A chromosome-level genome assembly and multi-omics analyses provide insights into the biosynthesis of piperlongumine in Piper sarmentosum | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article A chromosome-level genome assembly and multi-omics analyses provide insights into the biosynthesis of piperlongumine in Piper sarmentosum Yongjian Luo, Ru Wang, Yixin Zhang, Yuejiao Wang, Jun Liu, Yiqiang Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6556353/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Jan, 2026 Read the published version in Communications Biology → Version 1 posted You are reading this latest preprint version Abstract Piper sarmentosum Roxb. is a significant medicinal and edible plant, and its active compound piperlongumine (PL) has garnered attention due to its pharmacological activities, including anticancer and anti-inflammatory effects. However, the key enzymes and regulatory mechanisms of its biosynthetic pathway are not yet fully understood. In this study, we generated a chromosome-level genome assembly, with a contig N50 of 15.36 Mb and a scaffold N50 of 22.52 Mb. The BUSCO assessment indicated high completeness, with a score of 97.4%. Genome annotation revealed 39,154 protein-coding genes and identified three lineage-specific whole-genome duplication (WGD) events that expanded gene families associated with alkaloid biosynthesis. Metabolomic analysis identified 4,456 metabolites, including 238 alkaloids, and demonstrated that flowers and fruits are the primary organs for PL biosynthesis. Molecular docking and the correlation of gene expression with levels of PL suggest that PsHCT1 catalyzes the condensation of sinapoyl-CoA and 5,6-dihydropyridinone, while PsCCoAOMT1 is responsible for the final synthesis of PL. This study provides insights into the mechanism of alkaloid biosynthesis in P. sarmentosum and may help lay the groundwork for enhancing the production of medicinal compounds. Biological sciences/Plant sciences/Plant genetics/Genome duplication Biological sciences/Plant sciences/Plant genetics/Genome duplication Biological sciences/Plant sciences/Plant genetics/Genome duplication Biological sciences/Plant sciences/Plant genetics/Genome duplication Biological sciences/Plant sciences/Plant genetics/Genome duplication Alkaloids biosynthesis WGCNA Whole-genome duplication Medicinal plants HCT CCoAOMT Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Piper sarmentosum Roxb., a perennial creeping herb in the Piperaceae family, is primarily distributed along the southeastern coast of China and in tropical regions of Southeast Asia 1 . As a dual-purpose medicinal and edible plant, P. sarmentosum has a long history of use in traditional Chinese medicine. Its entire plant can be used as medicine and is known for its functions of dispelling wind and cold, promoting blood circulation, and reducing swelling. It is commonly used to treat conditions such as rheumatic pain and trauma-related swelling 2 . Modern research indicates that P. sarmentosum extract (PSE) possesses a variety of biological activities, such as antioxidant, analgesic, antimicrobial, and anti-inflammatory effects. These activities are likely related to its rich phytochemical composition, which includes alkaloids, amides, and phenolic compounds 3 – 6 . Among these, amide alkaloids are one of its most abundant chemical constituents 7 , showing potential for development as novel anticancer drugs 8 – 10 . The anticancer activity of Piper species is closely related to the presence of various bioactive compounds, particularly amides, such as pipelamide 11 , 12 . Among these compounds, piperlongumine (PL) was first isolated from Piper longum , and subsequent studies have found that P. sarmentosum also contains this important compound 13 . The α,β-unsaturated carbonyl group in the molecular structure of PL is the key pharmacophore responsible for its pharmacological activity, making it an ideal candidate molecule for the development of multitarget drugs 13 . Studies have shown that PL selectively induces apoptosis in tumor cells while maintaining the activity of normal cells, which gives it a unique advantage in cancer treatment. Its mechanisms include: inducing apoptosis in tumor cells by increasing reactive oxygen species (ROS) levels; inhibiting tumor metastasis-related signaling pathways; and regulating the expression of proteins associated with various cancers, such as breast cancer, colon cancer, prostate cancer, and lung cancer 14 – 16 . In addition to its anticancer activity, PL also demonstrates significant anti-inflammatory, antidiabetic, antidepressant, neuroprotective, and cardiovascular protective effects, making it an ideal candidate for multitarget drug development 17 , 18 . Currently, the chemical synthesis of PL can be achieved through reactions involving 3,4,5-trimethoxy-cinnamic acid and 5,6-dihydro-2(1H)-pyridinone with 1,3-dicyclohexylcarbodiimide (DCC) as a coupling agent, or by using Grubbs I and Grubbs II catalysts. Several new synthetic methods have been developed, although the overall reaction steps remain relatively complex and the conditions harsh 19 – 25 . However, with the development of biotechnology, biosynthesis has gradually become a simpler and more efficient synthesis route due to its highly selective catalysis 26 . Previous studies have found that the content of PL in P. longum L. fruits is only 1.2 mg/g, while P. sarmentosum contains approximately 40% more. The elucidation and analysis of the biosynthetic genes and mechanisms of complex natural products occur through the key steps of biosynthesis 27 . The key biosynthetic enzyme gene of PL has not yet been identified, which limits the possibility of achieving its large-scale production through synthetic biology methods 28 . On the other hand, the Piperaceae family is a large plant family with over 3,600 species, among which the Piper genus and the Peperomia genus are the most representative 29 . To date, only P. nigrum in the Piperaceae family has completed chromosome-level genome sequencing and assembly 30 . Although the genome of P. longum , a species morphologically similar to P. sarmentosum , has preliminary genomic information, it is still at the contig level, containing 89,204 scaffolds with an N50 value of 10.7 kb, which presents significant fragmentation issues 31 . This limits its application in gene function research and the analysis of complex gene structures. In this study, we combined PacBio HIFI and high-throughput chromosome conformation capture (Hi-C) technologies to successfully obtain a high-quality genome of P. sarmentosum . Through comparative genomics analysis, we revealed a whole-genome duplication (WGD) event in the Piperaceae plant genome, and by integrating transcriptomic and metabolomic data, we identified and validated a series of key genes in the biosynthetic pathway of PL. Our results provide an important foundation for understanding the genomic evolution of Piperaceae plants as well as alkaloid research. Results Genome sequencing, assembly, and quality assessment To estimate the initial characteristics of the P. sarmentosum genome, we generated 18.35 Gb of high-precision HiFi data with an average read length of 22.61 kb using the PacBio platform. K-mer analysis (K = 21) was performed to evaluate the genome size, repetitive sequences, and the heterozygosity rate of the genome. The survey plot revealed that this plant has a highly heterozygous and repetitive genome, with an estimated genome size of approximately 526.56 Mb and a heterozygosity rate of about 0.81% (Fig. 1A). Subsequently, these HiFi reads were assembled into a 548.44 Mb draft genome using Hifiasm, consisting of 674 contigs (N50 = 15.36 Mb). After several rounds of assembly, polishing, comparison, extension, and gap filling, we obtained 137 scaffolds, which included 102 gaps. The N50 of the scaffolds is 22.52 Mb, and the longest scaffold is 38.88 Mb. We constructed a high-throughput Hi-C library for P. sarmentosum , generating 85 Gb of Hi-C paired-end reads. The allelic sequences of 127 scaffolds were anchored to 26 chromosomes, achieving an anchoring rate of 97.79%, with an N50 of 34 Mb and an L50 of 10 Mb. Chromatin interaction data indicate that our Hi-C assembly is of high quality (Fig. 1B). To assess the integrity of the genome assembly, we further investigated the telomere and centromere structures. Except for chromosome 21, where telomeres were not detected, and chromosomes 12, 16, and 20, where only one side of the telomere was detected, all other chromosomes showed detectable telomeres with the telomere repeat monomer being AAACCCT/TTTGGGA. Centromere regions, ranging from 7.57 Mb to 130 kb, were predicted, and these regions were found to be associated with repetitive sequences and negatively correlated with gene distribution, further demonstrating the integrity of the genome assembly (Fig. 1C). We determined that the BUSCO score for the P. sarmentosum genome was 97.4% (Table 1 ), higher than the published value for P. nigrum (BUSCO: 96.1%) and P. longum (BUSCO: 96.0%). Additional validation using the LTR Assembly Index (LAI = 12.68) to assess the integrity of long terminal repeats (LTRs) further confirmed that the assembled P. sarmentosum genome is of sufficiently high quality to serve as a reference genome (Table 1 and Supplementary Data 1). Table 1 Statistics of the genome assembly for P. sarmentosum . Feature Value Genome size, estimated (Mb) 526.56 Genome size, assembled (Mb) 548.45 Hi-C reads (GB) 50.12 CCS reads (Gb) 123.52 Contig N50 (Mb) 7.39 Scaffold N50 (Mb) 22.52 Contigs 674 Scaffolds 138 Largest contig (Mb) 38.88 GC content (%) 34.49% HiFi reads mapping ratio (%) 99.99% BUSCO assembly completeness (%) 97.40% QV 61.40 Anchoring percentage (%) 97.79% Gaps number 102 Gaps Length (kb) 10.20 LAI core 12.68 BUSCO predicted gene completeness (%) 98. 6% Protein-coding genes 39,154 rRNA genes 1081 tRNA genes 1138 snRNA genes 846 snoRNA genes 1138 miRNA genes 175 Genome Annotation De novo prediction revealed that the P. sarmentosum genome contains 326.88 Mb of repetitive sequences, accounting for approximately 57.88% of the total genome size (Supplementary Data 2). These repeats consist of 31.82% retrotransposons, 4.10% DNA transposons, 18.78% unclassified repeats, and 1.12% satellite repeats. Among them, LTR retrotransposons represent the most abundant class of repetitive DNA, with Copia and Gypsy elements comprising 5.13% and 25.69% of the genome, respectively. These repetitive elements are unevenly distributed across chromosomes, showing a strong preference for centromeric regions (Fig. 1C). The insertion time distribution of Long Terminal Repeat Retrotransposons (LTR-RTs) reflects the historical activity of transposable elements (TEs) and selective pressures 32 . Active LTR-RTs inserted within or near functional genes can induce phenotypic variation, and the amplification and contraction of LTR-RTs significantly affect genome size 33 , 34 . In our analysis of the P. sarmentosum and P. nigrum genomes, we observed significant differences in the insertion times and durations of the Copia and Gypsy superfamilies of LTR-RTs (Fig. 1D). For the Gypsy family, the insertion time in P. sarmentosum was estimated to be 34.45 MYA, whereas in P. nigrum , it was significantly more recent at 15.90 MYAs, with P. nigrum containing more insertions than P. sarmentosum . This recent expansion of Gypsy elements in P. nigrum suggests that, following the divergence of the two species, Gypsy elements underwent a sustained period of growth. As for the Copia family, the insertion time in P. nigrum was recorded as 57.72 MYA, whereas in P. sarmentosum , insertion events continued intermittently between 1.0 and 2.67 MYA. Further phylogenetic analysis, based on coding region sequence homology, allowed us to classify the Copia and Gypsy elements into distinct lineages. Among these, the most abundant members of the Ty1/copia and Ty3/gypsy families were identified as Tork and Tekay, respectively (Fig. 1E and 1F). Functional prediction analysis of genes containing specific LTR retrotransposons inserted within approximately 5000 base pairs revealed that these insertions could impact gene functions in several ways. These include transposition, RNA-mediated processes, N-acylethanolamine metabolic processes, DNA integration, regulation of ubiquitin-protein transferase activity, cellular glucose homeostasis, terpenoid biosynthesis, and defensive response regulation (Supplementary Data 3). The rapid amplification of repeat elements likely played a crucial role in the genomic evolution of P. sarmentosum and its divergence from closely related species. This suggests that LTR-RTs, particularly Gypsy and Copia elements, have been important contributors to the genetic diversification and adaptation of P. sarmentosum , potentially influencing its phenotypic traits and evolutionary history. Using a combined approach of de novo prediction, homology-based annotation, and transcriptomic evidence, we annotated a total of 39,154 protein-coding genes, with an average gene length of 3,312 bp and an average coding sequence (CDS) length of 1,151 bp. These genes exhibit an uneven chromosomal distribution, with a pronounced bias toward telomeric regions, and display distinct expression patterns across different tissues (Fig. 1C). Although the number of annotated genes is significantly lower than that reported for the P. nigrum genome, our annotation achieves a completeness score of 98.83%, substantially higher than the previously reported 83.6% for P. nigrum (Supplementary Data 1). Functional annotations were assigned to the predicted genes using five major databases: TrEMBL, SWISS-PROT, Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and InterPro. In total, 20,937 (86.24%), 16,603 (38.03%), 31,276 (44.55%), 30,171 (94.14%), 35,034 (73.29%), and 35,232 (84.48%) gene models were successfully annotated in GO, KEGG, COG, PFAM, Swiss-Prot, and NR, respectively (Supplementary Data 4). Over 90% (35,266) of the genes were functionally annotated. Furthermore, we classified 2,403 transcription factors (TFs) from 58 gene families, representing 6.14% of the total CDS. Among these, basic helix-loop-helix (bHLH), ethylene-responsive element-binding factors (ERF), and myeloblastosis (MYB) families were the most prominent. Additionally, we identified 646 chromatin regulators (CRs), 157 transcriptional regulators (TRs), and a variety of non-coding RNAs (ncRNAs), including 1,138 small RNAs, 175 miRNAs, 652 tRNAs, 1,081 rRNAs, and 846 snRNAs. Gene Family Evolution and Phylogenetic Reconstruction and WGD We conducted gene family analysis by comparing the protein-coding sequences of P. sarmentosum with those of 14 other sequenced plant genomes. A total of 503,044 genes from the 15 species were subjected to gene family clustering, resulting in the identification of 31,805 orthologous gene families. Among these, 273 gene families were single-copy genes, while 5,853 gene families were shared by all species (Fig. 2A and Supplementary Data 5). Among the 15 species, P. nigrum had the highest number of single-copy orthologs (5,383), while P. sarmentosum had the fewest (1,668). The highest number of multicopy orthologs was identified in P. nigrum , with 18,483 multicopy orthologs. Furthermore, the gene family clustering analysis revealed that 8,429 gene families were shared by all five Magnoliids, while 468 gene families were unique to the P. sarmentosum genome, far fewer than the 3,088 gene families in P. nigrum ; of these, 3,838 orthologs are shared within the Piper genus (Fig. 2B and Supplementary Data 5). To investigate the functions of the shared genes within the Piper genus, we conducted Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses on the 3,838 shared gene families. The GO term enrichment analysis showed that these genes are mainly involved in "binding," "transport," "metabolic processes," and "signal transduction" (Supplementary Data 6). In contrast, KEGG enrichment analysis indicated that most of these genes were associated with pathways related to the biosynthesis of secondary metabolites, such as "Stilbenoid, diarylheptanoid and gingerol biosynthesis," "Phenylpropanoid biosynthesis," and "Terpenoid biosynthesis" (Supplementary Data 6). Additionally, we performed GO functional annotation for 382 unique genes, which revealed that these genes are enriched in biological processes such as "DNA unwinding involved in DNA replication," "regulation of helicase activity," "mannose transmembrane transport," "triterpenoid biosynthetic process," "regulation of cellular response to heat," and "membrane protein ectodomain proteolysis" (Supplementary Data 7). To investigate the phylogeny and evolutionary trajectory of P. sarmentosum , a genomic-scale phylogenetic tree was constructed based on 273 strict single-copy orthologous genes from 15 plant genomes, with Amborella trichopoda as the outgroup. The maximum likelihood (ML) method was employed for tree construction (Fig. 2C and Supplementary Data 8). As expected, the phylogenetic tree places P. sarmentosum as the sister group to the Piper species. The divergence of the Piperaceae family is estimated to have occurred around 92.20 MYA, and the divergence between P. nigrum and P. sarmentosum is estimated to have occurred approximately 17.56 MYA. Further analysis using CAFE 5 revealed that 4,430 gene families underwent expansion in the P. nigrum lineage, while 447 gene families contracted (Fig. 2C). In P. nigrum , 2,967 gene families expanded, while P. sarmentosum exhibited 2,746 expanded gene families. Among these, the Piper species showed contraction in 1,406 gene families, while P. sarmentosum had contraction in 813 gene families. Gene Ontology (GO) functional enrichment analysis of all expanded gene families revealed that they are significantly involved in processes such as alkaloid metabolic process (GO:0009820), cellular amide metabolic process (GO:0043603), jasmonic acid metabolic process (GO:0009694), response to wounding (GO:0009611), and mismatch repair (GO:0006298) (Supplementary Data 9). In addition, the specific gene expansions in P. sarmentosum were notably enriched in genes related to secondary metabolism, disease resistance, and growth/development (Fig. 2D). These include BAHD acyltransferases (28 genes), sulfotransferases, disease resistance proteins (e.g., RPS5, RPP13, RGA1, RGA2, RGA3, RGA4, RGA5 ), NBS-LRR disease resistance proteins, LRR receptor-like serine/threonine protein kinases (e.g., EFR, BAM1, FLS2, GSO2, EMS1 ), jasmonate (28 genes), and auxin-inducible genes (65 genes). These gene expansions may indicate that biotic stress from pathogen infection and herbivory are the primary selective pressures acting on P. sarmentosum in tropical rainforests. Whole-genome duplication is considered a major evolutionary force that generates additional genetic material, enhancing the adaptability and plasticity of plants, which in turn promotes species diversification and functional innovation 35 . In this study, we used MCScanX to infer synteny within the genome of P. sarmentosum . Our analysis identified 739 syntenic blocks across the entire genome, containing 25,308 genes, which account for 65.76% of the total gene count. Among these syntenic blocks, 689 (93.33%) of the paralogous genes were located between chromosomes, while the remaining 50 (6.77%) were located within chromosomes (Fig. 1C). The analysis of paralogous gene duplication types in P. sarmentosum indicated that most genes were classified as resulting from WGD or segmental duplications (25,308 genes, 65.76%). This suggests that a large proportion of P. sarmentosum 's genes experienced duplication during the evolutionary process. To gain deeper insight into the evolutionary history of the P. sarmentosum genome, we compared its synonymous substitution rate (Ks) with the genomes of P. nigrum , Cinnamomum camphora , Liriodendron tulipifera , and grape to identify homologous gene pairs and assess the synteny relationships between these species. The Ks curve rates of syntenic gene pairs indicate that the P. sarmentosum genome has undergone three rounds of WGD: the first being an ancient triplication event (Ks ≈ 1.53), consistent with the γ event of the angiosperm ancestor, shared by all core eudicot lineages. The second was a β duplication event shared by magnoliids (Ks ≈ 0.88), consistent with the Ks distribution region of other magnoliids, followed by a recent triplication event (Ks ≈ 0.15). Additionally, we conducted a synteny analysis using Aristolochia fimbriata , P. sarmentosum and P. nigrum , revealing a ratio of 1:8:8, consistent with previous studies on P. nigrum , further confirming the three rounds of WGD in P. sarmentosum 36 . Metabolite Profiling and Biosynthesis Pathways of Piperine and PL in P. sarmentosum As a distinctive plant, P. sarmentosum has not been extensively studied in terms of its metabolomics. This study uses non-targeted metabolomics to investigate the distribution of metabolites across different tissues of P. sarmentosum .A total of 4,456 metabolites were identified, including 1,290 amino acids and derivatives, 535 phenolic compounds, 535 organic acids, 238 alkaloids, 182 phenolic acids, 161 flavonoids, and other types of metabolites (Fig. 3A and Supplementary Data 10). The distribution of metabolites shows distinct tissue specificity (Fig. 3B). To assess the tissue-specific metabolites in P. sarmentosum , we conducted a weighted gene co-expression network analysis (WGCNA), which identified 15 distinct metabolic modules. Among these, the Brown, Turquoise, Blue, Yellow, and Green modules were found to be specific to each tissue, collectively representing 84.56% of the total metabolites (Fig. 3C). KEGG pathway enrichment analysis of these core modules revealed significant enrichment in the "Valine, leucine, and isoleucine biosynthesis" and "Glycolysis / Gluconeogenesis" pathways across all modules (Fig. 3D and Supplementary Data 11). Notably, the Brown and Turquoise modules showed significant enrichment in the "Biosynthesis of various alkaloids" pathway. We further investigated and observed that the relative content of piperidine alkaloid metabolites, such as Piperine, Piperitone, Guineensine, Pyrrolidine, Trichostachine, Piperlonguminine, and PL, is notably higher in the root, flower, and fruit tissues (Fig. 3E). This differential distribution may reflect a tissue-specific role of these alkaloids in plant defense mechanisms, as alkaloids are known to act as deterrents against herbivores and pathogens. (Fig. 3E and Supplementary Data 10). P. sarmentosum contains piperine, which is not only the major amid alkaloid in the fruit but also the key source of its spicy flavor and biological activity. However, the piperine content in P. sarmentosum is much lower than in P. nigrum 37 . Therefore, understanding its biosynthetic pathway is crucial for developing crops with high piperine content. Current research on piperine biosynthesis mainly involves three gene groups: The first group includes genes in the phenylpropanoid pathway (map00940), which catalyze a series of complex reactions to produce 3,4-methylenedioxycinnamoyl-CoA, a precursor for the biosynthesis of piperoyl-CoA. The second group consists of genes involved in L-lysine metabolism (map01064), which catalyze the conversion of lysine into piperidine through a series of reactions, including decarboxylation, amine oxidation, cyclization, and reduction 38 – 40 . The third group is acyltransferase genes, which catalyze the synthesis of piperidine alkaloids in the presence of piperoyl-CoA and piperidine (Fig. 4A). However, the biosynthetic pathway of PL remains unclear. Based on its chemical structure, we hypothesize that the key steps in its synthesis involve the reaction between Sinapoyl-CoA and 5,6-dihydropyridin-2(1H)-one, catalyzed by the BADH enzyme, forming an amide compound, which is then methylated by the OMT enzyme (Fig. 4A). Notably, this step shares many genes with the biosynthesis of piperine (Fig. 4A and 4B). Through homology searches and functional annotations, we identified 110 candidate genes that are likely involved in the biosynthesis of piperine alkaloids. Expression analysis showed distinct expression patterns of these genes across different plant tissues (Supplementary Data 12). Most of the genes in the phenylpropanoid pathway exhibit high expression levels, including PsSK (Pbechr23G000696, Pbechr8G000852), PsEPSPase (Pbechr5G001181), PsCS (Pbechr10G000850, Pbechr8G000653), PsCM (Pbechr22G000529, Pbechr26G000427, Pbechr8G001394), PsPAL (Pbechr4G002064, Pbechr5G000287, Pbechr3G001915), PsC4H (Pbechr16G000464, Pbechr23G000605), PsCOMT (Pbechr1G002005), Ps4CL (Pbechr2G001132, Pbechr8G001369), and PsCAO (Pbechr18G000248, Pbechr3G001234, Pbechr4G000818). These genes are highly expressed in multiple tissues, with the root, flower, and fruit showing the highest levels (Fig. 4A and 4B). Acyltransferase (BADH) is a key enzyme in the biosynthesis of piperine-like compounds. In this study, we conducted a gene family analysis and identified 126 BADH genes in P. sarmentosum , 155 in P. nigrum , 51 in A. fimbriata species, and 63 in Arabidopsis thaliana . These genes include two characteristic motifs found in all BAHD-like enzymes: HXXXD and DFGWG. A total of 126 PsBAHD genes were distributed across 25 chromosomes, with 51 of these genes (40.48%) located in WGD gene clusters, suggesting that the WGD event has played an important role in the amplification of PsBAHD genes (Supplementary Data 12). Phylogenetic trees were constructed using the Maximum Likelihood (ML) method, and based on the reference by Liu et al., the BAHD family proteins were classified into six branches (I, II, III, IV, V, and VI) (Fig. 4C) 41 . Notably, previous transcriptome studies have identified two genes involved in piperine synthesis: Piperine synthases (MW354956), which specifically catalyze the synthesis of piperine using piperoyl-CoA and piperidine as substrates, and Piperamide synthases (MW354957), which have broader substrate specificity and catalyze reactions involving various CoA esters and aliphatic or aromatic amines, producing a range of piperamide derivatives 38 . We found that in P. sarmentosum , only Piperamide synthases (Pbechr3G000899) are present, while Piperine synthases are absent. Furthermore, this gene is predominantly expressed in the root, which could explain the lower content of piperine in P. sarmentosum compared to P. nigrum . The remaining PsBAHD genes are mainly expressed at higher levels in the flowers and fruits of P. sarmentosum , suggesting that these genes may play a crucial role in the biosynthesis of piperamide and other alkaloids in the flowers and fruits (Fig. 4D and Supplementary Data 12). Biosynthetic genes for PL still require further analysis. Identification of key genes involved in PL biosynthesis To investigate the genes and regulatory network involved in the synthesis of PL, we constructed a WGCNA network using 39,154 genes from 15 samples. Genes with low expression variation (standard deviation ≤ 0.8) were filtered out, leaving 19,362 genes, which were then divided into 16 distinct modules, each marked with a different color. The modules are presented in a cluster dendrogram, network heatmap, and trait heatmap, with the gray module representing genes that were not assigned to any specific module and have no reference significance (Fig. 5A). Through Pearson correlation analysis, we associated each co-expressed module with alkaloid and lysine pathway metabolites. The results showed that most alkaloid-related modules were negatively correlated with L-Lysine and 5-Aminopentamic acid. Specifically, the 'Orange' and 'Darkturquoise' modules showed significant correlations with L-Lysine and 5-Aminopentamic acid ImC, while the 'Darkolivegreen' module was significantly associated with Pipericine and Piperine. Notably, PL was significantly correlated with the 'Darkgreen' module, which showed high expression during the flowering and fruiting stages. Therefore, we hypothesize that genes within the Darkgreen module may be closely involved in the synthesis of PL (Fig. 5B). Further analysis revealed that the Darkgreen module contained 621 genes, and their expression levels were significantly upregulated in the flowers and fruits (Fig. 5B). KEGG functional analysis indicated that most of these genes were enriched in metabolic pathways such as Biosynthesis of secondary metabolites, Metabolic pathways, Terpenoid backbone biosynthesis, Fatty acid degradation, Plant hormone signal transduction, Nicotinate and nicotinamide metabolism, Monoterpenoid biosynthesis, and MAPK signaling pathway – plant, among others. GO functional analysis showed that these genes are involved in flower development and the biosynthesis of alkaloid metabolites (Supplementary Data 13). To identify key genes involved in the synthesis of PL, we selected the top 200 genes with the highest ImC values from the Darkgreen module and visualized the relationships between highly connected genes using Cytoscape software (Fig. 5C). Among these genes with the highest connection degrees (KEM), we identified several key genes, such as PsHCT1 (Shikimate hydroxycinnamoyl transferase, Pbechr25G000561), PsCYP450 , PsAO , PsPK , PsCER3 , and others. In addition, several transcription factors, including MYB, bHLH, and CBF, were also identified. These transcription factors may play an important role in maintaining the development of flower and fruit organs, as well as in regulating the synthesis of amide alkaloids (Supplementary Data 14). Notably, PsHCT1 is the most highly connected hub gene within this Darkgreen module, and it has the highest expression level among all the BADH gene family members. The PsHCT1 -like gene encodes a protein of 427 amino acids, with an encoding sequence of 1281 base pairs. Subcellular localization analysis revealed that PsHCT1 is localized in the cytoplasm, consistent with previous studies 42 , 43 (Fig. 5D). To further explore the function of this gene, we modeled PsHCT1 based on the best template, the X-ray crystal structure of BAHD from rosemary (PDB accession number: 6MK2). We further investigated the interactions between the compounds Sinapic acid-CoA and 5,6-Dihydropyridin-2(1H)-one and the PsHCT1 gene, using the HCT crystal structure as the receptor. As shown in Fig. 5E, Sinapic acid forms hydrogen bonds with the residues Asp-298 (6.5 Å), SER-378 (3.4 Å), LEU-35 (2.5 Å), His-158 (1.5 Å), and Asp-162 (3.41 Å), and interacts with several other amino acid residues in this range. On the other hand, 5,6-Dihydropyridin-2(1H)-one forms a hydrogen bond with PRO-37 (1.1 Å). Notably, 5,6-Dihydropyridin-2(1H)-one forms a 2.9 Å hydrogen bond with the acyl group of Sinapic acid (Fig. 5E). The molecular docking results, which align with structure-activity relationships, show a strong binding affinity with an affinity value of -6.2 kcal/mol. Additionally, we predicted molecular docking between the PsHCT1 gene and the product. The results indicated that the product forms hydrogen bonds with ARG-363 (8.7 and 6.5 Å), LYS-221 (5.5, 5.5 Å), and PRO-37 (6.1 Å), demonstrating a high binding force. The molecular docking results, which are consistent with structure-activity relationships, also show an affinity of -6.3 kcal/mol, indicating a potential binding interaction (Fig. 5E). In the biosynthesis of PL, OMT enzymes play a crucial role in the addition of methoxy groups. Subsequently, through gene family analysis, we identified 96 OMT genes. A phylogenetic tree was constructed using Arabidopsis as a reference, revealing that the tree is divided into two families: PsCCoAOMT (35 genes) and PsCOMT (61 genes) (Supplementary Data 15). Based on the chemical structure of PL, we hypothesize that its biosynthesis is closely related to the PsCCoAOMT subfamily, which exhibits highly active gene expression, with PsCCoAOMT1 (Pbechr20G000401) showing the highest expression level (Supplementary Data 15). We then performed molecular docking predictions between the PsCCoAOMT1 gene, PL precursors, and the PL molecule. The results showed binding energies of -7.7 kcal/mol and − 8.0 kcal/mol, indicating strong binding affinity (Fig. 5F). This suggests that the enzyme may catalyze the addition of the methoxy group to the PL precursor through stable interactions. To summarize, through WGCNA, correlation analysis, high expression levels, and strong binding predictions from molecular docking, we identified PsHCT1 and PsCCoAOMT1 as key genes involved in PL synthesis. However, this result still requires further experimental validation. Discussion P. sarmentosum is a widely recognized traditional medicinal and edible plant, attracting increasing attention due to its therapeutic and ornamental value 2 . The genus Piper is of significant commercial and economic importance, widely used in the spice, pharmaceutical, and pesticide industries, and also having a long history of use in traditional practices 44 . Previous phytochemical research on Piper species has led to the isolation of amide alkaloids, lignans, neolignans, and phenylpropanoids as the main components 3 – 6 . These isolated compounds exhibit a broad range of biological effects, including antifungal, anticancer, anti-inflammatory, and antioxidant activities, sparking widespread interest 2 . Although many chemical constituents have been isolated and identified from this species, the biological activities of only a few purified compounds have been studied. Therefore, it is crucial to explore the genomic evolution and biosynthesis mechanisms of active compounds in P. sarmentosum . In this study, we assembled a high-quality P. sarmentosum genome using PacBio HiFi and Hi-C sequencing, achieving a Scaffold N50 of 22.52 Mb, with BUSCO and QV quality assessments confirming the genome's high completeness compared to P. nigrum and P. longum 30 , 31 . Notably, the completeness of the gene annotation in P. sarmentosum , as predicted by BUSCO, was 98.6%, significantly higher than P. nigrum 's 83.6% 30 . This provides an important reference for the genomic analysis of other Piper species, making it an ideal model plant for functional genomics research in the Piper genus. In this study, significant differences in genome size were observed between P. sarmentosum (527.85 Mb) and P. nigrum (761.2 Mb). Transposable elements (TEs) are an important factor contributing to this size difference 45 . We found that the repetitive sequences in P. sarmentosum amounted to 305 Mb, constituting 57.88% of the total sequence, while P. nigrum had 417.52 Mb of repetitive sequences, accounting for 54.85%. Previous studies have shown that Ty3/Gypsy elements have been identified as the main repetitive components driving genome expansion in all large-genome species 46 . In our study, LTR retrotransposons comprised 31.82% of the P. sarmentosum genome, significantly lower than the 40.55% observed in the P. nigrum genome, which may be a crucial factor contributing to the genome size difference 30 . Our analysis of insertion times revealed that P. sarmentosum and P. nigrum underwent different LTR-type bursts over the past 3.5 MYA. Notably, LTR-RT bursts peaked at 0.25 and 0.5 MYA. During this period, the Earth experienced climate oscillations known as the Pleistocene, and the insertion of LTRs into the genome may have influenced the expression of resistance genes, thereby enhancing the plant's adaptability to the environment 47 , 48 . However, more thorough and in-depth research is needed to understand the underlying processes that led to LTR bursts. WGD play a crucial role in plant genome evolution, often leading to sudden increases in gene content and genome size. Qin et al. used specialized computations to find that P. nigrum underwent three rounds of WGD 36 . In this study, two α and β WGD events near the Cretaceous-Paleocene boundary were observed at Ks values of ~ 0.15 and ~ 0.88 in P. sarmentosum . Additionally, we were able to clearly observe the γ triplication event common to core eudicots at Ks ~ 1.53 without the need for special calculations. Our research confirms that Piper species underwent three rounds of WGD, with P. nigrum showing no clear γ triplication event, which may be related to its relatively low BUSCO score. On the other hand, the three WGDs in P. sarmentosum are consistent with its higher chromosome number (2n = 52), based on the basic chromosome number (x = 13), suggesting that this plant is polyploid. WGD events have facilitated the expansion of genes related to secondary metabolism, disease resistance, and growth/development, similar to the expansion in P. nigrum , with high expression in roots and fruits. This suggests that pathogenic infection and herbivory pressure are the major selective pressures faced by P. sarmentosum in tropical rainforests 30 . Natural products have always been an important source of potential lead compounds, and natural products and their structural analogs have made significant contributions to the treatment of diseases throughout history 49 . P. sarmentosum contains diverse bioactive compounds, including alkaloids, amides, and phenolic compounds, which have well-documented antioxidant and anti-inflammatory activities. Its crude extracts exhibit inhibitory effects against various microbial pathogens and cancer cell lines, highlighting its potential as a source of novel anticancer agents 11 , 12 . In this study, metabolomic analysis identified 4,456 metabolites, among which 238 alkaloids demonstrated significant pharmacological activity. Notably, amide-type compounds such as PL, piperine, and PL exhibit multi-target bioactivities, providing molecular evidence for the traditional "medicinal-food homology" properties of P. sarmentosum and supporting its potential as a natural drug repository. Since its first isolation from P. nigrum in 1820, a series of piperamides including piperamide, pipernonaline, and guineensine, have been identified 40 . Piperine, one of the most abundant compounds in Piper species 40 , serves as a key quality marker in P. nigrum , with reported concentrations ranging from 29.57 to 54.23 mg/g 50 . Previous studies have reported that the piperine content in P. sarmentosum (7.9 ± 0.1 mg/g) is significantly lower than that in P. nigrum 37 . However, the exact reasons for this disparity remain unclear. Studies have identified two key enzymes involved in the biosynthesis of piperine in P. nigrum : piperine synthase, which synthesizes piperine by combining piperoyl-CoA and piperidine, and piperamide synthase, which has broad substrate specificity and can bind various CoA esters with both aliphatic and aromatic amines, catalyzing different reactions 38 . Both of these enzymes are BAHD-type acyltransferases, encoded by genes that are preferentially expressed in the developing fruits of P. nigrum 38 .Through comparative genomics, we discovered differences in the BADH gene copy number between P. sarmentosum (126 genes) and P. nigrum (155 genes). Notably, only piperamide synthase was identified in P. sarmentosum , which may explain the lower piperine content in P. sarmentosum . The piperine synthase in P. nigrum originated from a dispersed event, and the absence in P. sarmentosum still requires further investigation with additional Piper species to fully understand this phenomenon. Our transcriptomic and metabolomic analyses revealed that piperamides, including piperamide, pipernonaline, and guineensine, are predominantly enriched in roots, consistent with prior findings 40 . In contrast, leaves, stems, flowers, and immature fruits exhibit lower alkaloid content, suggesting tissue-specific metabolic partitioning. The high concentration of piperamides in roots may function as a defense mechanism against soil pathogens, potentially acting synergistically with terpenoids to form an effective protective system. Beyond piperine, amide alkaloids represent one of the most abundant phytochemical classes in P. sarmentosum . PL, a bioactive compound first isolated from P. longum , exhibits remarkable anticancer properties. Its α, β-unsaturated carbonyl moiety is critical for pharmacological activity 13 , enabling selective induction of tumor cell apoptosis and suppression of metastasis. This compound demonstrates efficacy against multiple cancer cell lines, including breast, colon, prostate, and lung cancers 17 , 18 . Despite its therapeutic potential, PL's low natural abundance poses extraction challenges. While P. longum fruits contain only 1.2 mg/g, P. sarmentosum fruits accumulate higher levels (1.7 mg/g) 28 . This may be related to resistance against biological stress. Although some studies report elevated concentrations in P. longum roots, agricultural practices primarily harvest flowers and fruits 51 . Our metabolomic data confirms that P. sarmentosum predominantly synthesizes PL in reproductive tissues, aligning with cultivation needs. Given its chemical structure, we hypothesize that Sinapyl-Coenzyme A, a key metabolite in lignin biosynthesis, serves as the precursor for PL synthesis 52 . This compound is primarily synthesized through the phenylpropanoid pathway. Through integrated transcriptomic-metabolomic mining, we identified two key precursor enzymes, PsHCT1 and PsCCoAOMT1 , involved in the PL biosynthetic pathway. Molecular docking predictions show a high probability of binding between these enzymes and their respective substrates and products, suggesting their potential role in catalyzing key biochemical reactions in PL synthesis. Transcription factors such as bHLH, MYB, and WRKY are known to regulate secondary metabolism, including the synthesis of alkaloids and other bioactive compounds, in response to environmental stress 53 – 56 . Our weighted gene co-expression network analysis (WGCNA) suggests a strong correlation between these transcription factors and the expression of PsHCT1 , indicating that they may enhance PL production by modulating the activity of these enzymes. While these computational results are promising, further experimental evidence is required to validate the involvement of PsHCT1 , PsCCoAOMT1 , and the transcription factors in PL biosynthesis. Ferulic acid, the best precursor for Sinapyl-Coenzyme A biosynthesis, is catalyzed by F5H to form 5-hydroxyferulic acid, which is subsequently converted into sinapate by COMT 57 . Sinapate undergoes hydroxylation and methylation by key enzymes, such as 4CL and COMT, to form CoA derivatives 58 . These key enzymes are well-characterized, facilitating the construction of chassis strains for de novo PL synthesis. Interestingly, 5,6-dihydropyridin-2(1H)-one, another precursor for PL synthesis, is typically synthesized through chemical methods, which are costly and complex 59 , 60 . Although the biosynthetic pathway has not yet been fully validated, we have identified PsHCT1 and PsCCoAOMT1 as key enzymes potentially involved in PL synthesis and hypothesize that transcriptional regulation through stress-responsive factors could effectively increase PL production. Overall, our study provides valuable directions for further validating these findings and optimizing the biosynthetic pathway for efficient PL production. Conclusions Through integrated multi-omics analysis, this study has achieve the chromosome-level genome assembly of P. sarmentosum , significantly advancing genomic research in the Piper genus. We have systematically elucidated the biosynthetic mechanisms of the key bioactive compound PL, providing crucial theoretical foundations for the genetic improvement of medicinal plants and the development of plant-derived pharmaceuticals. Materials and methods Plant Material, DNA Extraction, and Sequencing The P. sarmentosum plant used in this study was originally collected from a spice plantation in Lufeng City, Guangdong Province, China (35°2' N, 104°3' E) and subsequently relocated to the Guangdong Provincial Crop Germplasm Resource Nursery (23°16' N, 113°27' E) for long-term maintenance under natural conditions. The sample ID is GD2021441581. All genomic sequencing samples were derived from fresh leaves of a single plant. DNA was extracted using a modified cetyltrimethylammonium bromide (CTAB) method, as previously described 61 . After thoroughly grinding the P. sarmentosum leaf tissues, 5 mL of 2% CTAB, 50 µL of β-mercaptoethanol, and 26 µL of proteinase K were added, and the mixture was well mixed. The samples were incubated at 65°C for 30 minutes. After incubation, the samples were centrifuged at 12,000 rpm for 10 minutes, and the supernatant was collected. Next, an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1) was added to the supernatant and mixed thoroughly. The mixture was then centrifuged at 12,000 rpm for 10 minutes. This step was repeated twice, with the supernatant collected each time. Then, an equal volume of chloroform/isoamyl alcohol (24:1) was added, the mixture was mixed again, and centrifuged at 120,000 rpm for 10 minutes. The supernatant was collected. Subsequently, pre-chilled isopropanol (4°C) was added, and the mixture was inverted to mix and incubated at 4°C for 30 minutes to precipitate the DNA. The samples were centrifuged at 12,000 rpm for 10 minutes to collect the DNA precipitate. The precipitate was washed twice with 1 mL of pre-chilled 70% ethanol (4°C), centrifuging at 12,000 rpm for 5 minutes each time, and then air-dried at 37°C. Finally, the dried DNA pellet was dissolved in Tris-HCl buffer, treated with RNase A, and incubated at 37°C for 30 minutes to remove RNA. The final DNA solution was stored at -20°C. The concentration and quality of the extracted DNA were evaluated using a NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). For long-read sequencing, a PacBio SMRTbell library was constructed using the SMRTbell Prep Kit 3.0 (Pacific Biosciences, Menlo Park, CA, USA) according to the manufacturer's protocol. Sequencing was performed on the PacBio Revio platform (PacBio Sequel II system) to generate high-fidelity (HiFi) data. To improve the continuity of the genome assemblies, we created Hi-C libraries for the young leaves of the same plant using the GenSeq Hi-C library preparation kit (Cloud-Seq Bio Co., Ltd., China, Shanghai). The kit involves crosslinking, DpnII digestion, biotin labeling, ligation, shearing, and biotin capture 62 . Sequencing of the Hi-C fragments was conducted on the DNBSEQ-T7 platform (MGI, Shenzhen, China). De novo Genome Assembly First, HiFiAdapterFilt v3.0.0 63 was used to remove reads with residual PacBio adapter sequences from the HiFi sequencing data and perform quality control. Jellyfish v2.3.1 64 was used to count k-mers in the HiFi sequencing data with the parameter kmer = 21. Genomescope.R v2.0 65 was employed to estimate the genome size, setting the maximum k-mer coverage threshold to 10,000. The initial genome assembly of PacBio Revio sequencing platform HiFi reads was performed using Hifiasm v0.15.5 66 with default parameters. Subsequently, the genome was polished three times using Pilon v1.24 67 . Redundant overlapping contigs were removed using Purge_Haplotigs v1.1.2 68 . The final round of gap filling for the draft genome was conducted using NextDenovo v2.17-r941 69 and TGS_Gapcloser2 v1.9.4 70 . Next, the Hi-C reads were aligned to the assembled genome using Juicer v1.60 71 software, allowing us to obtain interaction data between chromatin regions across contigs. The 3D-DNA v180922 72 pipeline was used to automatically generate candidate chromosome-level assemblies to correct erroneous connections, orders, and orientations, and to organize the contigs into the draft chromosome assembly. Errors in the chromosome-level assembly were manually corrected in Juicebox v2.20.00 73 , and Hi-C reads were aligned to the chromosome-level assembly using HiCExplorer v3.7.2 74 to evaluate the clarity of structural domains across different chromosomes. The final chromosome-level genome assembly was assessed using BUSCO v3.1.0 75 based on the embryophyta_odb10 gene set. Minimap2 v2.28 76 was used to map PacBio HiFi reads to the assembled genome to evaluate coverage and average depth. Genome quality was assessed using LTR_retriever v2.9.681 77 . Finally, Mequery v1.3 78 was used to evaluate the assembly's overall quality (QV) and completeness. Genome Annotation The identification of known TEs in the genome is performed using RepeatMasker v4.1.0 79 with the Repbase TE library, and the TE protein database is queried using RepeatProteinMask. Subsequently, RepeatModeler2 v1.0.11 80 is employed to construct de novo repeat libraries for each genome, followed by detailed analysis, refinement, and classification. LTRs are identified with LTR_Retriever v2.9.681 77 and further classified using TESorter v1.4.682 81 . The terminal regions of LTRs are aligned with Mafft v7.50584 82 , and insertion times for LTRs are calculated using the formula T = K/2r, where K represents the genetic distance, and r is the substitution rate of 1.3e-8 substitutions per site per year. An unrooted phylogenetic tree is constructed using the neighbor-joining method with FastTree v2.1.1185 83 . For accurate protein-coding gene prediction, a combination of transcriptomic, homology-based, and de novo approaches is used. De novo predictions are made with Augustus 84 , GenScan 85 , and GlimmerHMM 86 , utilizing the Arabidopsis training set. Homology-based predictions employ GeMoMa 87 , incorporating protein sequences from P. nigrum and other species. Transcriptomic predictions align the de novo transcriptome assembly with the genome and refine gene structures using PASA. Gene model consensus sets are generated using EVidenceModeler 88 , excluding single-exon genes supported solely by transcriptomic data and genes with fewer than three exons. To further enhance the reliability of annotations, TransposonPSI v2.2.26 89 is used to identify transposon-related genes, while Pseudogene Pipeline identifies pseudogenes. Pseudogenes and transposon-related genes with FPKM < 1 are excluded. Gene function annotations are performed using EggNOG-mapper 90 , Diamond, and InterProScan, providing annotations for GO, EC, KEGG pathways, COGs, and other functional categories. Non-coding RNA annotations are performed using Infernal v1.1.4 and tRNAscan-SE v2.0.9. The integrity of the genome or protein sequences is assessed using BUSCO 75 with the embryophyta_odb10 plant reference set. Phylogenetic Analysis The longest protein sequences from each gene model of 15 plant species were extracted and subjected to an all-versus-all Diamond alignment. Homologous genomes were identified using the default parameters of OrthoFinder v3.0.1b1 91 software. The aligned tandem amino acid sequences were further refined using MAFFT v7.271 82 , followed by trimming with trimAI v1.4.rev22. A maximum likelihood phylogenetic tree was constructed using RAxML v8.2.12 92 with the PROTGAMMAJTT model and 1,000 bootstrap replicates, using A. trichopoda as the outgroup. The species tree topology was calibrated using MCMCtree v4.9 93 , incorporating two temporal calibration points: Node 1 (the common ancestor of A. trichopoda and O. sativa ) estimated to be between 179 and 205 MYA; Node 2 ( H. annuus and C. arabica ) estimated to be between 97.5 and 109.2 MYA, with data sourced from the TimeTree 94 database. A log-normal independent molecular clock model was used to generate 1,000,000 samples, discarding the first 25% as burn-in. The MCMCtree R package was employed to visualize the reliable divergence time intervals of each node in the species tree. Gene family expansion and contraction were assessed using CAFE v4.2.1 95 , and conditional P-values for each gene family were calculated. Gene families with P-values < 0.05 were considered to have significantly accelerated rates of expansion or contraction. Gene families with more than 100 copies in a single species were removed. Homologous protein sequences between species were aligned using Diamond v0.9.29.130 96 (E-value 0.5), and syntenic blocks were identified using MCScanX v1.0.0 97 . To investigate the evolution of the P. sarmentosum genome, the synonymous substitution rate (Ks) for collinear gene pairs was calculated using wgdi v1.1.1 98 . Transcriptome and Metabolomic Analysis The transcriptome sequencing was performed on five different tissues, including roots, stems, mature leaves, flowers, and fruits. Each sample consisted of three biological replicates. Total RNA was extracted using the Trizol reagent kit (Invitrogen, Carlsbad, CA, USA), and its quality was assessed using the Agilent 2100 Bioanalyzer. Eukaryotic mRNA was enriched with Oligo(dT) beads, while prokaryotic mRNA was enriched by removing rRNA using the Ribo-ZeroTM Magnetic Kit (Epicentre, Madison, WI, USA). The cDNA libraries were constructed using the NEBNext UltraTM RNA Library Prep Kit for Illumina (New England BioLabs, Beijing, China). The resulting cDNA library was sequenced on the MGI T7 platform (MGI, Shenzhen, China) using a 2 × 150 bp paired-end run, with the experimental procedures following standard plant RNA extraction protocols. Sequencing was performed by Yuda Biotechnology Co., Ltd (Guangzhou, China). After filtering low-quality reads with fastp v0.23.4 99 , clean reads were mapped to the P. sarmentosum genome using HISAT2 v.2.2.1 100 . Reads were quantified using featureCounts. Reads were quantified using featureCounts, and gene expression values were represented as TPM. We then used WGCNA v1.73 101 to filter genes with low expression variation (standard deviation ≤ 0.8), setting the power value to 30 and using other default parameters for analysis. Tissue-specific gene clusters were identified based on module-metabolite correlations (Pearson |cor| >0.95). The clusterProfiler v4.0 102 package was used to perform GO and KEGG enrichment analysis on the genes in the identified tissue-specific modules. The combination of chromatography and mass spectrometry achieves the entire process from separation of substances by chromatography to identification of substances by mass spectrometry. Liquid chromatography-tandem mass spectrometry (LC-MS/MS) enables accurate qualitative and quantitative analysis. In this study, the sample collection and transcriptomics were consistent, with root, stem, mature leaf, flower, and fruit tissues, each sample using 3 biological replicates. LC-MS/MS was used to detect and analyze the metabolites in the samples. The samples were freeze-dried using a freeze dryer (Scientz-100F) and ground into powder using a grinder (MM 400, Retsch) at 30 Hz for 1.5 minutes. A 50 mg powder sample was weighed and extracted with 1200 µL of pre-chilled 70% methanol aqueous extraction solution at -20°C, with shaking for 30 seconds every 30 minutes for a total of 6 times. The mixture was centrifuged (12000 rpm, 3 minutes), and the supernatant was collected, filtered, and stored in vials for UPLC-MS/MS analysis. HPLC analysis was performed using a Waters ACQUITY Premier HSs T3 column (1.8 µm, 2.1 mm * 100 mm) in positive ion mode, with a mobile phase of 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B). The gradient was as follows: 5–20% B (2 minutes), 20–60% B (3 minutes), 60–99% B (1 minute), held for 1.5 minutes, then returned to 5% B. The column temperature was 40°C, with a flow rate of 0.4 mL/min and an injection volume of 4 µL. Negative ion mode was analyzed with the same gradient. MS data were collected in Information Dependent Acquisition (IDA) mode, with source gas pressure at 50 psi, temperature at 550°C, spray voltage ± 5000 V, collision energy ± 30 V, scanning range of 50-1000 Da, accumulation time of 200 ms, product ion scanning range of 25-1000 Da, and collision energy ± 30 V, monitoring a maximum of 18 ions. Peak areas were corrected using the SVR method. Corrected peaks were used for metabolite identification through searching the laboratory’s self-built database, integrating public databases, prediction libraries, and the metDNA method. Finally, metabolites with a composite score of above 0.5 and an OC sample CV value less than 0.5 were extracted. The positive and negative modes were then merged, and the relative content of all metabolites was obtained. Alkaloid Biosynthesis Gene Identification and Molecular Docking To identify candidate genes involved in the biosynthesis pathway of alkaloids, BLAST searches were performed on the Piper genome assembly with an E-value threshold of ≤ 1e-5, using protein sequences from A. thaliana and Piper species as queries. The sequences encoding shikimate kinase ( PsSK ), 3-phosphoshikimate 1-carboxyvinyl transferase ( PsEPSPase ), chorismate synthase ( PsCS ), chorismate mutase ( PsCM ), aromatic-amino-acid transaminase ( PsARO8 ), prephenate dehydratase ( PsPDT ), phenylalanine ammonia-lyase ( PsPAL ), trans-cinnamate 4-monooxygenase ( PsC4H ), caffeic acid 3-O-methyltransferase ( PsCAOMT ), 4-coumarate:Coenzyme A ligase ( Ps4CL ), lysine decarboxylase ( PsLDC ), and acyltransferases ( PsBADH ) were retrieved from NCBI. These gene sequences were used as baits to identify homologous genes in the Piper genome. Subsequently, candidate genes were analyzed using the Pfam and SMART databases to verify conserved domains and motifs. Proteins with identical conserved domains were considered homologous. To identify BAHD and OMT proteins in P. sarmentosum , we downloaded the Pfam seed files for OMT genes (PF00891, PF01596) and BAHD genes (PF02458, PF07247) from the Pfam database ( http://pfam.xfam.org/ ). HMMER v3.0 103 and local BLAST were employed to search for sequences containing BADH and OMT protein domains. The identified protein sequences were aligned to remove redundant sequences. A hidden Markov model (HMM) was then reconstructed for the detected proteins, and sequences with corresponding Pfam domains were searched again. Further validation of BAHD and OMT family members was performed using the online tools SMART and CDD. AlphaFold 3 performs homology modeling of the mutated sequences of PsHCT1 and PsCAOMT1 . The best model is selected based on molpdf, DOPE, and GA341 potential scores. The geometric structure and quality of the model are checked online ( http://servicesn.mbi.ucla.edu/SAVES/ ). Docking analysis is carried out using AutoDock Vina, and the results are analyzed using PyMOL software. Subcellular localization prediction and validation for PsHCT1 ProtComp version 9 ( http://linux1.softberry.com/berry.phtml ) was used to predict the subcellular localization of PsHCT1 (Forward Primer: ATGGGAAATGGTGATTTTAGTGTGTC; Reverse Primer: TCAAGAGTTGAATCCAAGATAGTC) by comparing them with homologous proteins of known localization and data from the LocDB and PotLocDB databases. The coding region of PsHCT1 was amplified from the cDNA synthesized by reverse transcription of RNA extracted from leaf samples in the RNA-seq experiment, and then cloned downstream of the 35S promoter in the pCAMBIA2300 vector to construct the PsHCT1 -GFP fusion gen. The Agrobacterium suspension carrying these plasmids was mixed with a plasma membrane marker (PIP2A-RFP) (OD600 = 0.6) and infiltrated into tobacco leaves. After 72 hours, GFP and RFP signals were visualized using a Zeiss LSM980 confocal fluorescence microscope. Statistics and reproducibility In this study, HiFi and HiC sequencing used for genome assembly were performed as biological replicates once. RNA-seq and metabolomic profiling were each conducted with three biological replicates. For transcript-metabolite network analysis, a correlation coefficient > 0.9 or < -0.9, and a p-value < 0.05, were used as screening criteria. Subcellular localization was also performed with three biological replicates. GO and KEGG enrichment analyses (P < 0.05) were carried out using the clusterProfiler package, with multiple testing corrections applied using FDR, and the significance level was set at P < 0.05. All data are expressed as mean ± standard deviation. During the manuscript preparation, we employed a large language model (ChatGPT-5) for AI-assisted text editing, primarily for grammar checking, language translation, and optimizing text expression. The AI was used solely to enhance the readability and linguistic quality of the text, and it did not participate in research design, data analysis, or content creation. The final manuscript was reviewed and approved by the authors to ensure it reflects their original work. Declarations Reporting summary Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article. Data availability All the genome assembly and annotation files generated in this study have been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under BioProject accession number PRJNA1289360. The genome assembly files have been deposited in NCBI under accession number PRJNA1265616. The complete genome annotation files have been uploaded to the public database Figshare and can be accessed via the following link: https://doi.org/10.6084/m9.figshare.30404920.v1. The source data for Figure 1 has been uploaded to NCBI and can be accessed in the Methods section for reproducibility. The source files for Figures 2A-2D are in Supplementary Tables S5-S9. The data for Figures 2E and 2F can be obtained by downloading the genomic files shown in the figures. The source files for Figure 3 are in Supplementary Tables S10-S11, and those for Figure 4 are in Supplementary Table S12. The WGCNA result files, uncropped images for subcellular localization, and molecular docking simulation data, which are included in Figure 5, have been uploaded to the public database Figshare and can be accessed via the following link: https://doi.org/10.6084/m9.figshare.30404920.v1. The species protein data used in Figure 2A is also available on Figshare. Acknowledgments This work was supported by the Guangdong Provincial Key Research and Development Program (2022B0202110003, 2024B1212060007), the Natural Science Foundation of China (32171842), the National Key Research and Development Project of China (2019YFD1100403), and the Key Project of Central South University of Forestry and Technology (63223068). We also thank Guangzhou Yuda Biotechnology Co., Ltd. for providing sequencing and tech nical services. Special thanks to Luo Yongpeng for his assistance with language editing Author contributions Y.J.L. conducted writing–review, editing, writing original draft, software, methodology, and data curation; R.W. conducted writing–original draft, data curation, and conceptualization; Y.X.Z. conducted writing–original draft, data curation, and conceptualization; Y.J.W. conducted writing–original draft, data curation, and conceptualization; J.L. Writing review, editing, Writing– original draft, Investigation, Funding acquisition, Conceptualization. Y.Q.W. conducted writing–original draft, supervision, project administration, funding acquisition, and conceptualization. Code availability The software and parameters used in this study are described in the Methods section. No specific custom codes or scripts were utilized. Data processing was conducted according to the manuals and protocols provided with the respective software. Competing interests The authors declare no competing interests. Additional information Supplementary information: The online version contains supplementary material available at : References Shao, J., Liu, Y., Lv, J., Chen, X.: Alkaloid Components in Piper sarmentosum Leaves. Nat. Prod. Res. Dev. 35 , 231–235 (2023) Sun, X., et al.: Piper sarmentosum Roxb.: A review on its botany, traditional uses, phytochemistry, and pharmacological activities. J. Ethnopharmacol. 263 , 112897 (2020) de Azevedo, R.A., et al.: Mastoparan induces apoptosis in B16F10-Nex2 melanoma cells via the intrinsic mitochondrial pathway and displays antitumor activity in vivo. Peptides. 68 , 113–119 (2015) Bokesch, H.R., et al.: A new hypoxia inducible factor-2 inhibitory pyrrolinone alkaloid from roots and stems of Piper sarmentosum. Chem. Pharm. Bull. (Tokyo). 59 , 1178–1179 (2011) Jyothi, D., et al.: Diferuloylmethane augments the cytotoxic effects of piplartine isolated from Piper chaba. Toxicol. Vitro. 23 , 1085–1091 (2009) Gundala, S.R., et al.: Hydroxychavicol, a betel leaf component, inhibits prostate cancer through ROS-driven DNA damage and apoptosis. Toxicol. Appl. Pharmacol. 280 , 86–96 (2014) Salehi, B., et al.: Piper Species: A Comprehensive Review on Their Phytochemistry, Biological Activities and Applications. Molecules. 24 , 1364 (2019) A Dictionary of the Economic: Products of the Malay Peninsula. Nature. 137 , 255–255 (1936) Abdul Rahman, N., Mohd Noor, K., Suhaimi, K.M., Kutty, F., M., Sinor, M.Z.: Piper Sarmentosum Influences The Oxidative Stress Involved In Experimental Diabetic Rats. Internet J. Herb. Plant. Med. 1 , (2011) Chaveerach, A., Mokkamul, P., Sudmoon, R., Tanee, T.: Ethnobotany of the Genus Piper (Piperaceae) in Thailand. Ethnobotany Research and Applications (2006). https://www.semanticscholar.org/paper/Ethnobotany-of-the-Genus-Piper-(Piperaceae)-in-Chaveerach-Mokkamul/7b8de6453f12f81ffeb563c7421bc775a1ff2fcf Othman, L., Sleiman, A., Abdel-Massih, R.M.: Antimicrobial Activity of Polyphenols and Alkaloids in Middle Eastern Plants. Front. Microbiol. 10 , 911 (2019) Cai, Y.-Z., Mei Sun, null, Jie Xing, null, Luo, Q., Corke, H.: Structure-radical scavenging activity relationships of phenolic compounds from traditional Chinese medicinal plants. Life Sci 78, 2872–2888 (2006) Ware, I., et al.: Comparative metabolite analysis of Piper sarmentosum organs approached by LC–MS-based metabolic profiling. Nat. Prod. Bioprospect. 14 , 30 (2024) Baliza, I.R.S., et al.: Ruthenium Complexes With Piplartine Cause Apoptosis Through MAPK Signaling by a p53-Dependent Pathway in Human Colon Carcinoma Cells and Inhibit Tumor Development in a Xenograft Model. Front. Oncol. 9 , 582 (2019) Niu, M., et al.: Piperlongumine is a novel nuclear export inhibitor with potent anticancer activity. Chem. Biol. Interact. 237 , 66–72 (2015) Parama, D., et al.: The promising potential of piperlongumine as an emerging therapeutics for cancer. Explor. Target. Antitumor Ther. 2 , 323–354 (2021) Choudhary, N., Singh, V.: A census of P. longum’s phytochemicals and their network pharmacological evaluation for identifying novel drug-like molecules against various diseases, with a special focus on neurological disorders. PLoS One. 13 , e0191006 (2018) Bezerra, D.P., et al.: Overview of the therapeutic potential of piplartine (piperlongumine). Eur. J. Pharm. Sci. 48 , 453–463 (2013) Fincher, R.M., et al.: Inter- and Intraspecific Comparisons of Antiherbivore Defenses in Three Species of Rainforest Understory Shrubs. J. Chem. Ecol. 34 , 558–574 (2008) Peeck, L.H., Leuthäusser, S., Plenio, H.: Switched Stereocontrol in Grubbs – Hoveyda Complex Catalyzed ROMP Utilizing Proton-Switched NHC Ligands. Organometallics. 29 , 4339–4345 (2010) Rosen, E.L., Sung, D.H., Chen, Z., Lynch, V.M., Bielawski, C.W.: Olefin Metathesis Catalysts Containing Acyclic Diaminocarbenes. Organometallics. 29 , 250–256 (2010) Blum, A.P., Ritter, T., Grubbs, R.H.: Synthesis of N-Heterocylic Carbene-Containing Metal Complexes from 2-(Pentafluorophenyl)imidazolidines. Organometallics. 26 , 2122–2124 (2007) Sanford, M.S., Love, J.A., Grubbs, R.H.: A Versatile Precursor for the Synthesis of New Ruthenium Olefin Metathesis Catalysts. Organometallics. 20 , 5314–5318 (2001) Süssner, M., Plenio, H.: pi-Face donor properties of N-heterocyclic carbenes. Chem. Commun. (Camb). 5417–5419 (2005). 10.1039/b512008j Hua, D.H., Miao, S.W., Bharathi, S.N., Katsuhira, T., Bravo, A.A.: Selective nucleophilic addition reactions of alkyllithium reagents with N-(trimethylsilyl)lactams. Synthesis of cyclic ketimines. J. Org. Chem. 55 , 3682–3684 (1990) Tian, D.-S., Zhang, X., Cox, R.J.: Comparing total chemical synthesis and total biosynthesis routes to fungal specialized metabolites. Nat. Prod. Rep. (2024). https://doi.org/10.1039/D4NP00015C Liu, W., Hong, B., Wang, J., Lei, X.: New Strategies in the Efficient Total Syntheses of Polycyclic Natural Products. Acc. Chem. Res. 53 , 2569–2586 (2020) Sivaranjani, R., George, J.K., Saji, K.V.: Evaluation of chemo-diversity in major Piper species for three piperamides using validated RP-HPLC method. Genet. Resour. Crop Evol. 66 , 1635–1641 (2019) Parmar, V.S., et al.: Phytochemistry of the genus Piper. Phytochemistry. 46 , 597–673 (1997) Hu, L., et al.: The chromosome-scale reference genome of black pepper provides insight into piperine biosynthesis. Nat. Commun. 10 , 4702 (2019) Mathew, D., Valsalan, R.: The draft genome of Piper longum L. Crop Sci. 64 , 2854–2862 (2024) Zhang, L., et al.: A high-quality apple genome assembly reveals the association of a retrotransposon and red fruit colour. Nat. Commun. 10 , (2019) Zhang, S.-J., Liu, L., Yang, R., Wang, X.: Genome Size Evolution Mediated by Gypsy Retrotransposons in Brassicaceae. Genom. Proteom. Bioinform. 18 , 321–332 (2020) Zhou, S.-S., et al.: A comprehensive annotation dataset of intact LTR retrotransposons of 300 plant genomes. Sci. Data. 8 , 174 (2021) Clark, J.W., Donoghue, P.C.J.: Whole-Genome Duplication and Plant Macroevolution. Trends Plant Sci. 23 , 933–945 (2018) Qin, L., et al.: Insights into angiosperm evolution, floral development and chemical biosynthesis from the Aristolochia fimbriata genome. Nat. Plants. 7 , 1239–1253 (2021) Wang, Y.: Metabolomics-based Resource Identification of Six Piper spp. Resour. Qual. Identif. (Hainan Univ. (2023). 10.27073/d.cnki.ghadu.2023.000688 Schnabel, A., et al.: Identification and characterization of piperine synthase from black pepper, Piper nigrum L. Commun. Biol. 4 , 1–10 (2021) Jäckel, L., et al.: The terminal enzymatic step in piperine biosynthesis is co-localized with the product piperine in specialized cells of black pepper (Piper nigrum L). Plant J. 111 , 731–747 (2022) Lv, Y., et al.: Metabolome profiling and transcriptome analysis filling the early crucial missing steps of piperine biosynthesis in Piper nigrum L. Plant J. 117 , 107–120 (2024) Liu, C., et al.: Genome-wide comparative analysis of the BAHD superfamily in seven Rosaceae species and expression analysis in pear (Pyrus bretschneideri). BMC Plant Biol. 20 , 14 (2020) Liu, Z., et al.: Uncovering the Role of Hydroxycinnamoyl Transferase in Boosting Chlorogenic Acid Accumulation in Carthamus tinctorius Cells under Methyl Jasmonate Elicitation. Int. J. Mol. Sci. 25 , 2710 (2024) Bassard, J.-E., et al.: Protein–Protein and Protein–Membrane Associations in the Lignin Pathway. https://dx.doi.org/10.1105/tpc.112.102566 Adib, A.M., et al.: The metabolites of Piper sarmentosum and their biological properties: a recent update. Phytochem Rev. (2024). https://doi.org/10.1007/s11101-024-09930-2 Wang, J., et al.: DNA gains and losses in gigantic genomes do not track differences in transposable element-host silencing interactions. Commun. Biol. 8 , 704 (2025) Cheng, L., et al.: Genome assembly of Stewartia sinensis reveals origin and evolution of orphan genes in Theaceae. Commun. Biol. 8 , 354 (2025) Galindo-González, L., Mhiri, C., Deyholos, M.K., Grandbastien: M.-A. LTR-retrotransposons in plants: Engines of evolution. Gene. 626 , 14–25 (2017) Grandbastien, M.-A.: LTR retrotransposons, handy hitchhikers of plant regulation and stress response. Biochim. et Biophys. Acta (BBA) - Gene Regul. Mech. 1849 , 403–416 (2015) Sun, W., Xu, Z., Song, C., Chen, S.: Herbgenomics: Decipher molecular genetics of medicinal plants. Innov. (Camb). 3 , 100322 (2022) Vs, G., Pepper: - chemistry, technology, and quality evaluation. CRC Crit. reviews food Sci. Nutr. 9 , (1977) Rajopadhye, A.A., Namjoshi, T.P., Upadhye, A.S.: Rapid validated HPTLC method for estimation of piperine and piperlongumine in root of Piper longum extract and its commercial formulation. Rev. bras. farmacogn. 22 , 1355–1361 (2012) Vanholme, R., De Meester, B., Ralph, J., Boerjan, W.: Lignin biosynthesis and its integration into metabolism. Curr. Opin. Biotechnol. 56 , 230–239 (2019) Yamada, Y., Sato, F.: Transcription Factors Alkaloid Eng. Biomolecules. 11 , 1719 (2021) Xu, W., Dubos, C., Lepiniec, L.: Transcriptional control of flavonoid biosynthesis by MYB–bHLH–WDR complexes. Trends Plant Sci. 20 , 176–185 (2015) Hao, Y., Zong, X., Ren, P., Qian, Y., Fu, A.: Basic Helix-Loop-Helix (bHLH) Transcription Factors Regulate a Wide Range of Functions in Arabidopsis. Int. J. Mol. Sci. 22 , 7152 (2021) Prakash, P., Kumar, R., Gupta, V.: Chapter 9 - The regulatory aspects of plant transcription factors in alkaloids biosynthesis and pathway modulation. in Plant Transcription Factors (eds Srivastava, V., Mishra, S., Mehrotra, S. & Upadhyay, S. K.) 199–217Academic Press, (2023). 10.1016/B978-0-323-90613-5.00019-4 Zhou, Z., et al.: Targeting cofactors regeneration in methylation and hydroxylation for high level production of Ferulic acid. Metab. Eng. 73 , 247–255 (2022) Chen, R., et al.: De novo biosynthesis of plant lignans by synthetic yeast consortia. Nat. Chem. Biol. (2025). https://doi.org/10.1038/s41589-025-01861-z Fisyuk, A., Poendaev, N.: Synthesis of 5,6-Dihydropyridin-2(1H)-ones, 1,5,6,8,8a-Hexahydroisoquinolin-3(2H)-ones and 4a,5,6,7,8,8a-Hexahydroquinolin-2(1H)-ones by Intramolecular Wittig Reaction. Molecules. 7 , 124–128 (2002) Fisyuk, A.S., Poendaev, N.V., Bundel’, Y.G.: A new route for the synthesis of 5,6-dihydropyridin-2(1H)-ones, 2-pyridones and (4-hydroxy-2-oxopiperid-3-yl) pyridinium chlorides by intramolecular cyclization of N-3-oxoalkylchloroacetamide derivatives. Mendeleev Commun. 8 , 12–13 (1998) Cui, J., et al.: Telomere-to-telomere Phragmites australis reference genome assembly with a B chromosome provides insights into its evolution and polysaccharide biosynthesis. Commun. Biol. 8 , 73 (2025) Zhang, X.-Y., et al.: Optimization and quality control of genome-wide Hi-C library preparation. Yi Chuan. 39 , 847–855 (2017) Sim, S.B., Corpuz, R.L., Simmonds, T.J., Geib, S.M.: HiFiAdapterFilt, a memory efficient read processing pipeline, prevents occurrence of adapter sequence in PacBio HiFi reads and their negative impacts on genome assembly. BMC Genom. 23 , 157 (2022) Marçais, G., Kingsford, C.: A fast, lock-free approach for efficient parallel counting of occurrences of k-mers. Bioinformatics. 27 , 764–770 (2011) Vurture, G.W., et al.: GenomeScope: fast reference-free genome profiling from short reads. Bioinformatics. 33 , 2202–2204 (2017) Cheng, H., Concepcion, G.T., Feng, X., Zhang, H., Li, H.: Haplotype-resolved de novo assembly using phased assembly graphs with hifiasm. Nat. Methods. 18 , 170–175 (2021) Walker, B.J., et al.: Pilon: An Integrated Tool for Comprehensive Microbial Variant Detection and Genome Assembly Improvement. PLOS ONE. 9 , e112963 (2014) Roach, M.J., Schmidt, S.A., Borneman, A.R.: Purge Haplotigs: allelic contig reassignment for third-gen diploid genome assemblies. BMC Bioinform. 19 , 460 (2018) Hu, J., et al.: NextDenovo: an efficient error correction and accurate assembly tool for noisy long reads. Genome Biol. 25 , 107 (2024) Xu, M., et al.: TGS-GapCloser: A fast and accurate gap closer for large genomes with low coverage of error-prone long reads. Gigascience. 9 , giaa094 (2020) Durand, N.C., et al.: Juicer Provides a One-Click System for Analyzing Loop-Resolution Hi-C Experiments. Cell. Syst. 3 , 95–98 (2016) Loescher, S., Groeer, S., Walther, A.: 3D DNA Origami Nanoparticles: From Basic Design Principles to Emerging Applications in Soft Matter and (Bio-)Nanosciences. Angew Chem. Int. Ed. Engl. 57 , 10436–10448 (2018) Robinson, J.T., et al.: Juicebox.js Provides a Cloud-Based Visualization System for Hi-C Data. Cell. Syst. 6 , 256–258e1 (2018) Wolff, J., et al.: Galaxy HiCExplorer 3: a web server for reproducible Hi-C, capture Hi-C and single-cell Hi-C data analysis, quality control and visualization. Nucleic Acids Res. 48 , W177–W184 (2020) Simão, F.A., Waterhouse, R.M., Ioannidis, P., Kriventseva, E.V., Zdobnov, E.M.: BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics. 31 , 3210–3212 (2015) Li, H.: Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics. 34 , 3094–3100 (2018) Ou, S., Jiang, N., LTR_retriever:: A Highly Accurate and Sensitive Program for Identification of Long Terminal Repeat Retrotransposons. Plant. Physiol. 176 , 1410–1422 (2018) Rhie, A., Walenz, B.P., Koren, S., Phillippy, A.M.: Merqury: reference-free quality, completeness, and phasing assessment for genome assemblies. Genome Biol. 21 , 245 (2020) Tarailo-Graovac, M., Chen, N.: Using RepeatMasker to identify repetitive elements in genomic sequences. Curr Protoc Bioinformatics Chap. 4 , 4.10.1–4.10.14 (2009) Flynn, J.M., et al.: RepeatModeler2 for automated genomic discovery of transposable element families. Proc. Natl. Acad. Sci. U S A. 117 , 9451–9457 (2020) Zhang, R.-G., et al.: TEsorter: an accurate and fast method to classify LTR-retrotransposons in plant genomes. Hortic. Res. 9 , uhac017 (2022) Katoh, K., Standley, D.M.: MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30 , 772–780 (2013) Price, M.N., Dehal, P.S., Arkin, A.P.: FastTree 2–approximately maximum-likelihood trees for large alignments. PLoS One. 5 , e9490 (2010) Gabriel, L., et al.: BRAKER3: Fully automated genome annotation using RNA-seq and protein evidence with GeneMark-ETP, AUGUSTUS and TSEBRA. bioRxiv 06.10.544449 (2024) (2023). 10.1101/2023.06.10.544449 Burge, C., Karlin, S.: Prediction of complete gene structures in human genomic DNA. J. Mol. Biol. 268 , 78–94 (1997) Majoros, W.H., Pertea, M., Salzberg, S.L.: TigrScan and GlimmerHMM: two open source ab initio eukaryotic gene-finders. Bioinformatics. 20 , 2878–2879 (2004) Keilwagen, J., Hartung, F., Grau, J., GeMoMa: Homology-Based Gene Prediction Utilizing Intron Position Conservation and RNA-seq Data. Methods Mol Biol 161–177 (2019). (1962) Haas, B.J., et al.: Automated eukaryotic gene structure annotation using EVidenceModeler and the Program to Assemble Spliced Alignments. Genome Biol. 9 , R7 (2008) Riehl, K., Riccio, C., Miska, E.A., Hemberg, M.: TransposonUltimate: software for transposon classification, annotation and detection. https://dx.doi.org/10.1093/nar/gkac136 Cantalapiedra, C.P., Hernández-Plaza, A., Letunic, I., Bork, P., Huerta-Cepas, J.: eggNOG-mapper v2: Functional Annotation, Orthology Assignments, and Domain Prediction at the Metagenomic Scale. Mol. Biol. Evol. 38 , 5825–5829 (2021) Emms, D.M., Kelly, S.: OrthoFinder: phylogenetic orthology inference for comparative genomics. Genome Biol. 20 , 238 (2019) Stamatakis, A.: RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 30 , 1312–1313 (2014) Puttick, M.N.: MCMCtreeR: functions to prepare MCMCtree analyses and visualize posterior ages on trees. Bioinformatics. 35 , 5321–5322 (2019) Kumar, S., et al.: TimeTree 5: An Expanded Resource for Species Divergence Times. Mol. Biol. Evol. 39 , msac174 (2022) Mendes, F.K., Vanderpool, D., Fulton, B., Hahn: M. W. CAFE 5 models variation in evolutionary rates among gene families. Bioinformatics. 36 , 5516–5518 (2021) Buchfink, B., Xie, C., Huson, D.H.: Fast and sensitive protein alignment using DIAMOND. Nat. Methods. 12 , 59–60 (2015) Wang, Y., et al.: MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 40 , e49 (2012) Sun, P., et al.: A user-friendly toolkit for evolutionary analyses of whole-genome duplications and ancestral karyotypes. Mol. Plant. 15 , 1841–1851 (2022) Chen, S., Zhou, Y., Chen, Y., Gu, J.: fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 34 , i884–i890 (2018) Kim, D., Langmead, B., Salzberg, S.L.: HISAT: a fast spliced aligner with low memory requirements. Nat. Methods. 12 , 357–360 (2015) Langfelder, P., Horvath, S.: WGCNA: an R package for weighted correlation network analysis. BMC Bioinform. 9 , 559 (2008) Wu, T., et al.: clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innov. (Camb). 2 , 100141 (2021) Potter, S.C., et al.: HMMER web server: 2018 update. Nucleic Acids Res. 46 , W200–W204 (2018) Additional Declarations There is NO Competing Interest. Supplementary Files Supplementarymaterial112.xlsx Supplementary material 1-12 DescriptionofAdditionalSupplementaryFiles.docx Description of Additional Supplementary Files Supplementarymaterial115.xlsx Supplementary Data Cite Share Download PDF Status: Published Journal Publication published 03 Jan, 2026 Read the published version in Communications Biology → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6556353","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":541712162,"identity":"83aefe2b-fcda-43ad-bb68-5625d5b36492","order_by":0,"name":"Yongjian Luo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyUlEQVRIiWNgGAWjYBACfvmDDQc+VNjYybM3EKlFcgZz48MZZ9KSDXsOEKnF4AZ7szFv22HGhhsJxNoyu7FNgoftMDPjzMcbbzDU2EQT1MIvc7BNQoInnY9dOq3YguFYWm4DQVsaEtskDCSsmRln55hJMDYcJqzF4ABQS4IBM2PDzTPEarmR2GxwIMEZ6H0eIrVI9hxsfNhwABTIQL8kEOMXfvb2B4f//gNF5eGNNz7U2BDWguJIiQRSlEO0kKpjFIyCUTAKRgYAAK/YQ3JU6bAgAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-3788-524X","institution":"Guangdong Academy of Agricultural","correspondingAuthor":true,"prefix":"","firstName":"Yongjian","middleName":"","lastName":"Luo","suffix":""},{"id":541712163,"identity":"0e87e854-fea6-4a26-84ec-cf5b803a7ffc","order_by":1,"name":"Ru Wang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Ru","middleName":"","lastName":"Wang","suffix":""},{"id":541712164,"identity":"ad3dd8fa-cb27-4da6-b108-1d311e580363","order_by":2,"name":"Yixin Zhang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yixin","middleName":"","lastName":"Zhang","suffix":""},{"id":541712165,"identity":"29ef9b2d-70e2-40d7-bf49-b8bd836b4ac5","order_by":3,"name":"Yuejiao Wang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yuejiao","middleName":"","lastName":"Wang","suffix":""},{"id":541712166,"identity":"2cf3a837-04bd-4e18-bcdc-ebee60a3cba7","order_by":4,"name":"Jun Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Liu","suffix":""},{"id":541712167,"identity":"6bdcad51-7be1-4429-8b73-247aa00c0804","order_by":5,"name":"Yiqiang Wang","email":"","orcid":"","institution":"Central South University of Forestry and Technology","correspondingAuthor":false,"prefix":"","firstName":"Yiqiang","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2025-04-29 12:15:50","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6556353/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6556353/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s42003-025-09448-z","type":"published","date":"2026-01-03T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":95539256,"identity":"62e3a306-532f-4ab3-8858-d4bddd44b85a","added_by":"auto","created_at":"2025-11-10 11:14:18","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5971310,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/5d84f3267860b8ab43a6395d.png"},{"id":95654065,"identity":"ad8331e2-fae2-4732-bf8d-d665bba1c052","added_by":"auto","created_at":"2025-11-11 16:09:30","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":177267,"visible":true,"origin":"","legend":"","description":"","filename":"CleanVersion.docx","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/ca6ff7ee92657f4d5f1af056.docx"},{"id":95654470,"identity":"3a8acd1b-01ae-48e9-98fe-79a39422a087","added_by":"auto","created_at":"2025-11-11 16:12:06","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1920818,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/c1232d4206cb368d869a8d9c.png"},{"id":95539260,"identity":"692c7d0e-b7ef-4535-b54a-c160c1447db8","added_by":"auto","created_at":"2025-11-10 11:14:18","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6634183,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/25d2fd8867bf0ed8fdc103a1.png"},{"id":95539264,"identity":"26a4761c-025c-48b4-901a-3a8d07a6f4a4","added_by":"auto","created_at":"2025-11-10 11:14:18","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17923,"visible":true,"origin":"","legend":"","description":"","filename":"Table.docx","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/f122784bec5ea919fbf6c1e0.docx"},{"id":95539258,"identity":"40d3b67c-37a1-4c2b-9687-b3319a6f0a73","added_by":"auto","created_at":"2025-11-10 11:14:18","extension":"json","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7444,"visible":true,"origin":"","legend":"","description":"","filename":"COMMSBIO253976D.json","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/1276e146e30e98f7c480a85f.json"},{"id":95539262,"identity":"8ebb9ac7-c5fd-42a0-8537-2739dbe4172e","added_by":"auto","created_at":"2025-11-10 11:14:18","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17049,"visible":true,"origin":"","legend":"","description":"","filename":"DescriptionofAdditionalSupplementaryFiles.docx","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/24f2ec52995eba1ea73bc14f.docx"},{"id":95539269,"identity":"1c5a4fd0-7215-42fc-ab10-117b73036c3b","added_by":"auto","created_at":"2025-11-10 11:14:19","extension":"xlsx","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18195135,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial115.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/21c109e8d95933f97f5d67dd.xlsx"},{"id":95654292,"identity":"6f2d3f63-3942-46b6-953c-02d212d4cfef","added_by":"auto","created_at":"2025-11-11 16:10:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":24017395,"visible":true,"origin":"","legend":"\u003cp\u003eGenome Architecture and Characteristics of \u003cem\u003eP. sarmentosum\u003c/em\u003e. A. K-mer distribution (21-mer) spectrum, indicative of the genome complexity and size of \u003cem\u003eP. sarmentosum\u003c/em\u003e, as determined by k-mer analysis. B. Hi-C chromatin interaction heatmap for the 55 pseudomolecules of the \u003cem\u003eP. sarmentosum\u003c/em\u003e genome, revealing chromatin interaction regions that may play a crucial role in gene expression regulation. C. The genomic landscape of \u003cem\u003eP. sarmentosum\u003c/em\u003e. The features, from outside to inside, are: pseudochromosomes (1), GC content (0%–50%). (2), gene density (0–1). (3), TE repeat density (0–1). (4), LTR repeat density (0–1). (5, 6, 7, 8, 9), root, stem, leaf, flower, and fruit Transcripts Per Kilobase of exonmodel per Million mapped reads (TPM). (line). Intra-genome collinear blocks with \u0026gt; 10 gene pairs are highlighted with arcs in the middle of the diagram. Different colored lines connect matched gene pairs between different chromosomes. Circos was used to construct the diagram. All distributions were drawn using a window size of 1 Mb, except for expression data, which was drawn using a window size of 50 kb. \"Chr\" refers to chromosome. D. The insertion time distribution of LTR elements in the genome of giant ragweed. MYA: indicates million years ago. E. Phylogenetic relationship of Ty1-Copia LTR-RTs. F. Phylogenetic relationship of Ty3-Gypsy LTR-RTs.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/1093d2dab3a886d52fac2201.png"},{"id":95654300,"identity":"bc695dbc-eaea-4ded-922b-ee412f0248d2","added_by":"auto","created_at":"2025-11-11 16:10:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5971310,"visible":true,"origin":"","legend":"\u003cp\u003eComparative Genomics and Evolutionary Dynamics of Gene Families. A. Copy number distribution of gene families in 15 species. B. Comparative analysis of orthologous gene families among five species. C. Phylogenetic analysis and assessment of gene family expansion and contraction based on whole-genome data. D. GO enrichment analysis characterizing expanded gene families in the \u003cem\u003eP. sarmentosum\u003c/em\u003e genome, associated with 20 different functions. E. Ks density distributions. F. Interspecific collinearity plot.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/ec4af35a0fcebce9e54eef6c.png"},{"id":95539254,"identity":"01174e35-8198-4402-9e7f-802ab2d68e0f","added_by":"auto","created_at":"2025-11-10 11:14:18","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1920818,"visible":true,"origin":"","legend":"\u003cp\u003eUntargeted metabolomics analysis of \u003cem\u003eP. sarmentosum.\u003c/em\u003e A. Heatmap analysis of metabolites across different tissues. B. Principal component analysis (PCA) of various samples. C. WGCNA module analysis of all metabolomic data. D. KEGG enrichment analysis of metabolites from five specific modules. E. Relative content of piperidine alkaloid metabolites in different tissues. MJ represents stem, ML represents leaf, MR represents root, MF1 represents flower, and MF2 represents fruit.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/21c3e7b8f0443f8871def736.png"},{"id":95654403,"identity":"eb87066d-1099-4279-810c-ac26ad39564f","added_by":"auto","created_at":"2025-11-11 16:11:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6634183,"visible":true,"origin":"","legend":"\u003cp\u003eBiosynthetic Pathways of Piperine and PL, and BADH Gene Family Analysis. A. Biosynthetic Pathway of Piperine. B. Predicted Biosynthetic Pathway of PL. C. Phylogenetic tree of the BADH gene family. D. Expression heatmap (row-scale) of \u003cem\u003ePsBADH\u003c/em\u003e genes across different organs based on transcriptome data. The heatmap shows the expression levels of genes involved in the biosynthetic pathways of piperine and PL across five different plant tissues: leaf (L), stem (S), root (R), flower (F1), and fruit (F2). The data were processed using Log10 transformation of TPM values, with each row representing a gene and each column representing a tissue.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/cea6d0649bdcbd43dd6d2e9e.png"},{"id":95539265,"identity":"f4eb4cfa-3ada-4501-9634-e065d03040f1","added_by":"auto","created_at":"2025-11-10 11:14:18","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":21499393,"visible":true,"origin":"","legend":"\u003cp\u003eWGCNA analysis of piperine-type metabolites content-associated genes across tissues and identification of key biosynthetic genes. A.Hierarchical clustering dendrogram of 16 co-expression modules. B. Relationship between modules and the content of core metabolites. Each row and column represents a module and a metabolite, respectively. C. Identification of top 200 hub genes in the blue co-expression module. D. The subcellular localization of PsHCT1 in tobacco leaves, including images of the empty vector control and \u003cem\u003ePsHCT1\u003c/em\u003e-GFP under GFP-field. Co-expression images of the plasma membrane marker (PIP2A-RFP) and PsHCT1-GFP. Merged images of bright-field, GFP-field, and RFP-field. Scale bar, 20 μm. E. Molecular docking of \u003cem\u003ePsHCT1\u003c/em\u003e with sinapoyl-CoA and predicted reaction product. F. Molecular docking of \u003cem\u003ePsCCoAOMT\u003c/em\u003e 1 with PL precursor and PL.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/7c44fca4b272e02a5870f429.png"},{"id":102018469,"identity":"293ad7e6-ca98-4fc1-84af-441af5f98615","added_by":"auto","created_at":"2026-02-06 08:07:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":58907381,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/149201e8-e236-4255-a928-59d8801063f1.pdf"},{"id":95654247,"identity":"4d0a7fa7-9cc3-4063-a84b-ba5c78425ff3","added_by":"auto","created_at":"2025-11-11 16:10:41","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":17859625,"visible":true,"origin":"","legend":"Supplementary material 1-12","description":"","filename":"Supplementarymaterial112.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/234e24b278257ca6a4caa124.xlsx"},{"id":95539253,"identity":"2d612755-0d39-4009-8dc5-ba799df46108","added_by":"auto","created_at":"2025-11-10 11:14:18","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":17049,"visible":true,"origin":"","legend":"Description of Additional Supplementary Files","description":"","filename":"DescriptionofAdditionalSupplementaryFiles.docx","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/b1aa680c45c9d498a2d3a280.docx"},{"id":95654301,"identity":"7c33fad1-380d-4eed-a290-a128d23203b6","added_by":"auto","created_at":"2025-11-11 16:10:55","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":18195135,"visible":true,"origin":"","legend":"Supplementary Data","description":"","filename":"Supplementarymaterial115.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6556353/v1/6f0bbd4c500ab24d5f2f7e85.xlsx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"A chromosome-level genome assembly and multi-omics analyses provide insights into the biosynthesis of piperlongumine in Piper sarmentosum","fulltext":[{"header":"Introduction","content":"\u003cp\u003e\u003cem\u003ePiper sarmentosum\u003c/em\u003e Roxb., a perennial creeping herb in the Piperaceae family, is primarily distributed along the southeastern coast of China and in tropical regions of Southeast Asia\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. As a dual-purpose medicinal and edible plant, \u003cem\u003eP. sarmentosum\u003c/em\u003e has a long history of use in traditional Chinese medicine. Its entire plant can be used as medicine and is known for its functions of dispelling wind and cold, promoting blood circulation, and reducing swelling. It is commonly used to treat conditions such as rheumatic pain and trauma-related swelling\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Modern research indicates that \u003cem\u003eP. sarmentosum\u003c/em\u003e extract (PSE) possesses a variety of biological activities, such as antioxidant, analgesic, antimicrobial, and anti-inflammatory effects. These activities are likely related to its rich phytochemical composition, which includes alkaloids, amides, and phenolic compounds\u003csup\u003e\u003cspan additionalcitationids=\"CR4 CR5\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Among these, amide alkaloids are one of its most abundant chemical constituents\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e, showing potential for development as novel anticancer drugs\u003csup\u003e\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThe anticancer activity of \u003cem\u003ePiper\u003c/em\u003e species is closely related to the presence of various bioactive compounds, particularly amides, such as pipelamide\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Among these compounds, piperlongumine (PL) was first isolated from \u003cem\u003ePiper longum\u003c/em\u003e, and subsequent studies have found that \u003cem\u003eP. sarmentosum\u003c/em\u003e also contains this important compound\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. The α,β-unsaturated carbonyl group in the molecular structure of PL is the key pharmacophore responsible for its pharmacological activity, making it an ideal candidate molecule for the development of multitarget drugs\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Studies have shown that PL selectively induces apoptosis in tumor cells while maintaining the activity of normal cells, which gives it a unique advantage in cancer treatment. Its mechanisms include: inducing apoptosis in tumor cells by increasing reactive oxygen species (ROS) levels; inhibiting tumor metastasis-related signaling pathways; and regulating the expression of proteins associated with various cancers, such as breast cancer, colon cancer, prostate cancer, and lung cancer\u003csup\u003e\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. In addition to its anticancer activity, PL also demonstrates significant anti-inflammatory, antidiabetic, antidepressant, neuroprotective, and cardiovascular protective effects, making it an ideal candidate for multitarget drug development\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Currently, the chemical synthesis of PL can be achieved through reactions involving 3,4,5-trimethoxy-cinnamic acid and 5,6-dihydro-2(1H)-pyridinone with 1,3-dicyclohexylcarbodiimide (DCC) as a coupling agent, or by using Grubbs I and Grubbs II catalysts. Several new synthetic methods have been developed, although the overall reaction steps remain relatively complex and the conditions harsh\u003csup\u003e\u003cspan additionalcitationids=\"CR20 CR21 CR22 CR23 CR24\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. However, with the development of biotechnology, biosynthesis has gradually become a simpler and more efficient synthesis route due to its highly selective catalysis\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Previous studies have found that the content of PL in \u003cem\u003eP. longum\u003c/em\u003e L. fruits is only 1.2 mg/g, while \u003cem\u003eP. sarmentosum\u003c/em\u003e contains approximately 40% more. The elucidation and analysis of the biosynthetic genes and mechanisms of complex natural products occur through the key steps of biosynthesis\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. The key biosynthetic enzyme gene of PL has not yet been identified, which limits the possibility of achieving its large-scale production through synthetic biology methods\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eOn the other hand, the Piperaceae family is a large plant family with over 3,600 species, among which the \u003cem\u003ePiper\u003c/em\u003e genus and the Peperomia genus are the most representative\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. To date, only \u003cem\u003eP. nigrum\u003c/em\u003e in the Piperaceae family has completed chromosome-level genome sequencing and assembly\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Although the genome of \u003cem\u003eP. longum\u003c/em\u003e, a species morphologically similar to \u003cem\u003eP. sarmentosum\u003c/em\u003e, has preliminary genomic information, it is still at the contig level, containing 89,204 scaffolds with an N50 value of 10.7 kb, which presents significant fragmentation issues\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. This limits its application in gene function research and the analysis of complex gene structures. In this study, we combined PacBio HIFI and high-throughput chromosome conformation capture (Hi-C) technologies to successfully obtain a high-quality genome of \u003cem\u003eP. sarmentosum\u003c/em\u003e. Through comparative genomics analysis, we revealed a whole-genome duplication (WGD) event in the Piperaceae plant genome, and by integrating transcriptomic and metabolomic data, we identified and validated a series of key genes in the biosynthetic pathway of PL. Our results provide an important foundation for understanding the genomic evolution of Piperaceae plants as well as alkaloid research.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eGenome sequencing, assembly, and quality assessment\u003c/h2\u003e\u003cp\u003eTo estimate the initial characteristics of the \u003cem\u003eP. sarmentosum\u003c/em\u003e genome, we generated 18.35 Gb of high-precision HiFi data with an average read length of 22.61 kb using the PacBio platform. K-mer analysis (K\u0026thinsp;=\u0026thinsp;21) was performed to evaluate the genome size, repetitive sequences, and the heterozygosity rate of the genome. The survey plot revealed that this plant has a highly heterozygous and repetitive genome, with an estimated genome size of approximately 526.56 Mb and a heterozygosity rate of about 0.81% (Fig.\u0026nbsp;1A). Subsequently, these HiFi reads were assembled into a 548.44 Mb draft genome using Hifiasm, consisting of 674 contigs (N50\u0026thinsp;=\u0026thinsp;15.36 Mb). After several rounds of assembly, polishing, comparison, extension, and gap filling, we obtained 137 scaffolds, which included 102 gaps. The N50 of the scaffolds is 22.52 Mb, and the longest scaffold is 38.88 Mb. We constructed a high-throughput Hi-C library for \u003cem\u003eP. sarmentosum\u003c/em\u003e, generating 85 Gb of Hi-C paired-end reads. The allelic sequences of 127 scaffolds were anchored to 26 chromosomes, achieving an anchoring rate of 97.79%, with an N50 of 34 Mb and an L50 of 10 Mb. Chromatin interaction data indicate that our Hi-C assembly is of high quality (Fig.\u0026nbsp;1B). To assess the integrity of the genome assembly, we further investigated the telomere and centromere structures. Except for chromosome 21, where telomeres were not detected, and chromosomes 12, 16, and 20, where only one side of the telomere was detected, all other chromosomes showed detectable telomeres with the telomere repeat monomer being AAACCCT/TTTGGGA. Centromere regions, ranging from 7.57 Mb to 130 kb, were predicted, and these regions were found to be associated with repetitive sequences and negatively correlated with gene distribution, further demonstrating the integrity of the genome assembly (Fig.\u0026nbsp;1C). We determined that the BUSCO score for the \u003cem\u003eP. sarmentosum\u003c/em\u003e genome was 97.4% (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), higher than the published value for \u003cem\u003eP. nigrum\u003c/em\u003e (BUSCO: 96.1%) and \u003cem\u003eP. longum\u003c/em\u003e (BUSCO: 96.0%). Additional validation using the LTR Assembly Index (LAI\u0026thinsp;=\u0026thinsp;12.68) to assess the integrity of long terminal repeats (LTRs) further confirmed that the assembled \u003cem\u003eP. sarmentosum\u003c/em\u003e genome is of sufficiently high quality to serve as a reference genome (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Supplementary Data 1).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eStatistics of the genome assembly for \u003cem\u003eP. sarmentosum\u003c/em\u003e.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFeature\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eValue\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGenome size, estimated (Mb)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e526.56\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGenome size, assembled (Mb)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e548.45\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHi-C reads (GB)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e50.12\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCCS reads (Gb)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e123.52\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eContig N50 (Mb)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e7.39\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eScaffold N50 (Mb)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e22.52\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eContigs\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e674\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eScaffolds\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e138\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLargest contig (Mb)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e38.88\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGC content (%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e34.49%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHiFi reads mapping ratio (%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e99.99%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBUSCO assembly completeness (%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e97.40%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eQV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e61.40\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAnchoring percentage (%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e97.79%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGaps number\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e102\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGaps Length (kb)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e10.20\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLAI core\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e12.68\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBUSCO predicted gene completeness (%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e98. 6%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eProtein-coding genes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e39,154\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003erRNA genes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1081\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003etRNA genes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1138\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esnRNA genes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e846\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esnoRNA genes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1138\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emiRNA genes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e175\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eGenome Annotation\u003c/h3\u003e\n\u003cp\u003eDe novo prediction revealed that the \u003cem\u003eP. sarmentosum\u003c/em\u003e genome contains 326.88 Mb of repetitive sequences, accounting for approximately 57.88% of the total genome size (Supplementary Data 2). These repeats consist of 31.82% retrotransposons, 4.10% DNA transposons, 18.78% unclassified repeats, and 1.12% satellite repeats. Among them, LTR retrotransposons represent the most abundant class of repetitive DNA, with Copia and Gypsy elements comprising 5.13% and 25.69% of the genome, respectively. These repetitive elements are unevenly distributed across chromosomes, showing a strong preference for centromeric regions (Fig.\u0026nbsp;1C). The insertion time distribution of Long Terminal Repeat Retrotransposons (LTR-RTs) reflects the historical activity of transposable elements (TEs) and selective pressures\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Active LTR-RTs inserted within or near functional genes can induce phenotypic variation, and the amplification and contraction of LTR-RTs significantly affect genome size\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. In our analysis of the \u003cem\u003eP. sarmentosum\u003c/em\u003e and \u003cem\u003eP. nigrum\u003c/em\u003e genomes, we observed significant differences in the insertion times and durations of the Copia and Gypsy superfamilies of LTR-RTs (Fig.\u0026nbsp;1D). For the Gypsy family, the insertion time in \u003cem\u003eP. sarmentosum\u003c/em\u003e was estimated to be 34.45 MYA, whereas in \u003cem\u003eP. nigrum\u003c/em\u003e, it was significantly more recent at 15.90 MYAs, with \u003cem\u003eP. nigrum\u003c/em\u003e containing more insertions than \u003cem\u003eP. sarmentosum\u003c/em\u003e. This recent expansion of Gypsy elements in \u003cem\u003eP. nigrum\u003c/em\u003e suggests that, following the divergence of the two species, Gypsy elements underwent a sustained period of growth. As for the Copia family, the insertion time in \u003cem\u003eP. nigrum\u003c/em\u003e was recorded as 57.72 MYA, whereas in \u003cem\u003eP. sarmentosum\u003c/em\u003e, insertion events continued intermittently between 1.0 and 2.67 MYA. Further phylogenetic analysis, based on coding region sequence homology, allowed us to classify the Copia and Gypsy elements into distinct lineages. Among these, the most abundant members of the Ty1/copia and Ty3/gypsy families were identified as Tork and Tekay, respectively (Fig.\u0026nbsp;1E and 1F). Functional prediction analysis of genes containing specific LTR retrotransposons inserted within approximately 5000 base pairs revealed that these insertions could impact gene functions in several ways. These include transposition, RNA-mediated processes, N-acylethanolamine metabolic processes, DNA integration, regulation of ubiquitin-protein transferase activity, cellular glucose homeostasis, terpenoid biosynthesis, and defensive response regulation (Supplementary Data 3). The rapid amplification of repeat elements likely played a crucial role in the genomic evolution of \u003cem\u003eP. sarmentosum\u003c/em\u003e and its divergence from closely related species. This suggests that LTR-RTs, particularly Gypsy and Copia elements, have been important contributors to the genetic diversification and adaptation of \u003cem\u003eP. sarmentosum\u003c/em\u003e, potentially influencing its phenotypic traits and evolutionary history.\u003c/p\u003e\u003cp\u003eUsing a combined approach of de novo prediction, homology-based annotation, and transcriptomic evidence, we annotated a total of 39,154 protein-coding genes, with an average gene length of 3,312 bp and an average coding sequence (CDS) length of 1,151 bp. These genes exhibit an uneven chromosomal distribution, with a pronounced bias toward telomeric regions, and display distinct expression patterns across different tissues (Fig.\u0026nbsp;1C). Although the number of annotated genes is significantly lower than that reported for the \u003cem\u003eP. nigrum\u003c/em\u003e genome, our annotation achieves a completeness score of 98.83%, substantially higher than the previously reported 83.6% for \u003cem\u003eP. nigrum\u003c/em\u003e (Supplementary Data 1). Functional annotations were assigned to the predicted genes using five major databases: TrEMBL, SWISS-PROT, Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and InterPro. In total, 20,937 (86.24%), 16,603 (38.03%), 31,276 (44.55%), 30,171 (94.14%), 35,034 (73.29%), and 35,232 (84.48%) gene models were successfully annotated in GO, KEGG, COG, PFAM, Swiss-Prot, and NR, respectively (Supplementary Data 4). Over 90% (35,266) of the genes were functionally annotated. Furthermore, we classified 2,403 transcription factors (TFs) from 58 gene families, representing 6.14% of the total CDS. Among these, basic helix-loop-helix (bHLH), ethylene-responsive element-binding factors (ERF), and myeloblastosis (MYB) families were the most prominent. Additionally, we identified 646 chromatin regulators (CRs), 157 transcriptional regulators (TRs), and a variety of non-coding RNAs (ncRNAs), including 1,138 small RNAs, 175 miRNAs, 652 tRNAs, 1,081 rRNAs, and 846 snRNAs.\u003c/p\u003e\n\u003ch3\u003eGene Family Evolution and Phylogenetic Reconstruction and WGD\u003c/h3\u003e\n\u003cp\u003eWe conducted gene family analysis by comparing the protein-coding sequences of \u003cem\u003eP. sarmentosum\u003c/em\u003e with those of 14 other sequenced plant genomes. A total of 503,044 genes from the 15 species were subjected to gene family clustering, resulting in the identification of 31,805 orthologous gene families. Among these, 273 gene families were single-copy genes, while 5,853 gene families were shared by all species (Fig.\u0026nbsp;2A and Supplementary Data 5). Among the 15 species, \u003cem\u003eP. nigrum\u003c/em\u003e had the highest number of single-copy orthologs (5,383), while \u003cem\u003eP. sarmentosum\u003c/em\u003e had the fewest (1,668). The highest number of multicopy orthologs was identified in \u003cem\u003eP. nigrum\u003c/em\u003e, with 18,483 multicopy orthologs. Furthermore, the gene family clustering analysis revealed that 8,429 gene families were shared by all five Magnoliids, while 468 gene families were unique to the \u003cem\u003eP. sarmentosum\u003c/em\u003e genome, far fewer than the 3,088 gene families in \u003cem\u003eP. nigrum\u003c/em\u003e; of these, 3,838 orthologs are shared within the \u003cem\u003ePiper\u003c/em\u003e genus (Fig.\u0026nbsp;2B and Supplementary Data 5). To investigate the functions of the shared genes within the \u003cem\u003ePiper\u003c/em\u003e genus, we conducted Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses on the 3,838 shared gene families. The GO term enrichment analysis showed that these genes are mainly involved in \"binding,\" \"transport,\" \"metabolic processes,\" and \"signal transduction\" (Supplementary Data 6). In contrast, KEGG enrichment analysis indicated that most of these genes were associated with pathways related to the biosynthesis of secondary metabolites, such as \"Stilbenoid, diarylheptanoid and gingerol biosynthesis,\" \"Phenylpropanoid biosynthesis,\" and \"Terpenoid biosynthesis\" (Supplementary Data 6). Additionally, we performed GO functional annotation for 382 unique genes, which revealed that these genes are enriched in biological processes such as \"DNA unwinding involved in DNA replication,\" \"regulation of helicase activity,\" \"mannose transmembrane transport,\" \"triterpenoid biosynthetic process,\" \"regulation of cellular response to heat,\" and \"membrane protein ectodomain proteolysis\" (Supplementary Data 7).\u003c/p\u003e\u003cp\u003eTo investigate the phylogeny and evolutionary trajectory of \u003cem\u003eP. sarmentosum\u003c/em\u003e, a genomic-scale phylogenetic tree was constructed based on 273 strict single-copy orthologous genes from 15 plant genomes, with \u003cem\u003eAmborella trichopoda\u003c/em\u003e as the outgroup. The maximum likelihood (ML) method was employed for tree construction (Fig.\u0026nbsp;2C and Supplementary Data 8). As expected, the phylogenetic tree places \u003cem\u003eP. sarmentosum\u003c/em\u003e as the sister group to the \u003cem\u003ePiper\u003c/em\u003e species. The divergence of the Piperaceae family is estimated to have occurred around 92.20 MYA, and the divergence between \u003cem\u003eP. nigrum\u003c/em\u003e and \u003cem\u003eP. sarmentosum\u003c/em\u003e is estimated to have occurred approximately 17.56 MYA. Further analysis using CAFE 5 revealed that 4,430 gene families underwent expansion in the \u003cem\u003eP. nigrum\u003c/em\u003e lineage, while 447 gene families contracted (Fig.\u0026nbsp;2C). In \u003cem\u003eP. nigrum\u003c/em\u003e, 2,967 gene families expanded, while \u003cem\u003eP. sarmentosum\u003c/em\u003e exhibited 2,746 expanded gene families. Among these, the \u003cem\u003ePiper\u003c/em\u003e species showed contraction in 1,406 gene families, while \u003cem\u003eP. sarmentosum\u003c/em\u003e had contraction in 813 gene families. Gene Ontology (GO) functional enrichment analysis of all expanded gene families revealed that they are significantly involved in processes such as alkaloid metabolic process (GO:0009820), cellular amide metabolic process (GO:0043603), jasmonic acid metabolic process (GO:0009694), response to wounding (GO:0009611), and mismatch repair (GO:0006298) (Supplementary Data 9). In addition, the specific gene expansions in \u003cem\u003eP. sarmentosum\u003c/em\u003e were notably enriched in genes related to secondary metabolism, disease resistance, and growth/development (Fig.\u0026nbsp;2D). These include BAHD acyltransferases (28 genes), sulfotransferases, disease resistance proteins (e.g., \u003cem\u003eRPS5, RPP13, RGA1, RGA2, RGA3, RGA4, RGA5\u003c/em\u003e), NBS-LRR disease resistance proteins, LRR receptor-like serine/threonine protein kinases (e.g., \u003cem\u003eEFR, BAM1, FLS2, GSO2, EMS1\u003c/em\u003e), jasmonate (28 genes), and auxin-inducible genes (65 genes). These gene expansions may indicate that biotic stress from pathogen infection and herbivory are the primary selective pressures acting on \u003cem\u003eP. sarmentosum\u003c/em\u003e in tropical rainforests.\u003c/p\u003e\u003cp\u003eWhole-genome duplication is considered a major evolutionary force that generates additional genetic material, enhancing the adaptability and plasticity of plants, which in turn promotes species diversification and functional innovation\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. In this study, we used MCScanX to infer synteny within the genome of \u003cem\u003eP. sarmentosum\u003c/em\u003e. Our analysis identified 739 syntenic blocks across the entire genome, containing 25,308 genes, which account for 65.76% of the total gene count. Among these syntenic blocks, 689 (93.33%) of the paralogous genes were located between chromosomes, while the remaining 50 (6.77%) were located within chromosomes (Fig.\u0026nbsp;1C). The analysis of paralogous gene duplication types in \u003cem\u003eP. sarmentosum\u003c/em\u003e indicated that most genes were classified as resulting from WGD or segmental duplications (25,308 genes, 65.76%). This suggests that a large proportion of \u003cem\u003eP. sarmentosum\u003c/em\u003e's genes experienced duplication during the evolutionary process. To gain deeper insight into the evolutionary history of the \u003cem\u003eP. sarmentosum\u003c/em\u003e genome, we compared its synonymous substitution rate (Ks) with the genomes of \u003cem\u003eP. nigrum\u003c/em\u003e, \u003cem\u003eCinnamomum camphora\u003c/em\u003e, \u003cem\u003eLiriodendron tulipifera\u003c/em\u003e, and grape to identify homologous gene pairs and assess the synteny relationships between these species. The Ks curve rates of syntenic gene pairs indicate that the \u003cem\u003eP. sarmentosum\u003c/em\u003e genome has undergone three rounds of WGD: the first being an ancient triplication event (Ks\u0026thinsp;\u0026asymp;\u0026thinsp;1.53), consistent with the \u003cem\u003eγ\u003c/em\u003e event of the angiosperm ancestor, shared by all core eudicot lineages. The second was a β duplication event shared by magnoliids (Ks\u0026thinsp;\u0026asymp;\u0026thinsp;0.88), consistent with the Ks distribution region of other magnoliids, followed by a recent triplication event (Ks\u0026thinsp;\u0026asymp;\u0026thinsp;0.15). Additionally, we conducted a synteny analysis using \u003cem\u003eAristolochia fimbriata\u003c/em\u003e, \u003cem\u003eP. sarmentosum\u003c/em\u003e and \u003cem\u003eP. nigrum\u003c/em\u003e, revealing a ratio of 1:8:8, consistent with previous studies on \u003cem\u003eP. nigrum\u003c/em\u003e, further confirming the three rounds of WGD in \u003cem\u003eP. sarmentosum\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003ch3\u003eMetabolite Profiling and Biosynthesis Pathways of Piperine and PL in P. sarmentosum\u003c/h3\u003e\n\u003cp\u003eAs a distinctive plant, \u003cem\u003eP. sarmentosum\u003c/em\u003e has not been extensively studied in terms of its metabolomics. This study uses non-targeted metabolomics to investigate the distribution of metabolites across different tissues of \u003cem\u003eP. sarmentosum\u003c/em\u003e.A total of 4,456 metabolites were identified, including 1,290 amino acids and derivatives, 535 phenolic compounds, 535 organic acids, 238 alkaloids, 182 phenolic acids, 161 flavonoids, and other types of metabolites (Fig.\u0026nbsp;3A and Supplementary Data 10). The distribution of metabolites shows distinct tissue specificity (Fig.\u0026nbsp;3B). To assess the tissue-specific metabolites in \u003cem\u003eP. sarmentosum\u003c/em\u003e, we conducted a weighted gene co-expression network analysis (WGCNA), which identified 15 distinct metabolic modules. Among these, the Brown, Turquoise, Blue, Yellow, and Green modules were found to be specific to each tissue, collectively representing 84.56% of the total metabolites (Fig.\u0026nbsp;3C). KEGG pathway enrichment analysis of these core modules revealed significant enrichment in the \"Valine, leucine, and isoleucine biosynthesis\" and \"Glycolysis / Gluconeogenesis\" pathways across all modules (Fig.\u0026nbsp;3D and Supplementary Data 11). Notably, the Brown and Turquoise modules showed significant enrichment in the \"Biosynthesis of various alkaloids\" pathway. We further investigated and observed that the relative content of piperidine alkaloid metabolites, such as Piperine, Piperitone, Guineensine, Pyrrolidine, Trichostachine, Piperlonguminine, and PL, is notably higher in the root, flower, and fruit tissues (Fig.\u0026nbsp;3E). This differential distribution may reflect a tissue-specific role of these alkaloids in plant defense mechanisms, as alkaloids are known to act as deterrents against herbivores and pathogens. (Fig.\u0026nbsp;3E and Supplementary Data 10).\u003c/p\u003e\u003cp\u003e\u003cem\u003eP. sarmentosum\u003c/em\u003e contains piperine, which is not only the major amid alkaloid in the fruit but also the key source of its spicy flavor and biological activity. However, the piperine content in \u003cem\u003eP. sarmentosum\u003c/em\u003e is much lower than in \u003cem\u003eP. nigrum\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Therefore, understanding its biosynthetic pathway is crucial for developing crops with high piperine content. Current research on piperine biosynthesis mainly involves three gene groups: The first group includes genes in the phenylpropanoid pathway (map00940), which catalyze a series of complex reactions to produce 3,4-methylenedioxycinnamoyl-CoA, a precursor for the biosynthesis of piperoyl-CoA. The second group consists of genes involved in L-lysine metabolism (map01064), which catalyze the conversion of lysine into piperidine through a series of reactions, including decarboxylation, amine oxidation, cyclization, and reduction\u003csup\u003e\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. The third group is acyltransferase genes, which catalyze the synthesis of piperidine alkaloids in the presence of piperoyl-CoA and piperidine (Fig.\u0026nbsp;4A). However, the biosynthetic pathway of PL remains unclear. Based on its chemical structure, we hypothesize that the key steps in its synthesis involve the reaction between Sinapoyl-CoA and 5,6-dihydropyridin-2(1H)-one, catalyzed by the BADH enzyme, forming an amide compound, which is then methylated by the OMT enzyme (Fig.\u0026nbsp;4A). Notably, this step shares many genes with the biosynthesis of piperine (Fig.\u0026nbsp;4A and 4B). Through homology searches and functional annotations, we identified 110 candidate genes that are likely involved in the biosynthesis of piperine alkaloids. Expression analysis showed distinct expression patterns of these genes across different plant tissues (Supplementary Data 12). Most of the genes in the phenylpropanoid pathway exhibit high expression levels, including \u003cem\u003ePsSK\u003c/em\u003e (Pbechr23G000696, Pbechr8G000852), \u003cem\u003ePsEPSPase\u003c/em\u003e (Pbechr5G001181), \u003cem\u003ePsCS\u003c/em\u003e (Pbechr10G000850, Pbechr8G000653), \u003cem\u003ePsCM\u003c/em\u003e (Pbechr22G000529, Pbechr26G000427, Pbechr8G001394), \u003cem\u003ePsPAL\u003c/em\u003e (Pbechr4G002064, Pbechr5G000287, Pbechr3G001915), \u003cem\u003ePsC4H\u003c/em\u003e (Pbechr16G000464, Pbechr23G000605), \u003cem\u003ePsCOMT\u003c/em\u003e (Pbechr1G002005), \u003cem\u003ePs4CL\u003c/em\u003e (Pbechr2G001132, Pbechr8G001369), and \u003cem\u003ePsCAO\u003c/em\u003e (Pbechr18G000248, Pbechr3G001234, Pbechr4G000818). These genes are highly expressed in multiple tissues, with the root, flower, and fruit showing the highest levels (Fig.\u0026nbsp;4A and 4B).\u003c/p\u003e\u003cp\u003eAcyltransferase (BADH) is a key enzyme in the biosynthesis of piperine-like compounds. In this study, we conducted a gene family analysis and identified 126 BADH genes in \u003cem\u003eP. sarmentosum\u003c/em\u003e, 155 in \u003cem\u003eP. nigrum\u003c/em\u003e, 51 in \u003cem\u003eA. fimbriata\u003c/em\u003e species, and 63 in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. These genes include two characteristic motifs found in all BAHD-like enzymes: HXXXD and DFGWG. A total of 126 \u003cem\u003ePsBAHD\u003c/em\u003e genes were distributed across 25 chromosomes, with 51 of these genes (40.48%) located in WGD gene clusters, suggesting that the WGD event has played an important role in the amplification of \u003cem\u003ePsBAHD\u003c/em\u003e genes (Supplementary Data 12). Phylogenetic trees were constructed using the Maximum Likelihood (ML) method, and based on the reference by Liu et al., the BAHD family proteins were classified into six branches (I, II, III, IV, V, and VI) (Fig.\u0026nbsp;4C)\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. Notably, previous transcriptome studies have identified two genes involved in piperine synthesis: Piperine synthases (MW354956), which specifically catalyze the synthesis of piperine using piperoyl-CoA and piperidine as substrates, and Piperamide synthases (MW354957), which have broader substrate specificity and catalyze reactions involving various CoA esters and aliphatic or aromatic amines, producing a range of piperamide derivatives\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. We found that in \u003cem\u003eP. sarmentosum\u003c/em\u003e, only Piperamide synthases (Pbechr3G000899) are present, while Piperine synthases are absent. Furthermore, this gene is predominantly expressed in the root, which could explain the lower content of piperine in \u003cem\u003eP. sarmentosum\u003c/em\u003e compared to \u003cem\u003eP. nigrum\u003c/em\u003e. The remaining \u003cem\u003ePsBAHD\u003c/em\u003e genes are mainly expressed at higher levels in the flowers and fruits of \u003cem\u003eP. sarmentosum\u003c/em\u003e, suggesting that these genes may play a crucial role in the biosynthesis of piperamide and other alkaloids in the flowers and fruits (Fig.\u0026nbsp;4D and Supplementary Data 12). Biosynthetic genes for PL still require further analysis.\u003c/p\u003e\n\u003ch3\u003eIdentification of key genes involved in PL biosynthesis\u003c/h3\u003e\n\u003cp\u003eTo investigate the genes and regulatory network involved in the synthesis of PL, we constructed a WGCNA network using 39,154 genes from 15 samples. Genes with low expression variation (standard deviation\u0026thinsp;\u0026le;\u0026thinsp;0.8) were filtered out, leaving 19,362 genes, which were then divided into 16 distinct modules, each marked with a different color. The modules are presented in a cluster dendrogram, network heatmap, and trait heatmap, with the gray module representing genes that were not assigned to any specific module and have no reference significance (Fig.\u0026nbsp;5A). Through Pearson correlation analysis, we associated each co-expressed module with alkaloid and lysine pathway metabolites. The results showed that most alkaloid-related modules were negatively correlated with L-Lysine and 5-Aminopentamic acid. Specifically, the 'Orange' and 'Darkturquoise' modules showed significant correlations with L-Lysine and 5-Aminopentamic acid ImC, while the 'Darkolivegreen' module was significantly associated with Pipericine and Piperine. Notably, PL was significantly correlated with the 'Darkgreen' module, which showed high expression during the flowering and fruiting stages. Therefore, we hypothesize that genes within the Darkgreen module may be closely involved in the synthesis of PL (Fig.\u0026nbsp;5B). Further analysis revealed that the Darkgreen module contained 621 genes, and their expression levels were significantly upregulated in the flowers and fruits (Fig.\u0026nbsp;5B). KEGG functional analysis indicated that most of these genes were enriched in metabolic pathways such as Biosynthesis of secondary metabolites, Metabolic pathways, Terpenoid backbone biosynthesis, Fatty acid degradation, Plant hormone signal transduction, Nicotinate and nicotinamide metabolism, Monoterpenoid biosynthesis, and MAPK signaling pathway \u0026ndash; plant, among others. GO functional analysis showed that these genes are involved in flower development and the biosynthesis of alkaloid metabolites (Supplementary Data 13). To identify key genes involved in the synthesis of PL, we selected the top 200 genes with the highest ImC values from the Darkgreen module and visualized the relationships between highly connected genes using Cytoscape software (Fig.\u0026nbsp;5C). Among these genes with the highest connection degrees (KEM), we identified several key genes, such as \u003cem\u003ePsHCT1\u003c/em\u003e (Shikimate hydroxycinnamoyl transferase, Pbechr25G000561), \u003cem\u003ePsCYP450\u003c/em\u003e, \u003cem\u003ePsAO\u003c/em\u003e, \u003cem\u003ePsPK\u003c/em\u003e, \u003cem\u003ePsCER3\u003c/em\u003e, and others. In addition, several transcription factors, including MYB, bHLH, and CBF, were also identified. These transcription factors may play an important role in maintaining the development of flower and fruit organs, as well as in regulating the synthesis of amide alkaloids (Supplementary Data 14).\u003c/p\u003e\u003cp\u003eNotably, \u003cem\u003ePsHCT1\u003c/em\u003e is the most highly connected hub gene within this Darkgreen module, and it has the highest expression level among all the BADH gene family members. The \u003cem\u003ePsHCT1\u003c/em\u003e-like gene encodes a protein of 427 amino acids, with an encoding sequence of 1281 base pairs. Subcellular localization analysis revealed that \u003cem\u003ePsHCT1\u003c/em\u003e is localized in the cytoplasm, consistent with previous studies\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e (Fig.\u0026nbsp;5D). To further explore the function of this gene, we modeled \u003cem\u003ePsHCT1\u003c/em\u003e based on the best template, the X-ray crystal structure of BAHD from rosemary (PDB accession number: 6MK2). We further investigated the interactions between the compounds Sinapic acid-CoA and 5,6-Dihydropyridin-2(1H)-one and the \u003cem\u003ePsHCT1\u003c/em\u003e gene, using the HCT crystal structure as the receptor. As shown in Fig.\u0026nbsp;5E, Sinapic acid forms hydrogen bonds with the residues Asp-298 (6.5 \u0026Aring;), SER-378 (3.4 \u0026Aring;), LEU-35 (2.5 \u0026Aring;), His-158 (1.5 \u0026Aring;), and Asp-162 (3.41 \u0026Aring;), and interacts with several other amino acid residues in this range. On the other hand, 5,6-Dihydropyridin-2(1H)-one forms a hydrogen bond with PRO-37 (1.1 \u0026Aring;). Notably, 5,6-Dihydropyridin-2(1H)-one forms a 2.9 \u0026Aring; hydrogen bond with the acyl group of Sinapic acid (Fig.\u0026nbsp;5E). The molecular docking results, which align with structure-activity relationships, show a strong binding affinity with an affinity value of -6.2 kcal/mol. Additionally, we predicted molecular docking between the \u003cem\u003ePsHCT1\u003c/em\u003egene and the product. The results indicated that the product forms hydrogen bonds with ARG-363 (8.7 and 6.5 \u0026Aring;), LYS-221 (5.5, 5.5 \u0026Aring;), and PRO-37 (6.1 \u0026Aring;), demonstrating a high binding force. The molecular docking results, which are consistent with structure-activity relationships, also show an affinity of -6.3 kcal/mol, indicating a potential binding interaction (Fig.\u0026nbsp;5E).\u003c/p\u003e\u003cp\u003eIn the biosynthesis of PL, OMT enzymes play a crucial role in the addition of methoxy groups. Subsequently, through gene family analysis, we identified 96 OMT genes. A phylogenetic tree was constructed using Arabidopsis as a reference, revealing that the tree is divided into two families: \u003cem\u003ePsCCoAOMT\u003c/em\u003e (35 genes) and \u003cem\u003ePsCOMT\u003c/em\u003e (61 genes) (Supplementary Data 15). Based on the chemical structure of PL, we hypothesize that its biosynthesis is closely related to the \u003cem\u003ePsCCoAOMT\u003c/em\u003e subfamily, which exhibits highly active gene expression, with \u003cem\u003ePsCCoAOMT1\u003c/em\u003e (Pbechr20G000401) showing the highest expression level (Supplementary Data 15). We then performed molecular docking predictions between the \u003cem\u003ePsCCoAOMT1\u003c/em\u003e gene, PL precursors, and the PL molecule. The results showed binding energies of -7.7 kcal/mol and \u0026minus;\u0026thinsp;8.0 kcal/mol, indicating strong binding affinity (Fig.\u0026nbsp;5F). This suggests that the enzyme may catalyze the addition of the methoxy group to the PL precursor through stable interactions. To summarize, through WGCNA, correlation analysis, high expression levels, and strong binding predictions from molecular docking, we identified \u003cem\u003ePsHCT1\u003c/em\u003e and \u003cem\u003ePsCCoAOMT1\u003c/em\u003e as key genes involved in PL synthesis. However, this result still requires further experimental validation.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cem\u003eP. sarmentosum\u003c/em\u003e is a widely recognized traditional medicinal and edible plant, attracting increasing attention due to its therapeutic and ornamental value\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. The genus \u003cem\u003ePiper\u003c/em\u003e is of significant commercial and economic importance, widely used in the spice, pharmaceutical, and pesticide industries, and also having a long history of use in traditional practices\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. Previous phytochemical research on \u003cem\u003ePiper\u003c/em\u003e species has led to the isolation of amide alkaloids, lignans, neolignans, and phenylpropanoids as the main components\u003csup\u003e\u003cspan additionalcitationids=\"CR4 CR5\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. These isolated compounds exhibit a broad range of biological effects, including antifungal, anticancer, anti-inflammatory, and antioxidant activities, sparking widespread interest\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Although many chemical constituents have been isolated and identified from this species, the biological activities of only a few purified compounds have been studied. Therefore, it is crucial to explore the genomic evolution and biosynthesis mechanisms of active compounds in \u003cem\u003eP. sarmentosum\u003c/em\u003e. In this study, we assembled a high-quality \u003cem\u003eP. sarmentosum\u003c/em\u003e genome using PacBio HiFi and Hi-C sequencing, achieving a Scaffold N50 of 22.52 Mb, with BUSCO and QV quality assessments confirming the genome's high completeness compared to \u003cem\u003eP. nigrum\u003c/em\u003e and \u003cem\u003eP. longum\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Notably, the completeness of the gene annotation in \u003cem\u003eP. sarmentosum\u003c/em\u003e, as predicted by BUSCO, was 98.6%, significantly higher than \u003cem\u003eP. nigrum\u003c/em\u003e's 83.6%\u003csup\u003e30\u003c/sup\u003e. This provides an important reference for the genomic analysis of other \u003cem\u003ePiper\u003c/em\u003e species, making it an ideal model plant for functional genomics research in the \u003cem\u003ePiper\u003c/em\u003e genus.\u003c/p\u003e\u003cp\u003eIn this study, significant differences in genome size were observed between \u003cem\u003eP. sarmentosum\u003c/em\u003e (527.85 Mb) and \u003cem\u003eP. nigrum\u003c/em\u003e (761.2 Mb). Transposable elements (TEs) are an important factor contributing to this size difference\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. We found that the repetitive sequences in \u003cem\u003eP. sarmentosum\u003c/em\u003e amounted to 305 Mb, constituting 57.88% of the total sequence, while \u003cem\u003eP. nigrum\u003c/em\u003e had 417.52 Mb of repetitive sequences, accounting for 54.85%. Previous studies have shown that Ty3/Gypsy elements have been identified as the main repetitive components driving genome expansion in all large-genome species\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. In our study, LTR retrotransposons comprised 31.82% of the \u003cem\u003eP. sarmentosum\u003c/em\u003e genome, significantly lower than the 40.55% observed in the \u003cem\u003eP. nigrum\u003c/em\u003e genome, which may be a crucial factor contributing to the genome size difference\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Our analysis of insertion times revealed that \u003cem\u003eP. sarmentosum\u003c/em\u003e and \u003cem\u003eP. nigrum\u003c/em\u003e underwent different LTR-type bursts over the past 3.5 MYA. Notably, LTR-RT bursts peaked at 0.25 and 0.5 MYA. During this period, the Earth experienced climate oscillations known as the Pleistocene, and the insertion of LTRs into the genome may have influenced the expression of resistance genes, thereby enhancing the plant's adaptability to the environment\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e,\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. However, more thorough and in-depth research is needed to understand the underlying processes that led to LTR bursts. WGD play a crucial role in plant genome evolution, often leading to sudden increases in gene content and genome size. Qin et al. used specialized computations to find that \u003cem\u003eP. nigrum\u003c/em\u003e underwent three rounds of WGD\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. In this study, two \u003cem\u003eα\u003c/em\u003e and \u003cem\u003eβ\u003c/em\u003e WGD events near the Cretaceous-Paleocene boundary were observed at Ks values of ~\u0026thinsp;0.15 and ~\u0026thinsp;0.88 in \u003cem\u003eP. sarmentosum\u003c/em\u003e. Additionally, we were able to clearly observe the \u003cem\u003eγ\u003c/em\u003e triplication event common to core eudicots at Ks\u0026thinsp;~\u0026thinsp;1.53 without the need for special calculations. Our research confirms that Piper species underwent three rounds of WGD, with \u003cem\u003eP. nigrum\u003c/em\u003e showing no clear \u003cem\u003eγ\u003c/em\u003e triplication event, which may be related to its relatively low BUSCO score. On the other hand, the three WGDs in \u003cem\u003eP. sarmentosum\u003c/em\u003e are consistent with its higher chromosome number (2n\u0026thinsp;=\u0026thinsp;52), based on the basic chromosome number (x\u0026thinsp;=\u0026thinsp;13), suggesting that this plant is polyploid. WGD events have facilitated the expansion of genes related to secondary metabolism, disease resistance, and growth/development, similar to the expansion in \u003cem\u003eP. nigrum\u003c/em\u003e, with high expression in roots and fruits. This suggests that pathogenic infection and herbivory pressure are the major selective pressures faced by \u003cem\u003eP. sarmentosum\u003c/em\u003e in tropical rainforests\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eNatural products have always been an important source of potential lead compounds, and natural products and their structural analogs have made significant contributions to the treatment of diseases throughout history\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eP. sarmentosum\u003c/em\u003e contains diverse bioactive compounds, including alkaloids, amides, and phenolic compounds, which have well-documented antioxidant and anti-inflammatory activities. Its crude extracts exhibit inhibitory effects against various microbial pathogens and cancer cell lines, highlighting its potential as a source of novel anticancer agents\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. In this study, metabolomic analysis identified 4,456 metabolites, among which 238 alkaloids demonstrated significant pharmacological activity. Notably, amide-type compounds such as PL, piperine, and PL exhibit multi-target bioactivities, providing molecular evidence for the traditional \"medicinal-food homology\" properties of \u003cem\u003eP. sarmentosum\u003c/em\u003e and supporting its potential as a natural drug repository. Since its first isolation from \u003cem\u003eP. nigrum\u003c/em\u003e in 1820, a series of piperamides including piperamide, pipernonaline, and guineensine, have been identified\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Piperine, one of the most abundant compounds in \u003cem\u003ePiper\u003c/em\u003e species\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e, serves as a key quality marker in \u003cem\u003eP. nigrum\u003c/em\u003e, with reported concentrations ranging from 29.57 to 54.23 mg/g\u003csup\u003e50\u003c/sup\u003e. Previous studies have reported that the piperine content in \u003cem\u003eP. sarmentosum\u003c/em\u003e (7.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 mg/g) is significantly lower than that in \u003cem\u003eP. nigrum\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. However, the exact reasons for this disparity remain unclear. Studies have identified two key enzymes involved in the biosynthesis of piperine in \u003cem\u003eP. nigrum\u003c/em\u003e: piperine synthase, which synthesizes piperine by combining piperoyl-CoA and piperidine, and piperamide synthase, which has broad substrate specificity and can bind various CoA esters with both aliphatic and aromatic amines, catalyzing different reactions\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Both of these enzymes are BAHD-type acyltransferases, encoded by genes that are preferentially expressed in the developing fruits of \u003cem\u003eP. nigrum\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e.Through comparative genomics, we discovered differences in the BADH gene copy number between \u003cem\u003eP. sarmentosum\u003c/em\u003e (126 genes) and \u003cem\u003eP. nigrum\u003c/em\u003e (155 genes). Notably, only piperamide synthase was identified in \u003cem\u003eP. sarmentosum\u003c/em\u003e, which may explain the lower piperine content in \u003cem\u003eP. sarmentosum\u003c/em\u003e. The piperine synthase in \u003cem\u003eP. nigrum\u003c/em\u003e originated from a dispersed event, and the absence in \u003cem\u003eP. sarmentosum\u003c/em\u003e still requires further investigation with additional \u003cem\u003ePiper\u003c/em\u003e species to fully understand this phenomenon. Our transcriptomic and metabolomic analyses revealed that piperamides, including piperamide, pipernonaline, and guineensine, are predominantly enriched in roots, consistent with prior findings\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. In contrast, leaves, stems, flowers, and immature fruits exhibit lower alkaloid content, suggesting tissue-specific metabolic partitioning. The high concentration of piperamides in roots may function as a defense mechanism against soil pathogens, potentially acting synergistically with terpenoids to form an effective protective system.\u003c/p\u003e\u003cp\u003eBeyond piperine, amide alkaloids represent one of the most abundant phytochemical classes in \u003cem\u003eP. sarmentosum\u003c/em\u003e. PL, a bioactive compound first isolated from \u003cem\u003eP. longum\u003c/em\u003e, exhibits remarkable anticancer properties. Its α, β-unsaturated carbonyl moiety is critical for pharmacological activity\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e, enabling selective induction of tumor cell apoptosis and suppression of metastasis. This compound demonstrates efficacy against multiple cancer cell lines, including breast, colon, prostate, and lung cancers\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Despite its therapeutic potential, PL's low natural abundance poses extraction challenges. While \u003cem\u003eP. longum\u003c/em\u003e fruits contain only 1.2 mg/g, \u003cem\u003eP. sarmentosum\u003c/em\u003e fruits accumulate higher levels (1.7 mg/g) \u003csup\u003e28\u003c/sup\u003e. This may be related to resistance against biological stress. Although some studies report elevated concentrations in \u003cem\u003eP. longum\u003c/em\u003e roots, agricultural practices primarily harvest flowers and fruits\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. Our metabolomic data confirms that \u003cem\u003eP. sarmentosum\u003c/em\u003e predominantly synthesizes PL in reproductive tissues, aligning with cultivation needs. Given its chemical structure, we hypothesize that Sinapyl-Coenzyme A, a key metabolite in lignin biosynthesis, serves as the precursor for PL synthesis\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. This compound is primarily synthesized through the phenylpropanoid pathway. Through integrated transcriptomic-metabolomic mining, we identified two key precursor enzymes, \u003cem\u003ePsHCT1\u003c/em\u003e and \u003cem\u003ePsCCoAOMT1\u003c/em\u003e, involved in the PL biosynthetic pathway. Molecular docking predictions show a high probability of binding between these enzymes and their respective substrates and products, suggesting their potential role in catalyzing key biochemical reactions in PL synthesis. Transcription factors such as bHLH, MYB, and WRKY are known to regulate secondary metabolism, including the synthesis of alkaloids and other bioactive compounds, in response to environmental stress\u003csup\u003e\u003cspan additionalcitationids=\"CR54 CR55\" citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. Our weighted gene co-expression network analysis (WGCNA) suggests a strong correlation between these transcription factors and the expression of \u003cem\u003ePsHCT1\u003c/em\u003e, indicating that they may enhance PL production by modulating the activity of these enzymes. While these computational results are promising, further experimental evidence is required to validate the involvement of \u003cem\u003ePsHCT1\u003c/em\u003e, \u003cem\u003ePsCCoAOMT1\u003c/em\u003e, and the transcription factors in PL biosynthesis. Ferulic acid, the best precursor for Sinapyl-Coenzyme A biosynthesis, is catalyzed by F5H to form 5-hydroxyferulic acid, which is subsequently converted into sinapate by COMT\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. Sinapate undergoes hydroxylation and methylation by key enzymes, such as 4CL and COMT, to form CoA derivatives\u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e. These key enzymes are well-characterized, facilitating the construction of chassis strains for de novo PL synthesis. Interestingly, 5,6-dihydropyridin-2(1H)-one, another precursor for PL synthesis, is typically synthesized through chemical methods, which are costly and complex\u003csup\u003e\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e,\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e. Although the biosynthetic pathway has not yet been fully validated, we have identified \u003cem\u003ePsHCT1\u003c/em\u003e and \u003cem\u003ePsCCoAOMT1\u003c/em\u003e as key enzymes potentially involved in PL synthesis and hypothesize that transcriptional regulation through stress-responsive factors could effectively increase PL production. Overall, our study provides valuable directions for further validating these findings and optimizing the biosynthetic pathway for efficient PL production.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThrough integrated multi-omics analysis, this study has achieve the chromosome-level genome assembly of \u003cem\u003eP. sarmentosum\u003c/em\u003e, significantly advancing genomic research in the Piper genus. We have systematically elucidated the biosynthetic mechanisms of the key bioactive compound PL, providing crucial theoretical foundations for the genetic improvement of medicinal plants and the development of plant-derived pharmaceuticals.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003ePlant Material, DNA Extraction, and Sequencing\u003c/h2\u003e\u003cp\u003eThe \u003cem\u003eP. sarmentosum\u003c/em\u003e plant used in this study was originally collected from a spice plantation in Lufeng City, Guangdong Province, China (35\u0026deg;2' N, 104\u0026deg;3' E) and subsequently relocated to the Guangdong Provincial Crop Germplasm Resource Nursery (23\u0026deg;16' N, 113\u0026deg;27' E) for long-term maintenance under natural conditions. The sample ID is GD2021441581. All genomic sequencing samples were derived from fresh leaves of a single plant. DNA was extracted using a modified cetyltrimethylammonium bromide (CTAB) method, as previously described\u003csup\u003e\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u003c/sup\u003e. After thoroughly grinding the \u003cem\u003eP. sarmentosum\u003c/em\u003e leaf tissues, 5 mL of 2% CTAB, 50 \u0026micro;L of β-mercaptoethanol, and 26 \u0026micro;L of proteinase K were added, and the mixture was well mixed. The samples were incubated at 65\u0026deg;C for 30 minutes. After incubation, the samples were centrifuged at 12,000 rpm for 10 minutes, and the supernatant was collected. Next, an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1) was added to the supernatant and mixed thoroughly. The mixture was then centrifuged at 12,000 rpm for 10 minutes. This step was repeated twice, with the supernatant collected each time. Then, an equal volume of chloroform/isoamyl alcohol (24:1) was added, the mixture was mixed again, and centrifuged at 120,000 rpm for 10 minutes. The supernatant was collected. Subsequently, pre-chilled isopropanol (4\u0026deg;C) was added, and the mixture was inverted to mix and incubated at 4\u0026deg;C for 30 minutes to precipitate the DNA. The samples were centrifuged at 12,000 rpm for 10 minutes to collect the DNA precipitate. The precipitate was washed twice with 1 mL of pre-chilled 70% ethanol (4\u0026deg;C), centrifuging at 12,000 rpm for 5 minutes each time, and then air-dried at 37\u0026deg;C. Finally, the dried DNA pellet was dissolved in Tris-HCl buffer, treated with RNase A, and incubated at 37\u0026deg;C for 30 minutes to remove RNA. The final DNA solution was stored at -20\u0026deg;C. The concentration and quality of the extracted DNA were evaluated using a NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). For long-read sequencing, a PacBio SMRTbell library was constructed using the SMRTbell Prep Kit 3.0 (Pacific Biosciences, Menlo Park, CA, USA) according to the manufacturer's protocol. Sequencing was performed on the PacBio Revio platform (PacBio Sequel II system) to generate high-fidelity (HiFi) data. To improve the continuity of the genome assemblies, we created Hi-C libraries for the young leaves of the same plant using the GenSeq Hi-C library preparation kit (Cloud-Seq Bio Co., Ltd., China, Shanghai). The kit involves crosslinking, DpnII digestion, biotin labeling, ligation, shearing, and biotin capture\u003csup\u003e\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u003c/sup\u003e. Sequencing of the Hi-C fragments was conducted on the DNBSEQ-T7 platform (MGI, Shenzhen, China).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eDe novo Genome Assembly\u003c/h2\u003e\u003cp\u003eFirst, HiFiAdapterFilt v3.0.0\u003csup\u003e63\u003c/sup\u003e was used to remove reads with residual PacBio adapter sequences from the HiFi sequencing data and perform quality control. Jellyfish v2.3.1\u003csup\u003e64\u003c/sup\u003e was used to count k-mers in the HiFi sequencing data with the parameter kmer\u0026thinsp;=\u0026thinsp;21. Genomescope.R v2.0\u003csup\u003e65\u003c/sup\u003e was employed to estimate the genome size, setting the maximum k-mer coverage threshold to 10,000. The initial genome assembly of PacBio Revio sequencing platform HiFi reads was performed using Hifiasm v0.15.5\u003csup\u003e66\u003c/sup\u003e with default parameters. Subsequently, the genome was polished three times using Pilon v1.24\u003csup\u003e67\u003c/sup\u003e. Redundant overlapping contigs were removed using Purge_Haplotigs v1.1.2\u003csup\u003e68\u003c/sup\u003e. The final round of gap filling for the draft genome was conducted using NextDenovo v2.17-r941\u003csup\u003e69\u003c/sup\u003e and TGS_Gapcloser2 v1.9.4\u003csup\u003e70\u003c/sup\u003e. Next, the Hi-C reads were aligned to the assembled genome using Juicer v1.60\u003csup\u003e71\u003c/sup\u003e software, allowing us to obtain interaction data between chromatin regions across contigs. The 3D-DNA v180922\u003csup\u003e72\u003c/sup\u003e pipeline was used to automatically generate candidate chromosome-level assemblies to correct erroneous connections, orders, and orientations, and to organize the contigs into the draft chromosome assembly. Errors in the chromosome-level assembly were manually corrected in Juicebox v2.20.00\u003csup\u003e73\u003c/sup\u003e, and Hi-C reads were aligned to the chromosome-level assembly using HiCExplorer v3.7.2\u003csup\u003e74\u003c/sup\u003e to evaluate the clarity of structural domains across different chromosomes. The final chromosome-level genome assembly was assessed using BUSCO v3.1.0\u003csup\u003e75\u003c/sup\u003e based on the embryophyta_odb10 gene set. Minimap2 v2.28\u003csup\u003e76\u003c/sup\u003e was used to map PacBio HiFi reads to the assembled genome to evaluate coverage and average depth. Genome quality was assessed using LTR_retriever v2.9.681\u003csup\u003e77\u003c/sup\u003e. Finally, Mequery v1.3\u003csup\u003e78\u003c/sup\u003e was used to evaluate the assembly's overall quality (QV) and completeness.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eGenome Annotation\u003c/h2\u003e\u003cp\u003eThe identification of known TEs in the genome is performed using RepeatMasker v4.1.0\u003csup\u003e79\u003c/sup\u003e with the Repbase TE library, and the TE protein database is queried using RepeatProteinMask. Subsequently, RepeatModeler2 v1.0.11\u003csup\u003e80\u003c/sup\u003e is employed to construct de novo repeat libraries for each genome, followed by detailed analysis, refinement, and classification. LTRs are identified with LTR_Retriever v2.9.681\u003csup\u003e77\u003c/sup\u003e and further classified using TESorter v1.4.682\u003csup\u003e81\u003c/sup\u003e. The terminal regions of LTRs are aligned with Mafft v7.50584\u003csup\u003e82\u003c/sup\u003e, and insertion times for LTRs are calculated using the formula T\u0026thinsp;=\u0026thinsp;K/2r, where K represents the genetic distance, and r is the substitution rate of 1.3e-8 substitutions per site per year. An unrooted phylogenetic tree is constructed using the neighbor-joining method with FastTree v2.1.1185\u003csup\u003e83\u003c/sup\u003e. For accurate protein-coding gene prediction, a combination of transcriptomic, homology-based, and de novo approaches is used. De novo predictions are made with Augustus\u003csup\u003e\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e\u003c/sup\u003e, GenScan\u003csup\u003e\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e\u003c/sup\u003e, and GlimmerHMM\u003csup\u003e\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e\u003c/sup\u003e, utilizing the Arabidopsis training set. Homology-based predictions employ GeMoMa\u003csup\u003e\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e\u003c/sup\u003e, incorporating protein sequences from \u003cem\u003eP. nigrum\u003c/em\u003e and other species. Transcriptomic predictions align the de novo transcriptome assembly with the genome and refine gene structures using PASA. Gene model consensus sets are generated using EVidenceModeler\u003csup\u003e\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e\u003c/sup\u003e, excluding single-exon genes supported solely by transcriptomic data and genes with fewer than three exons. To further enhance the reliability of annotations, TransposonPSI v2.2.26\u003csup\u003e89\u003c/sup\u003e is used to identify transposon-related genes, while Pseudogene Pipeline identifies pseudogenes. Pseudogenes and transposon-related genes with FPKM\u0026thinsp;\u0026lt;\u0026thinsp;1 are excluded. Gene function annotations are performed using EggNOG-mapper\u003csup\u003e\u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e\u003c/sup\u003e, Diamond, and InterProScan, providing annotations for GO, EC, KEGG pathways, COGs, and other functional categories. Non-coding RNA annotations are performed using Infernal v1.1.4 and tRNAscan-SE v2.0.9. The integrity of the genome or protein sequences is assessed using BUSCO\u003csup\u003e\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e\u003c/sup\u003e with the embryophyta_odb10 plant reference set.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003ePhylogenetic Analysis\u003c/h2\u003e\u003cp\u003eThe longest protein sequences from each gene model of 15 plant species were extracted and subjected to an all-versus-all Diamond alignment. Homologous genomes were identified using the default parameters of OrthoFinder v3.0.1b1\u003csup\u003e91\u003c/sup\u003e software. The aligned tandem amino acid sequences were further refined using MAFFT v7.271\u003csup\u003e82\u003c/sup\u003e, followed by trimming with trimAI v1.4.rev22. A maximum likelihood phylogenetic tree was constructed using RAxML v8.2.12\u003csup\u003e92\u003c/sup\u003e with the PROTGAMMAJTT model and 1,000 bootstrap replicates, using \u003cem\u003eA. trichopoda\u003c/em\u003e as the outgroup. The species tree topology was calibrated using MCMCtree v4.9\u003csup\u003e93\u003c/sup\u003e, incorporating two temporal calibration points: Node 1 (the common ancestor of \u003cem\u003eA. trichopoda\u003c/em\u003e and \u003cem\u003eO. sativa\u003c/em\u003e) estimated to be between 179 and 205 MYA; Node 2 (\u003cem\u003eH. annuus\u003c/em\u003e and \u003cem\u003eC. arabica\u003c/em\u003e) estimated to be between 97.5 and 109.2 MYA, with data sourced from the TimeTree\u003csup\u003e\u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e\u003c/sup\u003e database. A log-normal independent molecular clock model was used to generate 1,000,000 samples, discarding the first 25% as burn-in. The MCMCtree R package was employed to visualize the reliable divergence time intervals of each node in the species tree. Gene family expansion and contraction were assessed using CAFE v4.2.1\u003csup\u003e95\u003c/sup\u003e, and conditional P-values for each gene family were calculated. Gene families with P-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered to have significantly accelerated rates of expansion or contraction. Gene families with more than 100 copies in a single species were removed. Homologous protein sequences between species were aligned using Diamond v0.9.29.130\u003csup\u003e96\u003c/sup\u003e (E-value\u0026thinsp;\u0026lt;\u0026thinsp;1e-5, C-score\u0026thinsp;\u0026gt;\u0026thinsp;0.5), and syntenic blocks were identified using MCScanX v1.0.0\u003csup\u003e97\u003c/sup\u003e. To investigate the evolution of the \u003cem\u003eP. sarmentosum\u003c/em\u003e genome, the synonymous substitution rate (Ks) for collinear gene pairs was calculated using wgdi v1.1.1\u003csup\u003e98\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eTranscriptome and Metabolomic Analysis\u003c/h2\u003e\u003cp\u003eThe transcriptome sequencing was performed on five different tissues, including roots, stems, mature leaves, flowers, and fruits. Each sample consisted of three biological replicates. Total RNA was extracted using the Trizol reagent kit (Invitrogen, Carlsbad, CA, USA), and its quality was assessed using the Agilent 2100 Bioanalyzer. Eukaryotic mRNA was enriched with Oligo(dT) beads, while prokaryotic mRNA was enriched by removing rRNA using the Ribo-ZeroTM Magnetic Kit (Epicentre, Madison, WI, USA). The cDNA libraries were constructed using the NEBNext UltraTM RNA Library Prep Kit for Illumina (New England BioLabs, Beijing, China). The resulting cDNA library was sequenced on the MGI T7 platform (MGI, Shenzhen, China) using a 2 \u0026times; 150 bp paired-end run, with the experimental procedures following standard plant RNA extraction protocols. Sequencing was performed by Yuda Biotechnology Co., Ltd (Guangzhou, China). After filtering low-quality reads with fastp v0.23.4\u003csup\u003e99\u003c/sup\u003e, clean reads were mapped to the \u003cem\u003eP. sarmentosum\u003c/em\u003e genome using HISAT2 v.2.2.1\u003csup\u003e100\u003c/sup\u003e. Reads were quantified using featureCounts. Reads were quantified using featureCounts, and gene expression values were represented as TPM. We then used WGCNA v1.73\u003csup\u003e101\u003c/sup\u003e to filter genes with low expression variation (standard deviation\u0026thinsp;\u0026le;\u0026thinsp;0.8), setting the power value to 30 and using other default parameters for analysis. Tissue-specific gene clusters were identified based on module-metabolite correlations (Pearson |cor| \u0026gt;0.95). The clusterProfiler v4.0\u003csup\u003e102\u003c/sup\u003e package was used to perform GO and KEGG enrichment analysis on the genes in the identified tissue-specific modules.\u003c/p\u003e\u003cp\u003eThe combination of chromatography and mass spectrometry achieves the entire process from separation of substances by chromatography to identification of substances by mass spectrometry. Liquid chromatography-tandem mass spectrometry (LC-MS/MS) enables accurate qualitative and quantitative analysis. In this study, the sample collection and transcriptomics were consistent, with root, stem, mature leaf, flower, and fruit tissues, each sample using 3 biological replicates. LC-MS/MS was used to detect and analyze the metabolites in the samples. The samples were freeze-dried using a freeze dryer (Scientz-100F) and ground into powder using a grinder (MM 400, Retsch) at 30 Hz for 1.5 minutes. A 50 mg powder sample was weighed and extracted with 1200 \u0026micro;L of pre-chilled 70% methanol aqueous extraction solution at -20\u0026deg;C, with shaking for 30 seconds every 30 minutes for a total of 6 times. The mixture was centrifuged (12000 rpm, 3 minutes), and the supernatant was collected, filtered, and stored in vials for UPLC-MS/MS analysis. HPLC analysis was performed using a Waters ACQUITY Premier HSs T3 column (1.8 \u0026micro;m, 2.1 mm * 100 mm) in positive ion mode, with a mobile phase of 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B). The gradient was as follows: 5\u0026ndash;20% B (2 minutes), 20\u0026ndash;60% B (3 minutes), 60\u0026ndash;99% B (1 minute), held for 1.5 minutes, then returned to 5% B. The column temperature was 40\u0026deg;C, with a flow rate of 0.4 mL/min and an injection volume of 4 \u0026micro;L. Negative ion mode was analyzed with the same gradient. MS data were collected in Information Dependent Acquisition (IDA) mode, with source gas pressure at 50 psi, temperature at 550\u0026deg;C, spray voltage\u0026thinsp;\u0026plusmn;\u0026thinsp;5000 V, collision energy\u0026thinsp;\u0026plusmn;\u0026thinsp;30 V, scanning range of 50-1000 Da, accumulation time of 200 ms, product ion scanning range of 25-1000 Da, and collision energy\u0026thinsp;\u0026plusmn;\u0026thinsp;30 V, monitoring a maximum of 18 ions. Peak areas were corrected using the SVR method. Corrected peaks were used for metabolite identification through searching the laboratory\u0026rsquo;s self-built database, integrating public databases, prediction libraries, and the metDNA method. Finally, metabolites with a composite score of above 0.5 and an OC sample CV value less than 0.5 were extracted. The positive and negative modes were then merged, and the relative content of all metabolites was obtained.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eAlkaloid Biosynthesis Gene Identification and Molecular Docking\u003c/h2\u003e\u003cp\u003eTo identify candidate genes involved in the biosynthesis pathway of alkaloids, BLAST searches were performed on the Piper genome assembly with an E-value threshold of \u0026le;\u0026thinsp;1e-5, using protein sequences from \u003cem\u003eA. thaliana\u003c/em\u003e and Piper species as queries. The sequences encoding shikimate kinase (\u003cem\u003ePsSK\u003c/em\u003e), 3-phosphoshikimate 1-carboxyvinyl transferase (\u003cem\u003ePsEPSPase\u003c/em\u003e), chorismate synthase (\u003cem\u003ePsCS\u003c/em\u003e), chorismate mutase (\u003cem\u003ePsCM\u003c/em\u003e), aromatic-amino-acid transaminase (\u003cem\u003ePsARO8\u003c/em\u003e), prephenate dehydratase (\u003cem\u003ePsPDT\u003c/em\u003e), phenylalanine ammonia-lyase (\u003cem\u003ePsPAL\u003c/em\u003e), trans-cinnamate 4-monooxygenase (\u003cem\u003ePsC4H\u003c/em\u003e), caffeic acid 3-O-methyltransferase (\u003cem\u003ePsCAOMT\u003c/em\u003e), 4-coumarate:Coenzyme A ligase (\u003cem\u003ePs4CL\u003c/em\u003e), lysine decarboxylase (\u003cem\u003ePsLDC\u003c/em\u003e), and acyltransferases (\u003cem\u003ePsBADH\u003c/em\u003e) were retrieved from NCBI. These gene sequences were used as baits to identify homologous genes in the \u003cem\u003ePiper\u003c/em\u003e genome.\u003c/p\u003e\u003cp\u003eSubsequently, candidate genes were analyzed using the Pfam and SMART databases to verify conserved domains and motifs. Proteins with identical conserved domains were considered homologous. To identify BAHD and OMT proteins in \u003cem\u003eP. sarmentosum\u003c/em\u003e, we downloaded the Pfam seed files for OMT genes (PF00891, PF01596) and BAHD genes (PF02458, PF07247) from the Pfam database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://pfam.xfam.org/\u003c/span\u003e\u003cspan address=\"http://pfam.xfam.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). HMMER v3.0\u003csup\u003e103\u003c/sup\u003e and local BLAST were employed to search for sequences containing BADH and OMT protein domains. The identified protein sequences were aligned to remove redundant sequences. A hidden Markov model (HMM) was then reconstructed for the detected proteins, and sequences with corresponding Pfam domains were searched again. Further validation of BAHD and OMT family members was performed using the online tools SMART and CDD.\u003c/p\u003e\u003cp\u003eAlphaFold 3 performs homology modeling of the mutated sequences of \u003cem\u003ePsHCT1\u003c/em\u003e and \u003cem\u003ePsCAOMT1\u003c/em\u003e. The best model is selected based on molpdf, DOPE, and GA341 potential scores. The geometric structure and quality of the model are checked online (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://servicesn.mbi.ucla.edu/SAVES/\u003c/span\u003e\u003cspan address=\"http://servicesn.mbi.ucla.edu/SAVES/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Docking analysis is carried out using AutoDock Vina, and the results are analyzed using PyMOL software.\u003c/p\u003e\u003cp\u003e\u003cb\u003eSubcellular localization prediction and validation for\u003c/b\u003e \u003cb\u003ePsHCT1\u003c/b\u003e\u003c/p\u003e\u003cp\u003eProtComp version 9 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://linux1.softberry.com/berry.phtml\u003c/span\u003e\u003cspan address=\"http://linux1.softberry.com/berry.phtml\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to predict the subcellular localization of \u003cem\u003ePsHCT1\u003c/em\u003e (Forward Primer: ATGGGAAATGGTGATTTTAGTGTGTC; Reverse Primer: TCAAGAGTTGAATCCAAGATAGTC) by comparing them with homologous proteins of known localization and data from the LocDB and PotLocDB databases. The coding region of \u003cem\u003ePsHCT1\u003c/em\u003e was amplified from the cDNA synthesized by reverse transcription of RNA extracted from leaf samples in the RNA-seq experiment, and then cloned downstream of the 35S promoter in the pCAMBIA2300 vector to construct the \u003cem\u003ePsHCT1\u003c/em\u003e-GFP fusion gen. The Agrobacterium suspension carrying these plasmids was mixed with a plasma membrane marker (PIP2A-RFP) (OD600\u0026thinsp;=\u0026thinsp;0.6) and infiltrated into tobacco leaves. After 72 hours, GFP and RFP signals were visualized using a Zeiss LSM980 confocal fluorescence microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eStatistics and reproducibility\u003c/h2\u003e\u003cp\u003eIn this study, HiFi and HiC sequencing used for genome assembly were performed as biological replicates once. RNA-seq and metabolomic profiling were each conducted with three biological replicates. For transcript-metabolite network analysis, a correlation coefficient\u0026thinsp;\u0026gt;\u0026thinsp;0.9 or \u0026lt; -0.9, and a p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05, were used as screening criteria. Subcellular localization was also performed with three biological replicates. GO and KEGG enrichment analyses (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) were carried out using the clusterProfiler package, with multiple testing corrections applied using FDR, and the significance level was set at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05. All data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. During the manuscript preparation, we employed a large language model (ChatGPT-5) for AI-assisted text editing, primarily for grammar checking, language translation, and optimizing text expression. The AI was used solely to enhance the readability and linguistic quality of the text, and it did not participate in research design, data analysis, or content creation. The final manuscript was reviewed and approved by the authors to ensure it reflects their original work.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eReporting summary\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFurther information on research design is available in the Nature Portfolio Reporting Summary linked to this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the genome assembly and annotation files generated in this study have been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under BioProject accession number PRJNA1289360. The genome assembly files have been deposited in NCBI under accession number PRJNA1265616. The complete genome annotation files have been uploaded to the public database Figshare and can be accessed via the following link: https://doi.org/10.6084/m9.figshare.30404920.v1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe source data for Figure 1 has been uploaded to NCBI and can be accessed in the Methods section for reproducibility. The source files for Figures 2A-2D are in Supplementary Tables S5-S9. The data for Figures 2E and 2F can be obtained by downloading the genomic files shown in the figures. The source files for Figure 3 are in Supplementary Tables S10-S11, and those for Figure 4 are in Supplementary Table S12. The WGCNA result files, uncropped images for subcellular localization, and molecular docking simulation data, which are included in Figure 5, have been uploaded to the public database Figshare and can be accessed via the following link: https://doi.org/10.6084/m9.figshare.30404920.v1. The species protein data used in Figure 2A is also available on Figshare.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Guangdong Provincial Key Research and Development Program\u0026nbsp;(2022B0202110003, 2024B1212060007), the Natural Science Foundation of China (32171842), the National Key Research and Development Project of China (2019YFD1100403), and the Key Project of Central South University of Forestry and Technology (63223068). We also thank Guangzhou Yuda Biotechnology Co., Ltd. for providing sequencing and tech nical services. Special thanks to Luo Yongpeng for his assistance with language editing\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eY.J.L. conducted writing\u0026ndash;review, editing, writing original draft, software, methodology, and data curation; R.W. conducted writing\u0026ndash;original draft, data curation, and conceptualization; Y.X.Z. conducted writing\u0026ndash;original draft, data curation, and conceptualization; Y.J.W. conducted writing\u0026ndash;original draft, data curation, and conceptualization; J.L.\u0026nbsp;Writing review, editing, Writing\u0026ndash; original draft, Investigation, Funding acquisition, Conceptualization.\u0026nbsp;Y.Q.W. conducted writing\u0026ndash;original draft, supervision, project administration, funding acquisition, and conceptualization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe software and parameters used in this study are described in the Methods section. No specific custom codes or scripts were utilized. Data processing was conducted according to the manuals and protocols provided with the respective software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSupplementary information: The online version contains supplementary material available at :\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eShao, J., Liu, Y., Lv, J., Chen, X.: Alkaloid Components in Piper sarmentosum Leaves. Nat. Prod. Res. Dev. \u003cb\u003e35\u003c/b\u003e, 231\u0026ndash;235 (2023)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun, X., et al.: Piper sarmentosum Roxb.: A review on its botany, traditional uses, phytochemistry, and pharmacological activities. J. Ethnopharmacol. \u003cb\u003e263\u003c/b\u003e, 112897 (2020)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ede Azevedo, R.A., et al.: Mastoparan induces apoptosis in B16F10-Nex2 melanoma cells via the intrinsic mitochondrial pathway and displays antitumor activity in vivo. Peptides. \u003cb\u003e68\u003c/b\u003e, 113\u0026ndash;119 (2015)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBokesch, H.R., et al.: A new hypoxia inducible factor-2 inhibitory pyrrolinone alkaloid from roots and stems of Piper sarmentosum. Chem. Pharm. Bull. (Tokyo). \u003cb\u003e59\u003c/b\u003e, 1178\u0026ndash;1179 (2011)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJyothi, D., et al.: Diferuloylmethane augments the cytotoxic effects of piplartine isolated from Piper chaba. Toxicol. Vitro. \u003cb\u003e23\u003c/b\u003e, 1085\u0026ndash;1091 (2009)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGundala, S.R., et al.: Hydroxychavicol, a betel leaf component, inhibits prostate cancer through ROS-driven DNA damage and apoptosis. Toxicol. Appl. Pharmacol. \u003cb\u003e280\u003c/b\u003e, 86\u0026ndash;96 (2014)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSalehi, B., et al.: Piper Species: A Comprehensive Review on Their Phytochemistry, Biological Activities and Applications. Molecules. \u003cb\u003e24\u003c/b\u003e, 1364 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA Dictionary of the Economic: Products of the Malay Peninsula. Nature. \u003cb\u003e137\u003c/b\u003e, 255\u0026ndash;255 (1936)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbdul Rahman, N., Mohd Noor, K., Suhaimi, K.M., Kutty, F., M., Sinor, M.Z.: Piper Sarmentosum Influences The Oxidative Stress Involved In Experimental Diabetic Rats. Internet J. Herb. Plant. Med. \u003cb\u003e1\u003c/b\u003e, (2011)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChaveerach, A., Mokkamul, P., Sudmoon, R., Tanee, T.: Ethnobotany of the Genus Piper (Piperaceae) in Thailand. \u003cem\u003eEthnobotany Research and Applications\u003c/em\u003e (2006). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.semanticscholar.org/paper/Ethnobotany-of-the-Genus-Piper-(Piperaceae)-in-Chaveerach-Mokkamul/7b8de6453f12f81ffeb563c7421bc775a1ff2fcf\u003c/span\u003e\u003cspan address=\"https://www.semanticscholar.org/paper/Ethnobotany-of-the-Genus-Piper-(Piperaceae)-in-Chaveerach-Mokkamul/7b8de6453f12f81ffeb563c7421bc775a1ff2fcf\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOthman, L., Sleiman, A., Abdel-Massih, R.M.: Antimicrobial Activity of Polyphenols and Alkaloids in Middle Eastern Plants. Front. Microbiol. \u003cb\u003e10\u003c/b\u003e, 911 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCai, Y.-Z., Mei Sun, null, Jie Xing, null, Luo, Q., Corke, H.: Structure-radical scavenging activity relationships of phenolic compounds from traditional Chinese medicinal plants. \u003cem\u003eLife Sci\u003c/em\u003e 78, 2872\u0026ndash;2888 (2006)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWare, I., et al.: Comparative metabolite analysis of Piper sarmentosum organs approached by LC\u0026ndash;MS-based metabolic profiling. Nat. Prod. Bioprospect. \u003cb\u003e14\u003c/b\u003e, 30 (2024)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaliza, I.R.S., et al.: Ruthenium Complexes With Piplartine Cause Apoptosis Through MAPK Signaling by a p53-Dependent Pathway in Human Colon Carcinoma Cells and Inhibit Tumor Development in a Xenograft Model. Front. Oncol. \u003cb\u003e9\u003c/b\u003e, 582 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNiu, M., et al.: Piperlongumine is a novel nuclear export inhibitor with potent anticancer activity. Chem. Biol. Interact. \u003cb\u003e237\u003c/b\u003e, 66\u0026ndash;72 (2015)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eParama, D., et al.: The promising potential of piperlongumine as an emerging therapeutics for cancer. Explor. Target. Antitumor Ther. \u003cb\u003e2\u003c/b\u003e, 323\u0026ndash;354 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChoudhary, N., Singh, V.: A census of P. longum\u0026rsquo;s phytochemicals and their network pharmacological evaluation for identifying novel drug-like molecules against various diseases, with a special focus on neurological disorders. PLoS One. \u003cb\u003e13\u003c/b\u003e, e0191006 (2018)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBezerra, D.P., et al.: Overview of the therapeutic potential of piplartine (piperlongumine). Eur. J. Pharm. Sci. \u003cb\u003e48\u003c/b\u003e, 453\u0026ndash;463 (2013)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFincher, R.M., et al.: Inter- and Intraspecific Comparisons of Antiherbivore Defenses in Three Species of Rainforest Understory Shrubs. J. Chem. Ecol. \u003cb\u003e34\u003c/b\u003e, 558\u0026ndash;574 (2008)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePeeck, L.H., Leuth\u0026auml;usser, S., Plenio, H.: Switched Stereocontrol in Grubbs\u0026thinsp;\u0026ndash;\u0026thinsp;Hoveyda Complex Catalyzed ROMP Utilizing Proton-Switched NHC Ligands. Organometallics. \u003cb\u003e29\u003c/b\u003e, 4339\u0026ndash;4345 (2010)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRosen, E.L., Sung, D.H., Chen, Z., Lynch, V.M., Bielawski, C.W.: Olefin Metathesis Catalysts Containing Acyclic Diaminocarbenes. Organometallics. \u003cb\u003e29\u003c/b\u003e, 250\u0026ndash;256 (2010)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBlum, A.P., Ritter, T., Grubbs, R.H.: Synthesis of N-Heterocylic Carbene-Containing Metal Complexes from 2-(Pentafluorophenyl)imidazolidines. Organometallics. \u003cb\u003e26\u003c/b\u003e, 2122\u0026ndash;2124 (2007)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSanford, M.S., Love, J.A., Grubbs, R.H.: A Versatile Precursor for the Synthesis of New Ruthenium Olefin Metathesis Catalysts. Organometallics. \u003cb\u003e20\u003c/b\u003e, 5314\u0026ndash;5318 (2001)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS\u0026uuml;ssner, M., Plenio, H.: pi-Face donor properties of N-heterocyclic carbenes. Chem. Commun. (Camb). 5417\u0026ndash;5419 (2005). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1039/b512008j\u003c/span\u003e\u003cspan address=\"10.1039/b512008j\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHua, D.H., Miao, S.W., Bharathi, S.N., Katsuhira, T., Bravo, A.A.: Selective nucleophilic addition reactions of alkyllithium reagents with N-(trimethylsilyl)lactams. Synthesis of cyclic ketimines. J. Org. Chem. \u003cb\u003e55\u003c/b\u003e, 3682\u0026ndash;3684 (1990)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTian, D.-S., Zhang, X., Cox, R.J.: Comparing total chemical synthesis and total biosynthesis routes to fungal specialized metabolites. Nat. Prod. Rep. (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/D4NP00015C\u003c/span\u003e\u003cspan address=\"10.1039/D4NP00015C\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, W., Hong, B., Wang, J., Lei, X.: New Strategies in the Efficient Total Syntheses of Polycyclic Natural Products. Acc. Chem. Res. \u003cb\u003e53\u003c/b\u003e, 2569\u0026ndash;2586 (2020)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSivaranjani, R., George, J.K., Saji, K.V.: Evaluation of chemo-diversity in major Piper species for three piperamides using validated RP-HPLC method. Genet. Resour. Crop Evol. \u003cb\u003e66\u003c/b\u003e, 1635\u0026ndash;1641 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eParmar, V.S., et al.: Phytochemistry of the genus Piper. Phytochemistry. \u003cb\u003e46\u003c/b\u003e, 597\u0026ndash;673 (1997)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu, L., et al.: The chromosome-scale reference genome of black pepper provides insight into piperine biosynthesis. Nat. Commun. \u003cb\u003e10\u003c/b\u003e, 4702 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMathew, D., Valsalan, R.: The draft genome of Piper longum L. Crop Sci. \u003cb\u003e64\u003c/b\u003e, 2854\u0026ndash;2862 (2024)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, L., et al.: A high-quality apple genome assembly reveals the association of a retrotransposon and red fruit colour. Nat. Commun. \u003cb\u003e10\u003c/b\u003e, (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, S.-J., Liu, L., Yang, R., Wang, X.: Genome Size Evolution Mediated by Gypsy Retrotransposons in Brassicaceae. Genom. Proteom. Bioinform. \u003cb\u003e18\u003c/b\u003e, 321\u0026ndash;332 (2020)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou, S.-S., et al.: A comprehensive annotation dataset of intact LTR retrotransposons of 300 plant genomes. Sci. Data. \u003cb\u003e8\u003c/b\u003e, 174 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eClark, J.W., Donoghue, P.C.J.: Whole-Genome Duplication and Plant Macroevolution. Trends Plant Sci. \u003cb\u003e23\u003c/b\u003e, 933\u0026ndash;945 (2018)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQin, L., et al.: Insights into angiosperm evolution, floral development and chemical biosynthesis from the Aristolochia fimbriata genome. Nat. Plants. \u003cb\u003e7\u003c/b\u003e, 1239\u0026ndash;1253 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang, Y.: Metabolomics-based Resource Identification of Six Piper spp. Resour. Qual. Identif. (Hainan Univ. (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.27073/d.cnki.ghadu.2023.000688\u003c/span\u003e\u003cspan address=\"10.27073/d.cnki.ghadu.2023.000688\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchnabel, A., et al.: Identification and characterization of piperine synthase from black pepper, Piper nigrum L. Commun. Biol. \u003cb\u003e4\u003c/b\u003e, 1\u0026ndash;10 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ\u0026auml;ckel, L., et al.: The terminal enzymatic step in piperine biosynthesis is co-localized with the product piperine in specialized cells of black pepper (Piper nigrum L). Plant J. \u003cb\u003e111\u003c/b\u003e, 731\u0026ndash;747 (2022)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLv, Y., et al.: Metabolome profiling and transcriptome analysis filling the early crucial missing steps of piperine biosynthesis in Piper nigrum L. Plant J. \u003cb\u003e117\u003c/b\u003e, 107\u0026ndash;120 (2024)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, C., et al.: Genome-wide comparative analysis of the BAHD superfamily in seven Rosaceae species and expression analysis in pear (Pyrus bretschneideri). BMC Plant Biol. \u003cb\u003e20\u003c/b\u003e, 14 (2020)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, Z., et al.: Uncovering the Role of Hydroxycinnamoyl Transferase in Boosting Chlorogenic Acid Accumulation in Carthamus tinctorius Cells under Methyl Jasmonate Elicitation. Int. J. Mol. Sci. \u003cb\u003e25\u003c/b\u003e, 2710 (2024)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBassard, J.-E., et al.: Protein\u0026ndash;Protein and Protein\u0026ndash;Membrane Associations in the Lignin Pathway. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://dx.doi.org/10.1105/tpc.112.102566\u003c/span\u003e\u003cspan address=\"10.1105/tpc.112.102566\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAdib, A.M., et al.: The metabolites of Piper sarmentosum and their biological properties: a recent update. Phytochem Rev. (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11101-024-09930-2\u003c/span\u003e\u003cspan address=\"10.1007/s11101-024-09930-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang, J., et al.: DNA gains and losses in gigantic genomes do not track differences in transposable element-host silencing interactions. Commun. Biol. \u003cb\u003e8\u003c/b\u003e, 704 (2025)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCheng, L., et al.: Genome assembly of Stewartia sinensis reveals origin and evolution of orphan genes in Theaceae. Commun. Biol. \u003cb\u003e8\u003c/b\u003e, 354 (2025)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGalindo-Gonz\u0026aacute;lez, L., Mhiri, C., Deyholos, M.K., Grandbastien: M.-A. LTR-retrotransposons in plants: Engines of evolution. Gene. \u003cb\u003e626\u003c/b\u003e, 14\u0026ndash;25 (2017)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGrandbastien, M.-A.: LTR retrotransposons, handy hitchhikers of plant regulation and stress response. Biochim. et Biophys. Acta (BBA) - Gene Regul. Mech. \u003cb\u003e1849\u003c/b\u003e, 403\u0026ndash;416 (2015)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun, W., Xu, Z., Song, C., Chen, S.: Herbgenomics: Decipher molecular genetics of medicinal plants. Innov. (Camb). \u003cb\u003e3\u003c/b\u003e, 100322 (2022)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVs, G., Pepper: - chemistry, technology, and quality evaluation. CRC Crit. reviews food Sci. Nutr. \u003cb\u003e9\u003c/b\u003e, (1977)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRajopadhye, A.A., Namjoshi, T.P., Upadhye, A.S.: Rapid validated HPTLC method for estimation of piperine and piperlongumine in root of Piper longum extract and its commercial formulation. Rev. bras. farmacogn. \u003cb\u003e22\u003c/b\u003e, 1355\u0026ndash;1361 (2012)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVanholme, R., De Meester, B., Ralph, J., Boerjan, W.: Lignin biosynthesis and its integration into metabolism. Curr. Opin. Biotechnol. \u003cb\u003e56\u003c/b\u003e, 230\u0026ndash;239 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYamada, Y., Sato, F.: Transcription Factors Alkaloid Eng. Biomolecules. \u003cb\u003e11\u003c/b\u003e, 1719 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu, W., Dubos, C., Lepiniec, L.: Transcriptional control of flavonoid biosynthesis by MYB\u0026ndash;bHLH\u0026ndash;WDR complexes. Trends Plant Sci. \u003cb\u003e20\u003c/b\u003e, 176\u0026ndash;185 (2015)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHao, Y., Zong, X., Ren, P., Qian, Y., Fu, A.: Basic Helix-Loop-Helix (bHLH) Transcription Factors Regulate a Wide Range of Functions in Arabidopsis. Int. J. Mol. Sci. \u003cb\u003e22\u003c/b\u003e, 7152 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePrakash, P., Kumar, R., Gupta, V.: Chapter 9 - The regulatory aspects of plant transcription factors in alkaloids biosynthesis and pathway modulation. in \u003cem\u003ePlant Transcription Factors\u003c/em\u003e (eds Srivastava, V., Mishra, S., Mehrotra, S. \u0026amp; Upadhyay, S. K.) 199\u0026ndash;217Academic Press, (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/B978-0-323-90613-5.00019-4\u003c/span\u003e\u003cspan address=\"10.1016/B978-0-323-90613-5.00019-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou, Z., et al.: Targeting cofactors regeneration in methylation and hydroxylation for high level production of Ferulic acid. Metab. Eng. \u003cb\u003e73\u003c/b\u003e, 247\u0026ndash;255 (2022)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, R., et al.: De novo biosynthesis of plant lignans by synthetic yeast consortia. Nat. Chem. Biol. (2025). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41589-025-01861-z\u003c/span\u003e\u003cspan address=\"10.1038/s41589-025-01861-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFisyuk, A., Poendaev, N.: Synthesis of 5,6-Dihydropyridin-2(1H)-ones, 1,5,6,8,8a-Hexahydroisoquinolin-3(2H)-ones and 4a,5,6,7,8,8a-Hexahydroquinolin-2(1H)-ones by Intramolecular Wittig Reaction. Molecules. \u003cb\u003e7\u003c/b\u003e, 124\u0026ndash;128 (2002)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFisyuk, A.S., Poendaev, N.V., Bundel\u0026rsquo;, Y.G.: A new route for the synthesis of 5,6-dihydropyridin-2(1H)-ones, 2-pyridones and (4-hydroxy-2-oxopiperid-3-yl) pyridinium chlorides by intramolecular cyclization of N-3-oxoalkylchloroacetamide derivatives. Mendeleev Commun. \u003cb\u003e8\u003c/b\u003e, 12\u0026ndash;13 (1998)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCui, J., et al.: Telomere-to-telomere Phragmites australis reference genome assembly with a B chromosome provides insights into its evolution and polysaccharide biosynthesis. Commun. Biol. \u003cb\u003e8\u003c/b\u003e, 73 (2025)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, X.-Y., et al.: Optimization and quality control of genome-wide Hi-C library preparation. Yi Chuan. \u003cb\u003e39\u003c/b\u003e, 847\u0026ndash;855 (2017)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSim, S.B., Corpuz, R.L., Simmonds, T.J., Geib, S.M.: HiFiAdapterFilt, a memory efficient read processing pipeline, prevents occurrence of adapter sequence in PacBio HiFi reads and their negative impacts on genome assembly. BMC Genom. \u003cb\u003e23\u003c/b\u003e, 157 (2022)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMar\u0026ccedil;ais, G., Kingsford, C.: A fast, lock-free approach for efficient parallel counting of occurrences of k-mers. Bioinformatics. \u003cb\u003e27\u003c/b\u003e, 764\u0026ndash;770 (2011)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVurture, G.W., et al.: GenomeScope: fast reference-free genome profiling from short reads. Bioinformatics. \u003cb\u003e33\u003c/b\u003e, 2202\u0026ndash;2204 (2017)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCheng, H., Concepcion, G.T., Feng, X., Zhang, H., Li, H.: Haplotype-resolved de novo assembly using phased assembly graphs with hifiasm. Nat. Methods. \u003cb\u003e18\u003c/b\u003e, 170\u0026ndash;175 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWalker, B.J., et al.: Pilon: An Integrated Tool for Comprehensive Microbial Variant Detection and Genome Assembly Improvement. PLOS ONE. \u003cb\u003e9\u003c/b\u003e, e112963 (2014)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRoach, M.J., Schmidt, S.A., Borneman, A.R.: Purge Haplotigs: allelic contig reassignment for third-gen diploid genome assemblies. BMC Bioinform. \u003cb\u003e19\u003c/b\u003e, 460 (2018)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu, J., et al.: NextDenovo: an efficient error correction and accurate assembly tool for noisy long reads. Genome Biol. \u003cb\u003e25\u003c/b\u003e, 107 (2024)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu, M., et al.: TGS-GapCloser: A fast and accurate gap closer for large genomes with low coverage of error-prone long reads. Gigascience. \u003cb\u003e9\u003c/b\u003e, giaa094 (2020)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDurand, N.C., et al.: Juicer Provides a One-Click System for Analyzing Loop-Resolution Hi-C Experiments. Cell. Syst. \u003cb\u003e3\u003c/b\u003e, 95\u0026ndash;98 (2016)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLoescher, S., Groeer, S., Walther, A.: 3D DNA Origami Nanoparticles: From Basic Design Principles to Emerging Applications in Soft Matter and (Bio-)Nanosciences. Angew Chem. Int. Ed. Engl. \u003cb\u003e57\u003c/b\u003e, 10436\u0026ndash;10448 (2018)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRobinson, J.T., et al.: Juicebox.js Provides a Cloud-Based Visualization System for Hi-C Data. Cell. Syst. \u003cb\u003e6\u003c/b\u003e, 256\u0026ndash;258e1 (2018)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWolff, J., et al.: Galaxy HiCExplorer 3: a web server for reproducible Hi-C, capture Hi-C and single-cell Hi-C data analysis, quality control and visualization. Nucleic Acids Res. \u003cb\u003e48\u003c/b\u003e, W177\u0026ndash;W184 (2020)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSim\u0026atilde;o, F.A., Waterhouse, R.M., Ioannidis, P., Kriventseva, E.V., Zdobnov, E.M.: BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics. \u003cb\u003e31\u003c/b\u003e, 3210\u0026ndash;3212 (2015)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi, H.: Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics. \u003cb\u003e34\u003c/b\u003e, 3094\u0026ndash;3100 (2018)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOu, S., Jiang, N., LTR_retriever:: A Highly Accurate and Sensitive Program for Identification of Long Terminal Repeat Retrotransposons. Plant. Physiol. \u003cb\u003e176\u003c/b\u003e, 1410\u0026ndash;1422 (2018)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRhie, A., Walenz, B.P., Koren, S., Phillippy, A.M.: Merqury: reference-free quality, completeness, and phasing assessment for genome assemblies. Genome Biol. \u003cb\u003e21\u003c/b\u003e, 245 (2020)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTarailo-Graovac, M., Chen, N.: Using RepeatMasker to identify repetitive elements in genomic sequences. \u003cem\u003eCurr Protoc Bioinformatics Chap. 4\u003c/em\u003e, 4.10.1\u0026ndash;4.10.14 (2009)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFlynn, J.M., et al.: RepeatModeler2 for automated genomic discovery of transposable element families. Proc. Natl. Acad. Sci. U S A. \u003cb\u003e117\u003c/b\u003e, 9451\u0026ndash;9457 (2020)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, R.-G., et al.: TEsorter: an accurate and fast method to classify LTR-retrotransposons in plant genomes. Hortic. Res. \u003cb\u003e9\u003c/b\u003e, uhac017 (2022)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKatoh, K., Standley, D.M.: MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. \u003cb\u003e30\u003c/b\u003e, 772\u0026ndash;780 (2013)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePrice, M.N., Dehal, P.S., Arkin, A.P.: FastTree 2\u0026ndash;approximately maximum-likelihood trees for large alignments. PLoS One. \u003cb\u003e5\u003c/b\u003e, e9490 (2010)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGabriel, L., et al.: BRAKER3: Fully automated genome annotation using RNA-seq and protein evidence with GeneMark-ETP, AUGUSTUS and TSEBRA. \u003cem\u003ebioRxiv\u003c/em\u003e 06.10.544449 (2024) (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/2023.06.10.544449\u003c/span\u003e\u003cspan address=\"10.1101/2023.06.10.544449\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBurge, C., Karlin, S.: Prediction of complete gene structures in human genomic DNA. J. Mol. Biol. \u003cb\u003e268\u003c/b\u003e, 78\u0026ndash;94 (1997)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMajoros, W.H., Pertea, M., Salzberg, S.L.: TigrScan and GlimmerHMM: two open source ab initio eukaryotic gene-finders. Bioinformatics. \u003cb\u003e20\u003c/b\u003e, 2878\u0026ndash;2879 (2004)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKeilwagen, J., Hartung, F., Grau, J., GeMoMa: Homology-Based Gene Prediction Utilizing Intron Position Conservation and RNA-seq Data. \u003cem\u003eMethods Mol Biol\u003c/em\u003e 161\u0026ndash;177 (2019). (1962)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHaas, B.J., et al.: Automated eukaryotic gene structure annotation using EVidenceModeler and the Program to Assemble Spliced Alignments. Genome Biol. \u003cb\u003e9\u003c/b\u003e, R7 (2008)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRiehl, K., Riccio, C., Miska, E.A., Hemberg, M.: TransposonUltimate: software for transposon classification, annotation and detection. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://dx.doi.org/10.1093/nar/gkac136\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkac136\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCantalapiedra, C.P., Hern\u0026aacute;ndez-Plaza, A., Letunic, I., Bork, P., Huerta-Cepas, J.: eggNOG-mapper v2: Functional Annotation, Orthology Assignments, and Domain Prediction at the Metagenomic Scale. Mol. Biol. Evol. \u003cb\u003e38\u003c/b\u003e, 5825\u0026ndash;5829 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEmms, D.M., Kelly, S.: OrthoFinder: phylogenetic orthology inference for comparative genomics. Genome Biol. \u003cb\u003e20\u003c/b\u003e, 238 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStamatakis, A.: RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. \u003cb\u003e30\u003c/b\u003e, 1312\u0026ndash;1313 (2014)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePuttick, M.N.: MCMCtreeR: functions to prepare MCMCtree analyses and visualize posterior ages on trees. Bioinformatics. \u003cb\u003e35\u003c/b\u003e, 5321\u0026ndash;5322 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKumar, S., et al.: TimeTree 5: An Expanded Resource for Species Divergence Times. Mol. Biol. Evol. \u003cb\u003e39\u003c/b\u003e, msac174 (2022)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMendes, F.K., Vanderpool, D., Fulton, B., Hahn: M. W. CAFE 5 models variation in evolutionary rates among gene families. Bioinformatics. \u003cb\u003e36\u003c/b\u003e, 5516\u0026ndash;5518 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBuchfink, B., Xie, C., Huson, D.H.: Fast and sensitive protein alignment using DIAMOND. Nat. Methods. \u003cb\u003e12\u003c/b\u003e, 59\u0026ndash;60 (2015)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang, Y., et al.: MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. \u003cb\u003e40\u003c/b\u003e, e49 (2012)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun, P., et al.: A user-friendly toolkit for evolutionary analyses of whole-genome duplications and ancestral karyotypes. Mol. Plant. \u003cb\u003e15\u003c/b\u003e, 1841\u0026ndash;1851 (2022)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, S., Zhou, Y., Chen, Y., Gu, J.: fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. \u003cb\u003e34\u003c/b\u003e, i884\u0026ndash;i890 (2018)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim, D., Langmead, B., Salzberg, S.L.: HISAT: a fast spliced aligner with low memory requirements. Nat. Methods. \u003cb\u003e12\u003c/b\u003e, 357\u0026ndash;360 (2015)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLangfelder, P., Horvath, S.: WGCNA: an R package for weighted correlation network analysis. BMC Bioinform. \u003cb\u003e9\u003c/b\u003e, 559 (2008)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu, T., et al.: clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innov. (Camb). \u003cb\u003e2\u003c/b\u003e, 100141 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePotter, S.C., et al.: HMMER web server: 2018 update. Nucleic Acids Res. \u003cb\u003e46\u003c/b\u003e, W200\u0026ndash;W204 (2018)\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Alkaloids biosynthesis, WGCNA, Whole-genome duplication, Medicinal plants, HCT, CCoAOMT","lastPublishedDoi":"10.21203/rs.3.rs-6556353/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6556353/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003ePiper sarmentosum\u003c/em\u003e Roxb. is a significant medicinal and edible plant, and its active compound piperlongumine (PL) has garnered attention due to its pharmacological activities, including anticancer and anti-inflammatory effects. However, the key enzymes and regulatory mechanisms of its biosynthetic pathway are not yet fully understood. In this study, we generated a chromosome-level genome assembly, with a contig N50 of 15.36 Mb and a scaffold N50 of 22.52 Mb. The BUSCO assessment indicated high completeness, with a score of 97.4%. Genome annotation revealed 39,154 protein-coding genes and identified three lineage-specific whole-genome duplication (WGD) events that expanded gene families associated with alkaloid biosynthesis. Metabolomic analysis identified 4,456 metabolites, including 238 alkaloids, and demonstrated that flowers and fruits are the primary organs for PL biosynthesis. Molecular docking and the correlation of gene expression with levels of PL suggest that \u003cem\u003ePsHCT1\u003c/em\u003e catalyzes the condensation of sinapoyl-CoA and 5,6-dihydropyridinone, while \u003cem\u003ePsCCoAOMT1\u003c/em\u003e is responsible for the final synthesis of PL. This study provides insights into the mechanism of alkaloid biosynthesis in \u003cem\u003eP. sarmentosum\u003c/em\u003e and may help lay the groundwork for enhancing the production of medicinal compounds.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e","manuscriptTitle":"A chromosome-level genome assembly and multi-omics analyses provide insights into the biosynthesis of piperlongumine in Piper sarmentosum","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-10 11:14:13","doi":"10.21203/rs.3.rs-6556353/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"51bca1ab-3db5-4a5f-8664-22cbc13434ee","owner":[],"postedDate":"November 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":57636785,"name":"Biological sciences/Plant sciences/Plant genetics/Genome duplication"},{"id":57636786,"name":"Biological sciences/Plant sciences/Plant genetics/Genome duplication"},{"id":57636787,"name":"Biological sciences/Plant sciences/Plant genetics/Genome duplication"},{"id":57636788,"name":"Biological sciences/Plant sciences/Plant genetics/Genome duplication"},{"id":57636789,"name":"Biological sciences/Plant sciences/Plant genetics/Genome duplication"}],"tags":[],"updatedAt":"2026-02-06T08:06:22+00:00","versionOfRecord":{"articleIdentity":"rs-6556353","link":"https://doi.org/10.1038/s42003-025-09448-z","journal":{"identity":"communications-biology","isVorOnly":false,"title":"Communications Biology"},"publishedOn":"2026-01-03 05:00:00","publishedOnDateReadable":"January 3rd, 2026"},"versionCreatedAt":"2025-11-10 11:14:13","video":"","vorDoi":"10.1038/s42003-025-09448-z","vorDoiUrl":"https://doi.org/10.1038/s42003-025-09448-z","workflowStages":[]},"version":"v1","identity":"rs-6556353","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6556353","identity":"rs-6556353","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.