resuspended in a pre-prepared DCFH-DA probe working solution (Sigma-Aldrich, D6883) at 1 × 10^6 cells/mL for 30 min. The cells were then subjected to a second round of centrifugation, after which the cell pellet was resuspended to yield a final cell suspension. Images were acquired on an Olympus IX83 inverted fluorescence microscope, equipped with a U-FBNA the filter set utilised in this experiment exhibited (excitation/emission: 488 nm/525 nm)and a 20× phase-contrast objective (NA 0.45). The exposure time was set to 300 millis, ensuring consistent conditions for the acquisition of light. Five random fields per sample were imaged, and the resulting images were stored in 16-bit TIFF format. Subsequently, the intensity of the fluorescence was measured and evaluated using ImageJ (v1.53t; NIH), with the mean integrated density per area used as the quantitative metric. Glutathione (GSH) / glutathione disulfide (GSSG) assay The levels of glutathione (GSH) and oxidized glutathione (GSSG) used a kit purchased by Nanjing Jiancheng Bioengineering Institute to measure the total amount of reduced and oxidized glutathione. When making the standard curve, prepare the GSH and GSSG solutions inside according to the instructions. Cell samples must be first broken up with a liquid containing 0.1% Triton X-100, and then centrifuged to collect the supernatant for testing. The working solution was prepared in strict accordance with the prescribed instructions, following which absorbance was measured at 412 nm. The desired outcome was accomplished through the utilisation of a microplate reader, with measurements being obtained at 30 s and 10 min and 30 s. Subsequently, a GSH standard curve (0-100 µM) was generated. The total glutathion (GSH) and glutathion disulfide (GSSG) contents were calculated using the standard curve method, and the resulting GSH/GSSG ratios were subsequently calculated. Ferrous iron (Fe 2+ ) level assay We used the iron ion detection kit (Elabscience, Wuhan, China) to measure the concentration of ferrous ions in the cells. The transfected cells were then placed on ice to crush, and the resulting solution was centrifuged at 15,000 rpm for 15 minutes. Finally, carefully transfer the supernatant into a new tube, thus avoiding contact with any residual cell debris. Subsequent to the execution of the reaction procedure stipulated by the kit, the degree of light absorption was measured at a wavelength of 593 nm, employing a pre-warmed microplate reader that had been preheated for a duration of 30 min and possessed a wavelength calibration error of no more than 2 nm. Data are presented as the mean of triplicate assays. We made a calibration chart using ferrous sulfate heptahydrate (FeSO·7H O) solution, with solution concentrations ranging from 0 to 50 µM, dissolved in 0.1 M HCl to prevent oxidation. The standard curve was derived from triplicate measurements using a four-parameter logistic model (R² >0.99). Fe²⁺ concentrations in samples were calculated by applying the absorbance values, after blank subtraction, to the standard curve equation. Construction of the cell-line-derived tumor xenograft (CDTX) model The xenograft osteosarcoma model was established in nude mice using the CDTX approach. After transfection, H143B cells (ATCC, CRL-8303) were dispersed into a single cell suspension. We then injected this suspension subcutaneously into the left tibia of 36 four-week-old female BALB/c-nu mice purchased from Vital River in Beijing (SCXK2021 -0006).Subsequent to injection, the mice were observed on a daily basis for any general health concerns and local reactions at the injection site. Mice were humanely euthanized when tumor diameter reached 18 mm to comply with animal ethical regulations. Magnetic resonance imaging (MRI) Following the establishment of the murine osteosarcoma (OS) model, mice were anesthetized with isoflurane and placed in a supine position on a customized MRI animal bed (Bruker, T10220) for magnetic resonance imaging (MRI). Acquired data were exported as DICOM files and imported into the PACS system (RadiAnt, version 4.6.9) for three-dimensional reconstruction. 3D Slicer software (version 5.0.3) was used to generate a three-dimensional tumor model via Poisson surface reconstruction. Tumor volumes were calculated using voxel accumulation (V = Σ(voxel volume × mask value)) and visualized with Blender software (version 2.93) for three-dimensional rendering. Nude mice were euthanized by overdose of inhalational anesthesia. Nude mice were euthanized using a rodent-specific euthanasia system (VetEquip, 901806). 24 h prior to the procedure, mice were transferred to individual quiet cages (Tecniplast, GM500) to minimize stress, with the environment maintained at 24 ± 1°C and 55 ± 5% humidity. After euthanasia, carcasses were surface-disinfected with 10% formalin (China National Pharmaceutical, 10010018), placed in biohazard bags (Whirl-Pak, B01342), and stored at − 80°C (Thermo, 902-UP) for 24 h before transfer to a licensed medical waste disposal facility. Statistical analysis Values are expressed as mean minus standard deviation (mean ± SD). Comparisons between groups were analyzed using Student's t-test, and results with p values less than 0.05 were considered statistically significant. The relationship between microRNA and mRNA expression levels was measured using Spearman's correlation coefficient, calculated using R software. Results Extraction and identification of exosomes The extraction of exosomal material was conducted from the osteosarcoma clinical samples that had been collected. Using TEM, the morphological characteristics of the vesicles were observed at a scale of 200 nm, showing a “double-layered disc-shaped” structure, consistent with typical exosome characteristics ( Fig. 2. A) . Further analysis via Western blot (WB) revealed that the exosome marker proteins HSP70 and TSG101 exhibited high levels of expression was detected in the exosome lysate, but the cytoplasmic marker calnexin was low. ( Fig. 2. B) , further confirming the exosome nature of the extracted vesicles. Identification and validation of miR-875-3p as the critical regulatory factor in Osteosarcoma Based on exosome microarray differential analysis ( Fig. 2C ) , The results showed that the level of miRNA-875- 3p in exosomes isolated from osteosarcoma tumors was significantly higher than that in nearby healthy tissues. Further RT-qPCR testing confirmed that the expression of miR-875- 3p in osteosarcoma cell line H143B was much higher than that in normal osteoblasts. ( Fig. 2D ) . Furthermore, RT-qPCR of paired osteosarcoma and non-tumorous tissues from patients revealed that the expression level of miRNA-875-3p was significantly higher in osteosarcoma tissue than in adjacent non-cancerous tissue. ( Fig. 2E ) , indicating that miRNA-875-3p can be considered a key regulatory factor in osteosarcoma. Identification and validation of SLC39A14 as a downstream target of miR-875-3p The identification of the targets of miRNA-875-3p was facilitated by the utilisation of the miRDB database, which was employed to predict downstream messenger ribonucleic acids (mRNAs) based on target score rankings. Among the array of candidate mRNAs, SLC39A14 was distinguished as the pivotal mRNA. ( Fig. 3A ) .Further dual-luciferase assays revealed the binding site of miRNA-875-3p, thereby demonstrating that the fluorescence levels of has-miRNA-875-3p + SLC39A14-wt were significantly reduced in comparison to the mutant group and the control group (P < 0.0001). This finding indicates a direct binding effect between the two. ( Fig. 3B ) . Subsequently, RT-qPCR analysis of five Osteosarcoma cell lines and osteoblasts showed that SLC39A14 was significantly downregulated in Osteosarcoma ( Fig. 3C ) . Similarly, RT-qPCR results from Osteosarcoma tissue and its matched adjacent non-cancerous tissue also indicated that SLC39A14 expression levels were significantly lower in Osteosarcoma tissue than in adjacent non-cancerous tissue ( Fig. 3D ) . Transfection and verification of the miR-875-3p/SLC39A14 axis Using lentivirus (LV) and adenovirus (ADV) transfection, we knocked down miR-875-3p/SLC39A14 in H143B cells and validated the significant transfection effect via RT-qPCR: Group II showed significantly lower miR-875-3p expression compared to Group I (NC), and Group IV showed significantly lower SLC39A14 expression compared to Group III (NC). To further validate the regulatory role of miR-875-3p on SLC39A14, SLC39A14 expression was detected in the miR-875-3p knockdown and corresponding NC groups. via RT-qPCR. SLC39A14 expression was found to correlate negatively with miR-875-3p, thereby confirming an expression regulatory relationship between the two. ( Fig. 4. A-C) . Table 1 List of primer sequences. Gene Name Primer Primer Sequence (5'→3') GAPDH-F Forward primer AATCAAGTGGGGCGATGCTG GAPDH-R Reversed primer GCAAATGAGCCCCAGCCTTC GPX4-F Forward primer AGGACATCGACGGGCACAT GPX4-R Reversed primer GTTACTCCCTGGCTCCTGCTTC ACSL4-F Forward primer TTGGCTACTTGCCTTTGGCTC ACSL4-R Reversed primer CGGAACAGCAGCCATAAGTGT XCT-F Forward primer GGGTCCTGTCACTATTTGGAGC XCT-R Reversed primer AGGAGTTCCACCCAGACTCG miR-875-3p-F Forward primer CTACACCTACCACTGTGTCTGC miR-875-3p-R Reversed primer AAGCCATGGGAGGATTAGCTG SLC39A14-F Forward primer CCAGCCAAATGGAAATCAGGATG SLC39A14-R Reversed primer TGGGCGGTGTAGAATCAGAGT Effects of miR-875-3p/SLC39A14 Expression on the Proliferation, Invasion, and Migration of Osteosarcoma Cells in Vitro The in vitro viability of osteosarcoma cells was used CCK-8 assay. Demonstrated that the depletion of miRNA-875-3p led to a substantial decline in osteosarcoma cell viability. Group II showed significantly lower cell survival compared to Group I. ( Fig. 4D ) . The results of the scratch assay indicated a statistically significant difference in the wound healing rates between Group II (33.21%) and Group I (45.20%). ( Fig. 4E ) . In the Transwell assay, a statistically significant decrease in the number of invasive cells was observed in Group II compared to Group I. In summary, the findings indicate that the suppression of miR-875-3p impedes the invasive, migratory and proliferative capabilities of osteosarcoma cells. ( Fig. 6E–F ) . The CCK-8 assay in the SLC39A14 knockdown experiment showed that cell viability was higher in the IV group than in the III group, indicating that knockdown of SLC39A14 promoted osteosarcoma cell viability. The scratch assay revealed that the cell healing rates of Groups IV and III were 59.95% and 45.90%, respectively. These results suggest that knocking down SLC39A14 enhances the migration capability of osteosarcoma cells, as the migration and proliferation capabilities of cells in Group IV were higher than those in Group III. In the Transwell assay, the number of cells that migrated through the membrane was also higher in Group IV than in Group III. These results consistently suggest that knocking down SLC39A14 enhances the invasion, migration and proliferation capabilities of osteosarcoma cells. ( Fig. 6. E–F) . Effects of the miR-875-3p/SLC39A14 axis on ferroptosis in vitro experiments This study wanted to see what role miRNA-875- 3p plays in iron death in osteosarcoma and identify related iron death biomarkers. Laboratory analysis found that the concentration of Fe² in Group II was higher than that in Group I. Moreover, Group II has a lower GSH/GSSG ratio than Group I. When detecting reactive oxygen species (ROS), Group II had stronger fluorescence intensity and higher malondialdehyde (MDA) levels than Group I, indicating increased oxidative stress. Using reverse transcription quantitative polymerase chain reaction (RT-qPCR), we measured the expression of several messenger RNAs (mRNA) associated with iron death. The results showed that GPX4 and xCT were expressed less in Group II than in Group I, but ACSL4 was expressed more. Later, Western blot experiments verified these results at the protein level, confirming that Group II's GPX4 and xCT did decrease, while ACSL4 increased. ( Fig. 5. A–E ). Further evaluation of the role of SLC39A14 in ferroptosis revealed that Fe²⁺ levels were lower in Group IV than in Group III. The GSH/GSSG ratio was found to be higher in Group IV than in Group III. In the context of ROS detection, Group IV exhibited a fluorescence intensity that was weaker in comparison to Group III. Concurrently, Group IV demonstrated reduced levels of MDA, thereby indicating a potential decline in oxidative stress levels. RT-qPCR was utilised to detect the expression levels of multiple ferroptosis-related mRNAs in vitro. The results demonstrated that, in comparison with Group III, the expression levels of GPX4 and xCT were elevated in Group IV, while the expression level of ACSL4 was reduced. Western blot (WB) analysis further confirmed that at the protein level, the expression of GPX4 and xCT was higher in Group IV than in Group III, while the expression of ACSL4 was lower in Group IV than in Group III ( Fig. 6. A–E) . The results of miR-875-3p inhibits the ferroptosis process in osteosarcoma cells by targeting SLC39A14. Effects of miR-875-3p/SLC39A14 expression on osteosarcoma cell proliferation and migration in vivo MRI scans were performed, and maximum cross-sectional the area of osteosarcoma was measured 3 weeks after inoculation of osteosarcoma cells into nude mice. The results demonstrated that the average area of osteosarcoma in Group II was 4.23 cm², significantly lower than the average volume of 6.93 cm² in Group I; the average volume of osteosarcoma in Group IV was 12.82 cm², significantly higher than the average volume of 6.96 cm² in Group III ( Fig. 6A ) . Effects of the miR-875-3p/SLC39A14 axis on the ferroptosis mechanism in osteosarcoma in vivo experiments RT-qPCR and Western blot analysis used to detect the expression levels of ferroptosis-related mRNAs and proteins in tissues collected from osteosarcoma patients. The results demonstrated that, in comparison with Group I, the expression levels of GPX4 and xCT were diminished in Group II, whilst the expression level of ACSL4 was augmented. This suggests that the suppression of miR-875-3p facilitates the process of ferroptosis. In addition, the comparative analysis of Groups III and IV revealed that the expression levels of GPX4 and xCT were elevated in Group IV compared to Group III. Conversely, the expression level of ACSL4 was diminished in Group IV relative to Group III. ( Fig. 6. B-C) . Discussion Osteosarcoma has been identified as a common primary malignant bone tumour, which accounts for a certain proportion of clinical bone tumor occurrences. Meanwhile, due to its high disability rate and poor prognosis, targeted therapy for osteosarcoma has always been a research focus. Exosomes are tiny intercellular vesicles synthesized by cancer cells. They carry miRNAs and a variety of proteins and are secreted into the extracellular microenvironment, participate in the formation of a pro-cancer growth environment, and promote tumor development. It has been proven that exosomes play a key role in migration, invasion, and cellular activities of other types of tumors: for example, the present study hypothesises that exosomal factors may contribute to a reduction in the sensitivity of lung adenocarcinoma to ferroptosis.[ 22 ]; tumor-derived exosomes induce the process of M2 polarization of macrophages critically promotes liver metastasis in colorectal cancer cases.[ 23 ]; exosomes regulate the proliferation and apoptosis of osteosarcoma, facilitate intercellular communication among osteosarcoma cells, and assist in the metastasis of osteosarcoma, are new target for targeted therapy[ 24 – 26 ].Classified as small single-stranded RNAs, they carried by exosomes, accumulating evidence implicates miRNAs in osteosarcoma development.The miR-875-3p/PF4V1 axis can inhibit the proliferation and migration of osteosarcoma cell lines[ 11 ], and the LncRNA SNHG3/miRNA-151a-3p/RAB22A axis can regulate The present study will examine the invasion and migration of osteosarcoma[ 27 ].miRNA-133b exhibits osteosarcoma-inhibiting activity[ 28 ]. Based on the above studies, exosome-mediated miRNAs have great potential in the targeted therapy of osteosarcoma. This experiment involved sequencing the exosomes of clinically collected osteosarcoma tissues.The expression of miR-875-3p differed significantly between cancerous and adjacent non-cancerous tissues.The expression of miR-875-3p was determined by RT-qPCR and Western blot in osteosarcoma tissues, revealing that its expression was upregulated. We hypothesise miR-875-3p is positive role in promoting osteosarcoma development. Since microRNAs (miRNAs) mainly exert their functions at the post-transcriptional level, they affect the corresponding protein levels through complementarity with the sequences of their target messenger RNAs (mRNAs). Through the miRDB database, SLC39A14, the downstream target molecule of miR-875-3p, was further screened out.As an intracellular zinc and metal ion transporter, SLC39A14 is associated with the development of various tumors. Existing literature suggests that it can promote the proliferation of gliomas[ 29 ]; in hepatocellular carcinoma, the down-regulation of SLC39A14 expression protects hepatocellular carcinoma from the tumor-suppressive effect of zinc [ 30 ]; the decreased expression of SLC39A14 promotes aggressive progression of prostate cancer.[ 31 ]. However, there are relatively few studies on the role of SLC39A14 in osteosarcoma. Based on the promoting effect of high levels of miR-875-3p on the development of osteosarcoma and the promoting effect of low levels of SLC39A14 on tumor development, we hypothesize that there may be a negative regulatory relationship between miR-875-3p and SLC39A14, and they jointly promote the development of osteosarcoma.The Dual-Luciferase assay confirmed the direct targeting of SLC39A14 by miR-875-3p. demonstrated that this gene is a direct target of microRNA-875-3p. Further analysis of the expression levels of miR-875-3p and SLC39A14 in tissues revealed a negative correlation between the levels of miR-875-3p and SLC39A14 in osteosarcoma tissues. Moreover, high levels of miR-875-3p were observed to be concomitant with low mRNA and protein levels of SLC39A14. Supports that miR-875-3p promotes osteosarcoma growth and spread by reducing SLC39A14 levels. The present study was predicated on the findings of transfection experiments. In order to study the role of the miR-875- 3p/SLC39A14 pathway in the invasion and migration of osteosarcoma cells, we conducted a series of experiments in the laboratory and in vivo. The results of the wound healing experiment showed that cell scratches healed more slowly in the group with reduced miR-875- 3p than in the untreated group. This suggests that reducing the level of miR-875- 3p can hinder cell movement, thereby slowing tumor development.The experimental group, which exhibited SLC39A14 knockdown, demonstrated a superior healing rate in comparison to the control group, thereby suggesting that SLC39A14 suppression may facilitate tumour progression. In the CCK-8 experiment, the miR-875-3p knockdown group had lower cell viability, while the SLC39A14 knockdown group had higher cell viability. In the nude mouse model, the tumour volume in the group exhibiting low levels of miR-875-3p expression was found to be diminished, and the growth of osteosarcoma was inhibited; the volume of the neoplasm in the group with low SLC39A14 expression was larger, and tumor growth was promoted. According to the experimental results, we believe that exosome-mediated miR-875-3p modulates osteosarcoma proliferation and migration by regulating SLC39A14 expression/activity. The specific mechanism by which the miR-875-3p/SLC39A14 axis acts on osteosarcoma has not been reported yet. However, in studies on other tumors, it has been found that knocking out SLC39A14 can promote ferritin deposition and inhibit the progression of gliomas[ 29 ];expression levels of SLC39A14 is a prognostic factor in ESCC. [ 32 ]; mesenchymal hepatocytes prevent SLC39A14-dependent ferroptosis in hepatocytes through exosomal miR-16-5p[ 33 ], and mesenchymal hepatocytes also alleviate ferroptosis in hepatocytes through exosome-transferred miR-1275[ 34 ]. These findings suggest that the miR-875-3p/SLC39A14 axis may exert its effect on osteosarcoma by regulating ferroptosis in osteosarcoma cells.Ferroptosis is an emerging research focus in cell apoptosis, and its main mechanisms include glutathione (GSH) imbalance, imbalances in iron homeostasis and elevated ROS levels. The mechanism of GSH imbalance, glutathione peroxidase 4 (GPX4) plays an important role. With GSH as a substrate, GPX4 converts cytotoxic peroxides into non-toxic hydroxyl groups, protecting cell membranes from the attack of peroxides, maintaining normal physiological functions, and thereby inhibiting ferroptosis in cancer cells[ 35 ]. Iron metabolism disorder is one of the mechanisms of ferroptosis[ 36 , 37 ], mainly manifested as iron accumulation.Iron is a double-edged sword, being essential for physiology but cytotoxic in excess. The accumulation of ROS is also one of the mechanisms of ferroptosis. GPX4/GSH depletion triggers ROS accumulation. ROS accumulated intracellularly can damage cell membranes and induce cell apoptosis[ 38 ]. Based on the above mechanisms of ferroptosis, we specifically detected the intracellular ROS levels, Fe²⁺/Fe³⁺ levels, and GSH/GSSG levels in each transfection group. In addition, this study also determined the expression levels of typical ferroptosis biomarkers, including acyl-CoA synthetase 4 (ACSL4), cystine/glutamate antiporter (xCT), and GPX4, to evaluate the level of intracellular ferroptosis. Research indicates that ACSL4 expression is modulated by miRNAs delivered via exosomes. For example, in lung cancer, exosomes can transfer miR-424 into cells, thereby down-regulating the expression of ACSL4 and inhibiting ferroptosis [ 39 ]; cancer-associated fibroblasts eliminate the inhibitory effect of ACSL4 on ferroptosis in pancreatic cancer cells by secreting exosomal miRNAs[ 40 ]. Studies confirm that the ferroptosis-related protein xCT (SLC7A11) is post-transcriptionally regulated by miRNAs delivered via exosomes, a process essential for preserving the intracellular redox balance. For example, microRNAs encoded by Kaposi's sarcoma-associated herpesvirus (KSHV) up-regulate xCT, improving the resistance of KSHV to the oxidative stress environment [ 41 ]. Findings from this study revealed that ​suppressed miR-875-3p expression promotes​ferroptosis, leading to the ​inhibition​of osteosarcoma proliferation and migration. ​In contrast, ​low levels of SLC39A14 antagonize​ferroptosis, thereby enhancing​tumor proliferation. This study demonstrates several methodological and design strengths. Firstly, the CDTX model was employed for in vivo investigations, offering a closer simulation of physiological environments and thereby thereby improving the clinical translatability of the results. Secondly, exosomes isolated directly from osteosarcoma tissues were subjected to sequencing. Tissue-derived exosomes capture the tumor microenvironment’s composition more precisely than serum exosomes, allowing a clearer exploration of intercellular communication within the tumor niche and its impact on proximate cells. Furthermore, through downregulation of miR-875-3p and SLC39A14, this research systematically examined several potential pathways involved in ferroptosis, thus establishing the miR-875-3p/SLC39A14 axis as a key regulator of this cell death process. However, several limitations should be considered.The sample size across experimental groups was limited, he consequences of upregulating miR-875-3p or SLC39A14 in osteosarcoma remain uninvestigated. Additionally, functional rescue assays were not performed, leaving validations for these interactions dependent on future research. Crucially, as the experiments were not replicated in human models, the applicability of these results to human osteosarcoma remains undetermined. Thus, further investigation is essential to elucidate the mechanistic relationships among miRNAs, ferroptosis, and osteosarcoma progression. Conclusion In conclusion, through the study of miR-875-3p, combining multiple levels including clinical, cellular, and animal experiments, this paper found that under the mediation of exosomes, miR-875-3p plays a positive role in the treatment of osteosarcoma, and inhibiting its expression can inhibit tumor proliferation and migration. It also revealed that SLC39A14 may be a key factor for it to exert its function. At the same time, it further explored that the physiological role of the miR-875-3p/SLC39A14 axis may depend on inhibiting ferroptosis in osteosarcoma cells, providing new biological therapeutics and targets for the clinical targeted therapy of osteosarcoma, and providing positive value for subsequent research. It is a meaningful step towards ultimately improving the cure rate of osteosarcoma, improving the prognosis of patients, and alleviating the suffering of patients. Abbreviations English Abbreviation Full Form in English OS osteosarcoma NTA Nanoparticle Tracking Analysis RT-qPCR Reverse Transcription-quantitative Polymerase Chain Reaction CCK-8 Cell Counting Kit-8 ROS Reactive Oxygen Species MDA Malondialdehyde WB Western Blot TEM Transmission electron microscopy MRI Magnetic Resonance Imaging miRDB micro-RNA Database HE Hematoxylin-eosin CDTX Construction of the cell-line-derived tumor xenograft PUFA Polyunsaturated fatty acids Declarations Ethics approval and consent to participate This study was approved by the Ethics Committee of Guangxi Medical University, and all procedures were conducted in accordance with the Declaration of Helsinki and China's Measures for the Ethical Review of Biomedical Research Involving Humans. Consent for publication Not applicable Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that the research was conducted in the absence of anycommercial or financial relationships that could be construed as a potentialconflict of interest. Funding This work was supported by the Guangxi Natural Science Foundation (Grant No. 2024GXNSFAA010400) Authors' Contributions J.H., J.H. and L.L. contributed equally to this work. J.H. designed the study and analyzed the data. J.H. performed the majority of the experiments. L.L. conducted data curation and formal analysis. K.Z., S.W. and J.C. provided critical reagents and technical assistance. Y.D., Z.Y. and C.S. participated in animal model preparation. M.J. and Z.B. supervised the project, acquired funding, and are co-corresponding authors. All authors read and approved the final manuscript. Acknowledgments Not applicable. References Bielack SS, Kempf-Bielack B, Delling G, Exner GU, Flege S, Helmke K, et al. Prognostic factors in high-grade osteosarcoma of the extremities or trunk: an analysis of 1,702 patients treated on neoadjuvant cooperative osteosarcoma study group protocols. J Clin Oncol. 2002;20(3):776–90. Marko TA, Diessner BJ, Spector LG. Prevalence of Metastasis at Diagnosis of Osteosarcoma: An International Comparison. Pediatr Blood Cancer. 2016;63(6):1006–11. Anderson ME. Update on Survival in Osteosarcoma. Orthop Clin North Am. 2016;47(1):283–92. Song XJ, Bi MC, Zhu QS, Liu XL. The emerging role of lncRNAs in the regulation of osteosarcoma stem cells. Eur Rev Med Pharmacol Sci. 2022;26(3):966–74. Li S, Zhang H, Liu J, Shang G. Targeted therapy for osteosarcoma: a review. J Cancer Res Clin Oncol. 2023;149(9):6785–97. Albarran V, Villamayor ML, Chamorro J, Rosero DI, Pozas J, San Roman M et al. Receptor Tyrosine Kinase Inhibitors for the Treatment of Recurrent and Unresectable Bone Sarcomas. Int J Mol Sci. 2022;23(22). Ng AJ, Mutsaers AJ, Baker EK, Walkley CR. Genetically engineered mouse models and human osteosarcoma. Clin Sarcoma Res. 2012;2(1):19. Zhu J, Feng Y, Ke Z, Yang Z, Zhou J, Huang X, et al. Down-regulation of miR-183 promotes migration and invasion of osteosarcoma by targeting Ezrin. Am J Pathol. 2012;180(6):2440–51. Li SS, Zhu HJ, Li JY, Tian LM, Lv DM. MiRNA-875-3p alleviates the progression of colorectal cancer via negatively regulating PLK1 level. Eur Rev Med Pharmacol Sci. 2020;24(3):1126–33. Tong JL, Wang LL, Ling XF, Wang MX, Cao W, Liu YY. MiR-875 can regulate the proliferation and apoptosis of non-small cell lung cancer cells via targeting SOCS2. Eur Rev Med Pharmacol Sci. 2019;23(12):5235–41. Zhang Z, Zhou L, Zhou S, Li X. Circular RNA hsa_circ_0069117 suppresses proliferation and migration of osteosarcoma cells lines via miR-875-3p/PF4V1 axis. J Orthop Surg Res. 2022;17(1):37. Liu W, Long Q, Zhang W, Zeng D, Hu B, Liu S, et al. miRNA-221-3p derived from M2-polarized tumor-associated macrophage exosomes aggravates the growth and metastasis of osteosarcoma through SOCS3/JAK2/STAT3 axis. Aging. 2021;13(15):19760–75. Raimondi L, De Luca A, Gallo A, Costa V, Russelli G, Cuscino N, et al. Osteosarcoma cell-derived exosomes affect tumor microenvironment by specific packaging of microRNAs. Carcinogenesis. 2020;41(5):666–77. Ye Z, Zheng Z, Peng L. MicroRNA profiling of serum exosomes in patients with osteosarcoma by high-throughput sequencing. J Investig Med. 2020;68(4):893–901. Wang JW, Wu XF, Gu XJ, Jiang XH. Exosomal miR-1228 From Cancer-Associated Fibroblasts Promotes Cell Migration and Invasion of Osteosarcoma by Directly Targeting SCAI. Oncol Res. 2019;27(9):979–86. Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012;149(5):1060–72. D'Arcy MS. Cell death: a review of the major forms of apoptosis, necrosis and autophagy. Cell Biol Int. 2019;43(6):582–92. Cao JY, Dixon SJ. Mechanisms of ferroptosis. Cell Mol Life Sci. 2016;73(11–12):2195–209. Seibt TM, Proneth B, Conrad M. Role of GPX4 in ferroptosis and its pharmacological implication. Free Radic Biol Med. 2019;133:144–52. Yan YZ, Yuan L, Li WX, Li S, Bian JC, Wang GD. Research progress on the mechanism of ferroptosis in osteosarcoma. Zhongguo Yi Shi Za Zhi. 2024;26(1):142–6. Ru Q, Li Y, Chen L, Wu Y, Min J, Wang F. Iron homeostasis and ferroptosis in human diseases: mechanisms and therapeutic prospects. Signal Transduct Target Ther. 2024;9(1):271. Zhang X, Xu Y, Ma L, Yu K, Niu Y, Xu X, et al. Essential roles of exosome and circRNA_101093 on ferroptosis desensitization in lung adenocarcinoma. Cancer Commun (Lond). 2022;42(4):287–313. Zhao S, Mi Y, Guan B, Zheng B, Wei P, Gu Y, et al. Tumor-derived exosomal miR-934 induces macrophage M2 polarization to promote liver metastasis of colorectal cancer. J Hematol Oncol. 2020;13(1):156. Sha L, Ma D, Chen C. Exosome-mediated Hic-5 regulates proliferation and apoptosis of osteosarcoma via Wnt/beta-catenin signal pathway. Aging. 2020;12(23):23598–608. Sarhadi VK, Daddali R, Seppanen-Kaijansinkko R. Mesenchymal Stem Cells and Extracellular Vesicles in Osteosarcoma Pathogenesis and Therapy. Int J Mol Sci. 2021;22(20). Wu SC, Kim A, Gu Y, Martinez DI, Zocchi L, Chen CC, et al. UHRF1 overexpression promotes osteosarcoma metastasis through altered exosome production and AMPK/SEMA3E suppression. Oncogenesis. 2022;11(1):51. Zheng S, Jiang F, Ge D, Tang J, Chen H, Yang J, et al. LncRNA SNHG3/miRNA-151a-3p/RAB22A axis regulates invasion and migration of osteosarcoma. Biomed Pharmacother. 2019;112:108695. Gao G, Tian Z, Zhu HY, Ouyang XY. miRNA-133b targets FGFR1 and presents multiple tumor suppressor activities in osteosarcoma. Cancer Cell Int. 2018;18:210. Zhang Y, Wu X, Zhu J, Lu R, Ouyang Y. Knockdown of SLC39A14 inhibits glioma progression by promoting erastin-induced ferroptosis SLC39A14 knockdown inhibits glioma progression. BMC Cancer. 2023;23(1):1120. Franklin RB, Levy BA, Zou J, Hanna N, Desouki MM, Bagasra O, et al. ZIP14 zinc transporter downregulation and zinc depletion in the development and progression of hepatocellular cancer. J Gastrointest Cancer. 2012;43(2):249–57. Xu XM, Wang CG, Zhu YD, Chen WH, Shao SL, Jiang FN, et al. Decreased expression of SLC 39A14 is associated with tumor aggressiveness and biochemical recurrence of human prostate cancer. Onco Targets Ther. 2016;9:4197–205. Zhao M, Li M, Zheng Y, Hu Z, Liang J, Bi G, et al. Identification and analysis of a prognostic ferroptosis and iron-metabolism signature for esophageal squamous cell carcinoma. J Cancer. 2022;13(5):1611–22. Deng Z, Zeng W, Gao Y, Yang Z, Luo X, Li X, et al. Mesenchymal Stem Cells Prevent SLC39A14-Dependent Hepatocyte Ferroptosis through Exosomal miR-16-5p in Liver Graft. Adv Sci (Weinh). 2025;12(6):e2411380. Gong Y, You Q, Yuan X, Zeng F, Zhang F, Xiao J, et al. Mesenchymal stem cell-derived extracellular vesicles attenuate ferroptosis in aged hepatic ischemia/reperfusion injury by transferring miR-1275. Redox Biol. 2025;81:103556. Yang WS, SriRamaratnam R, Welsch ME, Shimada K, Skouta R, Viswanathan VS, et al. Regulation of ferroptotic cancer cell death by GPX4. Cell. 2014;156(1–2):317–31. Gao M, Monian P, Quadri N, Ramasamy R, Jiang X. Glutaminolysis and Transferrin Regulate Ferroptosis. Mol Cell. 2015;59(2):298–308. Tuo QZ, Lei P, Jackman KA, Li XL, Xiong H, Li XL, et al. Tau-mediated iron export prevents ferroptotic damage after ischemic stroke. Mol Psychiatry. 2017;22(11):1520–30. Zuo YB, Zhang YF, Zhang R, Tian JW, Lv XB, Li R, et al. Ferroptosis in Cancer Progression: Role of Noncoding RNAs. Int J Biol Sci. 2022;18(5):1829–43. Dai SM, Li FJ, Long HZ, Zhou ZW, Luo HY, Xu SG, et al. Relationship between miRNA and ferroptosis in tumors. Front Pharmacol. 2022;13:977062. Qi R, Bai Y, Li K, Liu N, Xu Y, Dal E, et al. Cancer-associated fibroblasts suppress ferroptosis and induce gemcitabine resistance in pancreatic cancer cells by secreting exosome-derived ACSL4-targeting miRNAs. Drug Resist Updat. 2023;68:100960. Bilicki CV, White JL, Hem SL, Borin MT. Effect of anions on adsorption of bile salts by colestipol hydrochloride. Pharm Res. 1989;6(9):794–7. Additional Declarations No competing interests reported. Supplementary Files Additionalfile1.docx Additionalfile2.docx Additionalfile3.zip Cite Share Download PDF Status: Published Journal Publication published 25 Apr, 2026 Read the published version in Journal of Orthopaedic Surgery and Research → Version 1 posted Editorial decision: Revision requested 30 Dec, 2025 Reviews received at journal 25 Dec, 2025 Reviewers agreed at journal 20 Dec, 2025 Reviewers agreed at journal 05 Dec, 2025 Reviewers invited by journal 01 Dec, 2025 Editor assigned by journal 24 Nov, 2025 Submission checks completed at journal 24 Nov, 2025 First submitted to journal 22 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8181974","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":553333967,"identity":"6918fb32-802a-429c-8a0d-4003dfd33c8b","order_by":0,"name":"Jie Huang","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Huang","suffix":""},{"id":553333968,"identity":"143a9fda-8777-4528-94eb-5a2f2494993c","order_by":1,"name":"Jiaqi He","email":"","orcid":"","institution":"The First Clinical Medical College of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jiaqi","middleName":"","lastName":"He","suffix":""},{"id":553333969,"identity":"9c455c64-6f67-4337-b63d-70a5587eaa4c","order_by":2,"name":"Liuru Lu","email":"","orcid":"","institution":"The First Clinical Medical College of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Liuru","middleName":"","lastName":"Lu","suffix":""},{"id":553333970,"identity":"4536a455-9894-4d30-bf0b-08086518072e","order_by":3,"name":"Yongheng Dai","email":"","orcid":"","institution":"The First Affiliated Hospital of Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Yongheng","middleName":"","lastName":"Dai","suffix":""},{"id":553333971,"identity":"ac7c2c8b-4eee-4cab-97a4-c99597bfa476","order_by":4,"name":"Chengjun Sun","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chengjun","middleName":"","lastName":"Sun","suffix":""},{"id":553333972,"identity":"cd4743e6-9fc8-49e6-a298-5aa25c686483","order_by":5,"name":"Sichang Wu","email":"","orcid":"","institution":"The Second Clinical Medical College of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Sichang","middleName":"","lastName":"Wu","suffix":""},{"id":553333973,"identity":"a8c5acbe-dc34-417b-8c03-ab98294aca58","order_by":6,"name":"Junsheng Chen","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"prefix":"","firstName":"Junsheng","middleName":"","lastName":"Chen","suffix":""},{"id":553333974,"identity":"bf0dd152-77d1-4c8a-abfd-e0712e496aaa","order_by":7,"name":"Zihao Yuan","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zihao","middleName":"","lastName":"Yuan","suffix":""},{"id":553333975,"identity":"70482392-76e4-47ed-9252-d7a2c0af3784","order_by":8,"name":"Ke Zhang","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ke","middleName":"","lastName":"Zhang","suffix":""},{"id":553333976,"identity":"300daec3-15cf-4f21-bbb0-c2ebb813d9c3","order_by":9,"name":"Mingyang Jiang","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Mingyang","middleName":"","lastName":"Jiang","suffix":""},{"id":553333977,"identity":"4c701f86-8278-4040-ac2c-c2d0a3559a69","order_by":10,"name":"Zhandong Bo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYDCCAwxsYJKBIQGIKyTk+EnUcsbCWLKBJC2MbRWJGwhp4bt99tmDD3/uyJuzJx97+HWeBOMGBuaHj27g0SJ5Lt3ccAbPM8OdPc/SjWW3STCbM7AZG+fg0WJwho1NmkfiMOOGGzlm0pLbJNgsG3jYpAlrMThsD9EyR4LH4ABRWhIOJ4K0SH5skJAgqEXyDBu74YwDh5M3nHmWJs1wTMJAspmAX/iAtgBD7LDthuPJxyR/1NTV97M3P3yMTwsKYOYBk8QqBwHGH6SoHgWjYBSMghEDAF/VTZUlHMX1AAAAAElFTkSuQmCC","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":true,"prefix":"","firstName":"Zhandong","middleName":"","lastName":"Bo","suffix":""}],"badges":[],"createdAt":"2025-11-22 17:53:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8181974/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8181974/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13018-026-06830-3","type":"published","date":"2026-04-25T15:58:30+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":97546131,"identity":"cd5f55f0-18aa-49c3-bc3e-e7d83e2f7b66","added_by":"auto","created_at":"2025-12-05 16:05:50","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12522228,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/cb0d81da3b8592913ff82e71.docx"},{"id":97546122,"identity":"114b586d-f951-42e1-bf08-7f91c36769a9","added_by":"auto","created_at":"2025-12-05 16:05:50","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11737,"visible":true,"origin":"","legend":"","description":"","filename":"233ed0b72ed3400f96fec7d04a8b9725.json","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/215b12878c9d4b7a95b8735e.json"},{"id":97672659,"identity":"1ec67657-b006-43b1-b0d0-9dd8da75973c","added_by":"auto","created_at":"2025-12-08 09:38:32","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12877,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/135607dc0bd7b29854d85332.docx"},{"id":97546130,"identity":"8d26c036-9063-4311-ad10-73cb02f8d0d9","added_by":"auto","created_at":"2025-12-05 16:05:50","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":36086,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile2.docx","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/bc1b0daa735e6ba15a284a68.docx"},{"id":97546142,"identity":"5162ec6e-a377-44ed-8cd7-8f77e2c7f117","added_by":"auto","created_at":"2025-12-05 16:05:52","extension":"zip","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101400569,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile3.zip","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/f5e68c18ba33d899c3be69f1.zip"},{"id":97673044,"identity":"81935186-6e87-4993-997c-41afc52a0f0f","added_by":"auto","created_at":"2025-12-08 09:39:19","extension":"xml","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":147694,"visible":true,"origin":"","legend":"","description":"","filename":"233ed0b72ed3400f96fec7d04a8b97251enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/ec6bba4bed423000493ad706.xml"},{"id":97672365,"identity":"2c1b5f22-3885-473c-8339-7c9ed442b63c","added_by":"auto","created_at":"2025-12-08 09:36:49","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":43565,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/4c0a74ada695ab721c07623c.png"},{"id":97546132,"identity":"a29c3bf3-2590-4c26-b8dc-d0a257724e4b","added_by":"auto","created_at":"2025-12-05 16:05:50","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":51507,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/48ae34a153b483a459819a4f.png"},{"id":97546138,"identity":"5f4269ff-d314-45f0-be98-867b542842bc","added_by":"auto","created_at":"2025-12-05 16:05:50","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":54820,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/dfff03b6f81ec228ebc6f019.png"},{"id":97546139,"identity":"7049cf16-1846-4901-8727-f22f75698bdb","added_by":"auto","created_at":"2025-12-05 16:05:51","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":97706,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/4b07ea8f6c0e3ea973acc8aa.png"},{"id":97546137,"identity":"178d7357-56e0-45bf-9590-b8e75999e03b","added_by":"auto","created_at":"2025-12-05 16:05:50","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":58259,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/ba322dc39dff36dfb9df19a2.png"},{"id":97546140,"identity":"7f2f626b-fb4b-43e2-b339-24401a4dd12b","added_by":"auto","created_at":"2025-12-05 16:05:51","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":62008,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/fc7a7acda2f2fb140fec1e8d.png"},{"id":97546141,"identity":"788f7e2b-8f97-4075-ba31-0bf774e529bb","added_by":"auto","created_at":"2025-12-05 16:05:51","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":143225,"visible":true,"origin":"","legend":"","description":"","filename":"233ed0b72ed3400f96fec7d04a8b97251structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/2b44f725bbe05b24c1a431ed.xml"},{"id":97546133,"identity":"da084e1b-20a7-4598-8ffa-518e0717ef2c","added_by":"auto","created_at":"2025-12-05 16:05:50","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":157848,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/04fb20a1d59dbb49de2335e9.html"},{"id":97546121,"identity":"4f581e00-07e3-41b6-912d-a1928e8b9d71","added_by":"auto","created_at":"2025-12-05 16:05:50","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":429927,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic flowchart of the experimental design and procedures.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/36ee6a232012032f3cf8b3a3.png"},{"id":97546125,"identity":"534a9815-3d42-4f2d-8861-da20739e8c15","added_by":"auto","created_at":"2025-12-05 16:05:50","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":261583,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization and identification of exosomes, and screening of key miRNAs derived from osteosarcoma exosomes.\u003cstrong\u003e(A) \u003c/strong\u003eTEM micrographs of exosomes.\u003cstrong\u003e(B)\u003c/strong\u003eDetection of exosomal markers by Western blot.\u003cstrong\u003e(C)\u003c/strong\u003e Exosomal microarray analysis identified miR-875-3p as differentially expressed in OS and adjacent normal tissues.\u003cstrong\u003e(D)\u003c/strong\u003e Differential expression of miR-875-3p detected by RT-qPCR in osteoblasts and four osteosarcoma cell lines.\u003cstrong\u003e(E)\u003c/strong\u003e Expression levels of miR-875-3p in human osteosarcoma tissues and adjacent non-tumorous tissues.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/700b5541c982c63d993f28a8.png"},{"id":97673000,"identity":"6ee6a46c-20e5-48e1-8c10-92b373edeed6","added_by":"auto","created_at":"2025-12-08 09:39:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":325868,"visible":true,"origin":"","legend":"\u003cp\u003eConstruction and validation of the miR-875-3p/SLC39A14 molecular axis.\u003cstrong\u003e(A)\u003c/strong\u003eOnline prediction using the miRDB database identified SLC39A14 as a downstream target of miR-875-3p. \u003cstrong\u003e(B)\u003c/strong\u003e Dual-luciferase reporter assay confirmed the specific binding between miR-875-3p and SLC39A14. \u003cstrong\u003e(C–D) \u003c/strong\u003eSLC39A14 was downregulated in osteosarcoma cells and tissues.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/af0f9e90026b93ce0d493e8c.png"},{"id":97672155,"identity":"d1a7d8fa-f81e-41f1-b652-ec0343ab4792","added_by":"auto","created_at":"2025-12-08 09:34:27","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":385962,"visible":true,"origin":"","legend":"\u003cp\u003eTransfection validation and the phenotypic effects of the miR-875-3p/SLC39A14 axis on osteosarcoma cells through ferroptosis regulation. \u003cstrong\u003e(A–B)\u003c/strong\u003e Expression levels of miR-875-3p\u003cstrong\u003e (A)\u003c/strong\u003e and SLC39A14 \u003cstrong\u003e(B)\u003c/strong\u003ewere significantly reduced after transfection. \u003cstrong\u003e(C)\u003c/strong\u003e Knockdown of miR-875-3p markedly increased SLC39A14 expression. \u003cstrong\u003e(D)\u003c/strong\u003e Cell viability was assessed by CCK-8 assay. \u003cstrong\u003e(E)\u003c/strong\u003e Wound-healing assay. \u003cstrong\u003e(F)\u003c/strong\u003eTranswell assay.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/585b259852951d23edaa0b07.png"},{"id":97546127,"identity":"540038d5-312f-4f96-957e-47dd9f921d89","added_by":"auto","created_at":"2025-12-05 16:05:50","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":473809,"visible":true,"origin":"","legend":"\u003cp\u003ePhenotypic regulation of osteosarcoma cells by the miR-875-3p/SLC39A14 axis through ferroptosis modulation. \u003cstrong\u003e(A)\u003c/strong\u003e Measurement of Fe²⁺ levels. \u003cstrong\u003e(B)\u003c/strong\u003eImmunofluorescence detection of ROS. \u003cstrong\u003e(C) \u003c/strong\u003eMeasurement of MDA levels. \u003cstrong\u003e(D)\u003c/strong\u003eRT-qPCR analysis of GPX4, ACSL4, and xCT expression.\u003cstrong\u003e (E)\u003c/strong\u003e Western blot analysis of GPX4, ACSL4, and xCT. \u003cstrong\u003e(F)\u003c/strong\u003e Measurement of GSH/GSSG levels.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/b306146462914f7c52531e62.png"},{"id":97673190,"identity":"034df414-35aa-42eb-bc05-b2e9ef1f768d","added_by":"auto","created_at":"2025-12-08 09:39:35","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":493799,"visible":true,"origin":"","legend":"\u003cp\u003eIn vivo phenotypic regulation of osteosarcoma by the miR-875-3p/SLC39A14 axis through ferroptosis modulation.\u003cstrong\u003e (A)\u003c/strong\u003e Magnetic resonance imaging (MRI) of tumors. \u003cstrong\u003e(B)\u003c/strong\u003e RT-qPCR analysis was conducted on the expression of GPX4, ACSL4, and xCT.\u003cstrong\u003e (C) \u003c/strong\u003eWestern blot analysis of GPX4, ACSL4, and xCT.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/1e43e66009878485b4294b0c.png"},{"id":107928750,"identity":"66867480-1ec4-40c7-bac3-5136b68277ac","added_by":"auto","created_at":"2026-04-27 16:12:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2730802,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/a2dd8258-0c2e-460c-9c67-9f4496d7bf13.pdf"},{"id":97546123,"identity":"2b678037-cfbe-4fa1-b682-a8977ae4103e","added_by":"auto","created_at":"2025-12-05 16:05:50","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":12877,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/8c380e423dbd6722e49491a5.docx"},{"id":97672701,"identity":"78de37dd-5059-4067-9e5c-141724b8bc03","added_by":"auto","created_at":"2025-12-08 09:38:35","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":36086,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile2.docx","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/7e43a0b8d21b576498ae14c7.docx"},{"id":97546143,"identity":"29d28773-ee86-4c19-a242-30149b85881d","added_by":"auto","created_at":"2025-12-05 16:05:54","extension":"zip","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":101400569,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile3.zip","url":"https://assets-eu.researchsquare.com/files/rs-8181974/v1/e79ddd69a0cb57ebf8242430.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"The Role and Mechanism of Exosome-Mediated miR-875-3p in Targeting SLC39A14 to Regulate Ferroptosis in Osteosarcoma Proliferation, Migration, and Invasion","fulltext":[{"header":"Background","content":"\u003cp\u003eOsteosarcoma is the leading type of primary malignant bone cancer, representing roughly 11.7% of all bone tumors. Epidemiological studies indicate that the disease exhibits a distinct age clustering pattern, with about three-quarters of cases occurring in adolescents and young adults aged 15\u0026ndash;25 years, and is associated with high disability rates and poor prognosis [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Notably, at the time of clinical diagnosis, 15%-20% of patients already present with distant metastases, among which pulmonary metastases are detected in up to 82% of cases [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Although current treatment strategies combining adjuvant chemotherapy and wide tumor excision have improved the five-year survival rate to around 60% [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], key factors such as postoperative recurrence, multidrug resistance, and secondary organ damage continue to adversely affect prognosis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Given the high genomic heterogeneity and complex regulatory networks of osteosarcoma, in-depth exploration of its molecular mechanisms and the development of novel biomarker detection systems have become crucial research directions to overcome existing therapeutic limitations. In recent years, with rapid advances in targeted therapies, molecular targeted treatment for osteosarcoma has shown promising prospects, including IGF-R/IGF-1R inhibitors, TP53 inhibitors [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], and multi-target tyrosine kinase inhibitors designed against receptor tyrosine kinases [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. However, due to the high heterogeneity and intricate molecular regulatory mechanisms of osteosarcoma, selecting appropriate targets for related research remains challenging. Therefore, elucidating the molecular regulatory mechanisms of osteosarcoma and identifying new biomarkers are essential to achieve more effective clinical treatments.\u003c/p\u003e\u003cp\u003eRecent studies have shown that microRNAs (miRNAs), small single-stranded RNAs transcribed from genes, play a role in the pathophysiology of tumors and the process of distant metastasis [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].miRNAs are endogenous non-coding RNA molecules, typically 21\u0026ndash;25 nucleotides long, that regulate gene expression post-transcriptionally by binding specifically to the 3' untranslated region (3'-UTR) of target mRNAs[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. MiRNAs play crucial roles in regulating essential biological processes like cell proliferation, differentiation, and apoptosis, and are key players in the development and progression of cancer. Research has shown that miR-875-3p acts as a potent tumor suppressor in solid tumors, including colorectal cancer and non-small cell lung cancer[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Particularly in the field of osteosarcoma, Zhang et al. demonstrated through functional experiments that the circular RNA hsa_circ_0069117 can competitively bind to miR-875-3p to regulate PF4V1 expression, thereby inhibiting the proliferation and migration of osteosarcoma cell lines (MG-63 and U2OS) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. This suggests that miR-875-3p may serve as a potential biomarker for targeted therapy in osteosarcoma. However, key scientific questions regarding the dynamic regulatory mechanisms of miR-875-3p in the osteosarcoma microenvironment, especially its interactions with critical signaling pathways such as PI3K/AKT and Wnt/β-catenin, remain to be elucidated. Notably, extracellular vesicles such as exosomes can deliver functional non-coding RNAs to target cells. This miRNA-based intercellular communication mechanism may contribute to the invasive and metastatic processes of osteosarcoma by remodeling the tumor microenvironment. Therefore, we are particularly interested in all forms of regulatory non-coding RNAs, especially those associated with protein complexes in biological fluids or encapsulated within extracellular bioactive factors such as microvesicles or exosomes\u0026mdash;with particular emphasis on exosomes due to their excellent cellular penetration capacity and biocompatibility.\u003c/p\u003e\u003cp\u003eExosomes are tiny extracellular vesicles that carry various biomolecules, including DNA, mRNA, miRNA, cytoplasmic proteins, and lipids. They serve as important vehicles for the transfer of bioactive molecules within and between organisms, and are released into the extracellular microenvironment via exocytosis. Cancer cells actively synthesize and secrete exosomes, which contribute to tumor progression through mechanisms such as immune evasion. Current studies indicate that osteosarcoma cells utilize exosomes for pathological communication to promote tumor growth and proliferation. For example: Liu et al. Indicated that M2-type tumor-associated macrophages (M2-TAMs) deliver miR-221-3p via exosomes to osteosarcoma cells (143B and Saos2), promoting tumor cell proliferation in vivo [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]; Li et al. reported that YES1 is transported by exosomes into osteosarcoma cells, where it activates ERK signaling and mediates the MAPK pathway, thereby boosting tumor cell migration, proliferation, and invasion; Raimondi and his colleagues found that exosomes from osteosarcoma cells stimulate endothelial cells to produce pro-angiogenic molecules such as VEGF-A, IL-6 and IL-8, thereby promoting blood vessel formation and influencing the development of osteosarcoma [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Z and his team demonstrated through laboratory and animal models that osteosarcoma cells can enhance the proliferation and invasion capabilities of 143B cells by releasing exosomes containing miR-195- 3p [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]; Wang et al. found that exosomes secreted by cancer-associated fibroblasts deliver miR-1228 to osteosarcoma (OS) cells, promoting migration and invasion by suppressing the expression of SCAI, an endogenous inhibitor of cancer cell invasion [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eFerroptosis, newly dentified form of cell death introduced by Dixon et al. in 2012. \u003csup\u003e[16]\u003c/sup\u003e, has gained increasing research attention in recent years. It is a distinct non-apoptotic cell death process driven by iron-dependent lipid peroxide accumulation. \u003csup\u003e[17]\u003c/sup\u003e, marked by glutathione (GSH) depletion, lipid peroxidation, and iron accumulation. The cysteine-glutathione synthesis pathway is crucial for triggering ferroptosis. Glutathione peroxidase (GPX) is a classical enzyme family involved in this process. Cystine is imported into cells via the glutamate-cystine transporter (system xc⁻), where it is utilized for the synthesis of GSH and GPX4. GSH acts as a key cofactor in protecting cells from oxidative damage, meanwhile, GPX4 catalyzes the conversion of lipid peroxides into alcohols[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Inhibition of the glutamate-cystine transporter system (system xc⁻) located on the cell membrane\u0026mdash;particularly associated with transferrin receptor-1 (TFR-1)\u0026mdash;reduces the uptake of cystine into the cell. This leads to decreased synthesis of glutathione (GSH), diminished catalytic activity of GPX4, and consequent accumulation of lipid peroxides, ultimately triggering ferroptosis. Therefore, the accumulation of lipid oxides is an important characteristic of ferroptosis. Lipid peroxidation products and polyunsaturated fatty acids (PUFAs) increase membrane fluidity. PUFAs such as linoleic acid and arachidonic acid are susceptible to oxidation by intracellular reactive oxygen species (ROS), resulting in the generation of lipid peroxidation breakdown products that promote ferroptosis induced by GSH inhibitors such as RSL3 [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eFerroptosis is uniquely different from conventional forms of cell death, like apoptosis and necrosis. Morphologically, it is characterized by cell shrinkage, mitochondrial condensation, intact plasma membranes, and organelle swelling. Salaroli et al. conducted a study examining the cytotoxic effects of artemisinin extracts on two canine osteosarcoma cell lines (OSCA-8 and OSCA-40). The study found elevated total iron levels, the buildup of lipid peroxides, and \"ballooning\"-like cell death, all of which indicate ferroptosis as a mechanism of cell death in osteosarcoma (OS) cells. This highlights ferroptosis as a potential cell death pathway in OS cells. [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eRecently, researchers worldwide have extensively investigated the ion transport function and physiological roles of SLC39A14. Wang et al. identified SLC39A14 as a key transporter responsible for tissue iron overload, facilitating the uptake of non-transferrin-bound iron (NTBI) across the plasma membrane into cells, where it participates in various physiological and metabolic processes [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Furthermore, a study by P et al. demonstrated that inhibiting SLC39A14 significantly suppresses the cellular entry of NTBI, further supporting its crucial role in ferroptosis (doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41418-023-01230-0\u003c/span\u003e\u003cspan address=\"10.1038/s41418-023-01230-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). However, there have been few reports on SLC39A14-mediated ferroptosis in osteosarcoma (OS), suggesting its potential as a novel therapeutic target worthy of further investigation.\u003c/p\u003e\u003cp\u003eIn this study, we employed exosomes as carriers for miRNA-875-3p and SLC39A14. After validating exosome functionality, we utilized both in vitro and in vivo experimental approaches to analyze the regulatory interplay between miRNA-875-3p and SLC39A14 in the context of ferroptosis in osteosarcoma cells under knockdown conditions. Our aim is to elucidate the complex interaction network between them, examine the relationship between miRNA-875-3p-mediated SLC39A14 expression and ferroptosis-related characteristics in OS, and explore the underlying mechanisms. These findings could offer a fresh elucidates osteosarcoma pathogenesis and could pave the way for novel therapies.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003eAll related procedures were conducted according to the flowchart.\u003c/p\u003e\n\u003cp\u003eTransfection groups: Group I (miR-875-3p knockdown control), Group II (miR-875-3p knockdown), Group III (SLC39A14 knockdown control), Group IV (SLC39A14 knockdown).\u003c/p\u003e\n\u003ch3\u003eCell culture\u003c/h3\u003e\n\u003cp\u003eThe H143B human osteosarcoma cells were acquired from Cyagen BioSciences. The cells were grown in a medium called Dulbecco\u0026apos;s Modified Eagle Medium (DMEM), which was supplemented with 10% fetal bovine serum (FBS) and 100U/ml penicillin-streptomycin. The temperature of the cell incubator is maintained at 37\u0026deg;C with 5% carbon dioxide (CO ˇ).\u003c/p\u003e\n\u003cp\u003eHuman specimen collection\u003c/p\u003e\n\u003cp\u003eThe research received Ethics Committee approval from Guangxi Medical University and adhered to the Declaration of Helsinki guidelines, as well as China\u0026apos;s \u0026apos;Administrative Measures for Ethical Review of Biomedical Research Involving Humans. Osteosarcoma samples were collected from patients who attended From January 2024 to December 2024, see patients in the orthopedics or oncology department at the First Affiliated Hospital of Guangxi Medical University. All patients were histopathologically diagnosed with osteosarcoma (ICD: C40, C41). He had not received radiotherapy, chemotherapy or targeted therapy before collecting the samples. Tumor samples and corresponding non-cancerous adjacent tissues (located\u0026thinsp;\u0026gt;\u0026thinsp;5 cm from the tumor margin) were obtained intraoperatively. A total of three paired osteosarcoma and corresponding adjacent non-cancerous tissue samples were obtained for the study.\u003c/p\u003e\n\u003cp\u003eAnimal preparation\u003c/p\u003e\n\u003cp\u003eWe used 36 healthy BALB/c nude mice, all 4 weeks old, weighing between 18 and 20 grams, and the number of males and females was equal. These experimental mice were purchased from the Animal Experiment Center at Guangxi Medical University and kept in a dedicated SPF (Specific Pathogen Free) environment.\u003c/p\u003e\n\u003cp\u003eBioinformatic analysis\u003c/p\u003e\n\u003cp\u003eExosomal miRNA expression data related to human osteosarcoma were obtained using an exosome microarray technique. We used the R package \u0026quot;DESeq2\u0026quot; to perform differential expression analysis and identify important miRNAs. Next, miRDB was used to predict the mRNAs that these miRNAs might correspond to. Finally, a survival analysis was performed using SPSS to see if these key mRNAs were related to the patient\u0026apos;s prognosis.\u003c/p\u003e\n\u003cp\u003eExtraction of exosome in H143B cell\u003c/p\u003e\n\u003cp\u003eH143B cells were cultured in high-sugar DMEM medium (Corning, 10-013-CV) supplemented with 10% fetal bovine serum (FBS; Gibco, A2720801). They were placed in an incubator (Thermo Scientific, Heracell 150i) at 37\u0026deg;C and 5% CO ˇ. We use an inverted microscope (Olympus, CKX53) every day to see how the cells are growing, and when they are almost 70% old, we replace them with a new medium. Cells were then incubated for an additional 72 h to promote exosome secretion. Conditioned medium was sequentially subjected to low- and high-speed centrifugation to remove cells and debris, followed by filtration.After 90 min of ultracentfugation, we resuspended the pellet in PBS and centrifuged it again. The exosome pellet was then collected and resuspended, and its protein concentration was measured using the BCA Protein Assay Kit (Thermo, 23225). Finally, the exosome samples were dispensed into low-protein-binding tubes (Axygen, MCT-175-L-C) and immediately frozen in a refrigerator at-80\u0026deg;C (Thermo, 902-UP). Exosome integrity was further verified by nanoparticle tracking analysis (Malvern, NanoSight NS300) and Western blotting using CD63 and TSG101 antibodies (Abcam, ab59479/ab125011).\u003c/p\u003e\n\u003cp\u003eTransmission electron microscopy (TEM) observation\u003c/p\u003e\n\u003cp\u003eWe used transmission electron microscopy to observe exosomes isolated from H143B cells and recorded their structural characteristics, as the internal structure of the mitochondria changes, as seen under the 200 nm/50 nm and 500 nm scales.\u003c/p\u003e\n\u003cp\u003eExosome microarray\u003c/p\u003e\n\u003cp\u003eExosomal microarray analysis was performed using human osteosarcoma tissues with corresponding adjacent non-tumorous tissues to determine expression profiles of key mRNAs in osteosarcoma-derived exosomes. Tissue samples were dissociated into single-cell suspensions, and exosomes were subsequently isolated using the aforementioned protocol. Total RNA was purified and quality-controlled use R Neasy Mi-ni Kit ( Qiagen, p/n 74104). After complete drying, miRNA Complete Labeling and Hyb Kits together with a hybridization oven rotator were employed for labeling and hybridization. Microarray washing was performed using Gene Expression Wash Solution System (Agilent, p/n 5188\u0026ndash;5327). Ultimately, array scanning utilized a microarray device (e.g., Agilent G2505C) under optimized photomultiplier tube (PMT) gain settings, and raw data were extracted via Agilent Feature Extraction.\u003c/p\u003e\n\u003cp\u003eDual-luciferase reporter assay\u003c/p\u003e\n\u003cp\u003eWe performed a dual luciferase reporting experiment according to the instructions of the Dual-Lucifer\u0026reg; Reporter Assay Kit (Promega, E1941). The specific steps are as follows: We used Human Embryonic Kidney 293T cells (ATCC, CRL-3216) for transfection experiments. These cells were grown in 24-well plates (Corning, 3524) with 1 \u0026times; 10 cells per well and grown in high-sugar DMEM medium (HyClone, SH30244.01) supplemented with 10% fetal bovine serum (FBS; Gibco, A2720801), and experiments were conducted when they were approximately 70% full.\u003c/p\u003e\n\u003cp\u003eFor vector construction, normal SLC39A14 3\u0026apos;UTR sequence (GenBank accession no. NM_001135146.3) was cloned into the pGL3-control vector (Hanheng, HH-Luc-003). Plasmid quantity was assessed via NanoDrop 2000 spectrophotometer (Thermo Scientific), ensuring a final concentration of 250 ng/\u0026micro;L with an A260/A280 ratio of 1.89. A mutant plasmid, in which the key binding site CAGUGAA was substituted with GUCACUU, was also constructed as a control.\u003c/p\u003e\n\u003cp\u003eFor transfection complex preparation, 0.16 \u0026micro;g plasmid DNA (80 ng/\u0026micro;L working concentration), 5 pmol hsa-miR-875-3p mimics (RiboBio, miR10000444-1-5), and 10 \u0026micro;L Opti-MEM medium (Gibco, 31985070) were added into Tube 1 (Eppendorf, 30120003). In Tube 2, 10 \u0026micro;L Opti-MEM medium and 0.3 \u0026micro;L LipoFiter 3.0 transfection reagent (Hanheng, HH-LF300) were mixed. Both tubes were vortexed for 5 s ,Plasmid quantity was assessed via NanoDrop 2000 a further 5 min, and then combined by gentle pipetting (15 times). The mixture was incubated under light-protected conditions for 20 min to form liposome\u0026ndash;nucleic acid complexes.\u003c/p\u003e\n\u003cp\u003eTo add the transfection reagent, we first sucked away the original medium, and then replaced it with 500 \u0026micro;L of fresh medium, which added 50 \u0026micro;L of the transfection mixture. The cells were then incubated in a humidified incubator (Thermo, Heracell 150i) at 37\u0026deg;C and 5% CO ˇ for 48 h.\u003c/p\u003e\n\u003cp\u003eAfter incubation, we discarded the medium and gently washed the cells twice with cold DPBS (HyClone, SH30256.01). Then add 100 \u0026micro;L of 1\u0026times; Passive Lysis Buffer (Promega, E1941) to each well, place the culture plate on a shaker (TS-1, Qijing), and shake at 80 rpm for 15 minutes at room temperature. The lysate was then allowed to become clear by centrifugation with a centrifuge (Eppendorf 5424R) at 12,000 rpm (approximately 13,400 \u0026times; g) for 1 minute. Finally, 20 \u0026micro;L of the clear supernatant was taken and transferred to a white 96-well plate (Costar, 3917).\u003c/p\u003e\n\u003cp\u003eWe measured the luminous intensity using a GloMax Navigator device (Promega, GM3000). For each well, 100 \u0026micro;L Luciferase Assay Reagent II was automatically injected to measure firefly luciferase activity, followed by 100 \u0026micro;L Stop \u0026amp; Glo Reagent to measure Renilla luciferase activity. The integration time was set to 2 s/well.\u003c/p\u003e\n\u003cp\u003eWe used the luciferase activity ratio of firefly and Renilla (fLuc/rLuc) to adjust the relative luciferase values. Each group was assayed in six biological replicates. Statistical comparisons between wild-type and mutant groups GraphPad Prism 9.0 software was used to conduct two-tailed Student\u0026apos;s t-test, and the significance threshold was set at P\u0026thinsp;\u0026lt;\u0026thinsp;0.01. considered statistically significant.\u003c/p\u003e\n\u003cp\u003eWestern blot (WB)\u003c/p\u003e\n\u003cp\u003eWe extracted proteins from exosome, osteosarcoma cell, osteosarcoma tissue and adjacent tissue samples that were kept on ice and then lysed. The lysed liquid was centrifuged at 12,000 rpm for 5 minutes, and the supernatant was taken and reserved for subsequent experiments. We separated equal amounts of protein with 10% or 15% SDS-PAGE gel and then transferred them to a PVDF membrane using a wet transfer system. Next, the membrane was sealed in a bag and incubated at 4\u0026deg;C with appropriately diluted primary antibodies.This stage took place for a 12 h period with gentle agitation. Thereafter, they were washed thoroughly use Tris-buffered saline with Tween-20 (TBST) to wash off those antibodies that do not stick to it. Then, soak the membrane in diluted secondary antibodies should be stored at a temperature of 4\u0026deg;C for 90 min under gentle shaking. Following the incubation process, the membranes were subjected to a second wash with TBST, a step designed to ensure the removal of any excess secondary antibodies.\u003c/p\u003e\n\u003cp\u003eWe used the ECL Plus system to display protein bands to detection reagent (WBKLS0500, Thermo Fisher Scientific). The membranes were exposed to the reagent in a dark chamber, and chemiluminescent signals corresponding to protein\u0026ndash;antibody complexes were detected. Capture of the images was conducted utilising a Bio-Rad\u0026apos;s ChemiDoc XRS\u0026thinsp;+\u0026thinsp;equipment, and analysis of band signal intensity was carried out by means of ImageJ software. Thus, relative expression levels of target proteins were determined between different samples.\u003c/p\u003e\n\u003cp\u003eTranscription-quantitative polymerase chain reaction (RT-qPCR)\u003c/p\u003e\n\u003cp\u003ePreparation of lysates osteosarcoma (OS) cells from each group was undertaken prior to extraction of total RNA using a modified TRIzol method (Invitrogen, 15596026). We used a NanoDrop 2000 spectrophotometer produced by Thermo Scientific to measure the concentration and purity of RNA, and the purity of the 28S/18S rRNA bands was confirmed by running them through a 1% agarose gel and using electric current to separate them. RNA samples that satisfied the established quality criteria (total amount\u0026thinsp;\u0026ge;\u0026thinsp;1 \u0026micro;g) were then subjected to cDNA was synthesized using HiScript\u0026reg; III RT SuperMix (Vazyme, R323-01), which also removes gDNA in the meantime, resulting in the generation of a 20 \u0026micro;L reaction mixture. The ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711-02) was utilized for quantitative PCR.This was in a 20 \u0026micro;L reaction system. The system used was a StepOnePlus real-time PCR system (Applied Biosystems).\u003c/p\u003e\n\u003cp\u003eWe got the cycle threshold (Ct) values during the exponential phase, and we used StepOne Software v2.3 to get them. We then calculated relative expression levels target genes use something called 2^-\u0026Delta;\u0026Delta;Ct and made them normal to something called GAPDH, which is like an internal reference.\u003c/p\u003e\n\u003cp\u003eLV and ADV transfection\u003c/p\u003e\n\u003cp\u003eThe construction of the miR-875-3p/SLC39A14 knockdown lentivirus involved the initial utilisation of the PEI transfection method for viral packaging. First, we seeded the HEK293T cells in DMEM and then we let them grow at 37\u0026deg;C with 5% CO₂ until they were 70\u0026ndash;80% full. The preparation of the DNA mixture involved the mixing of the target plasmids (10 \u0026micro;g) and the packaging plasmids (psPAX2:pMD2.G at a ratio of 3:1, totalling 10 \u0026micro;g) in 500 \u0026micro;L of serum-free DMEM.Addition PEI (1 mg/mL) DNA:PEI ratio 1:3, followed by vortexing, incubation normal temperature 15 min, resulted in formation of transfection complexes.\u003c/p\u003e\n\u003cp\u003eSubsequently, the transfection complexes were introduced to HEK293T cells in DMEM. Following a 6 h incubation period,culture medium was replaced with DMEM supplemented with 10% fetal bovine serum. Supernatants were collected 48 and 72 hours after transfection, then filtered using a 0.45 \u0026micro;m filter.and subjected to brief centrifugation at 70,000 \u0026times; g at 4\u0026deg;C. Viral pellets located at the base of the tube were resuspended in DMEM containing 10% FBS, thus preparing viral working solutions.\u003c/p\u003e\n\u003cp\u003eThe exponentially growing H143B cells were subjected to trypsin digestion, neutralisation, and resuspension prior to seeding. The cells were then infected with the prepared lentivirus. 72 h after infection, the level of infection was evaluated using a microscope that uses light to reveal hidden structures, and the proportion of positive cells was used to judge the success of the infection for the following experiments.\u003c/p\u003e\n\u003cp\u003eCell counting kit-8 (CCK-8) assay\u003c/p\u003e\n\u003cp\u003eDuring the exponential growth phase of cells, we treated them with 0.25% trypsin at 37\u0026deg;C for 1.5 to 2 min. Process of digestion was brought to a conclusion by the addition of 2 mL of pre-warmed complete medium containing 10% fetal bovine serum, which occurred when cell edges began to shrink visibly. The cells were then detached from their substrate by means of gentle pipetting, a process which was repeated 30 times using a 1 mL pipette tip that had been sterilised in accordance with the relevant protocols. This process was carried out with the utmost care to avoid the formation of bubbles, thereby ensuring the integrity of the cells and their subsequent viability.\u003c/p\u003e\n\u003cp\u003eA 200-mesh cell strainer was used to filter the resulting cell suspension, and cell density was adjusted to 5 \u0026times; 10\u0026sup3; cells/mL using an automated cell counter. Each well of PLL-96WP was seeded 100 \u0026micro;L the cell suspension. The plates were subjected to a low-speed shaking process for a duration of 5 min, with the objective of ensuring uniform cell distribution. Thereafter, the plates were placed into a 37\u0026deg;C/5% CO₂ incubator and humidity level of 5%, in the presence of 5% CO₂. The incubation process was continued for a period of 24 h. The efficacy of cell attachment was subsequently evaluated through the utilisation of an inverted phase-contrast microscope, with the requirement for \u0026gt;\u0026thinsp;90% adherence being met.\u003c/p\u003e\n\u003cp\u003eOn the next day, 10 \u0026micro;L of CCK-8 solution was added to each well using a special tool that can pipette very small amounts, cells were then incubated period of 3 h. Absorbance measurements will taken 0, 24, 48, 72, and 96 h by microplate reader. The wells containing medium and CCK-8 without cells were used as blank controls, using untreated cells on negative controls. Dual-wavelength detection process was conducted at a primary at 450/630 nm. Each group was assayed in six replicates, and readings were averaged over three independent experiments. Y is the measured response, X is the independent variable, and A is the baseline.Growth kinetics over time were analysed by fitting sigmoid curves to the data.\u003c/p\u003e\n\u003cp\u003eTranswell assay\u003c/p\u003e\n\u003cp\u003eEmploying Matrigel (Corning, NY, USA). The Matrigel was subjected to a process of thawing, dilution, and centrifugation at 2,000 rpm, 30 s ,with objective of ensuring the homogeneity of the mixture. 60 \u0026micro;L of the diluted Matrigel added to the centre polycarbonate membrane in each Transwell insert. This was then spread evenly with a sterile cell scraper to form a uniform gel layer of approximately 6 mm in diameter. Subsequently, by placing the inserts at 37\u0026deg;C within a controlled environment containing 5% CO₂ and a humidity level of 95% for a duration of 3.5 h. This step was undertaken to facilitate the process of gel polymerisation. Subsequently, 200 \u0026micro;L of pre-warmed serum-free medium was added to the upper chamber,Prior to the assay, inserts were hydrated for 1 h in the incubator after the addition of 600 \u0026micro;L of medium to the lower chamber.\u003c/p\u003e\n\u003cp\u003eRapidly propagating H143B cells were treated with 0.25% trypsin-EDTA solution at 37\u0026deg;C for 2 minutes and 15 seconds to separate them. To stop the action of this enzyme, we added complete growth medium containing 10% fetal bovine serum. Next, the cell mixture was filtered through a 40 \u0026micro;m nylon mesh to obtain a uniform single cell population. We then carefully added 200 \u0026micro;L of the cell suspension to the Matrigel layer in the upper compartment. After allowing the cells to stand for 10 minutes, 600 \u0026micro;L of complete medium containing 20% fetal bovine serum (FBS) was added to the lower compartment. with the purpose of serving as a chemoattractant. The inserts were then subjected to an incubation period in a humidified incubator, with a relative humidity level of greater than 95%, for a duration of 48 h.\u003c/p\u003e\n\u003cp\u003eSubsequent to the conclusion of the incubation period, residual medium on upper chamber was meticulously removed, the inserts were immersed in pre-chilled PBS (4\u0026deg;C).Cells treated with a modified cross-fixation method, comprising an initial fixation step with 4% paraformaldehyde (pH 7.4, pre-chilled at 4\u0026deg;C ,15 min) This was followed by a subsequent fixation step with fresh fixative at room temperature for a period of 10 min. This approach was adopted to ensure the preservation of cell morphology in deeper layers. Fixed inserts were washed with Phosphate Buffered Saline (PBS), permeabilized with 0.1% Triton X-100 for a period of 8 min, and stained with 0.01% crystal violet solution for a further 25 min in dark. In order to reduce background interference,The inserts underwent dehydration in 70%, 95%, and 100% ethanol (2 min per step) with subsequent air-drying overnight (12 h) under a laminar flow hood.Following image acquisition (20\u0026times;), migrated/invaded cells were quantified (ImageJ).\u003c/p\u003e\n\u003cp\u003ewound healing assay\u003c/p\u003e\n\u003cp\u003eStable H143B cells expressing the target gene were routinely cultured and washed, then synchronized in the G0/G1 phase. For scratch preparation, use sterile 200 \u0026micro;L pipette tip (Axygen, T-200) under inverted microscope. The tip was advanced perpendicularly to the dish bottom at 0.5 mm/s along straightedge to create a linear scratch with a width of 800\u0026thinsp;\u0026plusmn;\u0026thinsp;50 \u0026micro;m. The plate was then tilted at a 45\u0026deg; angle, and pre-chilled PBS (4\u0026deg;C) was gently flushed along the scratch at a rate of 2 mL/min in three sequential washes.\u003c/p\u003e\n\u003cp\u003eAfter initial processing, five fixed observation points were selected under an inverted fluorescence microscope (Nikon, Eclipse Ti2). Images were captured continuously over 72 h using a 10\u0026times; objective and the NIS-Elements AR 5.11 imaging system, with both bright-field and fluorescence channels acquired automatically every 6 h.\u003c/p\u003e\n\u003cp\u003eImage analysis was performed using ImageJ 1.53t software. Scratch edges were measured at each time point using the \u0026ldquo;Straight line\u0026rdquo; tool, and the cell migration area was binarized with the \u0026ldquo;Threshold\u0026rdquo; algorithm.\u003c/p\u003e\n\u003cp\u003eMalondialdehyde (MDA) assay\u003c/p\u003e\n\u003cp\u003eLevels of malondialdehyde (MDA), a quantitative biomarker of ferroptosis, the measurement of the parameters was conducted as per manufacturer\u0026apos;s protocol, employing commercial MDA assay kit (Jiancheng Bioengineering, China).The transfected cells amalgamated with the kit reagents in order to prepare the reaction solution. Subsequent to the conclusion of the reaction, the sample tubes were placed in an ice-water bath for a period of 10 min, with the objective of terminating the reaction. The samples were then centrifuged at 3,500 \u0026times; g, 10 min, a duration of 15 min, with the purpose of separating precipitates.\u003c/p\u003e\n\u003cp\u003eThe analysis of the sample was conducted using a pre-warmed BioTek Synergy H1 multifunctional microplate reader, with the measurement of the sample\u0026apos;s extinction coefficient at 532 nm ( the primary wavelength) and 593 nm (the reference wavelength) undertaken under automatic path-length correction mode. A standard curve was generated using MDA a series of standard solutions (0 to 20 \u0026micro;M), processed in parallel, and fitted using a four-parameter logistic model. The calculation of sample MDA concentrations was performed by incorporating the dilution factor (1:3) and the reaction volume correction coefficient (200 \u0026micro;L/150 \u0026micro;L). Each sample was measured in triplicate, and background correction was performed using blank controls containing only lysis buffer. The acquisition and processing of data was conducted using SoftMax Pro 7.0 software, and mean values were reported for each sample.\u003c/p\u003e\n\u003cp\u003eReactive oxygen species (ROS) assay\u003c/p\u003e\n\u003cp\u003eWe measured ROS levels with a commercial kit (C1300, Solarbio).The cells were collected and prepared as a single-cell suspension. Following centrifugation at 3,500 rpm (~\u0026thinsp;2,200 \u0026times; g), the cell pellet was resuspended in a pre-prepared DCFH-DA probe working solution (Sigma-Aldrich, D6883) at 1 \u0026times; 10^6 cells/mL for 30 min. The cells were then subjected to a second round of centrifugation, after which the cell pellet was resuspended to yield a final cell suspension.\u003c/p\u003e\n\u003cp\u003eImages were acquired on an Olympus IX83 inverted fluorescence microscope, equipped with a U-FBNA the filter set utilised in this experiment exhibited (excitation/emission: 488 nm/525 nm)and a 20\u0026times; phase-contrast objective (NA 0.45). The exposure time was set to 300 millis, ensuring consistent conditions for the acquisition of light. Five random fields per sample were imaged, and the resulting images were stored in 16-bit TIFF format. Subsequently, the intensity of the fluorescence was measured and evaluated using ImageJ (v1.53t; NIH), with the mean integrated density per area used as the quantitative metric.\u003c/p\u003e\n\u003cp\u003eGlutathione (GSH) / glutathione disulfide (GSSG) assay\u003c/p\u003e\n\u003cp\u003eThe levels of glutathione (GSH) and oxidized glutathione (GSSG) used a kit purchased by Nanjing Jiancheng Bioengineering Institute to measure the total amount of reduced and oxidized glutathione. When making the standard curve, prepare the GSH and GSSG solutions inside according to the instructions. Cell samples must be first broken up with a liquid containing 0.1% Triton X-100, and then centrifuged to collect the supernatant for testing. The working solution was prepared in strict accordance with the prescribed instructions, following which absorbance was measured at 412 nm. The desired outcome was accomplished through the utilisation of a microplate reader, with measurements being obtained at 30 s and 10 min and 30 s. Subsequently, a GSH standard curve (0-100 \u0026micro;M) was generated. The total glutathion (GSH) and glutathion disulfide (GSSG) contents were calculated using the standard curve method, and the resulting GSH/GSSG ratios were subsequently calculated.\u003c/p\u003e\n\u003cdiv id=\"Sec3\"\u003e\n \u003ch2\u003eFerrous iron (Fe\u003csup\u003e2+\u003c/sup\u003e) level assay\u003c/h2\u003e\n \u003cp\u003eWe used the iron ion detection kit (Elabscience, Wuhan, China) to measure the concentration of ferrous ions in the cells. The transfected cells were then placed on ice to crush, and the resulting solution was centrifuged at 15,000 rpm for 15 minutes. Finally, carefully transfer the supernatant into a new tube, thus avoiding contact with any residual cell debris. Subsequent to the execution of the reaction procedure stipulated by the kit, the degree of light absorption was measured at a wavelength of 593 nm, employing a pre-warmed microplate reader that had been preheated for a duration of 30 min and possessed a wavelength calibration error of no more than 2 nm. Data are presented as the mean of triplicate assays.\u003c/p\u003e\n \u003cp\u003eWe made a calibration chart using ferrous sulfate heptahydrate (FeSO\u0026middot;7H O) solution, with solution concentrations ranging from 0 to 50 \u0026micro;M, dissolved in 0.1 M HCl to prevent oxidation. The standard curve was derived from triplicate measurements using a four-parameter logistic model (R\u0026sup2; \u0026gt;0.99). Fe\u0026sup2;⁺ concentrations in samples were calculated by applying the absorbance values, after blank subtraction, to the standard curve equation.\u003c/p\u003e\n \u003cp\u003eConstruction of the cell-line-derived tumor xenograft (CDTX) model\u003c/p\u003e\n \u003cp\u003eThe xenograft osteosarcoma model was established in nude mice using the CDTX approach. After transfection, H143B cells (ATCC, CRL-8303) were dispersed into a single cell suspension. We then injected this suspension subcutaneously into the left tibia of 36 four-week-old female BALB/c-nu mice purchased from Vital River in Beijing (SCXK2021 -0006).Subsequent to injection, the mice were observed on a daily basis for any general health concerns and local reactions at the injection site. Mice were humanely euthanized when tumor diameter reached 18 mm to comply with animal ethical regulations.\u003c/p\u003e\n \u003cp\u003eMagnetic resonance imaging (MRI)\u003c/p\u003e\n \u003cp\u003eFollowing the establishment of the murine osteosarcoma (OS) model, mice were anesthetized with isoflurane and placed in a supine position on a customized MRI animal bed (Bruker, T10220) for magnetic resonance imaging (MRI). Acquired data were exported as DICOM files and imported into the PACS system (RadiAnt, version 4.6.9) for three-dimensional reconstruction. 3D Slicer software (version 5.0.3) was used to generate a three-dimensional tumor model via Poisson surface reconstruction. Tumor volumes were calculated using voxel accumulation (V\u0026thinsp;=\u0026thinsp;\u0026Sigma;(voxel volume \u0026times; mask value)) and visualized with Blender software (version 2.93) for three-dimensional rendering.\u003c/p\u003e\n \u003cp\u003eNude mice were euthanized by overdose of inhalational anesthesia.\u003c/p\u003e\n \u003cp\u003eNude mice were euthanized using a rodent-specific euthanasia system (VetEquip, 901806). 24 h prior to the procedure, mice were transferred to individual quiet cages (Tecniplast, GM500) to minimize stress, with the environment maintained at 24\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C and 55\u0026thinsp;\u0026plusmn;\u0026thinsp;5% humidity. After euthanasia, carcasses were surface-disinfected with 10% formalin (China National Pharmaceutical, 10010018), placed in biohazard bags (Whirl-Pak, B01342), and stored at \u0026minus;\u0026thinsp;80\u0026deg;C (Thermo, 902-UP) for 24 h before transfer to a licensed medical waste disposal facility.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eValues are expressed as mean minus standard deviation (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD). Comparisons between groups were analyzed using Student\u0026apos;s t-test, and results with p values less than 0.05 were considered statistically significant. The relationship between microRNA and mRNA expression levels was measured using Spearman\u0026apos;s correlation coefficient, calculated using R software.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eExtraction and identification of exosomes\u003c/p\u003e\n\u003cp\u003eThe extraction of exosomal material was conducted from the osteosarcoma clinical samples that had been collected. Using TEM, the morphological characteristics of the vesicles were observed at a scale of 200 nm, showing a \u0026ldquo;double-layered disc-shaped\u0026rdquo; structure, consistent with typical exosome characteristics \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;2.\u003cstrong\u003eA)\u003c/strong\u003e. Further analysis via Western blot (WB) revealed that the exosome marker proteins HSP70 and TSG101 exhibited high levels of expression was detected in the exosome lysate, but the cytoplasmic marker calnexin was low.\u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;2.\u003cstrong\u003eB)\u003c/strong\u003e, further confirming the exosome nature of the extracted vesicles.\u003c/p\u003e\n\u003cp\u003eIdentification and validation of miR-875-3p as the critical regulatory factor in Osteosarcoma\u003c/p\u003e\n\u003cp\u003eBased on exosome microarray differential analysis \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;2C\u003cstrong\u003e)\u003c/strong\u003e, The results showed that the level of miRNA-875- 3p in exosomes isolated from osteosarcoma tumors was significantly higher than that in nearby healthy tissues. Further RT-qPCR testing confirmed that the expression of miR-875- 3p in osteosarcoma cell line H143B was much higher than that in normal osteoblasts.\u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;2D\u003cstrong\u003e)\u003c/strong\u003e. Furthermore, RT-qPCR of paired osteosarcoma and non-tumorous tissues from patients revealed that the expression level of miRNA-875-3p was significantly higher in osteosarcoma tissue than in adjacent non-cancerous tissue. \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;2E\u003cstrong\u003e)\u003c/strong\u003e, indicating that miRNA-875-3p can be considered a key regulatory factor in osteosarcoma.\u003c/p\u003e\n\u003cp\u003eIdentification and validation of SLC39A14 as a downstream target of miR-875-3p\u003c/p\u003e\n\u003cp\u003eThe identification of the targets of miRNA-875-3p was facilitated by the utilisation of the miRDB database, which was employed to predict downstream messenger ribonucleic acids (mRNAs) based on target score rankings. Among the array of candidate mRNAs, SLC39A14 was distinguished as the pivotal mRNA. \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;3A\u003cstrong\u003e)\u003c/strong\u003e.Further dual-luciferase assays revealed the binding site of miRNA-875-3p, thereby demonstrating that the fluorescence levels of has-miRNA-875-3p\u0026thinsp;+\u0026thinsp;SLC39A14-wt were significantly reduced in comparison to the mutant group and the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). This finding indicates a direct binding effect between the two. \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;3B\u003cstrong\u003e)\u003c/strong\u003e. Subsequently, RT-qPCR analysis of five Osteosarcoma cell lines and osteoblasts showed that SLC39A14 was significantly downregulated in Osteosarcoma \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;3C\u003cstrong\u003e)\u003c/strong\u003e. Similarly, RT-qPCR results from Osteosarcoma tissue and its matched adjacent non-cancerous tissue also indicated that SLC39A14 expression levels were significantly lower in Osteosarcoma tissue than in adjacent non-cancerous tissue \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;3D\u003cstrong\u003e)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eTransfection and verification of the miR-875-3p/SLC39A14 axis\u003c/p\u003e\n\u003cp\u003eUsing lentivirus (LV) and adenovirus (ADV) transfection, we knocked down miR-875-3p/SLC39A14 in H143B cells and validated the significant transfection effect via RT-qPCR: Group II showed significantly lower miR-875-3p expression compared to Group I (NC), and Group IV showed significantly lower SLC39A14 expression compared to Group III (NC). To further validate the regulatory role of miR-875-3p on SLC39A14, SLC39A14 expression was detected in the miR-875-3p knockdown and corresponding NC groups. via RT-qPCR. SLC39A14 expression was found to correlate negatively with miR-875-3p, thereby confirming an expression regulatory relationship between the two. \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;4.\u003cstrong\u003eA-C)\u003c/strong\u003e.\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eList of primer sequences.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003eGene Name\u003cbr\u003e\u003c/th\u003e\n \u003cth align=\"left\"\u003ePrimer\u003cbr\u003e\u003c/th\u003e\n \u003cth align=\"left\"\u003ePrimer Sequence (5\u0026apos;\u0026rarr;3\u0026apos;)\u003cbr\u003e\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eGAPDH-F\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eForward primer\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eAATCAAGTGGGGCGATGCTG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eGAPDH-R\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eReversed primer\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eGCAAATGAGCCCCAGCCTTC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eGPX4-F\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eForward primer\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eAGGACATCGACGGGCACAT\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eGPX4-R\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eReversed primer\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eGTTACTCCCTGGCTCCTGCTTC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eACSL4-F\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eForward primer\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eTTGGCTACTTGCCTTTGGCTC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eACSL4-R\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eReversed primer\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eCGGAACAGCAGCCATAAGTGT\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eXCT-F\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eForward primer\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eGGGTCCTGTCACTATTTGGAGC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eXCT-R\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eReversed primer\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eAGGAGTTCCACCCAGACTCG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003emiR-875-3p-F\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eForward primer\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eCTACACCTACCACTGTGTCTGC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003emiR-875-3p-R\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eReversed primer\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eAAGCCATGGGAGGATTAGCTG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eSLC39A14-F\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eForward primer\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eCCAGCCAAATGGAAATCAGGATG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eSLC39A14-R\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eReversed primer\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eTGGGCGGTGTAGAATCAGAGT\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eEffects of miR-875-3p/SLC39A14 Expression on the Proliferation, Invasion, and Migration of Osteosarcoma Cells in Vitro\u003c/p\u003e\n\u003cp\u003eThe in vitro viability of osteosarcoma cells was used CCK-8 assay. Demonstrated that the depletion of miRNA-875-3p led to a substantial decline in osteosarcoma cell viability. Group II showed significantly lower cell survival compared to Group I.\u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;4D\u003cstrong\u003e)\u003c/strong\u003e. The results of the scratch assay indicated a statistically significant difference in the wound healing rates between Group II (33.21%) and Group I (45.20%). \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;4E\u003cstrong\u003e)\u003c/strong\u003e. In the Transwell assay, a statistically significant decrease in the number of invasive cells was observed in Group II compared to Group I. In summary, the findings indicate that the suppression of miR-875-3p impedes the invasive, migratory and proliferative capabilities of osteosarcoma cells. \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;6E\u0026ndash;F\u003cstrong\u003e)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eThe CCK-8 assay in the SLC39A14 knockdown experiment showed that cell viability was higher in the IV group than in the III group, indicating that knockdown of SLC39A14 promoted osteosarcoma cell viability. The scratch assay revealed that the cell healing rates of Groups IV and III were 59.95% and 45.90%, respectively. These results suggest that knocking down SLC39A14 enhances the migration capability of osteosarcoma cells, as the migration and proliferation capabilities of cells in Group IV were higher than those in Group III. In the Transwell assay, the number of cells that migrated through the membrane was also higher in Group IV than in Group III. These results consistently suggest that knocking down SLC39A14 enhances the invasion, migration and proliferation capabilities of osteosarcoma cells. \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;6. \u003cstrong\u003eE\u0026ndash;F)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eEffects of the miR-875-3p/SLC39A14 axis on ferroptosis in vitro experiments\u003c/p\u003e\n\u003cp\u003eThis study wanted to see what role miRNA-875- 3p plays in iron death in osteosarcoma and identify related iron death biomarkers. Laboratory analysis found that the concentration of Fe\u0026sup2; in Group II was higher than that in Group I. Moreover, Group II has a lower GSH/GSSG ratio than Group I. When detecting reactive oxygen species (ROS), Group II had stronger fluorescence intensity and higher malondialdehyde (MDA) levels than Group I, indicating increased oxidative stress. Using reverse transcription quantitative polymerase chain reaction (RT-qPCR), we measured the expression of several messenger RNAs (mRNA) associated with iron death. The results showed that GPX4 and xCT were expressed less in Group II than in Group I, but ACSL4 was expressed more. Later, Western blot experiments verified these results at the protein level, confirming that Group II\u0026apos;s GPX4 and xCT did decrease, while ACSL4 increased. \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;5.\u003cstrong\u003eA\u0026ndash;E\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eFurther evaluation of the role of SLC39A14 in ferroptosis revealed that Fe\u0026sup2;⁺ levels were lower in Group IV than in Group III. The GSH/GSSG ratio was found to be higher in Group IV than in Group III. In the context of ROS detection, Group IV exhibited a fluorescence intensity that was weaker in comparison to Group III. Concurrently, Group IV demonstrated reduced levels of MDA, thereby indicating a potential decline in oxidative stress levels. RT-qPCR was utilised to detect the expression levels of multiple ferroptosis-related mRNAs in vitro. The results demonstrated that, in comparison with Group III, the expression levels of GPX4 and xCT were elevated in Group IV, while the expression level of ACSL4 was reduced. Western blot (WB) analysis further confirmed that at the protein level, the expression of GPX4 and xCT was higher in Group IV than in Group III, while the expression of ACSL4 was lower in Group IV than in Group III \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;6.\u003cstrong\u003eA\u0026ndash;E)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eThe results of miR-875-3p inhibits the ferroptosis process in osteosarcoma cells by targeting SLC39A14.\u003c/p\u003e\n\u003cp\u003eEffects of miR-875-3p/SLC39A14 expression on osteosarcoma cell proliferation and migration in vivo\u003c/p\u003e\n\u003cp\u003eMRI scans were performed, and maximum cross-sectional the area of osteosarcoma was measured 3 weeks after inoculation of osteosarcoma cells into nude mice. The results demonstrated that the average area of osteosarcoma in Group II was 4.23 cm\u0026sup2;, significantly lower than the average volume of 6.93 cm\u0026sup2; in Group I; the average volume of osteosarcoma in Group IV was 12.82 cm\u0026sup2;, significantly higher than the average volume of 6.96 cm\u0026sup2; in Group III \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;6A\u003cstrong\u003e)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eEffects of the miR-875-3p/SLC39A14 axis on the ferroptosis mechanism in osteosarcoma in vivo experiments\u003c/p\u003e\n\u003cp\u003eRT-qPCR and Western blot analysis used to detect the expression levels of ferroptosis-related mRNAs and proteins in tissues collected from osteosarcoma patients. The results demonstrated that, in comparison with Group I, the expression levels of GPX4 and xCT were diminished in Group II, whilst the expression level of ACSL4 was augmented. This suggests that the suppression of miR-875-3p facilitates the process of ferroptosis. In addition, the comparative analysis of Groups III and IV revealed that the expression levels of GPX4 and xCT were elevated in Group IV compared to Group III. Conversely, the expression level of ACSL4 was diminished in Group IV relative to Group III. \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;6.\u003cstrong\u003eB-C)\u003c/strong\u003e.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOsteosarcoma has been identified as a common primary malignant bone tumour, which accounts for a certain proportion of clinical bone tumor occurrences. Meanwhile, due to its high disability rate and poor prognosis, targeted therapy for osteosarcoma has always been a research focus. Exosomes are tiny intercellular vesicles synthesized by cancer cells. They carry miRNAs and a variety of proteins and are secreted into the extracellular microenvironment, participate in the formation of a pro-cancer growth environment, and promote tumor development. It has been proven that exosomes play a key role in migration, invasion, and cellular activities of other types of tumors: for example, the present study hypothesises that exosomal factors may contribute to a reduction in the sensitivity of lung adenocarcinoma to ferroptosis.[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]; tumor-derived exosomes induce the process of M2 polarization of macrophages critically promotes liver metastasis in colorectal cancer cases.[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]; exosomes regulate the proliferation and apoptosis of osteosarcoma, facilitate intercellular communication among osteosarcoma cells, and assist in the metastasis of osteosarcoma, are new target for targeted therapy[\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].Classified as small single-stranded RNAs, they carried by exosomes, accumulating evidence implicates miRNAs in osteosarcoma development.The miR-875-3p/PF4V1 axis can inhibit the proliferation and migration of osteosarcoma cell lines[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], and the LncRNA SNHG3/miRNA-151a-3p/RAB22A axis can regulate The present study will examine the invasion and migration of osteosarcoma[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].miRNA-133b exhibits osteosarcoma-inhibiting activity[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Based on the above studies, exosome-mediated miRNAs have great potential in the targeted therapy of osteosarcoma.\u003c/p\u003e\u003cp\u003eThis experiment involved sequencing the exosomes of clinically collected osteosarcoma tissues.The expression of miR-875-3p differed significantly between cancerous and adjacent non-cancerous tissues.The expression of miR-875-3p was determined by RT-qPCR and Western blot in osteosarcoma tissues, revealing that its expression was upregulated. We hypothesise miR-875-3p is positive role in promoting osteosarcoma development. Since microRNAs (miRNAs) mainly exert their functions at the post-transcriptional level, they affect the corresponding protein levels through complementarity with the sequences of their target messenger RNAs (mRNAs). Through the miRDB database, SLC39A14, the downstream target molecule of miR-875-3p, was further screened out.As an intracellular zinc and metal ion transporter, SLC39A14 is associated with the development of various tumors. Existing literature suggests that it can promote the proliferation of gliomas[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]; in hepatocellular carcinoma, the down-regulation of SLC39A14 expression protects hepatocellular carcinoma from the tumor-suppressive effect of zinc [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]; the decreased expression of SLC39A14 promotes aggressive progression of prostate cancer.[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. However, there are relatively few studies on the role of SLC39A14 in osteosarcoma. Based on the promoting effect of high levels of miR-875-3p on the development of osteosarcoma and the promoting effect of low levels of SLC39A14 on tumor development, we hypothesize that there may be a negative regulatory relationship between miR-875-3p and SLC39A14, and they jointly promote the development of osteosarcoma.The Dual-Luciferase assay confirmed the direct targeting of SLC39A14 by miR-875-3p. demonstrated that this gene is a direct target of microRNA-875-3p. Further analysis of the expression levels of miR-875-3p and SLC39A14 in tissues revealed a negative correlation between the levels of miR-875-3p and SLC39A14 in osteosarcoma tissues. Moreover, high levels of miR-875-3p were observed to be concomitant with low mRNA and protein levels of SLC39A14. Supports that miR-875-3p promotes osteosarcoma growth and spread by reducing SLC39A14 levels.\u003c/p\u003e\u003cp\u003eThe present study was predicated on the findings of transfection experiments. In order to study the role of the miR-875- 3p/SLC39A14 pathway in the invasion and migration of osteosarcoma cells, we conducted a series of experiments in the laboratory and in vivo. The results of the wound healing experiment showed that cell scratches healed more slowly in the group with reduced miR-875- 3p than in the untreated group. This suggests that reducing the level of miR-875- 3p can hinder cell movement, thereby slowing tumor development.The experimental group, which exhibited SLC39A14 knockdown, demonstrated a superior healing rate in comparison to the control group, thereby suggesting that SLC39A14 suppression may facilitate tumour progression. In the CCK-8 experiment, the miR-875-3p knockdown group had lower cell viability, while the SLC39A14 knockdown group had higher cell viability. In the nude mouse model, the tumour volume in the group exhibiting low levels of miR-875-3p expression was found to be diminished, and the growth of osteosarcoma was inhibited; the volume of the neoplasm in the group with low SLC39A14 expression was larger, and tumor growth was promoted. According to the experimental results, we believe that exosome-mediated miR-875-3p modulates osteosarcoma proliferation and migration by regulating SLC39A14 expression/activity.\u003c/p\u003e\u003cp\u003eThe specific mechanism by which the miR-875-3p/SLC39A14 axis acts on osteosarcoma has not been reported yet. However, in studies on other tumors, it has been found that knocking out SLC39A14 can promote ferritin deposition and inhibit the progression of gliomas[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e];expression levels of SLC39A14 is a prognostic factor in ESCC. [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]; mesenchymal hepatocytes prevent SLC39A14-dependent ferroptosis in hepatocytes through exosomal miR-16-5p[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], and mesenchymal hepatocytes also alleviate ferroptosis in hepatocytes through exosome-transferred miR-1275[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. These findings suggest that the miR-875-3p/SLC39A14 axis may exert its effect on osteosarcoma by regulating ferroptosis in osteosarcoma cells.Ferroptosis is an emerging research focus in cell apoptosis, and its main mechanisms include glutathione (GSH) imbalance, imbalances in iron homeostasis and elevated ROS levels. The mechanism of GSH imbalance, glutathione peroxidase 4 (GPX4) plays an important role. With GSH as a substrate, GPX4 converts cytotoxic peroxides into non-toxic hydroxyl groups, protecting cell membranes from the attack of peroxides, maintaining normal physiological functions, and thereby inhibiting ferroptosis in cancer cells[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Iron metabolism disorder is one of the mechanisms of ferroptosis[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], mainly manifested as iron accumulation.Iron is a double-edged sword, being essential for physiology but cytotoxic in excess. The accumulation of ROS is also one of the mechanisms of ferroptosis. GPX4/GSH depletion triggers ROS accumulation. ROS accumulated intracellularly can damage cell membranes and induce cell apoptosis[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Based on the above mechanisms of ferroptosis, we specifically detected the intracellular ROS levels, Fe\u0026sup2;⁺/Fe\u0026sup3;⁺ levels, and GSH/GSSG levels in each transfection group.\u003c/p\u003e\u003cp\u003eIn addition, this study also determined the expression levels of typical ferroptosis biomarkers, including acyl-CoA synthetase 4 (ACSL4), cystine/glutamate antiporter (xCT), and GPX4, to evaluate the level of intracellular ferroptosis. Research indicates that ACSL4 expression is modulated by miRNAs delivered via exosomes. For example, in lung cancer, exosomes can transfer miR-424 into cells, thereby down-regulating the expression of ACSL4 and inhibiting ferroptosis [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]; cancer-associated fibroblasts eliminate the inhibitory effect of ACSL4 on ferroptosis in pancreatic cancer cells by secreting exosomal miRNAs[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Studies confirm that the ferroptosis-related protein xCT (SLC7A11) is post-transcriptionally regulated by miRNAs delivered via exosomes, a process essential for preserving the intracellular redox balance. For example, microRNAs encoded by Kaposi's sarcoma-associated herpesvirus (KSHV) up-regulate xCT, improving the resistance of KSHV to the oxidative stress environment [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Findings from this study revealed that ​suppressed miR-875-3p expression promotes​ferroptosis, leading to the ​inhibition​of osteosarcoma proliferation and migration. ​In contrast, ​low levels of SLC39A14 antagonize​ferroptosis, thereby enhancing​tumor proliferation.\u003c/p\u003e\u003cp\u003eThis study demonstrates several methodological and design strengths. Firstly, the CDTX model was employed for in vivo investigations, offering a closer simulation of physiological environments and thereby thereby improving the clinical translatability of the results. Secondly, exosomes isolated directly from osteosarcoma tissues were subjected to sequencing. Tissue-derived exosomes capture the tumor microenvironment\u0026rsquo;s composition more precisely than serum exosomes, allowing a clearer exploration of intercellular communication within the tumor niche and its impact on proximate cells. Furthermore, through downregulation of miR-875-3p and SLC39A14, this research systematically examined several potential pathways involved in ferroptosis, thus establishing the miR-875-3p/SLC39A14 axis as a key regulator of this cell death process. However, several limitations should be considered.The sample size across experimental groups was limited, he consequences of upregulating miR-875-3p or SLC39A14 in osteosarcoma remain uninvestigated. Additionally, functional rescue assays were not performed, leaving validations for these interactions dependent on future research. Crucially, as the experiments were not replicated in human models, the applicability of these results to human osteosarcoma remains undetermined. Thus, further investigation is essential to elucidate the mechanistic relationships among miRNAs, ferroptosis, and osteosarcoma progression.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, through the study of miR-875-3p, combining multiple levels including clinical, cellular, and animal experiments, this paper found that under the mediation of exosomes, miR-875-3p plays a positive role in the treatment of osteosarcoma, and inhibiting its expression can inhibit tumor proliferation and migration. It also revealed that SLC39A14 may be a key factor for it to exert its function. At the same time, it further explored that the physiological role of the miR-875-3p/SLC39A14 axis may depend on inhibiting ferroptosis in osteosarcoma cells, providing new biological therapeutics and targets for the clinical targeted therapy of osteosarcoma, and providing positive value for subsequent research. It is a meaningful step towards ultimately improving the cure rate of osteosarcoma, improving the prognosis of patients, and alleviating the suffering of patients.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"636\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eEnglish Abbreviation\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003cstrong\u003eFull Form in English\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eOS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eosteosarcoma\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNanoparticle Tracking Analysis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eRT-qPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse Transcription-quantitative Polymerase Chain Reaction\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCK-8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCell Counting Kit-8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eROS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReactive Oxygen Species\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMDA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMalondialdehyde\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eWB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eWestern Blot\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTEM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTransmission electron microscopy\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMRI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMagnetic Resonance Imaging\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003emiRDB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003emicro-RNA \u0026nbsp;Database\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHematoxylin-eosin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCDTX\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eConstruction of the cell-line-derived tumor xenograft\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePUFA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePolyunsaturated fatty acids\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Ethics Committee of Guangxi Medical University, and all procedures were conducted in accordance with the Declaration of Helsinki and China\u0026apos;s Measures for the Ethical Review of Biomedical Research Involving Humans.\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003eAvailability of data and materials\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of anycommercial or financial relationships that could be construed as a potentialconflict of interest.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Guangxi Natural Science Foundation (Grant No. 2024GXNSFAA010400)\u003c/p\u003e\n\u003cp\u003eAuthors\u0026apos; Contributions\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eJ.H., J.H. and L.L. contributed equally to this work. J.H. designed the study and analyzed the data. J.H. performed the majority of the experiments. L.L. conducted data curation and formal analysis. K.Z., S.W. and J.C. provided critical reagents and technical assistance. Y.D., Z.Y. and C.S. participated in animal model preparation. \u0026nbsp;M.J. and Z.B. supervised the project, acquired funding, and are co-corresponding authors. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003eAcknowledgments\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBielack SS, Kempf-Bielack B, Delling G, Exner GU, Flege S, Helmke K, et al. Prognostic factors in high-grade osteosarcoma of the extremities or trunk: an analysis of 1,702 patients treated on neoadjuvant cooperative osteosarcoma study group protocols. J Clin Oncol. 2002;20(3):776\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarko TA, Diessner BJ, Spector LG. Prevalence of Metastasis at Diagnosis of Osteosarcoma: An International Comparison. Pediatr Blood Cancer. 2016;63(6):1006\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAnderson ME. Update on Survival in Osteosarcoma. Orthop Clin North Am. 2016;47(1):283\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSong XJ, Bi MC, Zhu QS, Liu XL. The emerging role of lncRNAs in the regulation of osteosarcoma stem cells. Eur Rev Med Pharmacol Sci. 2022;26(3):966\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi S, Zhang H, Liu J, Shang G. Targeted therapy for osteosarcoma: a review. J Cancer Res Clin Oncol. 2023;149(9):6785\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlbarran V, Villamayor ML, Chamorro J, Rosero DI, Pozas J, San Roman M et al. Receptor Tyrosine Kinase Inhibitors for the Treatment of Recurrent and Unresectable Bone Sarcomas. Int J Mol Sci. 2022;23(22).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNg AJ, Mutsaers AJ, Baker EK, Walkley CR. Genetically engineered mouse models and human osteosarcoma. Clin Sarcoma Res. 2012;2(1):19.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu J, Feng Y, Ke Z, Yang Z, Zhou J, Huang X, et al. Down-regulation of miR-183 promotes migration and invasion of osteosarcoma by targeting Ezrin. Am J Pathol. 2012;180(6):2440\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi SS, Zhu HJ, Li JY, Tian LM, Lv DM. MiRNA-875-3p alleviates the progression of colorectal cancer via negatively regulating PLK1 level. Eur Rev Med Pharmacol Sci. 2020;24(3):1126\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTong JL, Wang LL, Ling XF, Wang MX, Cao W, Liu YY. MiR-875 can regulate the proliferation and apoptosis of non-small cell lung cancer cells via targeting SOCS2. Eur Rev Med Pharmacol Sci. 2019;23(12):5235\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Z, Zhou L, Zhou S, Li X. Circular RNA hsa_circ_0069117 suppresses proliferation and migration of osteosarcoma cells lines via miR-875-3p/PF4V1 axis. J Orthop Surg Res. 2022;17(1):37.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu W, Long Q, Zhang W, Zeng D, Hu B, Liu S, et al. miRNA-221-3p derived from M2-polarized tumor-associated macrophage exosomes aggravates the growth and metastasis of osteosarcoma through SOCS3/JAK2/STAT3 axis. Aging. 2021;13(15):19760\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRaimondi L, De Luca A, Gallo A, Costa V, Russelli G, Cuscino N, et al. Osteosarcoma cell-derived exosomes affect tumor microenvironment by specific packaging of microRNAs. Carcinogenesis. 2020;41(5):666\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYe Z, Zheng Z, Peng L. MicroRNA profiling of serum exosomes in patients with osteosarcoma by high-throughput sequencing. J Investig Med. 2020;68(4):893\u0026ndash;901.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang JW, Wu XF, Gu XJ, Jiang XH. Exosomal miR-1228 From Cancer-Associated Fibroblasts Promotes Cell Migration and Invasion of Osteosarcoma by Directly Targeting SCAI. Oncol Res. 2019;27(9):979\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012;149(5):1060\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD'Arcy MS. Cell death: a review of the major forms of apoptosis, necrosis and autophagy. Cell Biol Int. 2019;43(6):582\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCao JY, Dixon SJ. Mechanisms of ferroptosis. Cell Mol Life Sci. 2016;73(11\u0026ndash;12):2195\u0026ndash;209.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSeibt TM, Proneth B, Conrad M. Role of GPX4 in ferroptosis and its pharmacological implication. Free Radic Biol Med. 2019;133:144\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYan YZ, Yuan L, Li WX, Li S, Bian JC, Wang GD. Research progress on the mechanism of ferroptosis in osteosarcoma. Zhongguo Yi Shi Za Zhi. 2024;26(1):142\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRu Q, Li Y, Chen L, Wu Y, Min J, Wang F. Iron homeostasis and ferroptosis in human diseases: mechanisms and therapeutic prospects. Signal Transduct Target Ther. 2024;9(1):271.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang X, Xu Y, Ma L, Yu K, Niu Y, Xu X, et al. Essential roles of exosome and circRNA_101093 on ferroptosis desensitization in lung adenocarcinoma. Cancer Commun (Lond). 2022;42(4):287\u0026ndash;313.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao S, Mi Y, Guan B, Zheng B, Wei P, Gu Y, et al. Tumor-derived exosomal miR-934 induces macrophage M2 polarization to promote liver metastasis of colorectal cancer. J Hematol Oncol. 2020;13(1):156.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSha L, Ma D, Chen C. Exosome-mediated Hic-5 regulates proliferation and apoptosis of osteosarcoma via Wnt/beta-catenin signal pathway. Aging. 2020;12(23):23598\u0026ndash;608.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSarhadi VK, Daddali R, Seppanen-Kaijansinkko R. Mesenchymal Stem Cells and Extracellular Vesicles in Osteosarcoma Pathogenesis and Therapy. Int J Mol Sci. 2021;22(20).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu SC, Kim A, Gu Y, Martinez DI, Zocchi L, Chen CC, et al. UHRF1 overexpression promotes osteosarcoma metastasis through altered exosome production and AMPK/SEMA3E suppression. Oncogenesis. 2022;11(1):51.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZheng S, Jiang F, Ge D, Tang J, Chen H, Yang J, et al. LncRNA SNHG3/miRNA-151a-3p/RAB22A axis regulates invasion and migration of osteosarcoma. Biomed Pharmacother. 2019;112:108695.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGao G, Tian Z, Zhu HY, Ouyang XY. miRNA-133b targets FGFR1 and presents multiple tumor suppressor activities in osteosarcoma. Cancer Cell Int. 2018;18:210.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Wu X, Zhu J, Lu R, Ouyang Y. Knockdown of SLC39A14 inhibits glioma progression by promoting erastin-induced ferroptosis SLC39A14 knockdown inhibits glioma progression. BMC Cancer. 2023;23(1):1120.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFranklin RB, Levy BA, Zou J, Hanna N, Desouki MM, Bagasra O, et al. ZIP14 zinc transporter downregulation and zinc depletion in the development and progression of hepatocellular cancer. J Gastrointest Cancer. 2012;43(2):249\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu XM, Wang CG, Zhu YD, Chen WH, Shao SL, Jiang FN, et al. Decreased expression of SLC 39A14 is associated with tumor aggressiveness and biochemical recurrence of human prostate cancer. Onco Targets Ther. 2016;9:4197\u0026ndash;205.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao M, Li M, Zheng Y, Hu Z, Liang J, Bi G, et al. Identification and analysis of a prognostic ferroptosis and iron-metabolism signature for esophageal squamous cell carcinoma. J Cancer. 2022;13(5):1611\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeng Z, Zeng W, Gao Y, Yang Z, Luo X, Li X, et al. Mesenchymal Stem Cells Prevent SLC39A14-Dependent Hepatocyte Ferroptosis through Exosomal miR-16-5p in Liver Graft. Adv Sci (Weinh). 2025;12(6):e2411380.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGong Y, You Q, Yuan X, Zeng F, Zhang F, Xiao J, et al. Mesenchymal stem cell-derived extracellular vesicles attenuate ferroptosis in aged hepatic ischemia/reperfusion injury by transferring miR-1275. Redox Biol. 2025;81:103556.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang WS, SriRamaratnam R, Welsch ME, Shimada K, Skouta R, Viswanathan VS, et al. Regulation of ferroptotic cancer cell death by GPX4. Cell. 2014;156(1\u0026ndash;2):317\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGao M, Monian P, Quadri N, Ramasamy R, Jiang X. Glutaminolysis and Transferrin Regulate Ferroptosis. Mol Cell. 2015;59(2):298\u0026ndash;308.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTuo QZ, Lei P, Jackman KA, Li XL, Xiong H, Li XL, et al. Tau-mediated iron export prevents ferroptotic damage after ischemic stroke. Mol Psychiatry. 2017;22(11):1520\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZuo YB, Zhang YF, Zhang R, Tian JW, Lv XB, Li R, et al. Ferroptosis in Cancer Progression: Role of Noncoding RNAs. Int J Biol Sci. 2022;18(5):1829\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDai SM, Li FJ, Long HZ, Zhou ZW, Luo HY, Xu SG, et al. Relationship between miRNA and ferroptosis in tumors. Front Pharmacol. 2022;13:977062.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQi R, Bai Y, Li K, Liu N, Xu Y, Dal E, et al. Cancer-associated fibroblasts suppress ferroptosis and induce gemcitabine resistance in pancreatic cancer cells by secreting exosome-derived ACSL4-targeting miRNAs. Drug Resist Updat. 2023;68:100960.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBilicki CV, White JL, Hem SL, Borin MT. Effect of anions on adsorption of bile salts by colestipol hydrochloride. Pharm Res. 1989;6(9):794\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-orthopaedic-surgery-and-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"josr","sideBox":"Learn more about [Journal of Orthopaedic Surgery and Research](http://josr-online.biomedcentral.com)","snPcode":"13018","submissionUrl":"https://submission.nature.com/new-submission/13018/3","title":"Journal of Orthopaedic Surgery and Research","twitterHandle":"@MSKmedBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Osteosarcoma, Exosomes, MiR-875-3p, SLC39A14, Ferroptosis","lastPublishedDoi":"10.21203/rs.3.rs-8181974/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8181974/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eOsteosarcoma is a common primary bone malignancy with a complex pathogenesis and poor prognosis. Dysregulated expression of multiple microRNAs (miRNAs) has been observed in osteosarcoma tissues and cells, where they regulate proliferation, apoptosis, invasion, and metastasis. The results reveal that miRNAs may serve as diagnostic biomarkers and therapeutic targets, providing new opportunities for early diagnosis and personalized treatment of osteosarcoma.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eWe first employed bioinformatics analyses combined with dual-luciferase reporter assays and reverse transcription quantitative polymerase chain reaction (RT-qPCR) to identify and validate key miRNAs and mRNAs in osteosarcoma (OS). Transmission electron microscopy (TEM) and western blotting (WB) were used to explore and confirm exosomes. Lentiviral (LV) and adenoviral (ADV) transfection were applied to downregulate candidate miRNAs and mRNAs, followed by in vitro functional assays in OS cell lines. Cell viability, migration, and invasion were evaluated using CCK-8 and wound-healing assays. GSH/GSSG ratio, Fe\u0026sup2;⁺, ROS, and MDA levels were measured with commercial kits, while RT-qPCR and WB were used to detect ferroptosis-related mRNA and protein expression. Finally, a nude mouse xenograft model was established to assess the effects of miRNA and mRNA downregulation on tumorigenesis in vivo.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eIn osteosarcoma (OS) cell lines and tissues, miR-875-3p was found to be upregulated, whereas SLC39A14 was downregulated. Knockdown of miR-875-3p promoted ferroptosis and inhibited the proliferation, invasion, and migration of OS cells, while knockdown of SLC39A14 exerted the opposite effects. Moreover, RT-qPCR analysis showed a negative correlation between SLC39A14 and miR-875-3p expression, confirming their regulatory relationship.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003emiR-875-3p inhibits ferroptosis by downregulating SLC39A14 expression, thereby affecting the proliferation, migration, and invasion of osteosarcoma (OS) cells both in vivo and in vitro.\u003c/p\u003e","manuscriptTitle":"The Role and Mechanism of Exosome-Mediated miR-875-3p in Targeting SLC39A14 to Regulate Ferroptosis in Osteosarcoma Proliferation, Migration, and Invasion","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-05 16:05:45","doi":"10.21203/rs.3.rs-8181974/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-30T08:53:42+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-25T12:18:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"168332278664881457198597877828765168095","date":"2025-12-20T09:40:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"214445551223264264174758359535517196952","date":"2025-12-05T13:42:45+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-01T10:22:51+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-25T02:20:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-25T02:18:57+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Orthopaedic Surgery and Research","date":"2025-11-22T17:45:08+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-orthopaedic-surgery-and-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"josr","sideBox":"Learn more about [Journal of Orthopaedic Surgery and Research](http://josr-online.biomedcentral.com)","snPcode":"13018","submissionUrl":"https://submission.nature.com/new-submission/13018/3","title":"Journal of Orthopaedic Surgery and Research","twitterHandle":"@MSKmedBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6b0bea5c-cf5b-4022-b55a-fc4e1680b3ae","owner":[],"postedDate":"December 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-04-27T16:09:30+00:00","versionOfRecord":{"articleIdentity":"rs-8181974","link":"https://doi.org/10.1186/s13018-026-06830-3","journal":{"identity":"journal-of-orthopaedic-surgery-and-research","isVorOnly":false,"title":"Journal of Orthopaedic Surgery and Research"},"publishedOn":"2026-04-25 15:58:30","publishedOnDateReadable":"April 25th, 2026"},"versionCreatedAt":"2025-12-05 16:05:45","video":"","vorDoi":"10.1186/s13018-026-06830-3","vorDoiUrl":"https://doi.org/10.1186/s13018-026-06830-3","workflowStages":[]},"version":"v1","identity":"rs-8181974","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8181974","identity":"rs-8181974","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00