Distinct Host Susceptibility and Periodontal Microbiome Shape Oral Neutrophil Priming in Molar– Incisor versus Generalized Periodontitis

preprint OA: closed
Full text JSON View at publisher
Full text 106,288 characters · extracted from preprint-html · click to expand
Distinct Host Susceptibility and Periodontal Microbiome Shape Oral Neutrophil Priming in Molar– Incisor versus Generalized Periodontitis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Distinct Host Susceptibility and Periodontal Microbiome Shape Oral Neutrophil Priming in Molar– Incisor versus Generalized Periodontitis Juan Khoury, Bshara Haloun, nadav Musai, Kfir Hayouka, Esti Davidovich, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6964222/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 09 Mar, 2026 Read the published version in Scientific Reports → Version 1 posted 13 You are reading this latest preprint version Abstract The study aimed to compare oral neutrophil (oNeut) functions in molar–incisor pattern periodontitis (MIPP), generalized periodontitis (GP), and periodontally healthy subjects, and to explore how biofilm exposure shapes these functions. oNeut were isolated from healthy, GP, and MIPP volunteers (n=10 per group) and challenged ex vivo with Aggregatibacter actinomycetemcomitans JP2. Reactive oxygen species (ROS) production, cell viability, and cytokine release were quantified post-infection. Separately, healthy oNeut were exposed to de novo biofilms modeling healthy, GP, or MIPP microbiomes, and their functional responses were assessed. Results show that periodontitis patients (GP and MIPP) had higher baseline oNeut counts but exhibited reduced resistance to necrosis and lower ROS output after JP2 challenge than controls; JP2‐stimulated ROS was significantly lower than both HOCl‐treated and naïve controls. MIPP oNeut secreted more TNFα, CCL2, OPG, and RANKL than GP, whereas GP displayed a higher OPG/RANKL ratio. Except for TNFα and IL-1β, all measured mediators were elevated in healthy oNeut versus those from periodontitis groups. Under dysbiotic versus symbiotic biofilm challenge, healthy oNeut produced less ROS but secreted higher TNFα, OPG, and RANKL. Overall, periodontitis patients oNeut exhibit distinct oxidative and cytokine responses to JP2, reflecting host-specific and biofilm-driven priming. Health sciences/Diseases/Oral diseases Biological sciences/Immunology/Mucosal immunology Oral neutrophils periodontal diagnosis biofilm Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Periodontitis is an inflammation-mediated alveolar bone loss condition. Periodontal inflammation is initiated and perpetuated by a chronic presence of the dysbiotic microbiome in the periodontal pockets. This condition has two main distinct phenotypes – generalized periodontitis (GP, previously termed chronic periodontitis) and molar-incisor pattern periodontitis (MIPP, previously termed aggressive periodontitis), with a non-resolved debate as to whether these phenotypes represent two constitutions of the same pathology or similar constitutions of two different pathologies. While conditions of periodontal diseases are associated with dysfunctional host-mediated tissue destruction, GP and MIPP differ in their dysbiotic microbiome; the GP dysbiotic microbiome is diverse and has a disordered structure, pathogenic microbiota, and host-destructive metabolism pathways 1 . This pathogenic microbiota consists of different gram-negative species that outgrow health-associated taxa. Among the enriched species are the classical red-complex triad consisting of Treponema denticola , Porphyromonas gingivalis , and Tanneralla forsythia . Several other Treponema spp. also appear to be abundant components of periodontitis communities, in agreement with classic microscopy studies that indicate the abundance of spirochaetes 2 . While the MIPP dysbiotic microbiome is also diverse, it is associated with the presence of Aggregatibacter actinomycetemcomitans 3 – 7 . In MIPP, the JP2 clone of A. actinomycetemcomitans is present, with a strong prognostic association with the initiation and progression of the disease and tissue attachment loss 5 . Early studies on the function of neutrophils in MIPP suggest that peripheral neutrophils play a major protective role against periodontal infection and that cellular chemotactic defects may predispose subjects to periodontal disease 8 . Still, Mizuno et al. showed that only some subjects with MIPP display chemotactic dysfunction 9 . Another study on circulating neutrophils from different periodontal patients showed that the extracellular release of reactive oxygen species was higher in GP patients compared to MIPP patients, and that the release of neutrophil elastase by PMNs was higher in periodontal groups compared with periodontally healthy cells 10 . Such conflicts led to a shift in the paradigm from the hyporesponsive to the hyperresponsive model of neutrophil dysfunction in periodontal etiopathogenesis 11 . Tapashetti et al. showed that the prevalence of neutrophil dysfunction, predominantly hypofunctional, was significantly high in GP patients, with a few having hyperactive respiratory burst function 12 . Johnstone et al. found larger receptor-independent respiratory bursts and higher phagocytotic activity in peripheral neutrophils derived from patients with recurrent MIPP when compared with GP and periodontally healthy patients 13 . Since then, ample studies have demonstrated that periodontal neutrophils are hyperactive and primed and release enhanced levels of oxygen radicals and inflammatory mediators, such as cytokines and matrix-degrading enzymes 10 , 14 . The hyperactivity of neutrophils is also associated with the destruction of periodontal tissues; indeed, several studies have shown that impaired neutrophil functions, such as defective and depressed chemotaxis, decreased phagocytic function, and increased production of reactive oxygen species, which increases the activity of proteases and activates neutrophil-produced matrix metalloproteinases, translate into tissue damage 11 , 15 , 16 . Most neutrophils circulate in the bloodstream and are recruited to peripheral tissue sites at times of infection 17 . Oral neutrophils are circulating neutrophils that migrate from the bloodstream through the gingival tissue and gingival pockets into the crevice environment 18 . They have a hyperactive phenotype characterized by increased potential for ROS production 19 . In addition, oral neutrophils are more apoptotic, with increased levels of degranulation markers in periodontitis compared to periodontal health 20 . Lakschevitz et al. demonstrated that oral neutrophils show a significant increase in T-cell receptor expression compared with circulating neutrophils, suggesting a role for oral neutrophils in crosstalk between the innate and adaptive immune systems in the mouth 21 . Furthermore, when comparing oral and circulating PMNs, oral cells from patients with periodontal disease displayed an altered transcriptome following migration into the oral tissues, which resulted in a pro-survival neutrophil phenotype in GP patients versus healthy subjects, resulting in a longer-lived neutrophil 21 , 22 . Still, no study has compared differences in oral neutrophils stemming from patients with different periodontal diagnoses, and the function of oral neutrophils in MIPP is currently unknown. The present study aims to examine oral neutrophil function in MIPP, GP, and periodontally healthy subjects and the impact of the different dysbiotic microbiomes on their priming. Results Oral neutrophil extraction from whole saliva and their purity are presented in Supplementary Fig. 1. The mean age of each group was 63.3 y for GP, 26.4 y for MIPP, and 29.7 y for the periodontally healthy group, and the percentage of females was 70% for GP, 55% for MIPP, and 50% for the periodontally healthy group. The average number of neutrophils that was obtained from each case was significantly higher in the periodontitis groups compared with the periodontally healthy group (mean count of 3.4*10 6 cells in the MIPP, 3.1*10 6 cells in the GP, and 1.4*10 6 cells for the periodontally healthy, P < 0.01). Periodontal diagnosis is associated with a functional change in oral neutrophils In periodontally healthy individuals, substantial oxidative stress expression was produced by naïve oNeut, while JP2 and the positive control showed lower levels than the naïve group (Fig. 1 a). Moreover, the JP2 infection group showed lower levels of ROS compared with the positive control group. This pattern was different in both periodontitis groups, which shows that while naïve cells expressed ROS, the positive control showed similar values, and only the JP2 groups showed reduced levels (Fig. 1 a). In general, periodontally healthy oNeut expressed greater ROS compared with the periodontitis groups in any tested condition, with small differences in ROS kinetics (Fig. 2 a). The ROS levels of oNeut at the end of the incubation showed that in the healthy group, two subsets of oNeut exist – one with low levels of ROS and the other with high ROS levels (Fig. 1 c). Interestingly, in the GP group, high ROS oNeut was missing, while in the MIPP group, low ROS levels were absent (Fig. 1 c). ROS expression is independent of JP2-induced cell necrosis JP2 is known to induce necrosis in neutrophils, which affects ROS production. To examine this, we stained the cells that were infected with JP2 for ROS and necrosis. The results show that in healthy oNeut, most cells are viable (PI negative) and express ROS (DCFH positive) in all tested groups (Fig. 2 a). Still, a quarter (25%) of the oNeut in the JP2-infected condition in the periodontally healthy group was negative for necrosis and ROS, and 40% were positive for necrosis and ROS (Fig. 2 a). In the GP group, a clear difference in cell response was observed in the JP2-infected condition, with the majority of cells showing low ROS expression, and only 10% of cells expressing ROS. In the MIPP group, the JP2 condition did not produce ROS at all, and most of the cells were also PI-negative (viable cells). In the positive control, both periodontitis groups showed two cell groups – one expressed ROS and the other did not. A quantification of the flow cytometry showed a reverse pattern in the percentage of viable ROS-positive cells (PI − DCFH + ) and viable ROS-negative cells (PI − DCFH − ), with reduced levels in the JP2-infected group in the viable ROS-positive cells (Fig. 2 b). Of interest, in the periodontitis groups, a peak in the JP2-infected condition was observed in the necrotic cells that did not express ROS, which was not observed in the periodontally healthy group (Fig. 2 b). Looking only at viable cells or ROS-expressing cells, a reverse pattern was observed between cells in both periodontitis groups but not in the periodontally healthy group in the JP2-infected group (Fig. 2 c). MIPP oral neutrophils express pro-inflammation and pro-osteoclastogenesis phenotypes While ROS is a key effector function on neutrophils, other traits, such as cytokine expression, may shed light on the differences in oNeut function between the tested groups. To that end, we examined cytokine and chemokine expression, as well as cytokines associated with the hallmark phenotype of periodontitis – bone loss. The results showed that TNFα and CCL2 expressions were reduced in GP, while in MIPP, their levels were more similar to the healthy controls (Fig. 3 a). The levels of IL1β and CXCL10 showed a different and opposite pattern, in which the periodontitis group showed elevated IL1β and reduced CXCL10. In both periodontitis groups, the levels of RANKL and OPG were reduced, summing up to a reduced ratio of OPG/RANKL compared with the healthy group (Fig. 3 B). Reduced ROS and robust cytokine expression by oral neutrophils are dependent on periodontal biofilm Oral neutrophils are immune cells that migrate from the bloodstream into the periodontal pocket tissue and then through the infected periodontal pockets and shed into the oral cavity. This path may affect neutrophil priming and effector function. To test this issue, we collected neutrophils from periodontally healthy cases and exposed them separately to different de novo biofilms (one representing a healthy condition, one representing GP, and one representing MIPP) and examined their functionality. The ROS production of oNeut was higher in the healthy biofilm than in both periodontal biofilms (Fig. 4 a), similar to the pattern observed in the primary oNeut (Fig. 1 ). On the other hand, the expression of the inflammatory cytokine TNFα, osteoclastogenesis cytokine RANKL, and osseoprotection cytokine OPG was elevated in the periodontal biofilms compared with the periodontally healthy biofilm (Fig. 4 b), which is opposite to the pattern observed in the primary oNeut (Fig. 3 ). Discussion This study portrays a unique phenotype of oral neutrophils that depends on periodontal diagnosis and their dysbiotic microbiome. On the one hand, the high oNeut counts, resistance to necrosis, low ROS production, and unique profile of cytokine expression reflect the complex biotype of periodontitis and its assertion of bone loss. On the other hand, examining oNeut, from healthy cases to the different biofilms, showed that it has a similar effect on ROS production but not on their cytokine profile. This difference may be due to microbiome-dependent neutrophil priming (expressed as ROS) and independent of the neutrophil’s immunomodulation effect (cytokine expression). Oral neutrophils migrate through the connective tissue and pocket epithelium to kill pocket microbes continuously, even without clinical inflammation or tissue damage 23 . In periodontitis, inflammation at the periodontal pockets 24 causes chemokine paralysis 23 and massive recruitment of neutrophils into the pocket and from there into the saliva. Thus, oral neutrophils in periodontal health and periodontitis reflect the complete neutrophil journey, thereby exhibiting functions that are linked to the destructive/protective host response. Several studies have compared circulatory and oral neutrophils (cNeut vs. oNeut) during bacterial insult; Rijkschroeff et al. showed that in healthy subjects, oNeut is more activated and advanced and in a more mature state than cNeut, although when challenged with bacteria, both cell types had a similar response 25 . Nicu et al. compared oNeut and cNeut in healthy and untreated periodontitis cases and showed a higher count, more apoptosis, higher expression of activation markers, and higher ROS production in oNeut in the periodontitis group 20 . Still, as in the previous study, both infected cells showed a similar response. The data attributes a hyper state of oNeut when compared to circulatory neutrophils in healthy and periodontal subjects. Hashai et al. examined circulatory neutrophils from healthy and MIPP subjects using the periopathogen MIPP and showed MIPP hypoactivation 26 . Indeed, oNeut levels correlate with the extent of oral inflammation and periodontal severity (Khoury, 2020) compared with healthy controls 20 . Similar to Nicu et al., our study showed that periodontitis cases (both GP and MIPP) have higher oNeut counts than healthy patients. Our data showed that the healthy group, oNeut had higher ROS values than the periodontitis groups (GP and MIPP patients), whether stimulated or unstimulated. This difference may be due to the exhaustion of the oNeut ROS potential in periodontal subjects, as they are constantly exposed to perio-pathogenic bacterium and are chronically active. In contrast, Nicu et al. (2018) did not find a difference in the ROS production of oral neutrophils between periodontal and healthy patients 20 . A possible explanation for this difference might be that Nicu et al. based their study on circulating neutrophils. In periodontitis patients, the JP2-inoculated oNeut expresses less ROS when compared to naïve oNeut, positive control, or JP2-inoculated oNeut in periodontally healthy patients. Similar results were shown in circulatory neutrophils, where MIPP PMNs exhibited lower ROS production in response to JP2 infection compared to neutrophils from the periodontally healthy group 26 . Rijkschroeff et al. showed higher ROS production in infected oNeut originating from healthy patients versus naïve cells 25 , which contradicts our current results, which present similar ROS production in the infected and naïve oNeut of healthy patients. This difference may be due to the fact that F. nucleatum was used as a stimulator in Rijkschroeff’s paper, while our study and that of Hashai and colleagues used Aggregatibacter actinmycetemcomitans JP2 clone infection. Healthy patients’ oNeut express a higher cytokine profile compared to periodontal patients with a higher OPG/RANKL ratio, which reflects a low inflammation and bone protection phenotype. The OPG/RANKL ratio did not differ between the GP and MIPP groups, which reflects the osseoresorption phenotype. On the other hand, IL-1β and CCL2 showed augmented levels in the MIPP group compared with the GP group, which may indicate a different inflammatory phenotype among the periodontitis groups. This is aligned with Galbraith et al., who showed that the cytokines released by oNeut were higher in periodontal patients 27 . In addition, other evidence has shown a strong expression of IL-1β and TNF-α in gingival specimens of periodontal patients 28 . TNFα plays a major role in the regulation of bone homeostasis by stimulating osteoclastogenesis, which requires the synergistic effect of RANKL and TNFα 29 . This might explain the low OPG/RANKL ratio, which is pro-resorption and a less protective state of bone. Furthermore, this is compatible with the clinical features of MIPP patients where there was site-specific yet dramatic bone loss. In conclusion, periodontal patients present an imbalanced cytokine profile and a low OPG/RANKL ratio when compared to healthy subjects, which might explain the bone resorption pattern in periodontitis. The difference between GP and MIPP patients was evident in TNFα levels in cytokines and protein-based analyses, exhibiting higher TNFα in MIPP patients in naïve and JP2-infected patients, which may contribute to the rapid bone loss associated with such a condition. Conclusions Oral neutrophils demonstrate distinct functional phenotypes reflecting periodontal health status and the dysbiotic microbiome. Periodontitis patients exhibit increased oral neutrophil counts, altered reactive oxygen species production, and a unique cytokine profile characterized by a lower OPG/RANKL ratio and elevated inflammatory markers, particularly TNFα in MIPP patients. These findings suggest that neutrophil dysfunction and altered immunomodulation contribute significantly to bone resorption and the rapid tissue destruction seen in aggressive periodontal conditions. Further understanding of these neutrophil-mediated immune responses may guide future therapeutic strategies to mitigate periodontal tissue damage. Methods Accordance statement All experimental procedures were approved by the Hadassah Medical Center Institutional Review Board and were performed in accordance with relevant guidelines and regulations. Study population The study was designed as a parallel arms study and was approved by the institutional Helsinki board (approval number 0033-19-HMO). Three groups of patients were included in the study – periodontally healthy, generalized periodontitis, and MIPP (diagnosed according to the 2017 classification of periodontal and peri-implant diseases and conditions 30 ). Upon signing informed consent forms, all participants were invited for oral neutrophil collection. The inclusion criteria were as follows – 18 years or older; systemically healthy (based on a health questionnaire filled out before treatment); and willingness to participate in the study. The exclusion criteria were the following – diagnosis of diabetes, heart diseases, thrombocytopenia/ coagulation factor deficiency; chronic use/abuse of drugs/alcohol; pregnancy; smoking more than 10 cigarettes per day; and antibiotic consumption in the last 3 months. Oral neutrophil collection The patients were instructed to refrain from eating/drinking one hour prior to collection. Each patient was given two 15 ml tubes of Hanks Balanced Salt Solution (HBSS) to rinse their mouths for 30 seconds, each time with a different tube. The two suspensions were pooled and filtered through a 40 µm pore nylon mesh and then through a 10 µm pore mesh. The samples were then centrifuged at 1250 rpm/10°C/10 minutes and the cellular pellet was suspended in HBSS. Cell purity and viability Cell purity and viability were tested using CD16 antibody and Annexin/PI staining, respectively, and flow cytometry. In brief, the collected cells were stained with CD16 using a specific antibody and incubated for 30 minutes on ice. The cells were then washed in HBSS and analyzed using flow cytometry. Bacteria cultivation Aggregatibacter actinomycetemcomitans strain JP2 was grown in a medium containing 0.5 g yeast extract, 1.5 g Tryptone, 0.74 g D-glucose, 0.25 g NaCl, 0.075 g L-cysteine, 0.05 g sodium thioglycolate, and 4% NaHCO 3 (Sigma-Aldrich, Rehovot, Israel) in double-distilled water at 37°C and 5% CO 2 . Quantification of the bacteria was done by optical density (OD) measurement 26 . Fusobacterium nucleatum PK1594, Porphyromonas gingivalis ATCC 33277, Step. sanguis NC02863, and Actinomyces naeslundii 17233 were separately grown in Wilkins-Chagren broth (Oxoid, Basigstoke, Hampshire, UK) and incubated at 37˚C for 24 hrs under anaerobic conditions (N 2 85%, H 2 5%, CO 2 10%). S. sanguis and A. naeslundii were transferred to Wilkins-Chagren broth enriched with 2% sucrose (Sigma, Rehovot, Israel) and cultured under anaerobic conditions for an additional 24 hrs. F. nucleatum and P. gingivalis were transferred to Wilkins-Chagren broth and incubated for a further 24 hrs under anaerobic conditions. The bacterial suspensions of S. sanguis , A. naeslundii , and P. gingivalis were adjusted spectrophotometrically to 10 9 cells/mL, and that of F. nucleatum was adjusted to 10 8 cells/mL 31 . In vitro biofilm model The bacterial suspensions were centrifuged (4000 rpm, 15 min) and suspended in a gingival crevicular fluid (GCF)-simulating medium (60% RPMI medium, 40% donor horse serum (Biological Industries, Beit Ha’emek, Israel)) enriched with 5 µg/mL hemin and 0.5 µg/mL menadione (both from Sigma). A suspension of S. sanguis and A. naeslundii (1:1 ratio in a total volume of 100 µl GCF-simulating medium) was inoculated onto 96-well plates and incubated for 24 hrs at 37˚C under anaerobic conditions. The wells with the newly formed biofilm were then washed with phosphate-buffered saline (PBS) and received the next preparation steps, as follows: For the GP biofilm, a suspension of P. gingivalis and F. nucleatum (1:1 ratio in a total volume of 100 µl GCF-simulating medium) was inoculated and incubated for an additional 48 hrs at 37˚C under anaerobic conditions. For the MIPP biofilm, a suspension of A. actinomycetemcomitans in a total volume of 100 µl GCF-simulating medium was inoculated and incubated for an additional 48 hrs at 37˚C under anaerobic conditions. For a healthy periodontal biofilm, no additional bacteria were added. Reactive oxygen species production assay The 96-well black plates were coated with 1% BSA in PBS (100 µl in each well) overnight at 4°C. A stock preparation of DCFH-DA at a working concentration of 10 µg/ml, HOCl in a concentration of 0.0006%, and cells were prepared in PBS (containing calcium and magnesium) at 10 6 cells/ml. The cells were divided into 3 groups – Neutrophils, Neutrophils + HOCl, and Neutrophils + JP2 – at the multiplicity of infection (MOI) 10. A total of 50,000 cells were incubated with 50 µl of DCFH-DA in each well. The plates were then incubated in a fluorescent plate reader for analysis. At the end of the 90 min incubation, the cells were collected, stained with propidium iodide (prepared at 2% in HBSS) at RT for 10 minutes, and analyzed using flow cytometry. qRT-PCR Cell RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, Massachusetts, USA) according to the manufacturer’s instructions. Double-stranded cDNA was synthesized with 1 µg of total RNA using a qScript cDNA synthesis kit (Quantabio, Beverly, MA) according to the manufacturer’s instructions. SYBR Green quantitative real-time PCR was performed (PCR BIOSYSTEMS, London, UK). The primer sets used in this study are shown in the table below. All the reactions were carried out in duplicates, and the data were analyzed using the 2 –ΔΔCT method. Gene name Forward Reverse TNFα CCTCTCTCTAATCAGCCCTCTG GAGGACCTGGGAGTAGATGAG IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATGTGTCGAAGAA CXCL10 GTGGCATTCAAGGAGTACCTC TGATGGCCTTCGATTCTGGATT CCL2 CAGCCAGATGCAATCAATGCC TGGAATCCTGAACCCACTTCT RANKL TCGTTGGATCACAGCACATCA TATGGGAACCAGATGGGATGTC OPG CGTCAAGCAGGAGTGCAATC CCAGCTTGCACCACTCCAA Beta-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT Data analysis The sample size (n = 10/group) calculation for this study was based on an effect size of 15% change in ROS measurements, with an alpha value of 0.05 and a power of 80%. The data were analyzed using a statistical software package (SigmaStat, Jandel Scientific, San Rafael, CA, USA). A one-way repeated measurements analysis of variance (RM ANOVA) was applied to test the significance of the differences between the treated groups. If the differences were found to be significant, inter-group differences were tested for significance using Student’s t-test with Bonferroni correction for multiple testing. Declarations Funding: The study was self-funded Suitability for Scientific Reports: Scientific Reports values rigorous, mechanistic studies that advance broad biological understanding. Our work combines quantitative neutrophil assays with clinically relevant biofilm models to reveal novel insights into host–microbe interactions in periodontitis, making it a strong fit for the journal’s scope. Author contributions Conceptualization, DE and DP; Methodology, KJ, HB, and DP.; Investigation, KJ, HB, MN, HK, and DP; Writing – Original Draft, DE, and DP; Writing – Review & Editing, KJ, HB, MN, HK, ED and DP; Funding Acquisition, DP; Resources, KJ, HB, MN, HK, ED and DP; Supervision, ED and DP. Data availability The datasets generated and analyzed during the current study are available from the corresponding author upon reasonable request. Additional Information The authors declare that they have no competing interests. References Lu, H. et al. Well-maintained patients with a history of periodontitis still harbor a more dysbiotic microbiome than health. J. Periodontol . 91 , 1584–1594. 10.1002/JPER.19-0498 (2020). Curtis, M. A., Diaz, P. I. & Van Dyke, T. E. The role of the microbiota in periodontal disease. Periodontol 2000 . 83 , 14–25. 10.1111/prd.12296 (2020). Haubek, D. & Johansson, A. Pathogenicity of the highly leukotoxic JP2 clone of Aggregatibacter actinomycetemcomitans and its geographic dissemination and role in aggressive periodontitis. J. Oral Microbiol. 6 10.3402/jom.v6.23980 (2014). Fine, D. H. et al. Aggregatibacter actinomycetemcomitans and its relationship to initiation of localized aggressive periodontitis: longitudinal cohort study of initially healthy adolescents. J. Clin. Microbiol. 45 , 3859–3869. 10.1128/JCM.00653-07 (2007). Aberg, C. H., Kelk, P. & Johansson, A. Aggregatibacter actinomycetemcomitans: virulence of its leukotoxin and association with aggressive periodontitis. Virulence 6 , 188–195. 10.4161/21505594.2014.982428 (2015). Claesson, R., Gudmundson, J., Aberg, C. H., Haubek, D. & Johansson, A. Detection of a 640-bp deletion in the Aggregatibacter actinomycetemcomitans leukotoxin promoter region in isolates from an adolescent of Ethiopian origin. J. Oral Microbiol. 7 , 26974. 10.3402/jom.v7.26974 (2015). van der Reijden, W. A., Bosch-Tijhof, C. J., van der Velden, U. & van Winkelhoff, A. J. Java project on periodontal diseases: serotype distribution of Aggregatibacter actinomycetemcomitans and serotype dynamics over an 8-year period. J. Clin. Periodontol . 35 , 487–492. 10.1111/j.1600-051X.2008.01218.x (2008). Van Dyke, T. E., Horoszewicz, H. U., Cianciola, L. J. & Genco, R. J. Neutrophil chemotaxis dysfunction in human periodontitis. Infect. Immun. 27 , 124–132. 10.1128/iai.27.1.124-132.1980 (1980). Mizuno, N. et al. Proteome analysis of proteins related to aggressive periodontitis combined with neutrophil chemotaxis dysfunction. J. Clin. Periodontol . 38 , 310–317. 10.1111/j.1600-051X.2010.01693.x (2011). Guentsch, A. et al. Neutrophils in chronic and aggressive periodontitis in interaction with Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans. J. Periodontal Res. 44 , 368–377. 10.1111/j.1600-0765.2008.01113.x (2009). Shah, R., Thomas, R. & Mehta, D. S. Neutrophil priming: Implications in periodontal disease. J. Indian Soc. Periodontol . 21 , 180–185. 10.4103/jisp.jisp_385_15 (2017). Tapashetti, R. P., Sharma, S., Patil, S. R. & Guvva, S. Potential effect of neutrophil functional disorders on pathogenesis of aggressive periodontitis. J. Contemp. Dent. Pract. 14 , 387–393. 10.5005/jp-journals-10024-1333 (2013). Johnstone, A. M., Koh, A., Goldberg, M. B. & Glogauer, M. A hyperactive neutrophil phenotype in patients with refractory periodontitis. J. Periodontol . 78 , 1788–1794. 10.1902/jop.2007.070107 (2007). Dias, I. H. et al. Activation of the neutrophil respiratory burst by plasma from periodontitis patients is mediated by pro-inflammatory cytokines. J. Clin. Periodontol . 38 , 1–7. 10.1111/j.1600-051X.2010.01628.x (2011). Bhansali, R. S., Yeltiwar, R. K. & Bhat, K. Evaluation of peripheral neutrophil functions in aggressive periodontitis patients and their family members in Indian population: An assessment of neutrophil chemotaxis, phagocytosis, and microbicidal activity. J. Indian Soc. Periodontol . 21 , 449–455. 10.4103/jisp.jisp_107_17 (2017). Johansson, A. et al. Prevalence of systemic immunoreactivity to Aggregatibacter actinomycetemcomitans leukotoxin in relation to the incidence of myocardial infarction. BMC Infect. Dis. 11 , 55. 10.1186/1471-2334-11-55 (2011). Kobayashi, S. D., Voyich, J. M., Burlak, C. & DeLeo, F. R. Neutrophils in the innate immune response. Arch. Immunol. Ther. Exp. (Warsz) . 53 , 505–517 (2005). Scott, D. A. & Krauss, J. Neutrophils in periodontal inflammation. Front. Oral Biol. 15 , 56–83. 10.1159/000329672 (2012). Aboodi, G. M., Goldberg, M. B. & Glogauer, M. Refractory periodontitis population characterized by a hyperactive oral neutrophil phenotype. J. Periodontol . 82 , 726–733. 10.1902/jop.2010.100508 (2011). Nicu, E. A., Rijkschroeff, P., Wartewig, E., Nazmi, K. & Loos, B. G. Characterization of oral polymorphonuclear neutrophils in periodontitis patients: a case-control study. BMC Oral Health . 18 , 149. 10.1186/s12903-018-0615-2 (2018). Lakschevitz, F. S., Aboodi, G. M. & Glogauer, M. Oral neutrophil transcriptome changes result in a pro-survival phenotype in periodontal diseases. PLoS One . 8 , e68983. 10.1371/journal.pone.0068983 (2013). Lakschevitz, F. S., Aboodi, G. M. & Glogauer, M. Oral neutrophils display a site-specific phenotype characterized by expression of T-cell receptors. J. Periodontol . 84 , 1493–1503. 10.1902/jop.2012.120477 (2013). Uriarte, S. M., Edmisson, J. S. & Jimenez-Flores, E. Human neutrophils and oral microbiota: a constant tug-of-war between a harmonious and a discordant coexistence. Immunol. Rev. 273 , 282–298. 10.1111/imr.12451 (2016). Hajishengallis, G., Chavakis, T. & Lambris, J. D. Current understanding of periodontal disease pathogenesis and targets for host-modulation therapy. Periodontol 2000 . 84 , 14–34. 10.1111/prd.12331 (2020). Rijkschroeff, P. et al. Oral polymorphonuclear neutrophil characteristics in relation to oral health: a cross-sectional, observational clinical study. Int. J. Oral Sci. 8 , 191–198. 10.1038/ijos.2016.23 (2016). Hashai, K. et al. CD18 Mediates Neutrophil Imperviousness to the Aggregatibacter actinomycetemcomitans JP2 Clone in Molar-Incisor Pattern Periodontitis. Front. Immunol. 13 , 847372. 10.3389/fimmu.2022.847372 (2022). Galbraith, G. M., Hagan, C., Steed, R. B., Sanders, J. J. & Javed, T. Cytokine production by oral and peripheral blood neutrophils in adult periodontitis. J. Periodontol . 68 , 832–838. 10.1902/jop.1997.68.9.832 (1997). Liu, R. K., Cao, C. F., Meng, H. X. & Gao, Y. Polymorphonuclear neutrophils and their mediators in gingival tissues from generalized aggressive periodontitis. J. Periodontol . 72 , 1545–1553. 10.1902/jop.2001.72.11.1545 (2001). Osta, B., Benedetti, G. & Miossec, P. Classical and Paradoxical Effects of TNF-alpha on Bone Homeostasis. Front. Immunol. 5 , 48. 10.3389/fimmu.2014.00048 (2014). Tonetti, M. S., Greenwell, H. & Kornman, K. S. Staging and grading of periodontitis: Framework and proposal of a new classification and case definition. J. Periodontol . 89 (Suppl 1), S159–S172. 10.1002/JPER.18-0006 (2018). Shany-Kdoshim, S., Polak, D., Houri-Haddad, Y. & Feuerstein, O. Killing mechanism of bacteria within multi-species biofilm by blue light. J. Oral Microbiol. 11 , 1628577. 10.1080/20002297.2019.1628577 (2019). Additional Declarations No competing interests reported. Supplementary Files supFigure1.tif Cite Share Download PDF Status: Published Journal Publication published 09 Mar, 2026 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 08 Aug, 2025 Reviews received at journal 07 Aug, 2025 Reviews received at journal 29 Jul, 2025 Reviews received at journal 22 Jul, 2025 Reviewers agreed at journal 19 Jul, 2025 Reviewers agreed at journal 16 Jul, 2025 Reviewers agreed at journal 16 Jul, 2025 Reviewers agreed at journal 15 Jul, 2025 Reviewers agreed at journal 14 Jul, 2025 Reviewers invited by journal 14 Jul, 2025 Editor assigned by journal 04 Jul, 2025 Submission checks completed at journal 27 Jun, 2025 First submitted to journal 27 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6964222","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":486463376,"identity":"c9961314-b68f-4ab3-80f1-b000167dda6b","order_by":0,"name":"Juan Khoury","email":"","orcid":"","institution":"Hebrew University Hadassah School of Dental Medicine","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"","lastName":"Khoury","suffix":""},{"id":486463378,"identity":"9f7f6b97-9f2a-436b-ab27-60f546dce166","order_by":1,"name":"Bshara Haloun","email":"","orcid":"","institution":"Hebrew University Hadassah School of Dental Medicine","correspondingAuthor":false,"prefix":"","firstName":"Bshara","middleName":"","lastName":"Haloun","suffix":""},{"id":486463380,"identity":"351641bd-dfbe-48d9-825b-a74eeb33636d","order_by":2,"name":"nadav Musai","email":"","orcid":"","institution":"Hebrew University Hadassah School of Dental Medicine","correspondingAuthor":false,"prefix":"","firstName":"nadav","middleName":"","lastName":"Musai","suffix":""},{"id":486463382,"identity":"0d856800-bda7-4cf6-b2ce-9fd2b95a5b6a","order_by":3,"name":"Kfir Hayouka","email":"","orcid":"","institution":"Hebrew University Hadassah School of Dental Medicine","correspondingAuthor":false,"prefix":"","firstName":"Kfir","middleName":"","lastName":"Hayouka","suffix":""},{"id":486463384,"identity":"5532ad4d-9440-4f68-8a41-74eb7b41fabd","order_by":4,"name":"Esti Davidovich","email":"","orcid":"","institution":"Hebrew University Hadassah School of Dental Medicine","correspondingAuthor":false,"prefix":"","firstName":"Esti","middleName":"","lastName":"Davidovich","suffix":""},{"id":486463386,"identity":"3392de7b-519d-4fd9-8291-118bef567483","order_by":5,"name":"David Polak","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABO0lEQVRIie2SP0vDQBTAXyicyyW3XqnkM7wQUIfiZ8kROBcplS51Cwg3FfwCBQe/gKPjhUC6BLoW2iEgxKVDuxko1FRTFHI6C+bHwbv34Hfv/gG0tPxFdDVoFR0gVm5FEAAc0uFhcgAvflQIkA5+KYhHhZsUqBXCDQo0FGeWeXoNK5ecpPK2fO4PWGTH+RvuBsAeUw7DhtLNrjGeQuETKtOlnckR107oTRBHwAvJDRtDLYOEQiIUXKmlpRIRaXrGKaKIeOajSZkXtcJe1U2p9uJB0/Ny95uyCPWnwmUKttLiqerS+ejCJl5uULqLFx1PsToLL8KercKRl1C/d4p+tQgRedBUnLm426zHK5cx6W1LdTlwZxNvux674p4lWm92/ca71JfwLenUkfAAjn/AgDYVmbHa0tLS8v94B8iBcieVd56sAAAAAElFTkSuQmCC","orcid":"","institution":"Sheba Medical Center","correspondingAuthor":true,"prefix":"","firstName":"David","middleName":"","lastName":"Polak","suffix":""}],"badges":[],"createdAt":"2025-06-24 09:38:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6964222/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6964222/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-026-39112-3","type":"published","date":"2026-03-09T15:58:06+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":87267696,"identity":"30898d82-987c-43c1-ab7b-c39ae1688e8d","added_by":"auto","created_at":"2025-07-22 08:07:32","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1024359,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cu\u003eReactive oxygen species expression in oral neutrophils extracted from periodontal healthy cases, generalized periodontitis, and molar-incisor pattern periodontitis\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eOral neutrophils were extracted from whole saliva and then inoculated with JP2 or HOCl (as positive control, PC) and compared with naïve cells (negative control, NC). Levels of ROS production were measured with DCFH and a fluorescence plate reader for over 90 minutes and presented as (\u003cstrong\u003eA\u003c/strong\u003e) cumulative ROS measurement (as the area under the curve (AUC) of the relative fluorescent units (RFU)) and (\u003cstrong\u003eB\u003c/strong\u003e) as the kinetics of ROS levels. At the end of the incubation, cells were collected for analysis with flow cytometry (\u003cstrong\u003eC\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e* indicate a P \u0026lt; 0.05 statistically significant difference\u003c/p\u003e\n\u003cp\u003e** indicate a P \u0026lt; 0.01 statistically significant difference\u003c/p\u003e\n\u003cp\u003e**** indicate a P \u0026lt; 0.0001 statistically significant difference\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6964222/v1/7ce418acb20d3d3077e0d43d.png"},{"id":87266104,"identity":"7da500e4-e21c-493a-80f6-401ae4a3808d","added_by":"auto","created_at":"2025-07-22 07:59:32","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2071368,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cu\u003eEvaluation of the co-occurrence of necrosis and reactive oxygen species expression in oral neutrophils extracted from periodontal healthy cases, generalized periodontitis, and molar-incisor pattern periodontitis\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eOral neutrophils were extracted from whole saliva and then inoculated with JP2 or HOCl (as positive control, PC) and compared with naïve cells (negative control, NC). ROS production was stained with DCFH, and necrosis was stained with propidium iodide. (\u003cstrong\u003eA\u003c/strong\u003e) Representative dot plots of flow cytometry analysis of all groups that depict neutrophils’ levels of ROS and necrosis. (\u003cstrong\u003eB\u003c/strong\u003e) Quantification of the percentage of ROS/necrosis cells. (C) Quantification of the percentage of high ROS cells or high necrosis cells.\u003c/p\u003e\n\u003cp\u003e* indicate a P \u0026lt; 0.05 statistically significant difference\u003c/p\u003e\n\u003cp\u003e** indicate a P \u0026lt; 0.01 statistically significant difference\u003c/p\u003e\n\u003cp\u003e*** indicate a P \u0026lt; 0.001 statistically significant difference\u003c/p\u003e\n\u003cp\u003e**** indicate a P \u0026lt; 0.0001 statistically significant difference\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6964222/v1/287ee8cb8b08d26cac2da7ac.png"},{"id":87267695,"identity":"6456efde-63b9-41fd-9b74-f361d2941801","added_by":"auto","created_at":"2025-07-22 08:07:32","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":548216,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cu\u003eCytokine expression in oral neutrophils extracted from periodontal healthy cases, generalized periodontitis, and molar-incisor pattern periodontitis\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eOral neutrophils were extracted from whole saliva and then inoculated with JP2 or HOCl (as positive control, PC) and compared with naïve cells (negative control, NC). mRNA was then collected for qRT-PCR analysis. Results are expressed as fold change ± SD. (\u003cstrong\u003eA\u003c/strong\u003e) Inflammatory cytokines. (\u003cstrong\u003eB\u003c/strong\u003e) Osseomodulation cytokines.\u003c/p\u003e\n\u003cp\u003e* indicate a P \u0026lt; 0.05 statistically significant difference\u003c/p\u003e\n\u003cp\u003e** indicate a P \u0026lt; 0.01 statistically significant difference\u003c/p\u003e\n\u003cp\u003e*** indicate a P\u0026lt;0.001 statistically significant difference\u003c/p\u003e\n\u003cp\u003e**** indicate a P \u0026lt; 0.0001 statistically significant difference\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6964222/v1/a4880c052a6c3563954a1c6b.png"},{"id":87267697,"identity":"bea748d9-fdf3-4eae-a55f-9446fe725325","added_by":"auto","created_at":"2025-07-22 08:07:32","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":506405,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cu\u003eROS production and cytokine expression in oral neutrophils extracted from periodontal healthy cases that were exposed to the different biofilms\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eOral neutrophils were extracted from whole saliva and then inoculated with three different biofilms (separately), each reflecting a different periodontal condition – periodontal health, generalized periodontitis, and molar-incisor pattern periodontitis. (\u003cstrong\u003eA\u003c/strong\u003e) ROS production over 90 min incubation with the biofilms (as the area under the curve, AUC). (\u003cstrong\u003eB\u003c/strong\u003e) Cytokine levels after incubation with the biofilms (as fold change).\u003c/p\u003e\n\u003cp\u003e** indicate a P \u0026lt; 0.01 statistically significant difference\u003c/p\u003e\n\u003cp\u003e*** indicate a P \u0026lt; 0.001 statistically significant difference\u003c/p\u003e\n\u003cp\u003e**** indicate a P \u0026lt; 0.0001 statistically significant difference\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6964222/v1/a3a5c3b68c7ed95acae1c0fa.png"},{"id":104739451,"identity":"1d8647c9-b652-4e20-8f64-33a839db1372","added_by":"auto","created_at":"2026-03-16 16:07:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4596389,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6964222/v1/05e095d9-8453-4b5b-9234-5706c01af20a.pdf"},{"id":87266121,"identity":"dead2c95-a43d-4efe-800f-b7553d66d785","added_by":"auto","created_at":"2025-07-22 07:59:32","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3333428,"visible":true,"origin":"","legend":"","description":"","filename":"supFigure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-6964222/v1/56b95adfcceb2d1665d01ffb.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Distinct Host Susceptibility and Periodontal Microbiome Shape Oral Neutrophil Priming in Molar– Incisor versus Generalized Periodontitis","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePeriodontitis is an inflammation-mediated alveolar bone loss condition. Periodontal inflammation is initiated and perpetuated by a chronic presence of the dysbiotic microbiome in the periodontal pockets. This condition has two main distinct phenotypes \u0026ndash; generalized periodontitis (GP, previously termed chronic periodontitis) and molar-incisor pattern periodontitis (MIPP, previously termed aggressive periodontitis), with a non-resolved debate as to whether these phenotypes represent two constitutions of the same pathology or similar constitutions of two different pathologies.\u003c/p\u003e\u003cp\u003eWhile conditions of periodontal diseases are associated with dysfunctional host-mediated tissue destruction, GP and MIPP differ in their dysbiotic microbiome; the GP dysbiotic microbiome is diverse and has a disordered structure, pathogenic microbiota, and host-destructive metabolism pathways \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. This pathogenic microbiota consists of different gram-negative species that outgrow health-associated taxa. Among the enriched species are the classical red-complex triad consisting of \u003cem\u003eTreponema denticola\u003c/em\u003e, \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e, and \u003cem\u003eTanneralla forsythia\u003c/em\u003e. Several other \u003cem\u003eTreponema\u003c/em\u003e spp. also appear to be abundant components of periodontitis communities, in agreement with classic microscopy studies that indicate the abundance of spirochaetes \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. While the MIPP dysbiotic microbiome is also diverse, it is associated with the presence of \u003cem\u003eAggregatibacter actinomycetemcomitans\u003c/em\u003e \u003csup\u003e\u003cspan additionalcitationids=\"CR4 CR5 CR6\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. In MIPP, the JP2 clone of \u003cem\u003eA. actinomycetemcomitans\u003c/em\u003e is present, with a strong prognostic association with the initiation and progression of the disease and tissue attachment loss \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eEarly studies on the function of neutrophils in MIPP suggest that peripheral neutrophils play a major protective role against periodontal infection and that cellular chemotactic defects may predispose subjects to periodontal disease \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Still, Mizuno et al. showed that only some subjects with MIPP display chemotactic dysfunction \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Another study on circulating neutrophils from different periodontal patients showed that the extracellular release of reactive oxygen species was higher in GP patients compared to MIPP patients, and that the release of neutrophil elastase by PMNs was higher in periodontal groups compared with periodontally healthy cells \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Such conflicts led to a shift in the paradigm from the hyporesponsive to the hyperresponsive model of neutrophil dysfunction in periodontal etiopathogenesis \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Tapashetti et al. showed that the prevalence of neutrophil dysfunction, predominantly hypofunctional, was significantly high in GP patients, with a few having hyperactive respiratory burst function \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Johnstone et al. found larger receptor-independent respiratory bursts and higher phagocytotic activity in peripheral neutrophils derived from patients with recurrent MIPP when compared with GP and periodontally healthy patients \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Since then, ample studies have demonstrated that periodontal neutrophils are hyperactive and primed and release enhanced levels of oxygen radicals and inflammatory mediators, such as cytokines and matrix-degrading enzymes \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. The hyperactivity of neutrophils is also associated with the destruction of periodontal tissues; indeed, several studies have shown that impaired neutrophil functions, such as defective and depressed chemotaxis, decreased phagocytic function, and increased production of reactive oxygen species, which increases the activity of proteases and activates neutrophil-produced matrix metalloproteinases, translate into tissue damage \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eMost neutrophils circulate in the bloodstream and are recruited to peripheral tissue sites at times of infection \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Oral neutrophils are circulating neutrophils that migrate from the bloodstream through the gingival tissue and gingival pockets into the crevice environment \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. They have a hyperactive phenotype characterized by increased potential for ROS production \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. In addition, oral neutrophils are more apoptotic, with increased levels of degranulation markers in periodontitis compared to periodontal health \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Lakschevitz et al. demonstrated that oral neutrophils show a significant increase in T-cell receptor expression compared with circulating neutrophils, suggesting a role for oral neutrophils in crosstalk between the innate and adaptive immune systems in the mouth \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Furthermore, when comparing oral and circulating PMNs, oral cells from patients with periodontal disease displayed an altered transcriptome following migration into the oral tissues, which resulted in a pro-survival neutrophil phenotype in GP patients versus healthy subjects, resulting in a longer-lived neutrophil \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Still, no study has compared differences in oral neutrophils stemming from patients with different periodontal diagnoses, and the function of oral neutrophils in MIPP is currently unknown.\u003c/p\u003e\u003cp\u003eThe present study aims to examine oral neutrophil function in MIPP, GP, and periodontally healthy subjects and the impact of the different dysbiotic microbiomes on their priming.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eOral neutrophil extraction from whole saliva and their purity are presented in Supplementary Fig.\u0026nbsp;1. The mean age of each group was 63.3 y for GP, 26.4 y for MIPP, and 29.7 y for the periodontally healthy group, and the percentage of females was 70% for GP, 55% for MIPP, and 50% for the periodontally healthy group.\u003c/p\u003e\u003cp\u003eThe average number of neutrophils that was obtained from each case was significantly higher in the periodontitis groups compared with the periodontally healthy group (mean count of 3.4*10\u003csup\u003e6\u003c/sup\u003e cells in the MIPP, 3.1*10\u003csup\u003e6\u003c/sup\u003e cells in the GP, and 1.4*10\u003csup\u003e6\u003c/sup\u003e cells for the periodontally healthy, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003ePeriodontal diagnosis is associated with a functional change in oral neutrophils\u003c/h2\u003e\u003cp\u003eIn periodontally healthy individuals, substantial oxidative stress expression was produced by na\u0026iuml;ve oNeut, while JP2 and the positive control showed lower levels than the na\u0026iuml;ve group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). Moreover, the JP2 infection group showed lower levels of ROS compared with the positive control group. This pattern was different in both periodontitis groups, which shows that while na\u0026iuml;ve cells expressed ROS, the positive control showed similar values, and only the JP2 groups showed reduced levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). In general, periodontally healthy oNeut expressed greater ROS compared with the periodontitis groups in any tested condition, with small differences in ROS kinetics (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). The ROS levels of oNeut at the end of the incubation showed that in the healthy group, two subsets of oNeut exist \u0026ndash; one with low levels of ROS and the other with high ROS levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Interestingly, in the GP group, high ROS oNeut was missing, while in the MIPP group, low ROS levels were absent (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eROS expression is independent of JP2-induced cell necrosis\u003c/h3\u003e\n\u003cp\u003eJP2 is known to induce necrosis in neutrophils, which affects ROS production. To examine this, we stained the cells that were infected with JP2 for ROS and necrosis.\u003c/p\u003e\u003cp\u003eThe results show that in healthy oNeut, most cells are viable (PI negative) and express ROS (DCFH positive) in all tested groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Still, a quarter (25%) of the oNeut in the JP2-infected condition in the periodontally healthy group was negative for necrosis and ROS, and 40% were positive for necrosis and ROS (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). In the GP group, a clear difference in cell response was observed in the JP2-infected condition, with the majority of cells showing low ROS expression, and only 10% of cells expressing ROS. In the MIPP group, the JP2 condition did not produce ROS at all, and most of the cells were also PI-negative (viable cells). In the positive control, both periodontitis groups showed two cell groups \u0026ndash; one expressed ROS and the other did not.\u003c/p\u003e\u003cp\u003eA quantification of the flow cytometry showed a reverse pattern in the percentage of viable ROS-positive cells (PI\u003csup\u003e\u0026minus;\u003c/sup\u003eDCFH\u003csup\u003e+\u003c/sup\u003e) and viable ROS-negative cells (PI\u003csup\u003e\u0026minus;\u003c/sup\u003eDCFH\u003csup\u003e\u0026minus;\u003c/sup\u003e), with reduced levels in the JP2-infected group in the viable ROS-positive cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Of interest, in the periodontitis groups, a peak in the JP2-infected condition was observed in the necrotic cells that did not express ROS, which was not observed in the periodontally healthy group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Looking only at viable cells or ROS-expressing cells, a reverse pattern was observed between cells in both periodontitis groups but not in the periodontally healthy group in the JP2-infected group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec).\u003c/p\u003e\n\u003ch3\u003eMIPP oral neutrophils express pro-inflammation and pro-osteoclastogenesis phenotypes\u003c/h3\u003e\n\u003cp\u003eWhile ROS is a key effector function on neutrophils, other traits, such as cytokine expression, may shed light on the differences in oNeut function between the tested groups. To that end, we examined cytokine and chemokine expression, as well as cytokines associated with the hallmark phenotype of periodontitis \u0026ndash; bone loss.\u003c/p\u003e\u003cp\u003eThe results showed that TNFα and CCL2 expressions were reduced in GP, while in MIPP, their levels were more similar to the healthy controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). The levels of IL1β and CXCL10 showed a different and opposite pattern, in which the periodontitis group showed elevated IL1β and reduced CXCL10. In both periodontitis groups, the levels of RANKL and OPG were reduced, summing up to a reduced ratio of OPG/RANKL compared with the healthy group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eReduced ROS and robust cytokine expression by oral neutrophils are dependent on periodontal biofilm\u003c/h3\u003e\n\u003cp\u003eOral neutrophils are immune cells that migrate from the bloodstream into the periodontal pocket tissue and then through the infected periodontal pockets and shed into the oral cavity. This path may affect neutrophil priming and effector function. To test this issue, we collected neutrophils from periodontally healthy cases and exposed them separately to different \u003cem\u003ede novo\u003c/em\u003e biofilms (one representing a healthy condition, one representing GP, and one representing MIPP) and examined their functionality.\u003c/p\u003e\u003cp\u003eThe ROS production of oNeut was higher in the healthy biofilm than in both periodontal biofilms (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea), similar to the pattern observed in the primary oNeut (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). On the other hand, the expression of the inflammatory cytokine TNFα, osteoclastogenesis cytokine RANKL, and osseoprotection cytokine OPG was elevated in the periodontal biofilms compared with the periodontally healthy biofilm (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb), which is opposite to the pattern observed in the primary oNeut (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study portrays a unique phenotype of oral neutrophils that depends on periodontal diagnosis and their dysbiotic microbiome. On the one hand, the high oNeut counts, resistance to necrosis, low ROS production, and unique profile of cytokine expression reflect the complex biotype of periodontitis and its assertion of bone loss. On the other hand, examining oNeut, from healthy cases to the different biofilms, showed that it has a similar effect on ROS production but not on their cytokine profile. This difference may be due to microbiome-dependent neutrophil priming (expressed as ROS) and independent of the neutrophil\u0026rsquo;s immunomodulation effect (cytokine expression).\u003c/p\u003e\u003cp\u003eOral neutrophils migrate through the connective tissue and pocket epithelium to kill pocket microbes continuously, even without clinical inflammation or tissue damage \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. In periodontitis, inflammation at the periodontal pockets \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e causes chemokine paralysis \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e and massive recruitment of neutrophils into the pocket and from there into the saliva. Thus, oral neutrophils in periodontal health and periodontitis reflect the complete neutrophil journey, thereby exhibiting functions that are linked to the destructive/protective host response. Several studies have compared circulatory and oral neutrophils (cNeut vs. oNeut) during bacterial insult; Rijkschroeff et al. showed that in healthy subjects, oNeut is more activated and advanced and in a more mature state than cNeut, although when challenged with bacteria, both cell types had a similar response \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Nicu et al. compared oNeut and cNeut in healthy and untreated periodontitis cases and showed a higher count, more apoptosis, higher expression of activation markers, and higher ROS production in oNeut in the periodontitis group \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Still, as in the previous study, both infected cells showed a similar response. The data attributes a hyper state of oNeut when compared to circulatory neutrophils in healthy and periodontal subjects. Hashai et al. examined circulatory neutrophils from healthy and MIPP subjects using the periopathogen MIPP and showed MIPP hypoactivation \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Indeed, oNeut levels correlate with the extent of oral inflammation and periodontal severity (Khoury, 2020) compared with healthy controls \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Similar to Nicu et al., our study showed that periodontitis cases (both GP and MIPP) have higher oNeut counts than healthy patients.\u003c/p\u003e\u003cp\u003eOur data showed that the healthy group, oNeut had higher ROS values than the periodontitis groups (GP and MIPP patients), whether stimulated or unstimulated. This difference may be due to the exhaustion of the oNeut ROS potential in periodontal subjects, as they are constantly exposed to perio-pathogenic bacterium and are chronically active. In contrast, Nicu et al. (2018) did not find a difference in the ROS production of oral neutrophils between periodontal and healthy patients \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. A possible explanation for this difference might be that Nicu et al. based their study on circulating neutrophils. In periodontitis patients, the JP2-inoculated oNeut expresses less ROS when compared to na\u0026iuml;ve oNeut, positive control, or JP2-inoculated oNeut in periodontally healthy patients. Similar results were shown in circulatory neutrophils, where MIPP PMNs exhibited lower ROS production in response to JP2 infection compared to neutrophils from the periodontally healthy group \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Rijkschroeff et al. showed higher ROS production in infected oNeut originating from healthy patients versus na\u0026iuml;ve cells \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e, which contradicts our current results, which present similar ROS production in the infected and na\u0026iuml;ve oNeut of healthy patients. This difference may be due to the fact that \u003cem\u003eF. nucleatum\u003c/em\u003e was used as a stimulator in Rijkschroeff\u0026rsquo;s paper, while our study and that of Hashai and colleagues used \u003cem\u003eAggregatibacter actinmycetemcomitans\u003c/em\u003e JP2 clone infection.\u003c/p\u003e\u003cp\u003eHealthy patients\u0026rsquo; oNeut express a higher cytokine profile compared to periodontal patients with a higher OPG/RANKL ratio, which reflects a low inflammation and bone protection phenotype. The OPG/RANKL ratio did not differ between the GP and MIPP groups, which reflects the osseoresorption phenotype. On the other hand, IL-1β and CCL2 showed augmented levels in the MIPP group compared with the GP group, which may indicate a different inflammatory phenotype among the periodontitis groups. This is aligned with Galbraith et al., who showed that the cytokines released by oNeut were higher in periodontal patients \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. In addition, other evidence has shown a strong expression of IL-1β and TNF-α in gingival specimens of periodontal patients \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eTNFα plays a major role in the regulation of bone homeostasis by stimulating osteoclastogenesis, which requires the synergistic effect of RANKL and TNFα \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. This might explain the low OPG/RANKL ratio, which is pro-resorption and a less protective state of bone. Furthermore, this is compatible with the clinical features of MIPP patients where there was site-specific yet dramatic bone loss.\u003c/p\u003e\u003cp\u003eIn conclusion, periodontal patients present an imbalanced cytokine profile and a low OPG/RANKL ratio when compared to healthy subjects, which might explain the bone resorption pattern in periodontitis. The difference between GP and MIPP patients was evident in TNFα levels in cytokines and protein-based analyses, exhibiting higher TNFα in MIPP patients in na\u0026iuml;ve and JP2-infected patients, which may contribute to the rapid bone loss associated with such a condition.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eOral neutrophils demonstrate distinct functional phenotypes reflecting periodontal health status and the dysbiotic microbiome. Periodontitis patients exhibit increased oral neutrophil counts, altered reactive oxygen species production, and a unique cytokine profile characterized by a lower OPG/RANKL ratio and elevated inflammatory markers, particularly TNFα in MIPP patients. These findings suggest that neutrophil dysfunction and altered immunomodulation contribute significantly to bone resorption and the rapid tissue destruction seen in aggressive periodontal conditions. Further understanding of these neutrophil-mediated immune responses may guide future therapeutic strategies to mitigate periodontal tissue damage.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eAccordance statement\u003c/h2\u003e\u003cp\u003e All experimental procedures were approved by the Hadassah Medical Center Institutional Review Board and were performed in accordance with relevant guidelines and regulations.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eStudy population\u003c/h2\u003e\u003cp\u003e The study was designed as a parallel arms study and was approved by the institutional Helsinki board (approval number 0033-19-HMO). Three groups of patients were included in the study \u0026ndash; periodontally healthy, generalized periodontitis, and MIPP (diagnosed according to the 2017 classification of periodontal and peri-implant diseases and conditions \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e). Upon signing informed consent forms, all participants were invited for oral neutrophil collection.\u003c/p\u003e\u003cp\u003eThe inclusion criteria were as follows \u0026ndash; 18 years or older; systemically healthy (based on a health questionnaire filled out before treatment); and willingness to participate in the study. The exclusion criteria were the following \u0026ndash; diagnosis of diabetes, heart diseases, thrombocytopenia/ coagulation factor deficiency; chronic use/abuse of drugs/alcohol; pregnancy; smoking more than 10 cigarettes per day; and antibiotic consumption in the last 3 months.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eOral neutrophil collection\u003c/h2\u003e\u003cp\u003eThe patients were instructed to refrain from eating/drinking one hour prior to collection. Each patient was given two 15 ml tubes of Hanks Balanced Salt Solution (HBSS) to rinse their mouths for 30 seconds, each time with a different tube. The two suspensions were pooled and filtered through a 40 \u0026micro;m pore nylon mesh and then through a 10 \u0026micro;m pore mesh. The samples were then centrifuged at 1250 rpm/10\u0026deg;C/10 minutes and the cellular pellet was suspended in HBSS.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eCell purity and viability\u003c/h2\u003e\u003cp\u003eCell purity and viability were tested using CD16 antibody and Annexin/PI staining, respectively, and flow cytometry. In brief, the collected cells were stained with CD16 using a specific antibody and incubated for 30 minutes on ice. The cells were then washed in HBSS and analyzed using flow cytometry.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eBacteria cultivation\u003c/h2\u003e\u003cp\u003e\u003cem\u003eAggregatibacter actinomycetemcomitans\u003c/em\u003e strain JP2 was grown in a medium containing 0.5 g yeast extract, 1.5 g Tryptone, 0.74 g D-glucose, 0.25 g NaCl, 0.075 g L-cysteine, 0.05 g sodium thioglycolate, and 4% NaHCO\u003csub\u003e3\u003c/sub\u003e (Sigma-Aldrich, Rehovot, Israel) in double-distilled water at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. Quantification of the bacteria was done by optical density (OD) measurement \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eFusobacterium nucleatum\u003c/em\u003e PK1594, \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e ATCC 33277, \u003cem\u003eStep. sanguis\u003c/em\u003e NC02863, and \u003cem\u003eActinomyces naeslundii\u003c/em\u003e 17233 were separately grown in Wilkins-Chagren broth (Oxoid, Basigstoke, Hampshire, UK) and incubated at 37˚C for 24 hrs under anaerobic conditions (N\u003csub\u003e2\u003c/sub\u003e 85%, H\u003csub\u003e2\u003c/sub\u003e 5%, CO\u003csub\u003e2\u003c/sub\u003e 10%). \u003cem\u003eS. sanguis\u003c/em\u003e and \u003cem\u003eA. naeslundii\u003c/em\u003e were transferred to Wilkins-Chagren broth enriched with 2% sucrose (Sigma, Rehovot, Israel) and cultured under anaerobic conditions for an additional 24 hrs. \u003cem\u003eF. nucleatum\u003c/em\u003e and \u003cem\u003eP. gingivalis\u003c/em\u003e were transferred to Wilkins-Chagren broth and incubated for a further 24 hrs under anaerobic conditions. The bacterial suspensions of \u003cem\u003eS. sanguis\u003c/em\u003e, \u003cem\u003eA. naeslundii\u003c/em\u003e, and \u003cem\u003eP. gingivalis\u003c/em\u003e were adjusted spectrophotometrically to 10\u003csup\u003e9\u003c/sup\u003e cells/mL, and that of \u003cem\u003eF. nucleatum\u003c/em\u003e was adjusted to 10\u003csup\u003e8\u003c/sup\u003e cells/mL \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eIn vitro biofilm model\u003c/h2\u003e\u003cp\u003eThe bacterial suspensions were centrifuged (4000 rpm, 15 min) and suspended in a gingival crevicular fluid (GCF)-simulating medium (60% RPMI medium, 40% donor horse serum (Biological Industries, Beit Ha\u0026rsquo;emek, Israel)) enriched with 5 \u0026micro;g/mL hemin and 0.5 \u0026micro;g/mL menadione (both from Sigma). A suspension of \u003cem\u003eS. sanguis\u003c/em\u003e and \u003cem\u003eA. naeslundii\u003c/em\u003e (1:1 ratio in a total volume of 100 \u0026micro;l GCF-simulating medium) was inoculated onto 96-well plates and incubated for 24 hrs at 37˚C under anaerobic conditions. The wells with the newly formed biofilm were then washed with phosphate-buffered saline (PBS) and received the next preparation steps, as follows: For the GP biofilm, a suspension of \u003cem\u003eP. gingivalis\u003c/em\u003e and \u003cem\u003eF. nucleatum\u003c/em\u003e (1:1 ratio in a total volume of 100 \u0026micro;l GCF-simulating medium) was inoculated and incubated for an additional 48 hrs at 37˚C under anaerobic conditions. For the MIPP biofilm, a suspension of \u003cem\u003eA. actinomycetemcomitans\u003c/em\u003e in a total volume of 100 \u0026micro;l GCF-simulating medium was inoculated and incubated for an additional 48 hrs at 37˚C under anaerobic conditions. For a healthy periodontal biofilm, no additional bacteria were added.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eReactive oxygen species production assay\u003c/h2\u003e\u003cp\u003eThe 96-well black plates were coated with 1% BSA in PBS (100 \u0026micro;l in each well) overnight at 4\u0026deg;C. A stock preparation of DCFH-DA at a working concentration of 10 \u0026micro;g/ml, HOCl in a concentration of 0.0006%, and cells were prepared in PBS (containing calcium and magnesium) at 10\u003csup\u003e6\u003c/sup\u003e cells/ml. The cells were divided into 3 groups \u0026ndash; Neutrophils, Neutrophils\u0026thinsp;+\u0026thinsp;HOCl, and Neutrophils\u0026thinsp;+\u0026thinsp;JP2 \u0026ndash; at the multiplicity of infection (MOI) 10. A total of 50,000 cells were incubated with 50 \u0026micro;l of DCFH-DA in each well. The plates were then incubated in a fluorescent plate reader for analysis. At the end of the 90 min incubation, the cells were collected, stained with propidium iodide (prepared at 2% in HBSS) at RT for 10 minutes, and analyzed using flow cytometry.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eqRT-PCR\u003c/h2\u003e\u003cp\u003eCell RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, Massachusetts, USA) according to the manufacturer\u0026rsquo;s instructions. Double-stranded cDNA was synthesized with 1 \u0026micro;g of total RNA using a qScript cDNA synthesis kit (Quantabio, Beverly, MA) according to the manufacturer\u0026rsquo;s instructions. SYBR Green quantitative real-time PCR was performed (PCR BIOSYSTEMS, London, UK). The primer sets used in this study are shown in the table below. All the reactions were carried out in duplicates, and the data were analyzed using the 2\u003csup\u003e\u0026ndash;ΔΔCT\u003c/sup\u003e method.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTNFα\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCTCTCTCTAATCAGCCCTCTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAGGACCTGGGAGTAGATGAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL1β\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGCTACGAATCTCCGACCAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGTTATCCCATGTGTCGAAGAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCXCL10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTGGCATTCAAGGAGTACCTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGATGGCCTTCGATTCTGGATT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCCL2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGCCAGATGCAATCAATGCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGGAATCCTGAACCCACTTCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRANKL\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCGTTGGATCACAGCACATCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTATGGGAACCAGATGGGATGTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOPG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGTCAAGCAGGAGTGCAATC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCAGCTTGCACCACTCCAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBeta-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCATGTACGTTGCTATCCAGGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTCCTTAATGTCACGCACGAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eData analysis\u003c/h2\u003e\u003cp\u003eThe sample size (n\u0026thinsp;=\u0026thinsp;10/group) calculation for this study was based on an effect size of 15% change in ROS measurements, with an alpha value of 0.05 and a power of 80%. The data were analyzed using a statistical software package (SigmaStat, Jandel Scientific, San Rafael, CA, USA). A one-way repeated measurements analysis of variance (RM ANOVA) was applied to test the significance of the differences between the treated groups. If the differences were found to be significant, inter-group differences were tested for significance using Student\u0026rsquo;s t-test with Bonferroni correction for multiple testing.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e The study was self-funded\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSuitability for Scientific Reports:\u003c/strong\u003e Scientific Reports values rigorous, mechanistic studies that advance broad biological understanding. Our work combines quantitative neutrophil assays with clinically relevant biofilm models to reveal novel insights into host\u0026ndash;microbe interactions in periodontitis, making it a strong fit for the journal\u0026rsquo;s scope.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cu\u003eAuthor contributions\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, DE and DP; Methodology, KJ, HB, and DP.; Investigation, KJ, HB, MN, HK, and DP; Writing \u0026ndash; Original Draft, DE, and DP; Writing \u0026ndash; Review \u0026amp; Editing, KJ, HB, MN, HK, ED and DP; Funding Acquisition, DP; Resources, KJ, HB, MN, HK, ED and DP; Supervision, ED and DP.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLu, H. et al. Well-maintained patients with a history of periodontitis still harbor a more dysbiotic microbiome than health. \u003cem\u003eJ. Periodontol\u003c/em\u003e. \u003cb\u003e91\u003c/b\u003e, 1584\u0026ndash;1594. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/JPER.19-0498\u003c/span\u003e\u003cspan address=\"10.1002/JPER.19-0498\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCurtis, M. A., Diaz, P. I. \u0026amp; Van Dyke, T. E. The role of the microbiota in periodontal disease. \u003cem\u003ePeriodontol 2000\u003c/em\u003e. \u003cb\u003e83\u003c/b\u003e, 14\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/prd.12296\u003c/span\u003e\u003cspan address=\"10.1111/prd.12296\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHaubek, D. \u0026amp; Johansson, A. Pathogenicity of the highly leukotoxic JP2 clone of Aggregatibacter actinomycetemcomitans and its geographic dissemination and role in aggressive periodontitis. \u003cem\u003eJ. Oral Microbiol.\u003c/em\u003e \u003cb\u003e6\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3402/jom.v6.23980\u003c/span\u003e\u003cspan address=\"10.3402/jom.v6.23980\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFine, D. H. et al. Aggregatibacter actinomycetemcomitans and its relationship to initiation of localized aggressive periodontitis: longitudinal cohort study of initially healthy adolescents. \u003cem\u003eJ. Clin. Microbiol.\u003c/em\u003e \u003cb\u003e45\u003c/b\u003e, 3859\u0026ndash;3869. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JCM.00653-07\u003c/span\u003e\u003cspan address=\"10.1128/JCM.00653-07\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAberg, C. H., Kelk, P. \u0026amp; Johansson, A. Aggregatibacter actinomycetemcomitans: virulence of its leukotoxin and association with aggressive periodontitis. \u003cem\u003eVirulence\u003c/em\u003e \u003cb\u003e6\u003c/b\u003e, 188\u0026ndash;195. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4161/21505594.2014.982428\u003c/span\u003e\u003cspan address=\"10.4161/21505594.2014.982428\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eClaesson, R., Gudmundson, J., Aberg, C. H., Haubek, D. \u0026amp; Johansson, A. Detection of a 640-bp deletion in the Aggregatibacter actinomycetemcomitans leukotoxin promoter region in isolates from an adolescent of Ethiopian origin. \u003cem\u003eJ. Oral Microbiol.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 26974. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3402/jom.v7.26974\u003c/span\u003e\u003cspan address=\"10.3402/jom.v7.26974\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003evan der Reijden, W. A., Bosch-Tijhof, C. J., van der Velden, U. \u0026amp; van Winkelhoff, A. J. Java project on periodontal diseases: serotype distribution of Aggregatibacter actinomycetemcomitans and serotype dynamics over an 8-year period. \u003cem\u003eJ. Clin. Periodontol\u003c/em\u003e. \u003cb\u003e35\u003c/b\u003e, 487\u0026ndash;492. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1600-051X.2008.01218.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1600-051X.2008.01218.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVan Dyke, T. E., Horoszewicz, H. U., Cianciola, L. J. \u0026amp; Genco, R. J. Neutrophil chemotaxis dysfunction in human periodontitis. \u003cem\u003eInfect. Immun.\u003c/em\u003e \u003cb\u003e27\u003c/b\u003e, 124\u0026ndash;132. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/iai.27.1.124-132.1980\u003c/span\u003e\u003cspan address=\"10.1128/iai.27.1.124-132.1980\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1980).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMizuno, N. et al. Proteome analysis of proteins related to aggressive periodontitis combined with neutrophil chemotaxis dysfunction. \u003cem\u003eJ. Clin. Periodontol\u003c/em\u003e. \u003cb\u003e38\u003c/b\u003e, 310\u0026ndash;317. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1600-051X.2010.01693.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1600-051X.2010.01693.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuentsch, A. et al. Neutrophils in chronic and aggressive periodontitis in interaction with Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans. \u003cem\u003eJ. Periodontal Res.\u003c/em\u003e \u003cb\u003e44\u003c/b\u003e, 368\u0026ndash;377. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1600-0765.2008.01113.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1600-0765.2008.01113.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShah, R., Thomas, R. \u0026amp; Mehta, D. S. Neutrophil priming: Implications in periodontal disease. \u003cem\u003eJ. Indian Soc. Periodontol\u003c/em\u003e. \u003cb\u003e21\u003c/b\u003e, 180\u0026ndash;185. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4103/jisp.jisp_385_15\u003c/span\u003e\u003cspan address=\"10.4103/jisp.jisp_385_15\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTapashetti, R. P., Sharma, S., Patil, S. R. \u0026amp; Guvva, S. Potential effect of neutrophil functional disorders on pathogenesis of aggressive periodontitis. \u003cem\u003eJ. Contemp. Dent. Pract.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 387\u0026ndash;393. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5005/jp-journals-10024-1333\u003c/span\u003e\u003cspan address=\"10.5005/jp-journals-10024-1333\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJohnstone, A. M., Koh, A., Goldberg, M. B. \u0026amp; Glogauer, M. A hyperactive neutrophil phenotype in patients with refractory periodontitis. \u003cem\u003eJ. Periodontol\u003c/em\u003e. \u003cb\u003e78\u003c/b\u003e, 1788\u0026ndash;1794. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1902/jop.2007.070107\u003c/span\u003e\u003cspan address=\"10.1902/jop.2007.070107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDias, I. H. et al. Activation of the neutrophil respiratory burst by plasma from periodontitis patients is mediated by pro-inflammatory cytokines. \u003cem\u003eJ. Clin. Periodontol\u003c/em\u003e. \u003cb\u003e38\u003c/b\u003e, 1\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1600-051X.2010.01628.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1600-051X.2010.01628.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBhansali, R. S., Yeltiwar, R. K. \u0026amp; Bhat, K. Evaluation of peripheral neutrophil functions in aggressive periodontitis patients and their family members in Indian population: An assessment of neutrophil chemotaxis, phagocytosis, and microbicidal activity. \u003cem\u003eJ. Indian Soc. Periodontol\u003c/em\u003e. \u003cb\u003e21\u003c/b\u003e, 449\u0026ndash;455. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4103/jisp.jisp_107_17\u003c/span\u003e\u003cspan address=\"10.4103/jisp.jisp_107_17\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJohansson, A. et al. Prevalence of systemic immunoreactivity to Aggregatibacter actinomycetemcomitans leukotoxin in relation to the incidence of myocardial infarction. \u003cem\u003eBMC Infect. Dis.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1471-2334-11-55\u003c/span\u003e\u003cspan address=\"10.1186/1471-2334-11-55\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKobayashi, S. D., Voyich, J. M., Burlak, C. \u0026amp; DeLeo, F. R. Neutrophils in the innate immune response. \u003cem\u003eArch. Immunol. Ther. Exp. (Warsz)\u003c/em\u003e. \u003cb\u003e53\u003c/b\u003e, 505\u0026ndash;517 (2005).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eScott, D. A. \u0026amp; Krauss, J. Neutrophils in periodontal inflammation. \u003cem\u003eFront. Oral Biol.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 56\u0026ndash;83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1159/000329672\u003c/span\u003e\u003cspan address=\"10.1159/000329672\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAboodi, G. M., Goldberg, M. B. \u0026amp; Glogauer, M. Refractory periodontitis population characterized by a hyperactive oral neutrophil phenotype. \u003cem\u003eJ. Periodontol\u003c/em\u003e. \u003cb\u003e82\u003c/b\u003e, 726\u0026ndash;733. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1902/jop.2010.100508\u003c/span\u003e\u003cspan address=\"10.1902/jop.2010.100508\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNicu, E. A., Rijkschroeff, P., Wartewig, E., Nazmi, K. \u0026amp; Loos, B. G. Characterization of oral polymorphonuclear neutrophils in periodontitis patients: a case-control study. \u003cem\u003eBMC Oral Health\u003c/em\u003e. \u003cb\u003e18\u003c/b\u003e, 149. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12903-018-0615-2\u003c/span\u003e\u003cspan address=\"10.1186/s12903-018-0615-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLakschevitz, F. S., Aboodi, G. M. \u0026amp; Glogauer, M. Oral neutrophil transcriptome changes result in a pro-survival phenotype in periodontal diseases. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e8\u003c/b\u003e, e68983. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0068983\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0068983\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLakschevitz, F. S., Aboodi, G. M. \u0026amp; Glogauer, M. Oral neutrophils display a site-specific phenotype characterized by expression of T-cell receptors. \u003cem\u003eJ. Periodontol\u003c/em\u003e. \u003cb\u003e84\u003c/b\u003e, 1493\u0026ndash;1503. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1902/jop.2012.120477\u003c/span\u003e\u003cspan address=\"10.1902/jop.2012.120477\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eUriarte, S. M., Edmisson, J. S. \u0026amp; Jimenez-Flores, E. Human neutrophils and oral microbiota: a constant tug-of-war between a harmonious and a discordant coexistence. \u003cem\u003eImmunol. Rev.\u003c/em\u003e \u003cb\u003e273\u003c/b\u003e, 282\u0026ndash;298. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/imr.12451\u003c/span\u003e\u003cspan address=\"10.1111/imr.12451\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHajishengallis, G., Chavakis, T. \u0026amp; Lambris, J. D. Current understanding of periodontal disease pathogenesis and targets for host-modulation therapy. \u003cem\u003ePeriodontol 2000\u003c/em\u003e. \u003cb\u003e84\u003c/b\u003e, 14\u0026ndash;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/prd.12331\u003c/span\u003e\u003cspan address=\"10.1111/prd.12331\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRijkschroeff, P. et al. Oral polymorphonuclear neutrophil characteristics in relation to oral health: a cross-sectional, observational clinical study. \u003cem\u003eInt. J. Oral Sci.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 191\u0026ndash;198. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ijos.2016.23\u003c/span\u003e\u003cspan address=\"10.1038/ijos.2016.23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHashai, K. et al. CD18 Mediates Neutrophil Imperviousness to the Aggregatibacter actinomycetemcomitans JP2 Clone in Molar-Incisor Pattern Periodontitis. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 847372. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2022.847372\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.847372\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGalbraith, G. M., Hagan, C., Steed, R. B., Sanders, J. J. \u0026amp; Javed, T. Cytokine production by oral and peripheral blood neutrophils in adult periodontitis. \u003cem\u003eJ. Periodontol\u003c/em\u003e. \u003cb\u003e68\u003c/b\u003e, 832\u0026ndash;838. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1902/jop.1997.68.9.832\u003c/span\u003e\u003cspan address=\"10.1902/jop.1997.68.9.832\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1997).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, R. K., Cao, C. F., Meng, H. X. \u0026amp; Gao, Y. Polymorphonuclear neutrophils and their mediators in gingival tissues from generalized aggressive periodontitis. \u003cem\u003eJ. Periodontol\u003c/em\u003e. \u003cb\u003e72\u003c/b\u003e, 1545\u0026ndash;1553. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1902/jop.2001.72.11.1545\u003c/span\u003e\u003cspan address=\"10.1902/jop.2001.72.11.1545\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2001).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOsta, B., Benedetti, G. \u0026amp; Miossec, P. Classical and Paradoxical Effects of TNF-alpha on Bone Homeostasis. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cb\u003e5\u003c/b\u003e, 48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2014.00048\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2014.00048\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTonetti, M. S., Greenwell, H. \u0026amp; Kornman, K. S. Staging and grading of periodontitis: Framework and proposal of a new classification and case definition. \u003cem\u003eJ. Periodontol\u003c/em\u003e. \u003cb\u003e89\u003c/b\u003e (Suppl 1), S159\u0026ndash;S172. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/JPER.18-0006\u003c/span\u003e\u003cspan address=\"10.1002/JPER.18-0006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShany-Kdoshim, S., Polak, D., Houri-Haddad, Y. \u0026amp; Feuerstein, O. Killing mechanism of bacteria within multi-species biofilm by blue light. \u003cem\u003eJ. Oral Microbiol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 1628577. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/20002297.2019.1628577\u003c/span\u003e\u003cspan address=\"10.1080/20002297.2019.1628577\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Oral neutrophils, periodontal diagnosis, biofilm","lastPublishedDoi":"10.21203/rs.3.rs-6964222/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6964222/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe study aimed to compare oral neutrophil (oNeut) functions in molar–incisor pattern periodontitis (MIPP), generalized periodontitis (GP), and periodontally healthy subjects, and to explore how biofilm exposure shapes these functions. oNeut were isolated from healthy, GP, and MIPP volunteers (n=10 per group) and challenged \u003cem\u003eex vivo\u003c/em\u003e with \u003cem\u003eAggregatibacter actinomycetemcomitans\u003c/em\u003e JP2. Reactive oxygen species (ROS) production, cell viability, and cytokine release were quantified post-infection. Separately, healthy oNeut were exposed to de novo biofilms modeling healthy, GP, or MIPP microbiomes, and their functional responses were assessed. Results show that periodontitis patients (GP and MIPP) had higher baseline oNeut counts but exhibited reduced resistance to necrosis and lower ROS output after JP2 challenge than controls; JP2‐stimulated ROS was significantly lower than both HOCl‐treated and naïve controls. MIPP oNeut secreted more TNFα, CCL2, OPG, and RANKL than GP, whereas GP displayed a higher OPG/RANKL ratio. Except for TNFα and IL-1β, all measured mediators were elevated in healthy oNeut versus those from periodontitis groups. Under dysbiotic versus symbiotic biofilm challenge, healthy oNeut produced less ROS but secreted higher TNFα, OPG, and RANKL. Overall, periodontitis patients oNeut exhibit distinct oxidative and cytokine responses to JP2, reflecting host-specific and biofilm-driven priming.\u003c/p\u003e","manuscriptTitle":"Distinct Host Susceptibility and Periodontal Microbiome Shape Oral Neutrophil Priming in Molar– Incisor versus Generalized Periodontitis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-22 07:59:27","doi":"10.21203/rs.3.rs-6964222/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-08-08T10:40:57+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-07T15:55:33+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-29T18:42:54+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-22T14:58:17+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"162669356879538886673651352220863624843","date":"2025-07-19T14:36:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"233806959483950705755026731209400886655","date":"2025-07-16T16:33:16+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"283901818083416385582893604786561906049","date":"2025-07-16T16:09:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"214489059072984860780797361493701530840","date":"2025-07-16T00:31:07+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"21999483211445247969526125399242003878","date":"2025-07-14T15:04:15+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-07-14T06:51:50+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-04T04:44:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-27T09:07:57+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-06-27T09:04:53+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b46d9eb6-65be-4916-8cc6-3ef88afb5f56","owner":[],"postedDate":"July 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":51645001,"name":"Health sciences/Diseases/Oral diseases"},{"id":51645002,"name":"Biological sciences/Immunology/Mucosal immunology"}],"tags":[],"updatedAt":"2026-03-16T16:03:24+00:00","versionOfRecord":{"articleIdentity":"rs-6964222","link":"https://doi.org/10.1038/s41598-026-39112-3","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2026-03-09 15:58:06","publishedOnDateReadable":"March 9th, 2026"},"versionCreatedAt":"2025-07-22 07:59:27","video":"","vorDoi":"10.1038/s41598-026-39112-3","vorDoiUrl":"https://doi.org/10.1038/s41598-026-39112-3","workflowStages":[]},"version":"v1","identity":"rs-6964222","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6964222","identity":"rs-6964222","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00