The type I and III interferon responses restrict infection with tick-borne orthoflaviviruses through IFI6

The type I and III interferon responses restrict infection with tick-borne orthoflaviviruses through IFI6 | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results The type I and III interferon responses restrict infection with tick-borne orthoflaviviruses through IFI6 View ORCID Profile Felix Streicher , View ORCID Profile Devin Kenney , View ORCID Profile Vincent Caval , View ORCID Profile Maxime Chazal , View ORCID Profile Sophie-Marie Aicher , View ORCID Profile Ségolène Gracias , View ORCID Profile Ferdinand Roesch , View ORCID Profile Florian Douam , View ORCID Profile Nolwenn Jouvenet doi: https://doi.org/10.1101/2025.04.06.647422 Felix Streicher 1 Institut Pasteur, Université Paris Cité, CNRS UMR 3569, Virus sensing and signaling Unit , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Felix Streicher Devin Kenney 2 Department of Virology, Immunology and Microbiology, Boston University School of Medicine , Boston, MA, USA 3 National Emerging Infectious Diseases Laboratories, Boston University , Boston, MA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Devin Kenney Vincent Caval 1 Institut Pasteur, Université Paris Cité, CNRS UMR 3569, Virus sensing and signaling Unit , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Vincent Caval Maxime Chazal 1 Institut Pasteur, Université Paris Cité, CNRS UMR 3569, Virus sensing and signaling Unit , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Maxime Chazal Sophie-Marie Aicher 1 Institut Pasteur, Université Paris Cité, CNRS UMR 3569, Virus sensing and signaling Unit , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Sophie-Marie Aicher Ségolène Gracias 1 Institut Pasteur, Université Paris Cité, CNRS UMR 3569, Virus sensing and signaling Unit , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Ségolène Gracias Ferdinand Roesch 4 UMR 1282 Infectiologie et Santé Publique, Inrae Centre Val de Loire , Nouzilly, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Ferdinand Roesch Florian Douam 2 Department of Virology, Immunology and Microbiology, Boston University School of Medicine , Boston, MA, USA 3 National Emerging Infectious Diseases Laboratories, Boston University , Boston, MA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Florian Douam Nolwenn Jouvenet 1 Institut Pasteur, Université Paris Cité, CNRS UMR 3569, Virus sensing and signaling Unit , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Nolwenn Jouvenet For correspondence: nolwenn.jouvenet{at}pasteur.fr Abstract Full Text Info/History Metrics Preview PDF Abstract Tick-borne orthoflaviviruses (TBOVs) are a growing global health concern. Several representatives of this viral family cause fatal disease in humans with increasing case numbers throughout the last decades. The innate immune response, especially interferon (IFN)-dependent signaling, is an essential part of the human defense system that counteracts infection with TBOVs and other viruses. Even though they activate the same signaling cascade, IFNs belonging to the type I and III families trigger differing gene expression patterns. Which genes the two IFN families induce to restrict infection with TBOVs remains poorly characterized. Here we show that type I and III IFNs are both capable of restricting TBOV infection of human cell lines in a cell type-specific manner. Infection of C57BL/6J mice with knockouts for either IFN type I or III receptors further underscored the critical role of IFN signaling in controlling TBOV replication in vivo . To assess the contribution of single genes to controlling TBOV infection in human cells, we used a CRISPR/Cas9-KO-based screening approach. This strategy identified IFI6 as a central player for IFN type I- and III-driven responses against TBOVs. We further defined IFI6 as an ER-resident protein that restricts TBOV replication at a post-entry step. Our work thus opens new perspectives for targeting weak points in the life cycle of TBOVs and other orthoflaviviruses, potentially paving the way for the development of new antiviral therapeutics. One Sentence Summary Type I and III interferons are crucial for protection against tick-borne orthoflavivirus infection in vitro and in vivo , both relying on IFI6 as a main antiviral effector. INTRODUCTION Tick-borne orthoflaviviruses (TBOVs) are enveloped viruses with a 10-11kb long, single-stranded positive-sense RNA genome encoding for three structural (Capsid (C), Membrane (M) and Envelope (E)) and 7 non-structural (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5) proteins ( 1 ). Much like their more extensively studied mosquito-borne relatives, such as Zika virus (ZIKV), Dengue virus (DENV) or yellow fever virus (YFV), TBOVs pose a major threat to global health ( 1 – 4 ). Several TBOVs cause severe diseases in humans and can be divided into viruses that primarily induce hemorrhagic or neuronal pathology. Members of the latter, such as tick-borne encephalitis virus (TBEV), Powassan virus (POWV), or Louping-ill virus (LIV), infect the human central nervous system (CNS) and cause long-term neurological damage or death ( 3 , 5 – 7 ). They are transmitted by a variety of mostly hard-bodied ticks of predominantly Ixodes and Dermacentor spp . that are distributed worldwide with a geographical preference for the temperate zone of the northern hemisphere ( 2 , 3 ). Although most human infections occur through tick bites, numerous cases of TBOV infection after ingestion of unpasteurized milk stemming from infected livestock such as sheep and goats have been reported in humans ( 8 , 9 ). As of 2025, TBEV, the prototypical neuropathogenic TBOV that is responsible for the most severe infections in humans, is the only TBOV against which a vaccine was approved for use in humans. Despite this, the incidence of TBEV-induced cases of severe disease steeply increased throughout the last decades ( 10 – 12 ). This is linked to a constant expansion of the habitats of the vector tick species and low vaccination rates, but also results from the lack of antiviral treatment options against TBOVs ( 7 , 13 , 14 ). To counteract the continuous rise in the number of patients suffering from severe disease caused by these emerging pathogens, alternative strategies against TBOVs need to be explored. The first line of defense against pathogenic intruders in eukaryotes is the innate immune system ( 15 ). The mammalian innate immune system has evolved to rapidly control virus replication by inducing the expression of antiviral cytokines like type I and III interferons (IFNs). Upon secretion by infected cells, IFN type I (IFNα, IFNβ) and type III (IFNλ, also known as IL29, IL28A and IL28B) bind to their heterodimeric receptors, IFNAR1/IFNAR2 and IFNλR1/IL-10R2, respectively, and activate the canonical JAK/STAT pathway in infected and surrounding cells ( 16 ). Activation of this pathway results in the expression of a plethora of IFN-stimulated genes (ISGs) that concertedly establish an antiviral state in the cells. ISGs comprise a core set of genes that, upon stimulation, are induced at high levels in all cell types across mammalian species ( 17 ). Certain ISGs directly block the viral life cycle by targeting specific stages of virus replication, including entry into host cells, protein translation, replication, or assembly of new viral particles ( 18 ). While some ISGs display virus-(or viral family-) specific antiviral activity, others exhibit broad-spectrum antiviral functions. Furthermore, ISGs are also involved in the regulation of IFN signaling and thus are key for facilitating the return to cellular homeostasis. However, the contribution of most ISGs to the modulation of viral infection and replication remains poorly characterized ( 18 ). Despite both activating the JAK/STAT pathway, IFN-I and IFN-III stimulate ISGs with different kinetics and potency, and in a cell type-dependent manner ( 19 – 22 ). These differences are likely connected to the abundance of type I or III receptor complexes expressed at the surface of different cell types ( 21 ). While type I IFNs and their receptors are ubiquitously expressed and robust inducers of the antiviral state in most cell types, type III IFN receptor complexes are expressed in a limited set of cell types, mainly in cells that compose mucosal surface tissues, like the lung or the gut ( 23 – 26 ). The importance of IFN-I signaling in controlling TBOV infections was previously established both in several distinct human cell types in vitro and in various murine models in vivo ( 6 , 27 – 36 ). In contrast, the antiviral potential of type III IFNs against TBOVs remains unknown. In addition, although the antiviral activities of IFN-I against TBOVs are documented, their effectors are poorly characterized. Aiming to clarify this, we investigated the impact of IFN-I and -III on TBOV replication in vitro and in vivo and performed the first CRISPR/Cas9 knock-out genetic screen for this viral family to identify which IFN-induced effector(s) contribute(s) to the anti-TBOV state in human cells. RESULTS Human cell lines derived from tissues with physiological relevance to TBOV pathogenesis are susceptible to infection with two TBOVs The transmission of TBOVs to humans can occur either through tick bite or ingestion of unpasteurized milk from infected animals ( 3 , 7 , 9 ). The latter marks cells of the intestinal epithelium as potential first targets of TBOV infections following oral transmission, which has been sparsely investigated to date ( 37 ). Independent of the transmission route, viral replication in neurons constitutes an essential part of the pathogenesis of neurotropic TBOVs ( 38 ). Thus, we selected human colorectal adenocarcinoma (Caco2) and medulloblastoma (DAOY) cells as human cell lines to study TBOV replication, since both were previously reported to be susceptible to TBEV ( 37 , 30 ). Caco2 and DAOY cells were infected with TBEV (strain Hypr) at a multiplicity of infection (MOI) of 0.1. Viral replication was monitored over time by analyzing the expression of the viral protein NS5 through immunofluorescence imaging at 24 and 48 h post-infection (hpi) ( Fig.1A ). Both cell lines were susceptible to TBEV, with an increase in NS5-positive cells over time ( Fig.1A ). In line with this, flow cytometric analysis using pan-orthoflavivirus anti-E antibodies revealed that while about 15% of Caco2 and 10% of DAOY cells were infected at 24 hpi, this increased to 55% and 45%, respectively, at 48 hpi ( Fig.1B ). Consistently, assessment of viral replication by RT-qPCR analysis showed significant increase of viral RNA over time ( Fig.1C ), further indicating robust TBEV replication in both cell lines. To assess whether these two cell lines were susceptible to other members of the TBOV group, they were infected with POWV (strain LB) at an MOI of 5. About 3 to 6 % of Caco2 and DAOY cells were positive for viral E proteins at 48 hpi ( Fig.1D ). Viral RNA yields increased over time ( Fig.1E ), further indicating viral replication. However, viral RNA abundances were about two logs lower in POWV-infected cells than in TBEV-infected cells ( Fig.1C and E ). In sum, despite disparities, Caco2 and DAOY cells were susceptible to TBEV and POWV. This validates these cell lines as useful models approximating tissues with physiological relevance to TBOV pathogenesis. Download figure Open in new tab Fig. 1. Type I and III IFNs protect human cell lines with physiological relevance against infection with TBOVs in a cell type-specific manner. (A) Confocal microscopy analysis of human colorectal adenocarcinoma (Caco2) or medulloblastoma cells (DAOY) infected with TBEV-Hypr at an MOI of 0.1. Twenty-four and forty-eight hours post-infection, cells were fixed, stained for TBEV-NS5 protein (red), and their nuclei stained with DAPI (blue). Scale bar 30 µm. Images are representative of two independent experiments. (B-E) Caco2 or DAOY cells were infected with either TBEV-Hypr (MOI 0.1) or POWV-LB (MOI 5) and monitored for percentage of infected cells via cytometric analysis after staining for orthoflaviviral E protein (B, D) or for relative amounts of viral RNA, expressed as genome equivalents (GE), via RT-qPCR analysis (C, E) at 24 and 48 hpi. (F) RT-qPCR analysis of mRNA levels of different interferons in Caco2 or DAOY cells infected with TBEV-Hypr at an MOI 1 for 24 or 48 h. (G) Caco2 or DAOY cells were treated with either recombinant human IFNα2 (50 U/mL, orange) or IFNλ1 (20 ng/mL, blue) for 16 h and assessed for IFITM3 expression via RT-qPCR. (H, I) Cytometry-based analysis of infection levels in Caco2 and DAOY cells treated with either IFNα2 (50 U/mL, orange) or IFNλ1 (20 ng/mL, blue) for 16 h and infected with either TBEV-Hypr (MOI 1, I ) or POWV-LB (MOI 5, J) for 24h. Cells were stained for orthoflaviviral envelope protein. (K) Caco2 or DAOY cells were treated with IFNα2 (50 u/mL, orange) or IFNλ1 (20 ng/mL, blue) for 4, 24, 48, or 72 h and infected with TBEV-Hypr (MOI 1) for 24 h before being stained for orthoflaviviral envelope protein and subjected to cytometry-based analysis for infection levels. (L) The abundance of IFNAR1 and IFNLR1 in cells of the Caco2 and DAOY cell lines as archived in the human protein atlas database (https://www.proteinatlas.org/ENSG00000142166-IFNAR1/cell+line; https://www.proteinatlas.org/ENSG00000185436-IFNLR1/cell+line) displayed as nTPM (transcripts per million). Data (C-K) from three independent experiments ± SEM. ns = non-significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 by unpaired, two-tailed t-test (C-F) or two-way ANOVA with Sidak post-test (I-K) . Type I and III IFNs protect human cell lines against infection with TBOVs in a cell type-specific manner Type I IFNs were previously shown to have a protective effect against several TBOVs in vitro ( 6 , 27 , 30 , 34 ). In contrast, the antiviral potential of the type III IFN family against TBOVs remains poorly characterized. We examined mRNA abundance of four IFN genes ( IFNA2 , IFNB , IFNL1, and IFNL2/3) in TBEV-infected cells at 24 and 48 hpi. Type III IFN upregulation surpassed type I IFN upregulation in TBEV-infected Caco2 and DAOY cells at both time points ( Fig. 1G ), potentially indicating an important role for type III IFNs in the antiviral response against TBOVs. To investigate whether Caco2 and DAOY cells respond differently to the two families of IFNs, the cells were treated with recombinant human IFNα2 or IFNλ1. Examination of the mRNA levels of IFITM3 , a conserved ISG known to block orthoflaviviral replication ( 17 , 39 , 40 ), revealed that the highest induction was achieved with IFNλ1 treatment in Caco2 cells, whereas expression was more rapid but of lower magnitude after IFNα2 treatment in DAOY cells ( Fig. 1H ). To assess whether these differences translate into different levels of protection in Caco2 and DAOY cells, both cell lines were infected with TBEV after 16 hours of IFNα2 or IFNλ1treatment and the percentage of cells positive for viral E protein was assessed by flow cytometric analysis ( Fig.1I ). In line with stronger IFITM3 -induction by IFN-III than IFN-I ( Fig. 1H ), Caco2 cells were protected against infection with TBEV following IFNλ1 treatment to around 90% compared to IFNα2 treatment, which protected only 50% of the cells from infection ( Fig.1I ). By contrast, DAOY cells mounted a stronger antiviral defense after exposure to IFNα2 compared to IFNλ1, correlating with the enhanced IFITM3 induction by IFN-I previously observed in this cell line ( Fig.1H ). Similar trends of IFN protection were observed when cells were infected with POWV ( Fig.1J ). However, since POWV replicated at lower levels as compared to TBEV ( Fig.1B-E ), the differences in infection phenotype between IFN-treated cells and non-treated ones were more subtle. Due to the variations in the kinetics of the ISG response following stimulation by the distinct IFN families in the two cellular models ( Fig.1K ), we also examined the protective effect of IFNα2 and IFNλ1 against TBEV infection after various periods of pre-treatment. Caco2 cells were better protected by IFNλ1 than IFNα2 pre-treatment against infection with TBEV, independently of the timing ( Fig.1K ). At earlier times post-treatment, DAOY cells were better protected by IFNα2 than by IFNλ1 ( Fig.1K ). However, after extended incubation times, the two treatments triggered the same protective state ( Fig.1K ). To assess whether the varying degrees of protection were linked to the expression of the IFN receptor complexes in the two cell types, transcriptomic data from the human protein atlas were exploited ( 45 ). While Caco2 cells present a higher relative expression of IFNLR1 , as compared to DAOY cells, DAOY cells express comparatively more IFNAR1 than Caco2 cells ( Fig.1L ). This suggests that the abundance of receptors indeed influences the responsiveness to different IFN types and subsequently, the ability to control viral replication. Altogether, this data shows that both type I and III IFNs mount an effective antiviral state against TBEV and POWV in Caco2 and DAOY cells with cell type-specific differences in potency of the antiviral response, which is likely related to the expression level of IFN receptors. IFN responses delay POWV-induced death in C57BL/6J mice While few studies exploring the role of type I IFN signaling in TBOV infection in mice were conducted ( 29 , 37 , 41 ), it remains unknown to what extent type III IFNs are involved in the antiviral defense against TBOVs in vivo . We aimed to determine whether a lack of IFN-I signaling alone, or a lack of both IFN-I and IFN-III signaling, influences TBOV disease outcome and viral dissemination in mice. To do so, C57BL/6J mice genotyped as either WT, Ifnar1 -/- , or Ifnar1 -/- Ifnlr1 -/- were infected with POWV (10 3 FFU) via subcutaneous injection into the footpad ( Fig.2A, B ). The survival rates of the infected mice were monitored for a 17-day period ( Fig.2A ), and viral titers in the sera were estimated through plaque assay at 2 dpi ( Fig.2B ). PBS-injected control mice survived the complete experiment without developing any clinical signs, independent of their genotype ( Fig.2A ). The majority of WT C57BL/6J exhibited an 80% mortality rate after 16 days of infection ( Fig.2A ). All Ifnar1 -/- mice rapidly succumbed to infection, some as early as 3 dpi, and at the latest at 4 dpi ( Fig.2A ). Similarly, Ifnar1 -/- Ifnlr1 -/- mice died four days after injection of POWV ( Fig.2A ). Titration of infectious POWV particles in the sera of Ifnar1 -/- or Ifnar1 -/- Ifnlr1 -/- mice two days after footpad injection yielded viral titers with no apparent difference between the two murine genotypes ( Fig.2B ). Therefore, following subcutaneous infection, Ifnar1 -/- and Ifnar1 -/- Ifnlr1 -/- mice were both hypersusceptible to POWV but exhibit no difference in terms of probability of survival or systemic viral titer. This suggests that IFN-I signaling supersedes IFN-III signaling in controlling POWV infection upon subcutaneous injection. Download figure Open in new tab Fig. 2. Ifnar1 -/- and Ifnar1 -/- Ifnlr1 -/- mice are hypersusceptible to POWV infection. (A) Survival of WT (black), Ifnar1 -/- (orange), and Ifnar1 -/- Ifnlr1 -/- (blue) C57BL/6J mice (5-10 per group) following subcutaneous POWV-LB infection with 10 3 FFU or WT and Ifnar1 -/- (grey, 2-3 per group) after administration of PBS as a control. (B) Titration of infectious viral particles in the sera of WT (black), Ifnar1 -/- (orange), and Ifnar1 -/- Ifnlr1 -/- (blue) C57BL/6J mice subcutaneously infected with 10 3 FFU of POWV-LB (5-9 per group), as determined 2 dpi via plaque assay. (C) Survival of WT (black), Ifnar1 -/- (orange), and Ifnar1-/- Ifnlr1-/- (blue) C57BL/6J mice (5-9 per group) following POWV-LB infection with 10 5 FFU through oral gavage or WT and Ifnar1 -/- (grey, 2-3 per group) after administration of PBS as a control. (D) Titration of infectious viral particles in the sera of WT (black), Ifnar1 -/- (orange), and Ifnar1 -/- Ifnlr1 -/- (blue) C57BL/6J mice orally infected with 10 5 FFU of POWV-LB (4-8 per group), as determined 2 dpi via plaque assay. The figure was created using Biorender.com. Our in vitro experiments using the Caco2 cell line suggest that cells of epithelial barrier tissues may respond more robustly to IFN-III treatment than IFN-I ( Fig.1H ). To test whether this translates to a crucial role of type III IFN-signaling in infection with TBOVs through ingestion, WT, Ifnar1 -/- , or Ifnar1 -/- Ifnlr1 -/- C57BL/6J mice were infected with 10 5 infectious particles of POWV administered through oral gavage ( Fig.2C ). Mice were either monitored for survival for 14 days ( Fig.2C ) or sacrificed at 2 dpi and their sera examined for viral titers ( Fig.2D ). Mock-treatment did not affect any mice throughout the monitored period, whereas 60% of WT mice infected with POWV deceased within 10 days ( Fig.2D ). All Ifnar1 -/- Ifnlr1 -/- mice succumbed to the virus in the first four days after infection, while 30% of Ifnar1 -/- mice were still alive at this timepoint ( Fig.2C ). The Ifnar1 -/- mice that were still alive at 4 dpi, except for one that survived the complete period of monitoring, died within the next three days. This delay in lethality might indicate a more prominent role of IFN-III, although still secondary to IFN-I signaling in the oral infection route of TBOVs. However, viremia in the sera was comparable between Ifnar1 -/- and Ifnar1 -/- Ifnlr1 -/- mice at 2 dpi, although the detected titers were 2-3 logs lower than in subcutaneously infected mice at the same timepoint ( Fig.2B, D ). Together, these results indicate that type I IFN is the central player of the antiviral response against POWV in vivo and that while type III IFNs might support the inhibition of infection at mucosal surfaces like the intestine, this IFN signaling pathway does not appear critical to prevent rapid viremia and accelerated death in C57BL/6J mice. IFN responses prevent dissemination of POWV in a wide array of tissues in C57BL/6J mice To characterize the effect of IFN-signaling on POWV dissemination and tropism in mice, WT, Ifnar1 -/- , or Ifnar1 -/- Ifnlr1 -/- C57BL/6J mice were infected either by subcutaneous injection into the footpad (10 3 FFU, Fig.3A ), or via oral gavage (10 5 FFU, Fig.3B ) and 2 dpi. Viral RNA abundance in individual tissues was quantified by RT-qPCR analysis. At 2 dpi, all the tested tissues of all mock-treated and WT mice subcutaneously infected with POWV were negative for viral RNA ( Fig.3A ), indicating that POWV replicated less efficiently in WT mice. By contrast, viral RNA was detected in all tissues of Ifnar1 -/- and Ifnar1 -/- Ifnlr1 -/- mice. Detection of viral RNA in the brain of Ifnar1 -/- and Ifnar1 -/- Ifnlr1 -/- mice, but not of WT mice, confirmed the importance of IFN-signaling for restriction of early dissemination to the brain ( Fig. 3A ). The highest levels of viral RNA were present in the spleen, suggesting that this tissue might be particularly dependent on IFN-signaling to limit viral dissemination. No significant difference in viral RNA load was observed between the two genotypes ( Fig. 3A ), indicating a widespread dissemination and a broad tissue-tropism of POWV in C57BL/6J mice lacking functional IFN signaling. Download figure Open in new tab Fig. 3. POWV shows widespread tropism in Ifnar1 -/- and Ifnar1 -/- Ifnlr1 -/- mice after injection in the footpad or administration of virus through oral gavage. (A) Viral loads within brain, small intestine, liver, kidney, and spleen tissue of WT (black), Ifnar1 -/- (orange), and Ifnar1 -/- Ifnlr -/- (blue) C57BL/6J mice (4-9 per group) subcutaneously infected with 10 3 FFU of POWV-LB, or (B) of WT (black), Ifnar1 -/- (orange), and Ifnar1 -/- Ifnlr1 -/- (blue) C57BL/6J mice (3-8 per group) infected with 10 5 FFU of POWV-LB through oral gavage at 2 dpi. Viral positive-strand RNA copies were quantified by RT-qPCR and expressed as genome equivalents (GE) per µg total RNA. The figure was created using Biorender.com. Oral infection of WT, Ifnar1 -/- , or Ifnar1 -/- Ifnlr1 -/- C57BL/6J mice with POWV (10 5 FFU) resulted in widespread detection of viral RNA in different tissues of mice at 2 dpi ( Fig.3B ). The highest levels of viral RNA were also present in the spleen following oral infection ( Fig.3B ). Viral RNA levels in the brain were reduced upon oral infection compared to subcutaneous injection ( Fig.3B ). Despite being infected with 100 times more viral particles, viral dissemination was less robust across all tissues compared to footpad-injected mice, at least at 2 dpi. No significant difference in viral yield between the two different mouse strains was observed at this timepoint. Type I IFNs restrict rapid dissemination into many peripheral tissues, and more particularly in the spleen. However, the oral route seems less effective in driving systemic dissemination upon disruption of IFN responses than the FP route – despite similar death phenotype (temporal and clinical). This could suggest that the spleen (and the hematopoietic compartment) is a key tissue where disease mechanisms occur when type I IFN signaling is disrupted. A CRISPR-KO screen identifies IFI6 as the central effector of the IFN type I and III-driven antiviral responses against TBEV Since both type I and III IFNs showed antiviral potential against TBOVs in vitro ( Fig.1 ) and in vivo ( Fig.2 , 3 ), we sought to identify the IFN effectors that are involved. We set up a CRISPR/Cas9-KO screening approach targeting 1905 genes that were previously identified as ISGs in a variety of human cell lines and primary immune cells ( Fig.4A ) ( 42 ). To maximize the output of the screen, we performed it both in Caco2 cells treated with IFNλ1 and in DAOY cells treated with IFNα2, since the respective treatments had more potent protective effects ( Fig.1I-K ). Cells transduced with the sgRNA library were selected by puromycin treatment, then treated with IFN, and finally infected with TBEV at an MOI of 1. Infected cells were sorted using antibodies binding to orthoflaviviral E protein and DNA was extracted from infected and non-infected control cells to identify integrated sgRNA sequences in each cell fraction ( Fig.4A ). Next Generation Sequencing coupled to MAGeCK-based statistical analyses ( 43 ) led to the identification of sgRNAs targeting 19 genes significantly enriched in infected cells, representing potential antiviral factors ( Fig.4B ). Comparison of antiviral hits in the two models revealed 5 genes that may be essential for both type I and III antiviral signaling against TBEV ( Fig.4B ). Three of these genes are key members the JAK/STAT pathway and thus well-known broadly-acting IFN-I/III effectors: STAT1 , STAT2 and IRF9 ( 15 , 16 ). IFI6 and KEAP1 were the other two antiviral candidates common to the two stimuli. Antiviral hits that were distinct for the two models included the receptors of the respective IFN type used for the two screens, namely IFNLR1 for the type III/Caco2 screen and IFNAR1 for the type I/DAOY screen ( Fig.4B ), further validating our experimental approach. With IFITM1 and IFITM3 , ISGs that were previously observed to demonstrate antiviral effects against TBOVs were also detected here ( 40 ). Ten of the antiviral hits, such as TMEM51 and COMMD3, have not been associated with antiviral functions yet. We also identified 10 genes that were significantly depleted in infected cells, representing potential proviral ISGs ( Fig. 4C ). These proviral hits included genes that are broad-spectrum facilitators of viral infection, such as ISG15 and USP18 , which negatively regulate the JAK/STAT pathway ( 44 , 45 ). Several genes with unknown functions in the context of viral infection, such as SLC35A2 and MARCKS, were also identified ( Fig.4C ). Download figure Open in new tab Fig. 4. A CRISPR-KO screen identifies IFI6 as the central effector of the IFN type I and III-driven antiviral responses against TBEV. ( A ) Schematic flow chart of the CRISPR-KO screen setup. ( B ) Antiviral and ( C ) proviral hits of the screens as identified through analyses of the resulting NGS data with the MAGeCK package. The cutoff point for screen hits is a FDR of 0.05. ( D ) Caco2 or DAOY cells were issued to siRNA-based knockdown of antiviral screen hits, or transfected with non-targeting siRNA (siNT), treated with IFNλ1 (Caco2, 16h, 20 U/mL) or IFNα2 (DAOY, 16 h, 10 ng/mL), infected with TBEV-Hypr (MOI 1, 24 h) and examined for viral genomic copy numbers via RT-qPCR. ( E ) Efficiency of knockdown of expression of target genes in the same IFN-treated samples as in (D) compared to cells transfected with siNT, as assessed by RT-qPCR analysis. ( F ) Caco2 cells with KO of IFI6 or KEAP1 or control cells (NT) were treated with IFNλ1 (16 h, 20 ng/mL) and infected with TBEV-Hypr at MOI 0.1 for 24 h. The percentage of infected cells was determined by flow cytometry after staining for orthoflaviviral envelope protein. ( G ) Same setup as (F) without IFN treatment. ( H ) Caco2 or DAOY cells were treated with either IFNα2 (250 U/mL, orange) or IFNλ1 (100 ng/mL, blue) for 16 h and analyzed for mRNA expression levels of IFI6 and KEAP1 via RT-qPCR. Data (D-H) are from three independent experiments ± SEM. ns = non-significant, * P < 0.05 by unpaired, two-tailed t-test. The figure was created using Biorender.com. We focused on IFI6 and KEAP1, which were the two antiviral hits that were common to the two screens. To further investigate their antiviral potential, their expression was knocked down using pools of 4 siRNAs. Negative controls were non-targeting siRNAs. Pools of siRNAs targeting IFNAR1 and IFNLR1 , which are expected to neutralize IFN-I and IFN-III signaling, respectively, served as positive controls. Pools of siRNAs targeting STAT2 were also included in the analysis. Following siRNA transfection, DAOY cells were treated with IFNα2 and Caco2 cells with IFNλ1 for 16 hours and then infected with TBEV for another 24 hours. Analysis of viral RNA yield by RT-qPCR, revealed, that, as expected, intracellular viral RNA levels were almost rescued to the level of non-treated cells in the presence of siRNAs targeting IFN receptors and STAT2 ( Fig.4D ). RT-qPCR analyses showed that the 4 siRNA pools were reducing the expression of their respective target genes, resulting in a 2-10-fold reduction of mRNA transcripts ( Fig.4E ). Reduced expression of IFI6 enhanced TBEV RNA yields in both cell types as compared to IFN-treated cells transfected with control siRNAs ( Fig. 4D ), confirming that IFI6 significantly contributes to the antiviral state against TBEV, independent of cell- or IFN-type. Replication of TBEV increased in DAOY cells expressing reduced levels of KEAP1 and pre-treated with IFNα2 ( Fig.4D ). However, it had no apparent effect on viral replication in IFNλ1-treated Caco2 cells ( Fig.4D ). To further investigate the potential effect of KEAP1 and IFI6 on TBEV replication, we generated KO cells using lentiviral vectors expressing Cas9 and gRNAs. Caco2 cells expressing non-targeting gRNAs were also produced as control cells. Cells were infected with TBEV and analyzed for the presence of the viral E protein by flow cytometric analysis. As expected from the 2 screens ( Fig. 4B ) and siRNA-based validation experiments ( Fig.4D ), significantly more IFI6 KO cells were positive for the viral E protein than control cells upon IFNλ1 treatment ( Fig.4F ). A significant rescue of viral protein production was also observed in KEAP1 KO cells ( Fig.4F ). However, the increase of infection in KEAP1 KO cells as compared to control cells was independent of prior IFN-treatment ( Fig.4G ), suggesting that the KEAP1 -induced antiviral effect is not linked to the IFN-induced antiviral state. Analysis of mRNA levels of IFI6 and KEAP1 revealed that IFI6 was upregulated by IFNα2 and IFNλ1 treatment in both DAOY and Caco2 cells ( Fig.4H ), thus qualifying as a genuine ISG in these cell types. However, KEAP1 mRNA abundance remained unchanged upon treatment with IFNα2 or IFNλ1 in both cell types ( Fig. 4H ), indicating that it is not an ISG in these two cell types. The screens thus recovered a set of genes with previously described antiviral potential, including genes crucial for IFN-signaling ( IRF9 , STAT1 and STAT2 ), validating our approach. Furthermore, they identified several poorly characterized host factors potentially modulating TBEV infection in human cells (such as TMEM51 and MARCKS) and IFI6 as a potent effector of both IFN families. Diminishing IFI6 expression impairs the antiviral potential of the IFN type I and III responses against TBEV Other CRISPR/Cas9 screens previously identified IFI6 as a major player in the type I IFN-dependent antiviral defense against several mosquito-borne orthoflaviviruses, including ZIKV and YFV ( 46 , 47 ). So far, its role in IFN-III signaling has not been explored, and its effect on the replication of TBOVs has not been investigated either. Moreover, the mechanism underlying its antiviral activities is poorly understood. To confirm the anti-TBEV function of IFI6 in both IFN-I and -III signaling, a pool of four siRNAs was used to assess the effect of reduced IFI6 expression on viral replication in Caco2 and DAOY cells after treatment with IFNλ1 or IFNα2. Flow cytometry analysis using anti-E antibodies confirmed that IFI6 anti-TBEV activities were dependent on the presence of IFN in both cell lines ( Fig. 5A ). Similarly, a rescue of the production of infectious virions was observed in cells expressing reduced levels of IFI6, independently of the type of IFN used for pre-treatment and the cell type ( Fig. 5B ). The siRNA-mediated knockdown reduced the amount of IFI6 mRNA by about 70% in Caco2 cells and by about 90 % in DAOY cells, independently of the type of IFN used for pretreatment ( Fig.5C ). This validates the used siRNAs as restrictors of IFI6 expression even in the presence of IFNs. Download figure Open in new tab Fig. 5. Diminishing IFI6 gene expression impairs the antiviral potential of the IFN type I and III responses against TBEV. (A) Cytometry-based analysis of cells stained for orthoflaviviral E protein after siRNA-based knockdown of IFI6 (siIFI6) using a pool of four different siRNAs, or non-targeting control (siNT) and subsequent treatment with either IFNα2 (50 U/mL) or IFNλ1 (20 ng/mL) for 16 h before infection with TBEV-Hypr (MOI 1) for 24 h. (B) Same experimental setup as (A) followed by estimating viral titers in the supernatant by plaque assay. (C) Reduction of IFI6 mRNA in Caco2 or DAOY cells transfected with a pool of four siRNAs targeting IFI6 (siIFI6) expression, or non-targeting siRNAs (siNT) and issued to IFN treatment (IFNα2: 50 U/mL, orange, or IFNλ1: 20 ng/mL, blue) for 16h, as identified by RT-qPCR analysis. (D) Western blot analysis of Caco2 cells with stable knockout of IFI6 (IFI6 KO) or control cells transduced with a lentivirus encoding a non-targeting sgRNA (NT) after treatment with either IFNα2 (50 U/mL) or IFNλ1 (20 ng/mL) for 16 h before infection with TBEV-Hypr (MOI 1) for the indicated times. The abundance of viral protein was determined by staining with an antibody against orthoflaviviral E protein. The data is representative of two independent experiments. (E) Plaque assay-based titration of supernatants of Caco2 cells with a targeted knockout of IFI6 (IFI6 KO) or control cells (NT) after treatment with IFNα2 (50 U/mL) for 16 h and infection with TBEV-Hypr (MOI 1) for the indicated time. (F) Same experimental setup as (F) but treatment with IFNλ1 (20 ng/mL) for 16 h. Data (A,B,E,F) are from three independent experiments ± SEM. The effect of IFI6 on viral replication was further assessed in unstimulated and stimulated IFI6-KO Caco2 cells at different times post-infection. Western blot analysis revealed that the expression of the viral E proteins was increased in cells lacking IFI6, stimulated with IFNλ1 or IFNα2, as compared to control cells that received non-targeting gRNAs ( Fig.5D ). In agreement with the Western blot analysis, stimulated Caco2 cells lacking IFI6 were producing more infectious viral particles than control cells ( Fig.5E-F ). The level was almost rescued to the level of control cells, suggesting that IFI6 is an essential contributor to the innate immune response against TBEV. Together, these data confirm that IFI6 plays a central role in the anti-TBEV signaling induced by both type I and III IFNs. IFI6 prevents the replication of diverse tick- and mosquito-borne orthoflaviviruses To further characterize the antiviral activity of IFI6, we produced Caco2 and DAOY cell lines stably expressing a C-terminally 3xFLAG-tagged version of IFI6 (IFI6-FLAG), as well as control Caco2 and DAOY cells stably expressing GFP. The expression of IFI6-FLAG in the generated cell lines was detectable by Western Blot analysis ( Fig.6A ). IFI6 mRNA levels exceeded IFI6 expression in GFP control cells treated with IFN, although less than 1 log in both cell lines with the concentrations of IFN used ( Fig. 6B ). Download figure Open in new tab Fig. 6. Overexpression of IFI6 prevents replication of diverse tick- and mosquito-borne orthoflaviviruses. (A) Western blot analysis of Caco2 or DAOY cells stably expressing IFI6-FLAG or GFP. The abundance of IFI6-FLAG was determined by staining with an antibody against FLAG protein. The data is representative of three independent experiments. (B) Expression levels of IFI6 mRNA in Caco2 or DAOY cells either stably expressing IFI6-FLAG, or after treatment with IFN (Caco2: IFNλ1, 100ng/mL, blue, or DAOY: IFNα2, 250U/mL, orange) for 16h, as identified by RT-qPCR analysis. (C) Confocal images of either Caco2 or DAOY cells stably overexpressing GFP or IFI6-FLAG 24 h after mock-infection or infection with TBEV-Hypr (MOI 0.1). Cells were fixed and stained for orthoflaviviral envelope protein (E) to assess their infection status. Images are representative of two independent experiments. Scale bar 30 µm. (D-F) Analysis of Caco2 or DAOY cells overexpressing GFP or IFI6-FLAG 24 h after infection with TBEV-Hypr (MOI 0.1) through either RT-qPCR-based estimation of viral genomic copy numbers (D) , cytometric assessment of cells positive for stained for orthoflaviviral envelope protein (E) or plaque assay-based titration to determine the abundance of infectious virions in the supernatant (F) . (G) Caco2 cells overexpressing GFP or IFI6-FLAG were infected with either VSV, orthoflaviviruses, or SARS-CoV-2 (MOIs: VSV:0.01; POWV:5; LIV:0.1; JEV:1; ROCV:0.1; ILHV:0.1; WNV:1; USUV:1; SLEV:1; ENTV:1; SARS-CoV-2:0.003) for 24 h and their percentage of infection determined through flow cytometry analysis after specific staining for VSV-G, orthoflaviviral envelope, or SARS-CoV-2 nucleocapsid protein. Transmission vectors are indicated for orthoflaviviruses (ticks, mosquitoes, or unknown (?)). Data (D-G) are from three independent experiments ± SEM. ns = non-significant, *P < 0.05, **P < 0.01, ***P < 0.001, and****P < 0.0001 by unpaired, two-tailed t-test. Confocal imaging revealed that expression of IFI6-FLAG resulted in a reduction of cells positive for viral E proteins 24 h post-TBEV infection in both cell lines, as compared to GFP control cells ( Fig.6C ). Viral RNA yields were also reduced in DAOY and Caco2 cells expressing IFI6-FLAG ( Fig.6D ). In agreement with these results, cytometry analysis showed that around 10 times less cells were positive for E proteins in the presence of IFI6-FLAG, as compared to GFP ( Fig. 6E ). Finally, the release of infectious virions was also significantly reduced in cells expressing IFI6-FLAG ( Fig.6F ), further validating the antiviral activity of IFI6. To evaluate the antiviral effect of IFI6-FLAG on other viruses, we conducted infection experiments with an array of diverse orthoflaviviruses transmitted to humans by ticks (POWV and LIV) or mosquitoes (Japanese encephalitis virus (JEV), Rocio virus (ROCV), Ilheus virus (ILHV), West Nile virus (WNV), Usutu virus (USUV), and St. Louis encephalitis virus (SLEV)). We also included Entebbe bat virus (ENTV), an orthoflavivirus isolated from a bat of the species Tadarida limbata whose transmission vector has not been identified yet, but that is closely related to YFV ( 48 ). Moreover, we tested whether IFI6 was active against Vesicular stomatitis virus (VSV), a negative-sense RNA virus belonging to the Rhabdoviridae family that replicates in the cytoplasm ( 49 ) as a non-orthoflaviviral control. Flow cytometry analysis using an antibody against the viral protein G revealed that VSV replication was not affected by IFI6 expression ( Fig.6G ). By contrast, IFI6 significantly reduced the number of E-positive cells in the context of infection with all orthoflaviviruses tested ( Fig.6G ). Of note, among the orthoflaviviruses tested, USUV and SLEV were the most sensitive to IFI6-overexpression ( Fig. 6G ). Finally, we assessed the effect of IFI6 overexpression on SARS-CoV-2 replication since two large-scale loss-of-function screens identified it as a potential SARS-CoV-2 restriction factor ( 50 , 51 ). The number of cells positive for the viral protein N was reduced by about 50% when IFI6 was overexpressed ( Fig. 6G ), indicating that IFI6 antiviral activity is not specific to orthoflaviviruses. Our experiments thus indicate that IFI6 has the ability to potently restrict the replication of a wide array of orthoflaviviruses, as well as at least one coronavirus, in human cells and acts independently of other ISGs. IFI6 is an ER-resident protein that restricts a post-entry step of TBEV replication To assess the localization of IFI6 within the cell, we tested several commercial antibodies in different assays. None of them gave us satisfactory results. Previous studies have reported a mitochondrial localization of stably overexpressed IFI6-FLAG in human MCF-7 breast cancer cells ( 52 , 53 ), while others described IFI6-3xFLAG as an ER-based protein in human hepatoma Huh7.5 cells in which endogenous IFI6 was replaced by a tagged version using CRISPR knock-in approaches ( 46 ). Anti-FLAG staining in DAOY cells stably expressing IFI6-FLAG revealed that the antiviral factor colocalized with the ER marker calreticulin, while no overlap in signal was identified with the mitochondrial marker TOM70 ( Fig.7A, B ). Download figure Open in new tab Fig. 7. IFI6 is an ER-resident protein that restricts a post-entry step of TBEV replication. (A, B) Confocal microscopy analysis of DAOY cells stably overexpressing IFI6-FLAG. Cells were fixed and stained with antibodies for FLAG and mitochondrial marker TOM70 (A) or ER-marker calreticulin (B) . Scale bar 10µm. (C-E) Analysis of IRF9 (C), MDA5 (D), or MAVS (E) mRNA levels in Caco2 or DAOY cells ectopically expressing GFP or IFI6-FLAG, via RT-qPCR. GFP expressing cells were treated with IFN (Caco2: 10 ng/mL IFNλ1, blue; DAOY: 20 U/mL IFNα2, orange) for 16 h. Gene expression was normalized to GAPDH and mRNA levels in mock-treated, GFP-expressing cells. (F) Western blot analysis of Caco2 or DAOY cells either ectopically expressing GFP or IFI6-FLAG that were electroporated with in vitro synthesized RNA derived from a TBEV Neudoerfl replicon 24 h after electroporation. Whole cell lysates were analyzed by staining with antibodies against the indicated proteins. (n=2). (G) Caco2 or DAOY cells, either ectopically expressing GFP or IFI6-FLAG, were electroporated with in vitro synthesized RNA derived from a TBEV replicon. At the indicated timepoints, the relative amounts of viral RNA were measured by RT–qPCR analysis of TBEV-NS5 copy numbers per μg of total cellular RNA. Data (C-E, G) are from three independent experiments ± SEM. ns = non-significant, ** P < 0.01, and *** P < 0.001 two-way ANOVA with Sidak correction. A recent report suggested an interaction between swine-IFI6 and the NS4A protein of JEV in human embryonic kidney 293T cells, potentially impeding the involvement of NS4A in remodeling of ER-membranes ( 54 ). To assess whether TBEV NS4A, or any other viral proteins, could be targeted by IFI6, 293T cells were transfected with FLAG-tagged versions of the 10 individual proteins of TBEV and a C-terminally HA-tagged IFI6. Co-immunoprecipitation assays failed to detect an interaction between viral proteins and IFI6 ( Fig.S1A ), suggesting that IFI6 does not elicit its antiviral potential via an interaction with a viral protein. Download figure Open in new tab Fig. S1. IFI6 does not interact with individual TBEV proteins. 293T cells were transfected with plasmids expressing IFI6-HA and empty vector (EV) plasmids or plasmids expressing FLAG tagged versions of proteins encoded by TBEV. Cells were lysed 24 h post transfection, and whole cell lysates were immunoblotted with the indicated antibodies (input). The same samples were issued to an immunoprecipitation assay using anti FLAG magnetic beads and subsequent staining with the indicated antibodies (FLAG-IP) (n=2). Since IFI6 restricts unrelated viruses ( Fig. 6G ), we assessed whether its activities could be linked to the IFN response. Monitoring the expression levels of three innate immune genes ( IRF9 , MDA5 , and MAVS) , illustrated that while MAVS was neither influenced by IFN-treatment, nor IFI6-FLAG expression in Caco2 or DAOY cells, IRF9 and MDA5 expression were upregulated by IFNα2 but not influenced by IFI6 overexpression ( Fig.7C-E ). These data suggest that IFI6 does not achieve its antiviral potential by modulating the expression of innate immune genes. To determine whether IFI6 affects early or late steps of TBEV replication, we took advantage of a replicon generated from the NS protein sequences of the Neudoerfl strain ( 55 ). DAOY and Caco2 cells stably expressing either IFI6-FLAG or GFP were electroporated with in vitro synthesized viral RNA generated from the replicon. In this context, viral replication bypasses early steps (viral attachment, entry, fusion in endosomes, and cytoplasmic uncoating). Analysis of the expression of NS5 in cells transfected with the replicon revealed reduced NS5 levels in DAOY cells and an absence of expression in Caco2 cells after 24 h ( Fig.7F ). Of note, Caco2 cells expressed more IFI6-FLAG than DAOY cells ( Fig.7F ), which could explain the more pronounced effect on NS5 expression. RT-qPCR analysis of viral RNA yields performed at different times post-electroporation revealed that viral replication was reduced after around 24 h in both cell lines expressing IFI6-FLAG compared to GFP-expressing control cells ( Fig.7G ). These data indicate that IFI6 acts at a late step of viral replication. Together, our findings suggest an antiviral effect of IFI6 by suppressing viral genome replication at a post-entry stage, without interacting with viral proteins. DISCUSSION Our results corroborate the antiviral activity of the type I and III IFN signaling pathways against TBOVs in two human cell lines derived from tissues with physiological relevance to TBOV pathogenesis. A parallel CRISPR/Cas9-KO screen identified IFI6 as a crucial effector of both IFN families in anti-TBEV response. IFI6 likely acts independently of other ISGs and targets a post-entry step shared by various members of the Orthoflavivirus genus. In addition to that, IFI6 restricts the replication of at least one member of the Betacoronavirus genus. The importance of type I IFN signaling to counteract TBOV replication in human cells is well established ( 3 , 6 ). In line with our results, the protective effect of pretreatment with type I IFNs was documented for several members of the TBOV family in a variety of cell lines ( 27 , 30 , 31 , 34 ). However, to our knowledge, the protective effect of type III IFN pretreatment was only investigated in one study that states that pretreatment of DAOY cells with IFNλ1 does not protect against TBEV replication ( 30 ). This is in stark contrast with our results showing the antiviral potential of IFNλ1 against different TBOVs in two human cell lines. Since the experimental setup did not differ in IFN-type nor concentration, the lack of IFNλ1-induced protection from TBEV in DAOY cells might stem from the 5-fold higher MOI previously used ( 30 ), potentially overcoming the IFNλ1-induced antiviral state. Several other studies, however, reported antiviral properties of the IFNλ family against diverse mosquito-borne orthoflaviviruses, suggesting that other members of the genus are also sensitive to the antiviral effects of these cytokines ( 56 , 47 , 57 – 63 ). The upregulation of type III IFNs following infection with TBOVs was reported in in vitro experiments but also in patients infected with TBEV and linked to a milder outcome of disease ( 30 , 64 , 65 ). Furthermore, studies performed on the Polish and Russian populations suggested that, amongst others, polymorphisms in the IFNL3/IL28B gene are associated with a predisposition to severe forms of TBE ( 64 , 66 ). Treatment of patients with IFNλ is currently successfully explored in the context of a variety of viral infections in humans, at present focusing on hepatic and respiratory viruses ( 67 – 73 ). Compared to type I IFNs, previously used for treatment of viral infections, type III IFNs trigger less expression of inflammatory cytokines, like IL-6 and TNFα ( 21 , 67 , 74 ). IFNλs may thus represent an interesting option to treat patients suffering from neurotropic TBOV infection. Only the impact of type I IFN signaling on TBOV infection was studied in vivo so far ( 29 , 33 , 41 , 75 , 76 ). Furthermore, data on POWV infection in mouse models is scarce. Our data underlines the importance of type I IFN signaling in restricting early viral dissemination and delaying lethal POWV-induced disease. The rapid and fulminant disease we observed in the Ifnar1 -/- and Ifnar1 -/- Ifnlr1 -/- mice is unlikely to reflect the typical neurological disease reported for POWV-infected individuals, but rather a systemic ‘cytokine storm’. The additional depletion of IFN-III signaling did not alter the probability of survival for subcutaneously infected C57BL/6J mice. Viral dissemination to spleen and brain as early as day 2 was reported for Ifnar1 -/- C57BL/6J mice intraperitoneally injected with Langat virus (LGTV) ( 29 ), complementing our observations for infection of these tissues by POWV after two days. Infection of the liver, although not reported for murine models challenged with POWV, complements reports of TBOV tropism for this tissue in infected patients ( 77 ). Importantly, subcutaneous infection with POWV resulted in the detection of viral RNA in the small intestine of mice depleted for IFN-signaling. This is in line with studies showing that TBEV also targets GI tissue in BALB/c or C57BL/6J mice following intravenous or subcutaneous injection, respectively and with GI complications in patients during acute TBOV infection ( 78 , 79 ). While transmission through ingestion was established for TBEV in a C57BL/6 mouse model and is frequently observed in patients, it remains unclear whether other TBOVs are able to exploit this way of transmission ( 33 , 80 , 81 ). The only study investigating oral transmission of POWV in animals revealed that infection of a lactating goat with POWV did not result in clinical signs or detectable viremia in the animal but resulted in the development of specific antibodies in its kid, suggesting milk-borne transmission of POWV ( 8 ), which is in line with our data. Moreover, vertical transmission of LGTV through breast milk in A129 mice was reported, and also cases of mother-to-child transmission of TBEV via breast milk were suggested for humans ( 36 ). These findings imply that potentially all TBOVs are transmittable from infected mothers to their children during breastfeeding, which needs to be considered for management of breastfeeding after tick bites in TBOV-endemic areas. The trend towards earlier lethality in orally infected Ifnar1 -/- Ifnlr1 -/- mice compared to mice depleted of only IFN-I signaling supports a greater importance of type III IFN-dependent antiviral signaling at mucosal surfaces than in the skin, as suggested for other viral families ( 82 ). However, the observed trend is modest, and no differences in viral titer in the sera of infected Ifnar1 -/- and Ifnar1 -/- Ifnlr1 -/- mice were observed at 2 dpi. This fits the comparable loads of viral RNA extracted from diverse tissues in orally infected mice and suggests a minor role of type III IFN signaling for the antiviral defense system in vivo , independently of the infection route. Generally, infection with POWV through oral gavage resulted in significantly lower systemic viral titers and abundance of POWV RNA in the examined tissues compared to footpad-injected mice. These results suggest more efficient viral dissemination routes following subcutaneous infection than oral infection of POWV. However, when C57BL/6J Ifnar1 -/- mice were subcutaneously infected with LGTV (10 2 FFU), they succumbed significantly earlier to the virus compared to perorally infected mice (10 4 FFU) ( 33 ). Interestingly, Ifnar1 -/- mice infected with up to 10 6 FFU of LGTV through oral gavage did not die, suggesting that peroral infection with TBOVs causes more efficient dissemination of the virus than administration via oral gavage ( 33 ). Similar observations were made for TBEV in WT and Ifnar1 -/- mice ( 33 ). The antiviral state induced by IFNs depends on the activation of a plethora of different ISGs, many of which remain uncharacterized ( 18 ). While several approaches successfully identified IFN-I effectors against mosquito-borne orthoflaviviruses ( 46 , 47 , 83 – 85 ), effectors against TBOVs are poorly described. Our parallel CRISPR/Cas9-KO screening approach recovered factors previously identified as antiviral effectors against TBOVs, such as IFITM1 and IFITM3 ( 40 ). Moreover, with IARS , MED12 , CHORDC1, and COMMD3 for the type I screen and TMEM51 , CDH1 , JUN , SLC16A1 , RASAL2, and HES1 for the type III screen, we identified several novel genes with potential involvement in the IFN-induced cellular defense mechanism against TBOVs. Further investigations would be required to validate the antiviral activities of these candidates and decipher their mechanisms of action. Of note, we did not identify RSAD2 (viperin) nor TRIM5 α, two ISGs previously were reported to counteract TBOV infection in human A549 and/or HEK293T cells, although they were included in the sgRNA library we screened ( 42 , 86 – 89 ). Their antiviral function may be cell-type specific. The screens further suggested a proviral effect of USP18 , ISG15, and VMP1 , which agrees with previous experiments performed in human cells infected with other members of the Flaviviridae family ( 44 , 45 ). KEAP1 emerged as a potential IFN-I and IFN-III effector against TBEV. Although further investigations revealed that its action is IFN-independent in Caco2 and DAOY cells, it may be induced by IFNs in other cell types. Our screens identified IFI6 as an IFN-I and IFN-III effector for the anti-TBEV response in human cells. Reducing IFI6 expression in the presence of IFN-I/-III enhanced TBEV replication to a level comparable to the inhibition of IFNAR1 or STAT2, suggesting that it largely contributes to the innate immune response against TBEV. We showed that IFI6 restricts the replication of orthoflaviviruses transmitted by ticks, Culex and Aedes mosquitoes. In line with previous reports ( 46 ), our data support the hypothesis of IFI6 being an ER resident and suppressing the replication of orthoflaviviruses at a post-entry step. We observed an anti-SARS-CoV-2 effect of IFI6 expression in Caco2 cells, which was unexpected since the replication of OC43, a related betacoronavirus, was unaffected by IFI6 overexpression in Huh7.5 cells ( 49 ). These effect on SARS-CoV-2 replication thus challenges the idea of IFI6 solely preventing the formation of orthoflavivirus-specific alterations in the ER membrane ( 46 ). IFI6 may thus restrict the replication of unrelated viruses that replicate in the ER, preventing the formation of virally-induced ER remodeling ( 46 ), a process that is key for orthoflaviviral and betacoronaviral replication ( 90 – 92 ). This re-arrangement of ER membrane structures is mostly driven by several viral proteins, even though the detailed mechanisms of their involvement are yet to be defined ( 93 ). How the restructuring of the ER membranes by viral proteins might be influenced by IFI6, however, remains unclear. A direct interaction between the 2K protein of JEV, which lies in the last transmembrane domain of NS4A, and swine IFI6 (sIFI6) was recently suggested ( 54 ). Cleavage of the 2K protein from NS4A through the viral NS2B-NS3 protease modulate its potential to induce membrane rearrangements ( 94 , 95 ). This is further illustrated by a mutation in the genome of WNV that prevents cleavage of NS4A-2K completely abrogating viral replication ( 96 ). IFI6 may thus block the 2K cleavage and prevent the ER-remodeling potential of the NS4A protein of orthoflaviviruses. However, we did not detect interaction between human IFI6 and TBEV NS4A-2K, or any other viral protein. Furthermore, IFI6 was not able to prevent NS4A-2K cleavage, or any other polyprotein processing events induced by the viral protease ( 46 , 47 ). Together, these results challenge the idea of IFI6 exercising its antiviral potential by inhibiting viral protease activity and subsequent prevention of ER remodelling. This makes further investigation of the mechanisms underlying IFI6 antiviral activities indispensable. Importantly, this is hindered by the fact that no murine ortholog of IFI6 exists, greatly complicating its investigation in an in vivo context. MATERIALS AND METHODS Mice All animal experiments described in this study were performed in accordance with protocols that were reviewed and approved by the Institutional Animal Care and Use Committee of Boston University (PROTO202100000025 (Breeding protocol) and PROTO202200000070 (BSL3 protocol)). All mice were maintained in facilities accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care (AAALAC). All replication-competent Powassan Virus experiments were performed in a biosafety level 3 laboratory (BSL-3) at the Boston University National Emerging Infectious Diseases Laboratories (NEIDL). C57BL/6J (Cat. # 000664) and B6(Cg)-Ifnar1tm1.2Ees/J ( Ifnar1 -/- mice; Cat. # 028288) mice that are deficient for type I innate immune signaling were acquired from Jackson Laboratories. Ifnar1 -/- Ifnlr1 -/- mice that are deficient in type I and III innate immune signaling were kindly provided by Sergei Kotenko at Rutgers University. All mice were maintained at the Animal Science Center at Boston University prior to being moved to the NEIDL for experiments. Mice in the NEIDL BSL-3 facility were group-housed by sex in Tecniplast green line individually ventilated cages (Tecniplast). Mice were maintained on a 12:12 light cycle at 30– 70% humidity and provided standard water and standard chow diets (LabDiet). Cell lines and viruses Human colorectal adenocarcinoma Caco2-TC7 (American Type Culture Collection (ATCC), HTB-37), human medulloblastoma DAOY (ATCC, HTB-186), Human embryonic kidney (HEK) 293T cells (ATCC, CRL□3216), human glioblastoma U87-MG (ATCC, HTB-14), African green monkey kidney epithelial Vero cells (ATCC), and human hepatoma-derived HuH7 cells (HuH7.5, ATCC) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) containing GlutaMAX I and sodium pyruvate (Invitrogen) supplemented with 10% heat inactivated fetal bovine serum (FBS) (Dutscher) and 1% penicillin and streptomycin (10,000 IU/ml; Thermo Fisher Scientific) at 37°C and 5% CO2. Experiments with TBEV, POWV, LIV, ZIKV, JEV, ROCV, ILHV, WNV, USUV, SLEV, ENTV, and SARS-CoV-2 were performed in a BSL□3 laboratory, following safety and security protocols approved by the risk prevention service of the Institut Pasteur, Paris, or the NEIDL at Boston University. Experiments with VSV and lentiviruses were performed in a BSL-2+ setting following biosafety regulations of the Institut Pasteur, Paris. VSV Indiana was kindly provided by N. Escriou (Institut Pasteur, Paris). The TBEV-Hypr (001v-EVA134), POWV-LB (001v-EVA124), ROCV (001v-EVA126), ILHV (001v-EVA106), and ENTV (001v-EVA84) were obtained from the European Virus Archive (EVAg; https://www.european□virus□archive.com/). Louping Ill virus (strain LI 3/1; APHA reference Arb126) was a kind gift from Nick Johnson (Animal and Plant Health Agency, Addlestone, Surrey, UK). JEV (strain RP9), SLEV (strain MSI-7) and WNV (strain IS-98-STI) were provided by the biological resource center of the Institut Pasteur. USUV (strain D18-03348) was a kind gift from Nolwenn Dheilly (Institut Pasteur, Paris, France). SARS-Cov-2 (strain BetaCoV/France/IDF0372/2020) was supplied by the French National Reference Centre for Respiratory Viruses hosted by Institut Pasteur (Paris, France). Vero cells were used to produce all viral stocks, and to assess the number of infectious virions produced through plaque assay, as previously described ( 97 ). Only POWV-LB virus used for infection of mice was titrated using a focus forming assay on Vero cells. Briefly, Vero cell monolayers in a 24-well plate were infected with serial dilutions of virus stock for 2 h at 37°C, then the supernatant was replaced with a 1:1 mixture of 2xDMEM and CMC and incubated for 6 days at 37°C under a 5% CO2 atmosphere. The overlay was then removed, cells washed with PBS, fixed with 4% PFA at RT for 15 min and then permeabilized and blocked with PBS (1%BSA, 1% Triton-X) at RT for 1 h. Cells were then incubated with PBS (1% BSA) with pan-orthoflaviviral E protein 4G2 antibody (1:2000, Thermo Fisher, NBP52666549) at RT for 1 h while shaking. Monolayers were then washed 3x with PBS and incubated with PBS (1% BSA) holding Li-Cor IRDye® 800CW anti-rabbit antibody (1:5000, Fisher, NC9523609) for 45 min. Cells were washed 3x with PBS and plates imaged using an Odyssey DLx machine (Li-Cor). Viral titers were calculated according to the dilution and plated volume. Antibodies and cytokines The following primary antibodies were used: commercially available antibodies against β□actin (produced in mouse, clone AC□74), FLAG (mouse, M2 F3165□1MG), 4G2 pan orthoflavivirus (mouse, 1:1000, kind gift from Philippe Desprès), anti-TBEV NS5 ( 34 ), TOM70 (rabbit, ab289977), calreticulin (rabbit, AB2907), and HA (rabbit, H6908) were obtained and used for immunoblotting at the indicated dilutions. Furthermore, FLAG M2 was used at 1:2000, 4G2 at 1:2000, and anti-NS5 at 1:1000 dilutions for immunofluorescence staining for microscopy analysis. 4G2 pan□orthoflavivirus antibody was used at 1:1000, anti-VSV-G antibody (kind gift from Gert Zimmer) was used at 1:2000, and anti-SARS-Cov-2-NCP-1 antibody (kind gift from Olivier Schwartz ( 98 )) was used at 1:200 dilutions in flow cytometry, respectively. For secondary staining, the following commercially available antibodies were employed: Alexa Fluor 488 goat anti□mouse IgG (H+L, A11001), Alexa Fluor 647 donkey anti□mouse IgG (H+L, A31571), Alexa Fluor 647 goat anti□rabbit IgG (H+L, A21244); Alexa Fluor 680 goat anti□mouse IgG (H+L, A21058); goat anti□chicken IgY (H+L) Dylight 800 (SA5□10076) and goat anti□rabbit IgG (H+L) Dylight 800 (SA5□35571). All secondary antibodies were used at 1:1,000 dilution for cytometry and immunofluorescence assays and diluted at 1:10,000 for Western blot analysis. Human recombinant IFNα2 (PBL Biosciences) and IFNλ1 (IL-29, Invitrogen) were used to stimulate cells at the concentrations (diluted in DMEM 10% FBS; 1% P/S) and for the time indicated in the respective figure legends. Viral infections Cells were infected at the MOIs indicated in the respective figure legends by a 2 h incubation in DMEM medium containing 2% FBS at 37°C under a 5% CO2 atmosphere. Cells were then washed with PBS (Gibco), infection medium was replaced by DMEM (10% FBS; 1% P/S) and cells were subsequently incubated at 37°C under a 5% CO2 atmosphere until collected for analysis at the indicated timepoint. Transfections 293T cells were transfected using the Trans IT□293 (Mirus) reagent following the protocol provided by the manufacturer. For co immunoprecipitation experiments, 5×10 5 cells in 12□well plates were transfected with 250□ng of each plasmid, as indicated in the figure. The ON-TARGETplus siRNAs used for either screen validation or IFI6 knockdown experiments in DAYO and Caco2 cells ( Table S1 ) were purchased from Horizon. Caco2 and DAOY cells were seeded on a 12-well plate (8×10 4 /well) and transfected with Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. View this table: View inline View popup Table S1. siRNA sequences used for knockdown experiments. Immunoblot and immunoprecipitation analyses Cells were lysed using radioimmunoprecipitation assay (RIPA) buffer (Sigma□Aldrich), supplemented with a protease and phosphatase inhibitor cocktail (Roche). Subsequently, samples were denatured in 4x protein sample loading buffer (Li□Cor Bioscience) under reducing conditions (NuPAGE reducing agent, Thermo Fisher Scientific) when non-infected, or not when infected with orthoflaviviruses. Only 293T cells expressing TBEV NS2A were lysed using the Mem□PER plus membrane protein extraction kit (Thermo Fisher Scientific) and sonicated for 20□minutes at 100% amplitude and 2/2 pulse. Proteins were then separated by SDS–PAGE (NuPAGE 4-12% Bis□Tris gel, Invitrogen) and transferred to nitrocellulose membranes (Bio□Rad) utilizing a Trans□Blot Turbo Transfer system (Bio□Rad). Membranes were blocked with PBS 0.1% Tween 20 (PBS□T) containing 5% milk. Following blocking, membranes were incubated for 1 h at RT or overnight at 4°C with primary antibodies diluted in blocking buffer. Subsequently, membranes were washed 3x with PBS-T and incubated for 45□minutes at room temperature with secondary antibodies (anti□rabbit/mouse IgG (H+L) DyLight 800/680) diluted in blocking buffer, followed by 3x washing of the membranes with PBS-T. Images were acquired using an Odyssey CLx infrared imaging system (Li□Cor Bioscience). For co□immunoprecipitation analysis, a portion of the cell lysates was incubated overnight with magnetic beads coupled with anti FLAG M2 (Sigma□Aldrich, M8823). Following incubation, immunoprecipitates were washed four times with washing buffer and analyzed by immunoblot as described above. RNA extraction and RT-qPCR analyses Total RNA was extracted from cell lysates utilizing the NucleoSpin RNA II kit (Macherey□Nagel) or the NucleoMag RNA kit (Macherey-Nagel) according to the manufacturer’s instructions and subsequently eluted in nuclease free water. First□strand cDNA synthesis involved 1□μg of total RNA using the RevertAid H Minus Moloney murine leukemia virus (M□MuLV) reverse transcriptase (Thermo Fisher Scientific) with random primers p(dN)6 (Roche). Quantitative real□time PCR was conducted on a Quant Studio 6 Flex real-time PCR system (Applied Biosystems) using SYBR green PCR master mix (Life Technologies). Data were analyzed employing the ΔΔCT method, with GAPDH (glyceraldehyde□3□phosphate dehydrogenase) serving as the normalization reference for human samples. Technical triplicates were performed for each experiment. RT–qPCR primer sequences are detailed in Table S2 . Quantification of TBEV and POWV genomes was achieved by extrapolation from a standard curve derived from serial dilutions of plasmids encoding TBEV NS5 (pCi□Neo□NS5 TBEV) or POWV NS5 (pCi-Neo-NS5 POWV). View this table: View inline View popup Table S2. RT-qPCR primer sequences. Immunofluorescence assays Cells were fixed with 4% paraformaldehyde (PFA) (Sigma□Aldrich) at RT for 30□minutes, followed by permeabilization with PBS containing 0.5% Triton-X at RT for 15□minutes. Subsequently, cells were blocked for 30□minutes with PBS containing 0.05% Tween and 5% BSA, before being exposed to the specified primary antibodies diluted in PBS containing 0.05% Tween and 2% BSA for 1□h. Following antibody incubation, cells were washed 3x with PBS containing 0.05% Tween. Secondary Alexa Fluor 488 or 647-conjugated antibodies diluted in PBS containing 0.05% Tween and 2% BSA were then applied for 1□h. After secondary antibody incubation, cells were washed 3x with PBS containing 0.05% and once with PBS alone. Nuclei were stained for 15□minutes using PBS/NucBlue (Life Technologies). Following staining, slides were mounted with Prolong gold imaging medium (Life Technologies). Images were captured utilizing a Leica SP8 confocal microscope. Flow cytometry Infected cells underwent fixation using the Cytofix/Cytoperm fixation and permeabilization kit (BD Pharmingen) for 20 min, followed by three washes with the corresponding wash buffer. Subsequently, cells were stained with the anti□E mAb 4G2 primary antibody, diluted in wash buffer, at 4°C for 1□h. After another three washes with wash buffer, cells were stained with secondary Alexa 488 or Alexa 647 antibody for 45□minutes in the dark at 4°C. Data acquisition was performed using the Attune NxT Acoustic Focusing Cytometer (Life Technologies), and analysis was conducted using the FlowJo v10.8.1 software. Generation of ISG-KO library cells Twenty 6-well plates were seeded with 4×106 HEK293T cells in DMEM (10% FBS, 1% P/S). After 24 h, cells were simultaneously transfected with the 667 ng lentiCRISPRv2 ISG library plasmids ( https://www.addgene.org/pooled-library/lenticrisprv2-isg-library/ ), 500 ng plasmids coding for HIV Gag/Pol (psPAX2) and 333 ng of plasmids encoding for the VSVg envelope (pVSV-G opt) per well using Trans IT□293 (Mirus) transfection reagent following the manufacturer’s instructions. Transfection medium was replaced after 24 h, and supernatants were harvested 24 and 48 h later, filtered, concentrated by ultracentrifugation (22,000□g, 4□°C for 1□h), and pooled. To generate the ISG KO library cells, 3×10 7 Caco2 or DAOY cells were seeded in 12-well plates 24□h before transduction. Each well was then transduced at an MOI of 1 as identified by colony formation titering assays for lentiviruses on Caco2 or DAOY cells following previously described protocols ( 99 ). Briefly, concentrated lentivector was diluted in serum-free DMEM, supplemented with 20□µg/mL of DEAE dextran (Sigma, D9885), and cells were spin-infected for 30 min at 1100xg. After 48□h, transduced cells were selected by puromycin treatment for 10 days (Caco2: 10 µg/mL, DAOY: 4□µg/mL; Sigma, P8833). CRISPR/Cas9 screens In total, 1.3□×□10 7 Caco2 or DAOY cells were treated with IFNλ1 (Caco2, 100 ng/mL) or IFNα2 (DAOY, 100□U/mL). After 16□h, cells were infected with TBEV-Hypr at an MOI of 1 in DMEM (2% FBS, 1% P/S). After 2h, the viral inoculum was removed, washed once with PBS, and cells were maintained in DMEM containing 10% FBS and 1% P/S for 24 h. Thereafter, cells were collected and fixed using the fixation buffer supplied with the Cytofix/Cytoperm™ fixation and permeabilization kit (BD Pharmigen). Fixed cells were washed in cold Cytoperm buffer and then incubated for 1 h at 4□°C under rotation with primary antibody (4G2, mouse, 1:1000) in the same buffer. Incubation with the secondary antibody (Alexa 488 anti-mouse, 1:10000) was performed for 45□min at 4□°C under rotation. Stained cells were resuspended in cold sorting buffer containing PBS, 2% FBS, 25□mM Hepes, and 5□mM EDTA. Cells were sorted into infected and non-infected cells using a BD FACS Aria Fusion machine. Sorted and control (non-infected, not IFN-treated) cells were then centrifuged for 20□min at 2000xg and resuspended in lysis buffer (NaCI 300□mM, SDS 0.1%, EDTA 10□mM, EGTA 20□mM, Tris 10□mM) supplemented with 1% Proteinase K (Qiagen) and 1% RNAse A/T1 (Sigma) and incubated overnight at 65□°C. DNA was isolated with two consecutive phenol-chloroform extractions and recovered by ethanol precipitation. Next, a PCR reaction using barcoded primers to allow for demultiplexing of the samples after sequencing was performed using the Herculase II Fusion DNA Polymerase (Agilent) and DNA oligos as described in ( 2 ). The resultant PCR products were purified using a QIAquick PCR Purification kit (Qiagen, 28104) and subjected to a second PCR following primer designs described in ( 99 ) before being purified using Agencourt AMPure XP Beads (Beckman Coulter Life Sciences). Next-generation sequencing was performed utilizing the NextSeq 500/550 High Output Kit v2.5 with 75 cycles (Illumina). Screen analysis Reads were demultiplexed using quality-aware fastq demultiplexer v0.1.1. Sequencing adapters were removed using trimmomatic v0.39. The reference library was built using bowtie2 v2.3.5.1. Read mapping was performed with bowtie2 and samtools v2.0.4. Mapping analysis and gene selection were performed using MAGeCK v0.5.9, normalizing the data with default parameters. Data from MAGeCK analyses of the screens are available upon request to the authors. Generation of cells with stable KO of IFI6 or KEAP1 Stable KO of IFI6 or KEAP1 in Caco2 or DAOY cells was achieved through transduction with lentivectors harboring sgRNA sequences targeting the specific genes ( Table S3 ) introduced into the lentiCRISPRv2 backbone. The sgRNAs were produced by hybridization of oligonucleotides encoding for the respective sgRNA sequence flanked by sequences resembling restriction sites for the BsmBI enzyme. LentiCRISPRv2 plasmids and the hybridized oligonucleotides were digested with the restriction enzyme and gel purified. The components obtained were then ligated using a T4 ligase for 2 h at RT. The resultant plasmids were transformed into Stbl3 bacteria for amplification and sequenced to ensure the successful incorporation of the sgRNA sequence. After, HEK293T cells plated in a 6-well plate and grown to 70% confluency were simultaneously transfected with the 667 ng PIKA sgRNA library plasmids, 500 ng plasmids coding for HIV Gag/Pol (psPAX2) and 333 ng of plasmids encoding for the VSVg envelope (pVSV-G opt) per well using Trans IT□293 (Mirus) transfection reagent following the manufacturer’s instructions. Transfection medium was replaced after 24 h, and supernatants were harvested 24 and 48 h later, filtered, and pooled. To generate the KO cells, a 6-well plate with Caco2 or DAOY cells was incubated with lentivector-holding supernatant diluted 1:2 in serum-free DMEM for 2 h before replacing the inoculum with DMEM (10% FBS, 1% P/S). After 48 h, transduced cells were selected by puromycin treatment for 10 days (Caco2: 8 µg/mL, DAOY: 4□µg/mL; Sigma, P8833). View this table: View inline View popup Download powerpoint Table S3. sgRNA sequences used for lentiviral vector-mediated CRISPR/Cas9 KO. Generation of IFI6-Flag expression plasmid and lentiviral vectors IFI6-Flag expression plasmid was generated by cloning the IFI6 coding sequence from IFN-stimulated DAOY cells’ cDNA into p3XFLAG-CMV™-14 vector (Sigma) using EcoRI/KpnI restriction sites (Fwd: 5’-TCTAGTGAATTCCCACCATGCGGCAGA AGGCGGTATCGC -3’, Rev: 5’-GACTGGTACCTCCTCATCCTCCTCACTATC-3’). The generated IFI6-3xFLAG plasmid was used to transfer the IFI6-3xFLAG cassette into the pFlap-Ubc-nLuc-IRES-Puro lentiviral vector (kind gift of Pierre Charneau). PCR primers were designed to add BclI/XhoI restriction sites to IFI6-3XFLAG coding sequence (Fwd: 5’-CTCTAGAGGATCCCGGGCTG-3’, Rev: 5’-GAGAGGCTCGAGTCTCACTACTTGTCATCGTCA-3’), and the amplicon was cloned into pFlap-Ubc-IRES-Puro lentiviral vector digested with BamHI/XhoI to generate the pFlap-Ubc-IFI6-3xFLAG-IRES-Puro plasmid. Amplicon was cloned in pFlap-Ubc-IRES-Puro using BamHI/XhoI restriction sites. The HA tagged version of IFI6 was obtained amplifying IFI6 from the IFI6-3XFLAG plasmid, with primers designed to add BclI/XhoI restriction sites along with a C-terminal HA tag (Fwd: 5’-TCTAGTTGATCAGCCACCATGCGGCAGAAGGCGGT-3’, Rev: 5’-GAGAG GCTCGAGTCACTAAGCGTAATCTGGAACATCGTATGGGTAAGCCCGGGATCCTCTAGAGTC-3‘) and amplicon was cloned into pFlap-Ubc-IRES-Puro lentiviral vector digested with BamHI/XhoI to generate the pFlap-Ubc-IFI6-HA-IRES-Puro plasmid used for transfection. Control GFP expressing lentiviral vector was obtained using the same cloning strategy, amplifying GFP from pEGFP-C1 plasmid (Clontech) (Fwd: 5’-TCTAGTTGATCAGCCACCATGGTGAGCAAGGGCGA-3’, Rev: 5’-GAGAGGCTCGAGTCTTACTTGTACAGCTCGTCCAT-3’). All plasmids were propagated in Stbl3 E. coli cells and verified by sequencing (Eurofins Genomics). Generation of stable cell lines HEK293T cells plated in a 6-well plate and grown to 70% confluency were simultaneously transfected with 1.6 µg of either p6.16-Lenti-GW-TMEM51, pFlap-Ubc-IFI6-3xFLAG-IRES-Puro pFlap-Ubc-IFI6-HA-IRES-Puro or pFlap-Ubc-EGFP-IRES-Puro, 1 µg plasmids coding for HIV Gag/Pol (psPAX2) and 400 ng of plasmids encoding for the VSVg envelope (pVSV-G opt) per well using Trans IT□293 (Mirus) transfection reagent following the manufacturer’s instructions. Transfection medium was replaced after 24 h, and supernatants were harvested 24 and 48 h later, filtered, and pooled. To generate the cells stably expressing IFI6-FLAG, a 6-well plate with Caco2 or DAOY cells was incubated with lentivector-containing supernatant diluted 1:2 in serum-free DMEM for 2 h before replacing the inoculum with DMEM (10% FBS, 1% P/S). After 48□h, transduced cells were selected by zeocin treatment for TMEM51-expressing cells (Caco2: 300 µg/mL, DAOY: 200□µg/mL, Sigma) or puromycin treatment for IFI6-3xFLAG or IFI6-HA and GFP expressing cells (Caco2: 10 µg/mL, DAOY: 4□µg/mL, Sigma) for 10 days. HEK293T cells plated in a 6-well plate and grown to 70% confluency were simultaneously transfected with 1.6 µg of either p6.16-Lenti-GW-TMEM51, pFlap-Ubc-IFI6-3xFLAG-IRES-Puro or pFlap-Ubc-EGFP-IRES-Puro, 1 µg plasmids coding for HIV Gag/Pol (psPAX2) and 400 ng of plasmids encoding for the VSVg envelope (pVSV-G opt) per well using Trans IT□293 (Mirus) transfection reagent following the manufacturer’s instructions. Transfection medium was replaced after 24 h, and supernatants were harvested 24 and 48 h later, filtered, and pooled. To generate the KO cells, a 6-well plate with Caco2 or DAOY cells was incubated with lentivector-containing supernatant diluted 1:2 in serum-free DMEM for 2 h before replacing the inoculum with DMEM (10% FBS, 1% P/S). After 48□h, transduced cells were selected by zeocin treatment for TMEM51-expressing cells (Caco2: 300 µg/mL, DAOY: 200□µg/mL, Sigma) or puromycin treatment for IFI6-3xFLAG and GFP expressing cells (Caco2: 10 µg/mL, DAOY: 4□µg/mL, Sigma) for 10 days. In vitro transcription and electroporation of TBEV replicons TBEV pTND/ΔME replicon plasmids (kindly provided by Franz X. Heinz via Karin Stiasny) ( 55 ) were linearized via NheI digestion and blunt ended using the Quick Blunting Kit (New England Biolab). 5 µg of purified DNA template were utilized for T7-mediated in vitro transcription employing the RiboMAX large□scale RNA production system T7 (Promega), with the addition of 40 mM cap analog (Ribo m7G Cap, Promega) as proposed by the manufacturer’s protocol. After treatment with RQ1 DNase (Promega), RNA was purified using an RNA clean-up kit (Macherey□Nagel). In vitro synthesized TBEV replicon RNA was then delivered into Caco2 or DAOY cells via electroporation. Here, 2×106 cells were trypsinized, washed 3x in cold PBS, resuspended in 200 µL cold PBS, and electroporated with 5□μg of RNA in 0.4-cm electroporation cuvettes (Biorad), using a 950□μF and 260□V pulse with the Genepulser system (Biorad). Following electroporation, cells were collected in 3.2□ml of warm medium, split into four wells of a 12-well plate, and incubated at 37°C under standard conditions. Mouse infection and monitoring C57BL/6J, Ifnar1 -/- , and Ifnar1 -/- Ifnlr1 -/- adult male and female adult mice (6-30 weeks of age) were infected through subcutaneous injection in the foodpad with POWV-LB (10 3 FFU) diluted in 50 µl of PBS or through oral gavage with POWV-LB (10 5 FFU). Clinical manifestations of disease were monitored daily, and signs of clinical disease progression were recorded through weighing, clinical scoring, and temperature measurements using a UID temperature implantable probe (Unified Information Devices; SKU: UCT-2112-198). Overall appearance was assessed using a clinical scoring matrix assigned after assessing the following parameters: significant (10-24%) body weight loss, neurological signs (hind limb paralysis, weak grip, ataxia), appearance (ruffled fur, hunched), responsiveness (low to moderate), and behavior (circling, head tilt). Mice that scored higher than three on two consecutive days were euthanized and documented as dead for the following day. Tissue collection At two days postinfection, mice were anesthetized using 1–3% isoflurane, followed by euthanasia using an overdose of ketamine/xylazine. Whole blood (200 µl) was collected from the heart of mice and transferred into Eppendorf tubes. Serum was collected from blood by centrifugation at 3500 RPM and 4°C for 10 min and stored at -80°C for later analysis. 20-30 mg of liver, small intestine, brain, spleen, and kidney tissue were weighed and transferred into Eppendorf tubes holding 600 µL RNAlater (Ambion) and stored at 4°C for next day processing or at -80°C for future processing. RNA extraction from serum and tissues The isolated tissues (20 to 30 mg) were transferred into 2 mL tubes containing buffer RLT–1 % β-mercaptoethanol (Qiagen) and a 5 mm stainless steel bead. Tissues were lysed using a TissueLyser (Qiagen) at 30 cycles/s for 2 min, 1 min wait, 30 cycles/s for 2 min, and centrifuged at high speed (13,000 rpm) for 10 min. Total RNA was then extracted from the resulting supernatant or serum using a RNeasy minikit (Qiagen) following the manufacturer’s instructions. Sera titrations Viral particle quantification in sera was performed by plaque assay on HuH7.5 cells. 4.5×10 4 cells were plated in 48-well plates 16-24 hours prior to experiments. For titration, sera were diluted 1:10 in OptiMEM + GlutaMax (Gibco) then serial diluted (10 -1 – 10 -8 ). 100 μL of each dilution was plated onto HuH7.5 cells, incubated for 2 hours at 37°C and 5% CO 2 , then the inoculum was removed prior to overlay of 800 μμL of 1% Methylcellulose media in DMEM 10% FBS. Plates were incubated for 5 days at 37°C and 5% CO 2 before removal of overlay and fixation with 10% neutral-buffered formalin. After 2 hours of fixation, formalin was removed, and the fixed cells were stained with 0.1% crystal violet in 10% ethanol for 30 minutes. Cells were then washed and plaques were counted. Data representation and statistical analyses Data are presented and analyzed using GraphPad Prism software v10.0.2. Significance was calculated as indicated in the corresponding figure legend. Supplementary Materials Fig.S1. IFI6 does not interact with individual TBEV proteins. Table S1. siRNA sequences used for knockdown experiments. Table S2. RT-qPCR primer sequences. Table S3. sgRNA sequences used for lentiviral vector-mediated CRISPR/Cas9 KO. Acknowledgments We thank Sergei Kotenk at Rutgers University (NJ, USA), N. Escriou (Institut Pasteur, Paris, France), Nick Johnson (Animal and Plant Health Agency, Addlestone, Surrey, UK), Nolwenn Dheilly (Institut Pasteur, Paris, France), Gert Zimmer (Institute of Virology and Immunology (IVI), Bern, Switzerland), Olivier Schwartz (Institut Pasteur, Paris, France), and Nathalie Morel for providing reagents. FS was supported by a Boehringer Ingelheim Fonds PhD fellowship to realize this work. References and Notes 1. ↵ Pierson TC , Diamond MS . The continued threat of emerging flaviviruses . Nat Microbiol . 2020 May 4 ; 5 ( 6 ): 796 – 812 . OpenUrl CrossRef PubMed 2. ↵ Grabowski JM , Hill CA . A Roadmap for Tick-Borne Flavivirus Research in the “Omics” Era . Front Cell Infect Microbiol . 2017 Dec 22 ; 7 : 519 . OpenUrl CrossRef PubMed 3. ↵ Kemenesi G , Bányai K . Tick-Borne Flaviviruses, with a Focus on Powassan Virus . Clin Microbiol Rev . 2018 Dec 19 ; 32 ( 1 ): e00106 – 17 . OpenUrl PubMed 4. ↵ Stone ET , Pinto AK . T Cells in Tick-Borne Flavivirus Encephalitis: A Review of Current Paradigms in Protection and Disease Pathology . Viruses . 2023 Apr 13 ; 15 ( 4 ): 958 . OpenUrl CrossRef PubMed 5. ↵ Hermance ME , Thangamani S . Powassan Virus: An Emerging Arbovirus of Public Health Concern in North America . Vector-Borne Zoonotic Dis . 2017 Jul ; 17 ( 7 ): 453 – 62 . OpenUrl CrossRef 6. ↵ Lindqvist R , Upadhyay A , Överby A . Tick-Borne Flaviviruses and the Type I Interferon Response . Viruses . 2018 Jun 21 ; 10 ( 7 ): 340 . OpenUrl CrossRef PubMed 7. ↵ Ruzek D , Avšič Županc T , Borde J , Chrdle A , Eyer L , Karganova G , et al. Tick-borne encephalitis in Europe and Russia: Review of pathogenesis, clinical features, therapy, and vaccines . Antiviral Res . 2019 Apr ; 164 : 23 – 51 . OpenUrl CrossRef PubMed 8. ↵ Roz A , Woodall JP . Experimental Milk-Borne Transmission of Powassan Virus in the Goat . Am J Trop Med Hyg . 1977 Jan 1 ; 26 ( 1 ): 190 – 2 . OpenUrl Abstract / FREE Full Text 9. ↵ Ličková M , Fumačová Havlíková S , Sláviková M , Klempa B . Alimentary Infections by Tick-Borne Encephalitis Virus . Viruses . 2021 Dec 30 ; 14 ( 1 ): 56 . OpenUrl CrossRef PubMed 10. ↵ Amicizia D , Domnich A , Panatto D , Lai PL , Cristina ML , Avio U , et al. Epidemiology of tick-borne encephalitis (TBE) in Europe and its prevention by available vaccines . Hum Vaccines Immunother . 2013 May 14 ; 9 ( 5 ): 1163 – 71 . OpenUrl CrossRef 11. Hellenbrand W , Kreusch T , Böhmer M , Wagner-Wiening C , Dobler G , Wichmann O , et al. Epidemiology of Tick-Borne Encephalitis (TBE) in Germany, 2001–2018 . Pathogens . 2019 Mar 29 ; 8 ( 2 ): 42 . OpenUrl CrossRef PubMed 12. ↵ Riccardi N , Antonello RM , Luzzati R , Zajkowska J , Di Bella S , Giacobbe DR . Tick-borne encephalitis in Europe: a brief update on epidemiology, diagnosis, prevention, and treatment . Eur J Intern Med . 2019 Apr ; 62 : 1 – 6 . OpenUrl CrossRef PubMed 13. ↵ Ostfeld RS , Brunner JL. Climate change and Ixodes tick-borne diseases of humans . Philos Trans R Soc B Biol Sci . 2015 Apr 5 ; 370 ( 1665 ): 20140051 . OpenUrl CrossRef PubMed 14. ↵ Gilbert L . The Impacts of Climate Change on Ticks and Tick-Borne Disease Risk . Annu Rev Entomol . 2021 Jan 7 ; 66 ( 1 ): 373 – 88 . OpenUrl CrossRef PubMed 15. ↵ Streicher F , Jouvenet N . Stimulation of Innate Immunity by Host and Viral RNAs . Trends Immunol . 2019 Dec ; 40 ( 12 ): 1134 – 48 . OpenUrl CrossRef PubMed 16. ↵ Lazear HM , Schoggins JW , Diamond MS . Shared and Distinct Functions of Type I and Type III Interferons . Immunity . 2019 Apr ; 50 ( 4 ): 907 – 23 . OpenUrl CrossRef PubMed 17. ↵ Shaw AE , Hughes J , Gu Q , Behdenna A , Singer JB , Dennis T , et al. Fundamental properties of the mammalian innate immune system revealed by multispecies comparison of type I interferon responses . Malik H , editor. PLOS Biol . 2017 Dec 18 ; 15 ( 12 ): e2004086 . OpenUrl CrossRef PubMed 18. ↵ Schoggins JW . Interferon-Stimulated Genes: What Do They All Do? Annu Rev Virol . 2019 Sep 29 ; 6 ( 1 ): 567 – 84 . OpenUrl CrossRef PubMed 19. ↵ Marcello T , Grakoui A , Barba–Spaeth G , Machlin ES , Kotenko SV , Macdonald MR , et al. Interferons α and λ Inhibit Hepatitis C Virus Replication With Distinct Signal Transduction and Gene Regulation Kinetics . Gastroenterology . 2006 Dec ; 131 ( 6 ): 1887 – 98 . OpenUrl CrossRef PubMed Web of Science 20. Bolen CR , Ding S , Robek MD , Kleinstein SH . Dynamic expression profiling of type I and type III interferon-stimulated hepatocytes reveals a stable hierarchy of gene expression: Hepatology . Hepatology . 2014 Apr ; 59 ( 4 ): 1262 – 72 . OpenUrl CrossRef PubMed 21. ↵ Forero A , Ozarkar S , Li H , Lee CH , Hemann EA , Nadjsombati MS , et al. Differential Activation of the Transcription Factor IRF1 Underlies the Distinct Immune Responses Elicited by Type I and Type III Interferons . Immunity . 2019 Sep ; 51 ( 3 ): 451 – 464 .e6. OpenUrl CrossRef PubMed 22. ↵ Zhao M , Li L , Zhai L , Yue Q , Liu H , Ren S , et al. Comparative Transcriptomic and Proteomic Analyses Prove that IFN-λ1 is a More Potent Inducer of ISGs than IFN-α against Porcine Epidemic Diarrhea Virus in Porcine Intestinal Epithelial Cells . J Proteome Res . 2020 Sep 4 ; 19 ( 9 ): 3697 – 707 . OpenUrl CrossRef PubMed 23. ↵ Sommereyns C , Paul S , Staeheli P , Michiels T. IFN-Lambda (IFN-λ) Is Expressed in a Tissue-Dependent Fashion and Primarily Acts on Epithelial Cells In Vivo . Buchmeier MJ , editor. PLoS Pathog . 2008 Mar 14 ; 4 ( 3 ): e1000017 . OpenUrl CrossRef PubMed 24. Pott J , Mahlakõiv T , Mordstein M , Duerr CU , Michiels T , Stockinger S , et al. IFN-λ determines the intestinal epithelial antiviral host defense . Proc Natl Acad Sci . 2011 May 10 ; 108 ( 19 ): 7944 – 9 . OpenUrl Abstract / FREE Full Text 25. Kotenko SV , Kotenko SV , Durbin JE . Contribution of type III interferons to antiviral immunity: location, location, location . J Biol Chem . 2017 ; 26. ↵ Stanifer ML , Stanifer ML , Guo C , Doldan P , Doldan P , Boulant S . Importance of Type I and III Interferons at Respiratory and Intestinal Barrier Surfaces . Front Immunol . 2020 ; 27. ↵ Best SM , Morris KL , Shannon JG , Robertson SJ , Mitzel DN , Park GS , et al. Inhibition of Interferon-Stimulated JAK-STAT Signaling by a Tick-Borne Flavivirus and Identification of NS5 as an Interferon Antagonist . J Virol . 2005 Oct 15 ; 79 ( 20 ): 12828 – 39 . OpenUrl Abstract / FREE Full Text 28. Taylor RT , Lubick KJ , Robertson SJ , Broughton JP , Broughton JP , Bloom ME , et al. TRIM79α, an Interferon-Stimulated Gene Product, Restricts Tick-Borne Encephalitis Virus Replication by Degrading the Viral RNA Polymerase . Cell Host Microbe . 2011 ; 29. ↵ Weber E , Finsterbusch K , Lindquist R , Nair S , Lienenklaus S , Gekara NO , et al. Type I Interferon Protects Mice from Fatal Neurotropic Infection with Langat Virus by Systemic and Local Antiviral Responses . Lyles DS , editor. J Virol . 2014 Nov; 88 ( 21 ): 12202 – 12 . OpenUrl Abstract / FREE Full Text 30. ↵ Selinger M , Wilkie GS , Tong L , Gu Q , Schnettler E , Grubhoffer L , et al. Analysis of tick-borne encephalitis virus-induced host responses in human cells of neuronal origin and interferon-mediated protection . J Gen Virol . 2017 Aug 1 ; 98 ( 8 ): 2043 – 60 . OpenUrl CrossRef PubMed 31. ↵ Flint M , McMullan LK , Dodd KA , Bird BH , Khristova ML , Nichol ST , et al. Inhibitors of the Tick-Borne, Hemorrhagic Fever-Associated Flaviviruses . Antimicrob Agents Chemother . 2014 Jun ; 58 ( 6 ): 3206 – 16 . OpenUrl Abstract / FREE Full Text 32. Lindqvist R , Mundt F , Gilthorpe JD , Wölfel S , Wölfel S , Gekara NO , et al. Fast type I interferon response protects astrocytes from flavivirus infection and virus-induced cytopathic effects . J Neuroinflammation . 2016 ; 33. ↵ Schreier S , Cebulski K , Kröger A. Contact-Dependent Transmission of Langat and Tick-Borne Encephalitis Virus in Type I Interferon Receptor 1-Deficient Mice . Sandri-Goldin RM , editor. J Virol . 2021 Mar 25 ; 95 ( 8 ):e02039-20. 34. ↵ Gracias S , Chazal M , Decombe A , Unterfinger Y , Sogues A , Pruvost L , et al. Tickr::borne flavivirus NS5 antagonizes interferon signaling by inhibiting the catalytic activity of TYK2 . EMBO Rep . 2023 Dec 6 ; 24 ( 12 ): e57424 . OpenUrl CrossRef PubMed 35. Lin S , Wang X , Sallapalli BT , Hage A , Chang P , He J , et al. Langat virus inhibits the gp130/JAK/STAT signaling by reducing the gp130 protein level . J Med Virol . 2024 Apr ; 96 ( 4 ): e29522 . OpenUrl CrossRef PubMed 36. ↵ Miao Y , Zheng Y , Wang T , Yi W , Zhang N , Zhang W , et al. Breast milk transmission and involvement of mammary glands in tick-borne flavivirus infected mice . Heise MT , editor. J Virol . 2024 Mar 19 ; 98 ( 3 ):e01709-23. 37. ↵ Yu C , Achazi K , Möller L , Schulzke JD , Niedrig M , Bücker R. Tick-Borne Encephalitis Virus Replication, Intracellular Trafficking, and Pathogenicity in Human Intestinal Caco-2 Cell Monolayers . Wang T , editor. PLoS ONE . 2014 May 12 ; 9 ( 5 ): e96957 . OpenUrl CrossRef PubMed 38. ↵ Fares M , Cochet-Bernoin M , Gonzalez G , Montero-Menei CN , Blanchet O , Benchoua A , et al. Pathological modeling of TBEV infection reveals differential innate immune responses in human neurons and astrocytes that correlate with their susceptibility to infection . J Neuroinflammation . 2020 Dec ; 17 ( 1 ): 76 . OpenUrl CrossRef PubMed 39. ↵ Zani A , Yount JS . Antiviral Protection by IFITM3 In Vivo . Curr Clin Microbiol Rep . 2018 Dec ; 5 ( 4 ): 229 – 37 . OpenUrl CrossRef PubMed 40. ↵ Chmielewska AM , Gómez-Herranz M , Gach P , Nekulova M , Bagnucka MA , Lipińska AD , et al. The Role of IFITM Proteins in Tick-Borne Encephalitis Virus Infection . Williams BRG , editor. J Virol . 2022 Jan 12 ; 96 ( 1 ):e01130-21. 41. ↵ Chotiwan N , Rosendal E , Willekens SMA , Schexnaydre E , Nilsson E , Lindqvist R , et al. Type I interferon shapes brain distribution and tropism of tick-borne flavivirus . Nat Commun . 2023 Apr 10 ; 14 ( 1 ): 2007 . OpenUrl CrossRef PubMed 42. ↵ OhAinle M , Helms L , Vermeire J , Roesch F , Humes D , Basom R , et al. A virus-packageable CRISPR screen identifies host factors mediating interferon inhibition of HIV . eLife . 2018 Dec 6 ; 7 : e39823 . OpenUrl CrossRef PubMed 43. ↵ Li W , Xu H , Xiao T , Cong L , Love MI , Zhang F , et al. MAGeCK enables robust identification of essential genes from genome-scale CRISPR/Cas9 knockout screens . 2014 ; 44. ↵ Espada CE , Da Rocha EL , Ricciardi-Jorge T , Dos Santos AA , Soares ZG , Malaquias G , et al. ISG15/USP18/STAT2 is a molecular hub regulating IFN I-mediated control of Dengue and Zika virus replication . Front Immunol . 2024 Feb 7 ; 15 : 1331731 . OpenUrl CrossRef PubMed 45. ↵ Yousefi M , Lee WS , Yan B , Cui L , Yong CL , Yap X , et al. TMEM41B and VMP1 modulate cellular lipid and energy metabolism for facilitating dengue virus infection . Lazear HM , editor. PLOS Pathog . 2022 Aug 8 ; 18 ( 8 ): e1010763 . OpenUrl CrossRef PubMed 46. ↵ Richardson RB , Ohlson MB , Eitson JL , Kumar A , McDougal MB , Boys IN , et al. A CRISPR screen identifies IFI6 as an ER-resident interferon effector that blocks flavivirus replication . Nat Microbiol . 2018 Nov ; 3 ( 11 ): 1214 – 23 . OpenUrl CrossRef PubMed 47. ↵ Dukhovny A , Lamkiewicz K , Chen Q , Fricke M , Jabrane-Ferrat N , Marz M , et al. A CRISPR Activation Screen Identifies Genes That Protect against Zika Virus Infection . Williams BRG , editor. J Virol . 2019 Aug 15 ; 93 ( 16 ):e00211-19. 48. ↵ Lutwama J , Kityo R , Crabtree MB , Miller BR , Ledermann J , Nakayiki T , et al. Detection of Entebbe Bat Virus After 54 Years . Am J Trop Med Hyg . 2015 Sep 2 ; 93 ( 3 ): 475 – 7 . OpenUrl Abstract / FREE Full Text 49. ↵ Banerjee AK . Transcription and replication of rhabdoviruses . Microbiol Rev . 1987 Mar ; 51 ( 1 ): 66 – 87 . OpenUrl FREE Full Text 50. ↵ Mac Kain A , Maarifi G , Aicher SM , Arhel N , Baidaliuk A , Munier S , et al. Identification of DAXX as a restriction factor of SARS-CoV-2 through a CRISPR/Cas9 screen . Nat Commun . 2022 May 4 ; 13 ( 1 ): 2442 . OpenUrl CrossRef PubMed 51. ↵ Le Pen J , Rice CM . The antiviral state of the cell: lessons from SARS-CoV-2 . Curr Opin Immunol . 2024 Apr ; 87 : 102426 . OpenUrl CrossRef PubMed 52. ↵ Cheriyath V , Kaur J , Davenport A , Khalel A , Chowdhury N , Gaddipati L . G1P3 (IFI6), a mitochondrial localised antiapoptotic protein, promotes metastatic potential of breast cancer cells through mtROS . Br J Cancer . 2018 Jul ; 119 ( 1 ): 52 – 64 . OpenUrl CrossRef PubMed 53. ↵ Davenport AM , Morris M , Sabti F , Sabti S , Shakya D , Hynds DL , et al. G1P3/IFI6, an interferon stimulated protein, promotes the association of RAB5 + endosomes with mitochondria in breast cancer cells . Cell Biol Int . 2023 Nov ; 47 ( 11 ): 1868 – 79 . OpenUrl CrossRef PubMed 54. ↵ Qin L , Fan W , Zheng F , Chen H , Qian P , Li X . Swine IFI6 confers antiviral effects against Japanese encephalitis virus in vitro and in vivo . J Gen Virol [Internet ]. 2023 Apr 25 [cited 2024 Apr 19]; 104 ( 4 ). Available from: https://www.microbiologyresearch.org/content/journal/jgv/10.1099/jgv.0.001847 55. ↵ Gehrke R , Ecker M , Aberle SW , Allison SL , Heinz FX , Mandl CW . Incorporation of Tick-Borne Encephalitis Virus Replicons into Virus-Like Particles by a Packaging Cell Line . J Virol . 2003 Aug 15 ; 77 ( 16 ): 8924 – 33 . OpenUrl Abstract / FREE Full Text 56. ↵ Douam F , Soto Albrecht YE , Hrebikova G , Sadimin E , Davidson C , Kotenko SV , et al. Type III Interferon-Mediated Signaling Is Critical for Controlling Live Attenuated Yellow Fever Virus Infection In Vivo . Rappuoli R , editor. mBio . 2017 Sep 6 ; 8 ( 4 ):e00819-17. 57. ↵ Corry J , Arora N , Good CA , Sadovsky Y , Coyne CB . Organotypic models of type III interferon-mediated protection from Zika virus infections at the maternal–fetal interface . Proc Natl Acad Sci . 2017 Aug 29 ; 114 ( 35 ): 9433 – 8 . OpenUrl Abstract / FREE Full Text 58. Lazear HM , Daniels BP , Pinto AK , Huang AC , Vick SC , Doyle SE , et al. Interferon-λ restricts West Nile virus neuroinvasion by tightening the blood-brain barrier . Sci Transl Med [Internet] . 2015 Apr 22 [cited 2022 Aug 27]; 7 ( 284 ). Available from: https://www.science.org/doi/10.1126/scitranslmed.aaa4304 59. Cacciotti G , Caputo B , Selvaggi C , La Sala A , Vitiello L , Diallo D , et al. Variation in interferon sensitivity and induction between Usutu and West Nile (lineages 1 and 2) viruses . Virology . 2015 Nov ; 485 : 189 – 98 . OpenUrl CrossRef PubMed 60. Hsu YL , Wang MY , Ho LJ , Lai JH . Dengue virus infection induces interferon-lambda1 to facilitate cell migration . Sci Rep . 2016 Jul 26 ; 6 ( 1 ): 24530 . OpenUrl CrossRef PubMed 61. Caine EA , Scheaffer SM , Arora N , Zaitsev K , Artyomov MN , Coyne CB , et al. Interferon lambda protects the female reproductive tract against Zika virus infection . Nat Commun . 2019 Jan 17 ; 10 ( 1 ): 280 . OpenUrl CrossRef PubMed 62. Palma-Ocampo HK , Flores-Alonso JC , Vallejo-Ruiz V , Reyes-Leyva J , Flores-Mendoza L , Herrera-Camacho I , et al. Interferon lambda inhibits dengue virus replication in epithelial cells . Virol J . 2015 Dec ; 12 ( 1 ): 150 . OpenUrl CrossRef PubMed 63. ↵ Ma D , Jiang D , Qing M , Weidner JM , Qu X , Guo H , et al. Antiviral effect of interferon lambda against West Nile virus . Antiviral Res . 2009 Jul ; 83 ( 1 ): 53 – 60 . OpenUrl CrossRef PubMed 64. ↵ Grygorczuk S , Parczewski M , Moniuszko A , Świerzbińska R , Kondrusik M , Zajkowska J , et al. Increased concentration of interferon lambda-3, interferon beta and interleukin-10 in the cerebrospinal fluid of patients with tick-borne encephalitis . Cytokine . 2015 Feb ; 71 ( 2 ): 125 – 31 . OpenUrl CrossRef PubMed 65. ↵ Ignatieva EV , Igoshin AV , Yudin NS . A database of human genes and a gene network involved in response to tick-borne encephalitis virus infection . BMC Evol Biol . 2017 ; 66. ↵ Barkhash AV , Babenko VN , Voevoda MI , Romaschenko AG . Association of IL28B and IL10 gene polymorphism with predisposition to tick-borne encephalitis in a Russian population . Ticks Tick-Borne Dis . 2016 Jul ; 7 ( 5 ): 808 – 12 . OpenUrl CrossRef 67. ↵ Davidson S , McCabe TM , Crotta S , Gad HH , Hessel EM , Beinke S , et al. IFNλ is a potent antir::influenza therapeutic without the inflammatory side effects of IFNα treatment . Embo Mol Med . 2016 ; 68. Ryoo S , Koh DH , Yu SY , Choi M , Huh K , Yeom JS , et al. Clinical efficacy and safety of interferon (Type I and Type III) therapy in patients with COVID-19: A systematic review and meta-analysis of randomized controlled trials . Cobucci RNO , editor. PLOS ONE . 2023 Mar 29 ; 18 ( 3 ): e0272826 . OpenUrl CrossRef PubMed 69. Hermant P , Michiels T . Interferon-λ in the Context of Viral Infections: Production, Response and Therapeutic Implications . J Innate Immun . 2014 ; 6 ( 5 ): 563 – 74 . OpenUrl CrossRef PubMed 70. Etzion O , Hamid S , Lurie Y , Gane EJ , Yardeni D , Duehren S , et al. Treatment of chronic hepatitis D with peginterferon lambda—the phase 2 LIMT-1 clinical trial . Hepatology . 2023 Jun ; 77 ( 6 ): 2093 – 103 . OpenUrl CrossRef PubMed 71. Sattar AA , Qaiser A , Kausar H , Aqil S , Mudassar R , Manzoor S , et al. The potential of IFN-λ, IL-32γ, IL-6, and IL-22 as safeguards against human viruses: a systematic review and a meta-analysis . Front Immunol . 2024 Feb 14 ; 15 : 1303115 . OpenUrl CrossRef PubMed 72. Lasfar A , Zloza A , Cohen-Solal KA . IFN-lambda therapy: current status and future perspectives . Drug Discov Today . 2016 Jan ; 21 ( 1 ): 167 – 71 . OpenUrl CrossRef PubMed 73. ↵ Andreakos E , Tsiodras S . COVID r::19: lambda interferon against viral load and hyperinflammation . EMBO Mol Med . 2020 Jun 8 ; 12 ( 6 ): e12465 . OpenUrl CrossRef PubMed 74. ↵ Galani IE , Triantafyllia V , Eleminiadou EE , Koltsida O , Stavropoulos A , Manioudaki ME , et al. Interferon-λ Mediates Non-redundant Front-Line Antiviral Protection against Influenza Virus Infection without Compromising Host Fitness . Immunity . 2017 ; 75. ↵ Kurhade C , Zegenhagen L , Weber E , Nair S , Michaelsen-Preusse K , Spanier J , et al. Type I Interferon response in olfactory bulb, the site of tick-borne flavivirus accumulation, is primarily regulated by IPS-1 . J Neuroinflammation . 2016 ; 76. ↵ Lindman M , Angel JP , Estevez I , Chang NP , Chou TW , McCourt M , et al. RIPK3 promotes brain region-specific interferon signaling and restriction of tick-borne flavivirus infection . Perlman S , editor. PLOS Pathog . 2023 Nov 27 ; 19 ( 11 ): e1011813 . OpenUrl CrossRef PubMed 77. ↵ Haglund M , Günther G . Tick-borne encephalitis—pathogenesis, clinical course and long-term follow-up . Vaccine . 2003 Apr ; 21 : S11 – 8 . OpenUrl CrossRef PubMed Web of Science 78. ↵ Boelke M , Puff C , Becker K , Hellhammer F , Gusmag F , Marks H , et al. Enteric Ganglioneuritis, a Common Feature in a Subcutaneous TBEV Murine Infection Model . Microorganisms . 2021 Apr 18 ; 9 ( 4 ): 875 . OpenUrl CrossRef PubMed 79. ↵ Nagata N , Iwata-Yoshikawa N , Hayasaka D , Sato Y , Kojima A , Kariwa H , et al. The Pathogenesis of 3 Neurotropic Flaviviruses in a Mouse Model Depends on the Route of Neuroinvasion After Viremia . J Neuropathol Exp Neurol . 2015 Mar ; 74 ( 3 ): 250 – 60 . OpenUrl CrossRef PubMed 80. ↵ Martello E , Gillingham EL , Phalkey R , Vardavas C , Nikitara K , Bakonyi T , et al. Systematic review on the non-vectorial transmission of Tick-borne encephalitis virus (TBEv) . Ticks Tick-Borne Dis . 2022 Nov ; 13 ( 6 ): 102028 . OpenUrl CrossRef 81. ↵ Elbaz M , Gadoth A , Shepshelovich D , Shasha D , Rudoler N , Paran Y . Systematic Review and Meta-analysis of Foodborne Tickborne Encephalitis, Europe, 1980–2021 . Emerg Infect Dis [Internet] . 2022 Oct [cited 2024 May 12]; 28 ( 10 ). Available from: https://www.nc.cdc.gov/eid/article/28/10/22-0498_article.htm 82. ↵ Walker FC , Sridhar PR , Baldridge MT . Differential roles of interferons in innate responses to mucosal viral infections . Trends Immunol . 2021 Nov ; 42 ( 11 ): 1009 – 23 . OpenUrl CrossRef PubMed 83. ↵ Schoggins JW , Wilson SJ , Panis M , Murphy MY , Murphy M , Jones CT , et al. A diverse range of gene products are effectors of the type I interferon antiviral response . Nature . 2011 ; 84. Hanners NW , Mar KB , Boys IN , Eitson JL , De La Cruz-Rivera PC , Richardson RB , et al. Shiftless inhibits flavivirus replication in vitro and is neuroprotective in a mouse model of Zika virus pathogenesis . Proc Natl Acad Sci . 2021 Dec 7 ; 118 ( 49 ): e2111266118 . OpenUrl Abstract / FREE Full Text 85. ↵ Lesage S , Chazal M , Beauclair G , Batalie D , Cerboni S , Couderc E , et al. Discovery of Genes that Modulate Flavivirus Replication in an Interferon-Dependent Manner . J Mol Biol . 2022 Mar ; 434 ( 6 ): 167277 . OpenUrl CrossRef PubMed 86. ↵ Lindqvist R , Kurhade C , Gilthorpe JD , Överby AK . Cell-type- and region-specific restriction of neurotropic flavivirus infection by viperin . J Neuroinflammation . 2018 ; 87. Upadhyay AS , Vonderstein K , Pichlmair A , Stehling O , Bennett KL , Dobler G , et al. Viperin is an iron-sulfur protein that inhibits genome synthesis of tick-borne encephalitis virus via radical SAM domain activity: Enzymatic antiviral mechanism of viperin . Cell Microbiol . 2014 Jun ; 16 ( 6 ): 834 – 48 . OpenUrl CrossRef PubMed 88. Panayiotou C , Lindqvist R , Kurhade C , Vonderstein K , Pasto J , Edlund K , et al. Erratum for Panayiotou et al. , “ Viperin Restricts Zika Virus and Tick-Borne Encephalitis Virus Replication by Targeting NS3 for Proteasomal Degradation .” J Virol . 2018 Jun 15 ; 92 ( 12 ): e00501 – 18 . OpenUrl PubMed 89. ↵ Chiramel AI , Meyerson NR , McNally KL , Broeckel RM , Montoya VR , Méndez-Solís O , et al. TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation . Cell Rep . 2019 Jun ; 27 ( 11 ): 3269 – 3283 .e6. OpenUrl CrossRef PubMed 90. ↵ Welsch S , Miller S , Romero-Brey I , Merz A , Bleck CKE , Walther P , et al. Composition and Three-Dimensional Architecture of the Dengue Virus Replication and Assembly Sites . Cell Host Microbe . 2009 Apr ; 5 ( 4 ): 365 – 75 . OpenUrl CrossRef PubMed Web of Science 91. Överby AK , Popov VL , Niedrig M , Weber F . Tick-borne encephalitis virus delays interferon induction and hides its double-stranded RNA in intracellular membrane vesicles . J Virol . 2010 ; 92. ↵ Andronov L , Han M , Zhu Y , Balaji A , Roy AR , Barentine AES , et al. Nanoscale cellular organization of viral RNA and proteins in SARS-CoV-2 replication organelles . Nat Commun . 2024 May 31 ; 15 ( 1 ): 4644 . OpenUrl CrossRef PubMed 93. ↵ Ci Y , Shi L . Compartmentalized replication organelle of flavivirus at the ER and the factors involved . Cell Mol Life Sci . 2021 Jun ; 78 ( 11 ): 4939 – 54 . OpenUrl CrossRef PubMed 94. ↵ Roosendaal J , Westaway EG , Khromykh A , Mackenzie JM . Regulated Cleavages at the West Nile Virus NS4A-2K-NS4B Junctions Play a Major Role in Rearranging Cytoplasmic Membranes and Golgi Trafficking of the NS4A Protein . J Virol . 2006 May ; 80 ( 9 ): 4623 – 32 . OpenUrl Abstract / FREE Full Text 95. ↵ Miller S , Kastner S , Krijnse-Locker J , Bühler S , Bartenschlager R . The Non-structural Protein 4A of Dengue Virus Is an Integral Membrane Protein Inducing Membrane Alterations in a 2K-regulated Manner . J Biol Chem . 2007 Mar ; 282 ( 12 ): 8873 – 82 . OpenUrl Abstract / FREE Full Text 96. ↵ Ambrose RL , Mackenzie JM . A Conserved Peptide in West Nile Virus NS4A Protein Contributes to Proteolytic Processing and Is Essential for Replication . J Virol . 2011 Nov ; 85 ( 21 ): 11274 – 82 . OpenUrl Abstract / FREE Full Text 97. ↵ Chazal M , Beauclair G , Gracias S , Najburg V , Simon-Lorière E , Tangy F , et al. RIG-I Recognizes the 5′ Region of Dengue and Zika Virus Genomes . Cell Rep . 2018 Jul ; 24 ( 2 ): 320 – 8 . OpenUrl CrossRef PubMed 98. ↵ Planas D , Bruel T , Staropoli I , Guivel-Benhassine F , Porrot F , Maes P , et al. Resistance of Omicron subvariants BA.2.75.2, BA.4.6, and BQ.1.1 to neutralizing antibodies . Nat Commun . 2023 Feb 14 ; 14 ( 1 ): 824 . OpenUrl CrossRef PubMed 99. ↵ Roesch F , OhAinle M . HIV-CRISPR: A CRISPR/Cas9 Screening Method to Identify Genes Affecting HIV Replication . BIO-Protoc [Internet ]. 2020 [cited 2024 Jul 18]; 10 ( 9 ). Available from: https://bio-protocol.org/e3614 View the discussion thread. Back to top Previous Next Posted April 06, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following The type I and III interferon responses restrict infection with tick-borne orthoflaviviruses through IFI6 Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share The type I and III interferon responses restrict infection with tick-borne orthoflaviviruses through IFI6 Felix Streicher , Devin Kenney , Vincent Caval , Maxime Chazal , Sophie-Marie Aicher , Ségolène Gracias , Ferdinand Roesch , Florian Douam , Nolwenn Jouvenet bioRxiv 2025.04.06.647422; doi: https://doi.org/10.1101/2025.04.06.647422 Share This Article: Copy Citation Tools The type I and III interferon responses restrict infection with tick-borne orthoflaviviruses through IFI6 Felix Streicher , Devin Kenney , Vincent Caval , Maxime Chazal , Sophie-Marie Aicher , Ségolène Gracias , Ferdinand Roesch , Florian Douam , Nolwenn Jouvenet bioRxiv 2025.04.06.647422; doi: https://doi.org/10.1101/2025.04.06.647422 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Microbiology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17690) Bioengineering (13892) Bioinformatics (41936) Biophysics (21451) Cancer Biology (18588) Cell Biology (25499) Clinical Trials (138) Developmental Biology (13378) Ecology (19899) Epidemiology (2067) Evolutionary Biology (24320) Genetics (15609) Genomics (22506) Immunology (17736) Microbiology (40394) Molecular Biology (17181) Neuroscience (88603) Paleontology (666) Pathology (2832) Pharmacology and Toxicology (4824) Physiology (7641) Plant Biology (15152) Scientific Communication and Education (2045) Synthetic Biology (4294) Systems Biology (9825) Zoology (2271)