Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis

preprint OA: closed
Full text JSON View at publisher
Full text 195,779 characters · extracted from preprint-html · click to expand
Exploring the moderating effects of SIRT1 and... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/12-510" }, "headline": "Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between...", "datePublished": "2023-05-17T16:23:37", "dateModified": "2024-05-08T16:54:27", "author": [ { "@type": "Person", "name": "Dedi Ardinata" }, { "@type": "Person", "name": "Novita Sari Harahap" }, { "@type": "Person", "name": "Nenni Dwi Aprianti Lubis" }, { "@type": "Person", "name": "Tetty Aman Nasution" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": " Background Relationship age, hemoglobin, and physical frailty have all been investigated in older people with more than one chronic disease. There has been little analysis of the relationship between hemoglobin, age, physical frailty, plasma levels of Sirtuin1 (SIRT1), and the gene polymorphism (SNP) rs7895833 A>G. The goal of this study was to find out how SIRT1 level, SNP rs7895833, hemoglobin, age, and physical frailty (frail score) are related in older Indonesian adults with comorbid chronic diseases. Methods This was an observational study. Demographic and clinical data were retrieved from the electronic health records of Universitas Sumatera Utara Hospital, Medan, Indonesia. Physical frailty, SIRT1 level, and SNP rs7895833 were measured using an appropriate and valid method. Purposive sampling was used to determine the eligibility of 132 elderly adults from November 2022 to February 2023. Results The indirect effect of hemoglobin on the frail score (FS) through age was negative and significant, according to a conditional mediation analysis (β=-0.0731; p=0.023). Meanwhile, the direct effect of hemoglobin on the FS was negative and not significant (β=0.1632; p=0.052). According to the conditional moderated mediation analysis, the size of the direct effect of age on FS was increased by genotype AG-GG and SIRT1 level (βlow=0.2647; p=0.002, βmiddle=0.2956; p<0.001, and βhigh=0.319; p<0.001). The size of the conditional indirect effect of Hemoglobin on FS through age was negative and significantly increased by SNP genotype AG-GG and SIRT1 level (βlow=-0.0647; p=0.032, βmiddle=-0.0723; p=0.024, and βhigh=-0.078; p=0.02). Conclusions Higher plasma levels of SIRT1 and the SNP genotype AG-GG may both contribute to physical frailty in the elderly population. Hemoglobin levels in the blood fall with age, which can negatively impact older persons who already have chronic diseases. However, the interactions between these factors are intricate, requiring more study to completely understand the processes underlying development. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/12-510", "name": "Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833..." } } ] } Home Browse Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Ardinata D, Sari Harahap N, Lubis NDA and Nasution TA. Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.12688/f1000research.133517.3 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Revised Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] Previously titled: Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis Dedi Ardinata https://orcid.org/0000-0002-7214-4295 1 , Novita Sari Harahap 2 , Nenni Dwi Aprianti Lubis 3 , Tetty Aman Nasution 4 Dedi Ardinata https://orcid.org/0000-0002-7214-4295 1 , Novita Sari Harahap 2 , Nenni Dwi Aprianti Lubis 3 , Tetty Aman Nasution 4 PUBLISHED 08 May 2024 Author details Author details 1 Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, North Sumatra, Indonesia 2 Department of Sport Science, Faculty of Sport Science, Universitas Negeri Medan, Medan, North Sumatra, Indonesia 3 Department of Nutrition, Faculty of Medicine, Universitas Sumatera Utara, Medan, North Sumatra, Indonesia 4 Department of Microbiology, Universitas Sumatera Utara, Medan, North Sumatra, Indonesia Dedi Ardinata Roles: Conceptualization, Formal Analysis, Investigation, Methodology, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing Novita Sari Harahap Roles: Data Curation, Formal Analysis, Funding Acquisition, Methodology, Project Administration, Resources Nenni Dwi Aprianti Lubis Roles: Data Curation, Funding Acquisition, Investigation, Methodology, Project Administration, Validation, Writing – Review & Editing Tetty Aman Nasution Roles: Conceptualization, Formal Analysis, Investigation, Methodology, Validation, Writing – Original Draft Preparation, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the Genomics and Genetics gateway. Abstract Background Relationship age, hemoglobin, and physical frailty have all been investigated in older people with more than one chronic disease. There has been little analysis of the relationship between hemoglobin, age, physical frailty, plasma levels of Sirtuin1 (SIRT1), and the gene polymorphism (SNP) rs7895833 A>G. The goal of this study was to find out how SIRT1 level, SNP rs7895833, hemoglobin, age, and physical frailty (frail score) are related in older Indonesian adults with comorbid chronic diseases. Methods This was an observational study. Demographic and clinical data were retrieved from the electronic health records of Universitas Sumatera Utara Hospital, Medan, Indonesia. Physical frailty, SIRT1 level, and SNP rs7895833 were measured using an appropriate and valid method. Purposive sampling was used to determine the eligibility of 132 elderly adults from November 2022 to February 2023. Results The indirect effect of hemoglobin on the frail score (FS) through age was negative and significant, according to a conditional mediation analysis (β=-0.0731; p=0.023). Meanwhile, the direct effect of hemoglobin on the FS was negative and not significant (β=0.1632; p=0.052). According to the conditional moderated mediation analysis, the size of the direct effect of age on FS was increased by genotype AG-GG and SIRT1 level (βlow=0.2647; p=0.002, βmiddle=0.2956; p<0.001, and βhigh=0.319; p<0.001). The size of the conditional indirect effect of Hemoglobin on FS through age was negative and significantly increased by SNP genotype AG-GG and SIRT1 level (βlow=-0.0647; p=0.032, βmiddle=-0.0723; p=0.024, and βhigh=-0.078; p=0.02). Conclusions Higher plasma levels of SIRT1 and the SNP genotype AG-GG may both contribute to physical frailty in the elderly population. Hemoglobin levels in the blood fall with age, which can negatively impact older persons who already have chronic diseases. However, the interactions between these factors are intricate, requiring more study to completely understand the processes underlying development. READ ALL READ LESS Keywords Hemoglobin, physical frailty, SIRT1 expression, SNP rs7895833, moderated mediation analysis. Corresponding Author(s) Dedi Ardinata ( [email protected] ) Close Corresponding author: Dedi Ardinata Competing interests: No competing interests were disclosed. Grant information: This study was funded by the Universitas Sumatera Utara through the TALENTA scheme 2022 with contract No. 335/UN5.2.3.1/PPM/KP-TALENTA/2022. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2024 Ardinata D et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Ardinata D, Sari Harahap N, Lubis NDA and Nasution TA. Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.12688/f1000research.133517.3 ) First published: 17 May 2023, 12 :510 ( https://doi.org/10.12688/f1000research.133517.1 ) Latest published: 08 May 2024, 12 :510 ( https://doi.org/10.12688/f1000research.133517.3 ) Revised Amendments from Version 2 We acknowledge the importance of analyzing the impact of comorbidities and individual BMI scores on the relationships studied. However, due to the high prevalence of multiple comorbidities in our study population and the relatively small sample size in each subgroup, we were unable to conduct these analyses. This limitation has been added to the revised manuscript. Regarding the rs7895833 SNP, we have included information about its biological impacts in the background section. However, a thorough literature search did not yield specific data on the population distribution of this SNP in Indonesia and North Sumatra, highlighting a gap in current knowledge and the need for future research to investigate the prevalence and potential effects of this genetic variation in these populations. We also recognize the importance of exploring subjects' lifestyle factors, such as routine exercise and diet, which may influence plasma SIRT1 levels. Unfortunately, we did not collect detailed data on these factors, limiting our ability to analyze their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study. Despite these limitations, we believe that our core conclusions remain valid. However, we agree that addressing these factors could further improve our introduction, method, and discussion sections, particularly in terms of the study's limitations. We appreciate the reviewer's valuable input and hope that our responses adequately address their concerns. We acknowledge the importance of analyzing the impact of comorbidities and individual BMI scores on the relationships studied. However, due to the high prevalence of multiple comorbidities in our study population and the relatively small sample size in each subgroup, we were unable to conduct these analyses. This limitation has been added to the revised manuscript. Regarding the rs7895833 SNP, we have included information about its biological impacts in the background section. However, a thorough literature search did not yield specific data on the population distribution of this SNP in Indonesia and North Sumatra, highlighting a gap in current knowledge and the need for future research to investigate the prevalence and potential effects of this genetic variation in these populations. We also recognize the importance of exploring subjects' lifestyle factors, such as routine exercise and diet, which may influence plasma SIRT1 levels. Unfortunately, we did not collect detailed data on these factors, limiting our ability to analyze their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study. Despite these limitations, we believe that our core conclusions remain valid. However, we agree that addressing these factors could further improve our introduction, method, and discussion sections, particularly in terms of the study's limitations. We appreciate the reviewer's valuable input and hope that our responses adequately address their concerns. See the authors' detailed response to the review by Made Putra Semadhi See the authors' detailed response to the review by Amit Singh READ REVIEWER RESPONSES Introduction Frailty has a yearly incidence rate of 4.34%, with a global prevalence rate of 13.6% among older adults. 1 In Indonesia, however, the number of people aged 60 and older was 18.1 million in 2010, representing 7.6% and is projected to rise to 33.7 million by 2025 and 48.2 million by 2035. 2 Among older adult residents, it has been shown that the prevalence of multimorbidity is between 55 and 98%, anemia was within 19 and 76%, and frailty is around 70 and 93%. 3 – 5 According to the literature, older adults who have more chronic diseases are more vulnerable to the risk developing anemia. 6 Anemia and frailty in older adults were found to be correlated, according to a systematic review and meta-analysis of observational studies. 7 Some cross-sectional studies indicate a relationship between older adults’ frailty and hemoglobin levels. 8 , 9 The following hypothesis is therefore proposed: Hypothesis 1 (H1): Hemoglobin is negatively related to FS. The aging process or the presence of comorbidities are associated to the development of frailty. 10 Frailty and age-related chronic diseases are not only often associated, but one increases the risk of the other, suggesting a bidirectional association between frailty and comorbidity aging-related disorders. 11 , 12 The pathobiology of aging relates chronic disease, multimorbidity, and frailty, and this knowledge provides criteria for diagnosis and management approaches. 13 Able to follow is the hypothesis: Hypothesis 2 (H2): Age is positively related to FS. Hemoglobin is a protein found in red blood cells that carries oxygen throughout the body. 14 Low hemoglobin levels, known as anemia, are a common condition in older adults and can be caused by a variety of factors, including nutritional deficiencies, chronic diseases, and medications 15 which can lead to a decrease in physical function and an increased risk of frailty. Age is a major risk factor for physical frailty 16 , 17 which is defined as a state of decreased physiological reserve and increased vulnerability to stressors. 18 As people age, they may experience declines in muscle mass and strength, balance and coordination, and cardiovascular and respiratory function, which can contribute to physical frailty. 19 Based on the preceding considerations, the following hypothesis is proposed: Hypothesis 3 (H3): Age mediates the relationship between hemoglobin and FS. Previous studies have indicated that the SIRT1 SNP rs7895833 is located in the promoter region of the SIRT1 gene, about 21kb upstream of the coding region. 20 Its location in the promoter suggests that it could influence SIRT1 gene expression levels. Altered SIRT1 levels caused by the SNP could dysregulate these processes and lead to much worse health outcomes, including chronic obstructive pulmonary disease, 21 cardiovascular diseases, 22 oxidative stress, 23 essential hypertension and type 2 diabetes mellitus, 24 coronary artery disease, 25 rheumatoid arthritis, 26 dyslipidaemia, 27 metabolic syndrome, 28 rheumatoid arthritis, 29 and neurodegenerative disease. 30 There was limited research on the specific interaction between SIRT1 SNP rs7895833, hemoglobin, age, and physical frailty. However, it is possible that these factors may be related to each other through various biological pathways. SIRT1 has been related to both frailty and deteriorating health outcomes. However, other investigations have produced inconsistent results. Using Fried’s criteria, there was no consistent correlation between SIRT1 and frailty in older people living in the community, 31 and there was no correlation between frailty and serum-induced SIRT1 expression. 32 Participants in the lowest quintile had a lower likelihood of being weak, but serum-induced SIRT1 expression was not related to age or mortality. 33 Kumar et al. , found frail people’s serum sirtuin levels (SIRT1 and SIRT3) were much lower than those of non-frail persons. 34 Frail older adults had higher levels of SIRT1 than robust older adults. 35 Even though the relationship of age, hemoglobin, and frailty in older adults has been studied, there is currently limited studies on the association of these three variables with plasma levels of SIRT1 and the SNP genotype rs7895833 in elderly adults with chronic disease comorbidity. As a consequence, we come to the following hypothesis: Hypothesis 4 (H4): SNP genotype AG-GG and plasma levels of SIRT1 negatively moderates the effect of hemoglobin on FS through age as a mediator. The purpose of this study was to investigate the effects of plasma levels of SIRT1 and the SIRT1 SNP rs7895833 A>G in the promoter region on the relationship between hemoglobin, age, and frailty in Indonesian older adults with chronic diseases comorbid. Methods This study follows ‘A Guideline for Reporting Mediation Analyses of Randomized Trials and Observational Studies (AGReMA) 36 and The Strengthening the Reporting of Observational studies in Epidemiology (STROBE). 37 We conducted observational (cohort) studies of the moderated mediation analyses to find any potential causal effects. The mediator role of age in the association between hemoglobin level and frail scale score is explained by plasma levels of SIRT1 and the NSP rs7895833 genotype serving as moderating variables. The study included 132 older adults who were scheduled to receive outpatient care at the Universitas Sumatera Utara Hospital in Medan, Indonesia, and who met the study criteria: men and women over the age of 60 with a complete electronic health record of laboratory and clinical data, as well as having chronic diseases one year prior. There are no mental or physical disorders that are interfering with their capacity to respond to questionnaire questions. A purposive sampling approach was used to choose the study subjects. The sample size was determined using the following formula 38 : n = Z 1 − α ∕ 2 2 p 1 − p d 2 Z 1-α/2 2 /22 (type I error 5%)=1.96, expected proportion in population based on previous studies (p)=18.7%, 39 absolute error/precision (d)=0.05. Measurements Sociodemographic, clinical, and laboratory data We used sociodemographic, clinical, and laboratory data results from an electronic health record database after clinical diagnoses were determined for each subject one year ago. Frailty assessment The physical frailty phenotype was assessed that used the frailty scale score. During face-to-face interviews with the patients, trained nursing staff used the Indonesian version of the FRAIL scale, which has been proven to be a reliable and valid screening tool for frailty syndrome assessment. 40 The FRAIL scale (FS) consists of five components: fatigue, resistance, ambulation, sickness, and weight loss. The FRAIL scale scores range from 0 to 5 (one point for each component; 0 represents best to 5 represents worst) and indicate robust (0), pre-frail (1 to 2), frail (3 to 5). The physical frailty phenotype was also treated as a continuous variable, ranging from 0 to 5, in the study. Blood sampling Blood samples were collected from each subject in line with approved protocols. Subjects were instructed to fast for at least 8 hours before blood collection, which took place between 8:00 and 10:00 a.m. Professional phlebotomists collected 2 mL of blood in tubes containing EDTA using a predefined method. Blood processing and DNA isolation The collected blood samples were immediately processed for plasma separation. Plasma samples were aliquoted and stored at -80°C until analysis. Genomic DNA was extracted from the residual white blood cells using a DNA isolation kit (Wizard ® , Madison, USA, A1120) and the manufacturer’s instructions. All pure DNA samples were kept at 2-8°C until PCR was used for SIRT1 genotyping. SIRT1 assay The plasma levels of SIRT1 was determined by a monoclonal antibody-based ELISA method using a commercially available human SIRT1 ELISA kit (Elabscience ® , Houston, USA, E-EL-H1546). Microtiter plates were coated with an antibody specific to human SIRT1. 100 μL standard and plasma samples were pipetted into the appropriate wells, and the protocol was followed by using a secondary antibody and then avidin conjugated horseradish peroxidase. The formation of horseradish peroxidase was measured using ELISA reader (Thermo Fisher Scientific, Finland) at 450 nm. Seven different concentrations of purified SIRT1 (20, 10, 5, 2.500, 1.250, 0.630, and 0.31 ng/mL) were used to plot a standard curve. The inter- and intra-assay coefficients of variation were 4.04% and 4.55% respectively, with a detection range of 0.31–20 ng/mL. Determination of SIRT1 gene polymorphisms The single nucleotide polymorphism (SNP) rs7895833 was selected because it is one of the most frequent polymorphisms in the SIRT1 gene, and has been associated frailty and several diseases. SIRT1 rs7895833 A>G in the promoter region 41 were analysed using polymerase chain reactions with two-pair primers (PCR-CTPP) assay with minor modifications. 42 The SIRT1 gene encompassing rs7895833 A>G, polymorphic sites were amplified by PCR using the primers. 41 Briefly, 25 ml total PCR mixtures containing 100–200 ng DNA, 10.0 pmol of each primers, 1.0 mM dNTP (deoxynucleotide triphosphates), 25 mM MgCl2 and 2.5U Taq DNA polymerase in the supplied reaction buffer (Taq Buffer with (NH 4 ) 2 SO 4 ) were prepared. PCR was performed with the primers were the following: Forward primer 1: CCCAGGGTTCAACAAATCTATGTTG Forward primer 2: CCCAGGGTTCAACAAATCTATGTTG Reverse primer 1: GCTTCCTAATCTCCATTACGTTGAC Reverse primer 2: CCTCCCAGTCAACGACTTTATC with the initial denaturation at 95°C for 10 min.; 30 cycles of 95°C for 1 min., 64°C for rs7895833 A>G polymorphism, PCR products were visualized on a 2% agarose gel with ethidium bromide staining and genotyped. The genotypes for polymorphism were defined by 3 distinct banding patterns ( Figure 1 ); for rs7895833 AG polymorphism: 320, 241 bp for AA genotype; 320, 241 and 136 bp for AG genotype; and 320, 136 bp for GG genotype. 41 Figure 1. SIRT1 SNP rs7895833 A>G representative PCR gel electrophoresis images. Statistical evaluation Hardy–Weinberg equilibrium tests were performed with Hardy-Weinberg Equilibrium online calculator. All statistical analyses were carried out using statistical tool jamovi ver.2.3. and the significance was set at p<0.05 (two-tail). Descriptive statistics were used to examine all of the subject’s characteristics. Normally distributed variables were reported using means and standard deviations, while non-normally distributed ones were summarized with medians and ranges. Qualitative variables were described using the numbers of events and frequencies. The correlation plot (Qgraph) created with jamovi’s seolmatrix. This module was used to determine how the potential major variables interacted with one another. 43 The jAMM GLM Mediation Model was used to analysis the conditional process. The conditional process analysis to determine how much more the mechanism(s) by which an effect operates is conditional on or varies depending on the nature, environment, stimulus, or individual variations. 44 Mediation and moderation could be integrated analytically as a conditional process model in a variety of ways, depending on which step of the mediation process is moderated, the number of mediators, the number of moderators, and whether or not the direct effect is likewise moderated. 45 Mediating effect An analysis of mediation was investigated to assess if age mediated the relation between hemoglobin level and frail score. This model was used to determine if hemoglobin and frail score had a considerable indirect influence. When mediator variables are included, the direct effect is diminished but still statistically significant; this effect is known as “partial mediation”. Complete mediation shows that the direct effect is no longer significant when mediator variables have been included. 46 Moderating effect A subgroup evaluation was carried in the multiple-mediation model to see whether there was a moderating effect on simple pathways. It was considered that the existence of the moderation effect in this path was shown by the statistically significant difference in the path coefficient between the two variables. 47 Moderated mediation Testing for mediation effects in each subgroup will lead in a biased estimated parameter and low statistical power, in accordance with Edwards’ hypothesis. The estimated parameters, including the total, indirect, and direct effects of the moderated mediation model, were conducted by integrating moderation and mediation models. Subgrouping analysis was solely used to test which path the moderator affected. 48 , 49 Before testing all mediational hypotheses, conditional process analysis depicting all interactions was developed using the general linear mediation model (i.e., the GLM mediation model) with factor coding “dummies” for genotypes AA=0 and AG-GG = 1 and covariates scaling “standardized” for hemoglobin level and plasma levels of SIRT1. A standard (delta method) procedure that leverages the approximation from the central limit theorem 50 was used to test the significance of the total and indirect effects, and the coefficient confidence intervals were deemed statistically significant if they did not include zero. Ethical considerations This study was authorized by the Universitas Sumatera Utara Health Ethical Committee under the number 1097/KEPK/USU/2022. Each participant completed a structured questionnaire after signing informed consent, which included questions about their demographics, level of physical frailty (Frail scale), and willingness to submit a blood sample. The Declaration of Helsinki ethical principles were followed during the study’s conduction. Results Hardy–Weinberg equilibrium tests The genotypic frequencies of the SNP rs7895833 A>G in the SIRT1 gene were not in accordance with those expected by Hardy-Weinberg equilibrium in the current investigation, confirming a previous study. 51 We looked at several possibilities: first, we evaluated the possibility of recruiting bias. Second, faults in the real-time PCR genotyping experiment. In each batch, however, proper controls were applied, and the probes used were definitely capable of discriminating between genotypes. Third, the Hardy-Weinberg departure occurred by chance since the observed and expected genotype frequency variations were minimal. Characteristics of the study’s subjects This study included 132 eligible subjects. More than half of the participants were female (51.5%). The median age was 65 (range: 60 to 85), and the FS was 1 (range: 0 to 3). Meanwhile, the mean hemoglobin level was 12.35 (±1.8) mg/dL, and the plasma SIRT1 level was 57.1 (±32.3) ng/ml. Table 1 shows the study subjects’ detailed characteristics. Table 1. Demographic, clinical and genotype characteristics of elderly adults with multimorbid (n=132). Characteristics Characteristics Age (year) 65 (60-85) a Comorbidities Sex (Female) 68 (51.5) b Diabetes mellitus 82 (62.12) b Frail score 1 (0-3) a Cardiovascular disease 81 (61.36) b %BMI loss 1 year 2.06 (-12.2 – 24.6) a Hypertension 58 (43.94) b Sirtuin1 plasma level (ng/ml) 57.1 (32.3) c Arthritis 49 (37.12) b Systolic Blood Pressure (mmHg) 138.5 (21.7) c Stroke 35 (26.52) b Diastolic Blood Pressure (mmHg) 75.13 (10.81) c Chronic lung disease 23 (17.42) b Hemoglobin (g/dL) 12.35 (1.8) c Chronic kidney disease 17 (12.88) b Fasting blood glucose (mg/dL) 120 (83 – 420) a Cancer 7 (5.30) b HbA1c (%) 7.95 (2.49) c Genotype rs7895833 Total cholesterol (mg/dL) 195.18 (43.89) c AA 16 (12.1) b Triglyceride (mg/dL) 132 (53 – 669) a AG 79 (59.8) b High-density lipoprotein (mg/dL) 45 (20-445) a GG 37 (28.0) b Low-density lipoprotein (mg/dL) 133.74 (42.19) c AG-GG 116 (87.9) b Blood urea nitrogen (mg/dL) 20.3 (5.9 – 114.5) a AA-AG 95 (72.0) b Creatinine (mg/dL) 0.9 (0.1 – 15.1) a Allele rs7895833 A 111 (42.05) b G 153 (57.95) b a Median (min–max). b n (%). c Mean (±SD). The interrelationship between the potential main variables There was a negative relationship between hemoglobin levels and FS (r=-0.236, p=0.006). The age yielded similar results (r=-0.259, p=0.003). Meanwhile, age was also shown to have a significant positive association with FS (r=0.325, p=0.006) but a negative correlation with SIRT1 (r=-0.192, p=0.027). There were no statistically significant correlations or relationships detected between the SNP genotypes AA, AG-GG and any of the covariates ( Figure 2 ). Figure 2. The correlation plot of the interrelationship between the potential main variables. Hb (Hemoglobin); SIRT1 (Sirtuin1); Frail score (frailty); genotype (AA, AG-GG). Spearman's rank correlation with two tail significant: *p<0.05, **p<0.01, ***p<0.001. Hypothesis testing According to Baron and Kenny’s 47 criterion, there are three conditions for the existence of mediating role: 1) there is a significant correlation between independent variable (hemoglobin) and dependent variable (physical frailty); 2) there is a significant correlation between independent variable (hemoglobin) and mediating variables (age); 3) finally, the regression coefficients of independent variables (hemoglobin) and mediating variable (age) are simultaneously regressed to the dependent variable (physical frailty), the coefficient of mediator should be significant and the coefficient of independent variable become non-significant (complete mediation) or reduced (partial mediation). Figure 2 depicts them in accordance with the partial correlation’s results. It can be seen that hemoglobin and FS had a moderately strong negative relationship (r=-0.236, p=0.006), and that age and FS had a moderately strong positive relationship (r=0.325, p<0.001). Therefore, the first and second conditions are satisfied. Hence, H1 and H2 were accepted. The mediating effect of age Mediation analyses for direct effects, indirect mediation by age, and total effects are provided in Figure 3A and Table 2 . When age was included in the model, the following occurred: The direct effect of hemoglobin on FS was negative and non-significant (β=-0.1632, p=0.052). The indirect effect or indirect mediation of hemoglobin on FS was negative and significant (β=-0.0731, p=0.023) and the total effect was negative and significant (β=-0.2363, p=0.005). As a consequence, we may conclude that age completely mediates the negative relationship between hemoglobin and FS, with a significant model mediation effect of 13% (R 2 =0.13, p=0.001, F=9.68). As a result, H3 was accepted. This result reveals that lower hemoglobin levels may lead to physical frailty and that this effect was totally influenced by the increasing age of an elderly adult with comorbid chronic diseases. Figure 3. A conceptual diagram that shows hypothesized interactions between variables study; (A) Mediation model, (B) Moderated mediation model with two moderators. Table 2. The mediation effect of age between hemoglobin and frail score. Age ab a b c’ c -0.0731; 0.023 -0.2587; 0.002 0.2828; <0.001 -0.1632; 0.052 -0.2363; 0.005 Full model effect R 2 F p 0.13 3.43 0.004 Moderated mediation relationship The moderated mediation model was then put to the test. The SNP genotypes (AA and AG-GG) and SIRT1 were integrated into this model ( Figure 3B and Table 3 ). Conditional moderated mediation was assessed at levels of SIRT1 of 25% (low), 50% (middle), and 75% (high) and SNP genotypes of AA and AG-GG. We noted the following: The size of the conditional direct effect of age on FS was moderately positive and significantly increased by SNP genotypes AA and SIRT1 level (β middle =0.1828, p=0.034 and β high =0.2087, p=0.015). Whereas by genotype AG-GG and SIRT1 level (β low =0.2647, p=0.002, β middle =0.2956, p<0.001, and β high =0.319, p<0.001). The size of the conditional direct effect of hemoglobin on FS was moderately negative but non-significant by SNP genotypes AA, AG-GG, and all SIRT1 levels. The size of the conditional indirect effect of hemoglobin on FS through age was moderately negative and significantly increased by SNP genotypes AG-GG and SIRT1 level (β low =0.2647, p=0.002, β middle =0.2956, p<0.001, and β high =0.319, p<0.001). The total effect was negative and significant (β=-0.2246, p=0.008). such that the conditional negative indirect effect of hemoglobin on FS completely through age becomes stronger when the SNP genotype was AG-GG and levels of SIRT1 increase (moderated mediation). The SNP genotype and SIRT1 have a 14.1% moderated mediation effect (R 2 =0.141, p=0.004, F=3.43) Therefore, H4 was accepted. The study may have found that individuals with the AG-GG genotype and higher levels of SIRT1 may experience a stronger negative indirect effect of hemoglobin on physical frailty, compared to individuals with the AA genotype and lower levels of SIRT1. According to these analyses, decreased hemoglobin levels can lead to physical frailty, and this effect is completely mediated by age, through the SNP genotype AG-GG and elevated SIRT1 levels in elderly adults with comorbid chronic diseases. Table 3. The moderation effects of SNP genotypes AA, AG-GG, and SIRT1 between hemoglobin and frail score through age as mediation variables. Genotype * SIRT1 ab a b c’ c AA * 25% -0.0364; 0.137 -0.2444: 0.003 0.149; 0.085 -0.1633; 0.063 -0.2246: 0.008 AA * 50% -0.0447; 0.085 -0.2444: 0.003 0.1828; 0.034 -0.163; 0.064 -0.2246: 0.008 AA * 75% -0.051; 0.061 -0.2444: 0.003 0.2087; 0.015 -0.1625; 0.064 -0.2246: 0.008 AG-GG * 25% -0.0647; 0.032 -0.2444: 0.003 0.2647; 0.002 -0.1608; 0.055 -0.2246: 0.008 AG-GG * 50% -0.0723; 0.024 -0.2444: 0.003 0.2956; <0.001 -0.1594; 0.058 -0.2246: 0.008 AG-GG * 75% -0.078; 0.02 -0.2444: 0.003 0.319; <0.001 -0.1581; 0.061 -0.2246: 0.008 Full model effect R 2 F p 0.141 3.43 0.004 Discussion In terms of physical frailty, the current research was conducted in a moderated-moderated mediation or conditional moderated mediation relationship. Hypotheses have been created based on the conceptual model in Figure 1 and the findings of prior studies. The findings supported each of the research hypotheses. The model provided the five variables that supported our conceptual model. A recent study revealed that the relationship between low hemoglobin levels and physical frailty in older adults with one or more chronic diseases was affected by the age. Age is a major risk factor for physical frailty, 16 , 17 which is defined as a state of decreased physiological reserve and increased vulnerability to stressors. 18 As people age, they may experience declines in muscle mass and strength, balance and coordination, and cardiovascular and respiratory function, which can contribute to physical frailty. 19 Low hemoglobin levels, also called anemia, is a condition in which the number of red blood cells or the amount of hemoglobin in the blood drops. This usually happens in older adults. Causes of anemia in older adults include nutritional deficiency, chronic kidney disease, chronic inflammation, and occult blood loss from gastrointestinal malignancy, although in many patients the aetiology were unknown. 8 , 52 – 54 Previous studies have shown that the prevalence of physical frailty increases with age, and that low hemoglobin levels are also more common in older adults. 53 , 55 In addition, there is evidence to suggest that low hemoglobin levels are a risk factor for physical frailty, as anemia can lead to reduced physical function and decreased muscle mass. According to the study, low hemoglobin levels and physical frailty were related. Age completely mediated the effect of low hemoglobin levels on physical frailty, indicating that the relationship between these two variables was only significant when age was excluded. This study further showed that age completely mediated this effect and that SNP genotype AG-GG and high SIRT1 levels further moderated this effect in elderly adults with comorbid chronic diseases. This showed that the following two factors, including the existence of comorbid chronic diseases and a specific genetic variant (AG-GG) of SNP SIRT1, further moderated the relation between low hemoglobin levels and physical frailty. The correlation between low hemoglobin levels and physical frailty, in particular, may have depended on the levels of SIRT1, a protein involved in cellular metabolism, among older adults with comorbid chronic diseases and the AG-GG genotype. There was a complex interaction between hemoglobin levels, physical frailty, age, and genetic factors that could have big effects on older people with chronic conditions. The blood contained the important protein hemoglobin, which was responsible for carrying oxygen from the lungs to the body’s tissues and organs. 56 Decreased hemoglobin levels can lead to anemia, which can cause fatigue, weakness, and physical frailty. Physical frailty is a common concern for elderly people, and it is a complex condition affected by several factors, including age, chronic diseases, life styles, and heredity. Studies have shown that elderly adults, particularly those with chronic diseases, who have low hemoglobin levels are more plausible to become physically frail. 57 – 59 Furthermore, genetic factors may contribute to the development of physical frailty in elderly adults. The SIRT1 SNP rs7895833 A>G is closely associated with an increased risk of developing chronic diseases., such as cardiovascular disease, 22 , 25 chronic obstructive pulmonary disease, 21 Parkinson’s disease, 60 type 2 diabetes mellitus, 61 rheumatoid arthritis. 29 These chronic diseases can contribute to the development of physical frailty in elderly adults by reducing muscle mass, strength, and function 11 , 62 and also anemia. 63 SIRT1, a protein that protects cells from oxidative stress, controls glucose and lipid metabolism, and increases DNA integrity by binding to and deacetylating numerous substrates, may also have a role in physical frailty. 64 , 65 SIRT1 is regarded to be one of the potential molecules for promoting healthy aging because of its protective activities against numerous age-related diseases. Some studies have suggested that SIRT1 levels decrease with age; according to several studies, SIRT1 has been studied for its potential role in aging and age-related diseases. 23 , 66 , 67 Additionally, it is well known that it alters skeletal muscle metabolism and function, two major considerations in physical frailty. There were few studies on the role of SIRT1 in iron metabolism related anaemia of chronic disease or anaemia of inflammation that decreases plasma iron with suppression of erythropoiesis. A study showed that activating SIRT1 can reduce iron accumulation in splenic macrophages by inhibiting hepcidin. 68 This suggests that SIRT1 may inhibit ferroptosis by reducing intracellular iron levels. Another study showed that Intestinal SIRT1 deficiency improved iron metabolism in ethanol-induced liver injury in mice, reducing ferroptosis in hepatocytes. 69 There are still not many studies that show what role the SNP rs7895833 A>G, especially genotype AG-GG, plays in the activity of SIRT1 in older adults. The patients with the wild-type (AA) genotype had a significantly higher level of SIRT1 protein and a significantly lower level of endothelial nitric oxide synthase (eNOS) expression. Patients with the heterozygote mutant (AG) genotype also had a significantly higher level of SIRT1 protein, but eNOS expression was not significantly different. 22 Kilic et al. , who observed that older people carrying both the wild-type (AA) genotype and the heterozygote (AG) genotype had significantly higher SIRT1 expression levels in plasma, while older people carrying the heterozygote mutant (AG) genotype had a significantly higher SIRT1 level compared with older people carrying the wild-type (AA) genotype. 23 As was already mentioned, the NSP rs7895833 A>G affects the expression of the SIRT1 gene. It can impact the expression of the SIRT1 gene because it is located in the promoter region, 21 kb upstream of the gene. Thus, the activity of SIRT1 appears to be regulated by a promoter-dependent change in expression mechanism, which may have an impact on the elderly’s metabolism or the progression of neurological disease. Chromatin and transcription are regulated by SIRT1, linking NAD+ signaling and metabolism to the regulation of cellular activities. 70 Limitations This study has established moderated mediation analysis among the drivers of physical frailty in elderly adults with comorbid chronic diseases, but it is not without limitations. Some limitations of the present study should be noted: The study used an observational (cohort) design and studied only elderly individuals from a university hospital, which may constitute a selection bias, meaning that we may not have been able to establish a causal relationship between the variables of interest. Another constraint of the study is the sample size, which was insufficient to detect all associations with the other studied variables and could limit the generalizability of the results. Other factors, such as multi-comorbidity, BMI, lifestyle habits (including routine exercise, diet, etc.), environmental factors, and medications, could have influenced the results, and we may not have accounted for these variables. However, our findings are supported by previously published literature; several studies with probabilistic samples and a greater number of individuals reported changes in physical frailty in relation to hemoglobin, age, the polymorphism rs7895833, involving genotype AG-GG, and plasma SIRT1 levels. Conclusion The present study emphasizes the nuanced interaction of biological variables, especially SIRT1 plasma levels, NSP rs7895833 genotype, and age, in influencing physical frailty in elderly people with chronic diseases. Our findings suggests that SIRT1 levels and genotype modify the effect of age on frailty. Data availability Underlying data Figshare: Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases. A moderated mediation analysis, https://doi.org/10.6084/m9.figshare.22492603.v2 . 71 Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). Acknowledgments We would like to thank all the patients and Laboratory staffs in an integrated laboratory faculty of Medicine, Universitas Sumatera Utara and Universitas Sumatera Utara Hospital who participated in the study. References 1. Ofori-Asenso R, Chin KL, Mazidi M, et al. : Global Incidence of Frailty and Prefrailty among Community-Dwelling Older Adults: A Systematic Review and Meta-analysis. JAMA Netw. Open. 2019; 2 (8): e198398. PubMed Abstract | Publisher Full Text | Free Full Text 2. Adioetomo SM: Indonesia on the Threshold of Population Ageing. Indonesia: UNFPA; 2014; 65 (632). 3. Barnett K, Mercer SW, Norbury M, et al. : Epidemiology of multimorbidity and implications for health care, research, and medical education: A cross-sectional study. Lancet. 2012; 380 (9836): 37–43. Publisher Full Text 4. Biritwum RB, Minicuci N, Yawson AE, et al. : Prevalence of and factors associated with frailty and disability in older adults from China, Ghana, India, Mexico, Russia and South Africa. Maturitas. 2016; 91 : 8–18. PubMed Abstract | Publisher Full Text 5. Kojima G: Prevalence of Frailty in Nursing Homes: A Systematic Review and Meta-Analysis. J. Am. Med. Dir. Assoc. 2015; 16 : 940–945. PubMed Abstract | Publisher Full Text 6. Gandhi SJ, Hagans I, Nathan K, et al. : Prevalence, Comorbidity and Investigation of Anemia in the Primary Care Office. J. Clin. Med. Res. 2017; 9 (12): 970–980. Publisher Full Text 7. Palmer K, Vetrano DL, Marengoni A, et al. : The Relationship Between Anaemia and Frailty: A Systematic Review and Meta-Analysis of Observational Studies. J. Nutr. Health Aging. 2018; 22 : 965–974. Publisher Full Text 8. Ruan Y, Guo Y, Kowal P, et al. : Association between anemia and frailty in 13,175 community-dwelling adults aged 50 years and older in China. BMC Geriatr. 2019; 19 (1): 327. PubMed Abstract | Publisher Full Text | Free Full Text 9. Steinmeyer Z, Delpierre C, Soriano G, et al. : Hemoglobin concentration; A pathway to frailty. BMC Geriatr. 2020; 20 (1): 202. PubMed Abstract | Publisher Full Text | Free Full Text 10. Angioni D, Macaron T, Takeda C, et al. : Can We Distinguish Age-Related Frailty from Frailty Related to Diseases? Data from the MAPT Study. J. Nutr. Health Aging. 2020; 24 (10): 1144–1151. PubMed Abstract | Publisher Full Text 11. Angulo J, El Assar M, Rodríguez-Mañas L: Frailty and sarcopenia as the basis for the phenotypic manifestation of chronic diseases in older adults. Mol. Asp. Med. 2016; 50 : 1–32. Publisher Full Text 12. Kleipool EEF, Hoogendijk EO, Trappenburg MC, et al. : Frailty in older adults with cardiovascular disease: Cause, effect or both? Aging Dis. 2018; 9 (3): 489–497. PubMed Abstract | Publisher Full Text | Free Full Text 13. Thillainadesan J, Scott IA, Le Couteur DG: Frailty, a multisystem ageing syndrome. Age and Ageing. Oxford University Press; 2020; Vol. 49 . : p. 758–63. Publisher Full Text 14. Ahmed MH, Ghatge MS, Safo MK: Hemoglobin: Structure, Function and Allostery. Subcell. Biochem. 2020. PubMed Abstract | Publisher Full Text | Free Full Text 15. Stauder R, Thein SL: Anemia in the elderly: Clinical implications and new therapeutic concepts. Haematologica. 2014; 99 : 1127–1130. PubMed Abstract | Publisher Full Text | Free Full Text 16. Badrasawi M, Shahar S, Kaur Ajit Singh D: Risk Factors of Frailty Among Multi-Ethnic Malaysian Older Adults. Int. J. Gerontol. 2017; 11 (3): 154–160. Publisher Full Text 17. Wang X, Hu J, Wu D: Risk factors for frailty in older adults. Medicine (United States). Lippincott Williams and Wilkins; 2022; Vol. 101 . : p. E30169. 18. Fried LP, Cohen AA, Xue QL, et al. : The physical frailty syndrome as a transition from homeostatic symphony to cacophony. Nat Aging. 2021; 1 (1): 36–46. PubMed Abstract | Publisher Full Text | Free Full Text 19. Angulo J, El Assar M, Álvarez-Bustos A, et al. : Physical activity and exercise: Strategies to manage frailty. Redox Biol. 2020; 35 : 101513. PubMed Abstract | Publisher Full Text | Free Full Text 20. Shimoyama Y, Suzuki K, Hamajima N, et al. : Sirtuin 1 gene polymorphisms are associated with body fat and blood pressure in Japanese. Transl. Res. 2011; 157 (6): 339–347. PubMed Abstract | Publisher Full Text 21. Kalemci S, Gokdogan Edgunlu T, Kara M, et al. : Sirtuin gene polymorphisms are associated with chronic obstructive pulmonary disease in patients in Muğla province. Kardiochirurgia i Torakochirurgia Polska. 2014; 3 (3): 306–310. Publisher Full Text 22. Kilic U, Gok O, Bacaksiz A, et al. : SIRT1 gene polymorphisms affect the protein expression in cardiovascular diseases. PLoS One. 2014; 9 (2): e90428. PubMed Abstract | Publisher Full Text | Free Full Text 23. Kilic U, Gok O, Erenberk U, et al. : A Remarkable Age-Related Increase in SIRT1 Protein Expression against Oxidative Stress in Elderly: SIRT1 Gene Variants and Longevity in Human. PLoS One. 2015; 10 : 10. Publisher Full Text Reference Source 24. Mahmoud AA, Ali AHK, Eldin EN: Sirtuin 1 gene rs2273773 C > T single nucleotide polymorphism and protein oxidation markers in asthmatic patients. Egypt. J. Med. Hum. Genet. 2016; 17 (2): 191–196. Publisher Full Text 25. Ramkaran P, Moodley D, Chuturgoon A, et al. : Sirtuin 1 rs1467568 and rs7895833 in South African Indians with early-onset coronary artery disease. Cardiovasc. J. Afr. 2016; 27 : 213–217. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source 26. Sabry D, Kaddafy SR, Abdelaziz AA, et al. : Association of SIRT-1 Gene Polymorphism and Vitamin D Level in Egyptian Patients With Rheumatoid Arthritis. J. Clin. Med. Res. 2018; 10 (3): 189–195. Publisher Full Text 27. Casarotto AAF, Galera BB, Sumiyoshi LM, et al. : Polymorphism rs7895833 in the SIRT1 gene and its association with dyslipidaemia in the elderly. Rev. Esp. Geriatr. Gerontol. 2019; 54 (4): 214–219. PubMed Abstract | Publisher Full Text 28. Tao TT, Lin XH, Tang SJ, et al. : Association of genetic variants in the Sirt1 and Nrf2 genes with the risk of metabolic syndrome in a Chinese Han population. BMC Endocr. Disord. 2022; 22 (1): 84. PubMed Abstract | Publisher Full Text | Free Full Text 29. Zhou J, He YW, Fu L, et al. : Gene polymorphisms of SIRT1 in patients with rheumatoid arthritis. Int. J. Rheum. Dis. 2022; 25 (2): 210–217. PubMed Abstract | Publisher Full Text 30. Siwak M, Maślankiewicz M, Nowak-Zduńczyk A, et al. : Analysis of rs7895833 polymorphism of SIRT1 gene and its influence on the risk occurrence and progression of neurodegenerative disease, such as primary open-angle glaucoma in a Polish population. J. Pre-Clin. Clin. Res. 2022 Dec 27; 16 (4): 127–130. Publisher Full Text 31. Fried LP, Tangen CM, Walston J, et al. : Frailty in older adults: Evidence for a phenotype. J. Gerontol. A Biol. Sci. Med. Sci. 2001; 56 (3): M146–M157. Publisher Full Text 32. Le Couteur DL , Benson V, Mcmahon A, et al. : Determinants of serum-induced SIRT1 expression in older men: the CHAMP study. J. Gerontol. A Biol. Sci. Med. Sci. 2011; 66 (1): 3–8. PubMed Abstract | Publisher Full Text Reference Source 33. Razi S, Cogger V, Kennerson M, et al. : SIRT1 Polymorphisms and Serum-Induced SIRT1 Protein Expression in Aging and Frailty: The CHAMP Study.2017. Reference Source 34. Kumar R, Mohan N, Upadhyay A, et al. : Identification of serum sirtuins as novel noninvasive protein markers for frailty. Aging Cell. 2014; 13 : 975–980. Publisher Full Text Reference Source 35. Ma L, Niu H, Sha G, et al. : Serum SIRT1 is Associated with Frailty and Adipokines in Older Adults. J. Nutr. Health Aging. 2018; 23 : 246–250. Publisher Full Text Reference Source 36. Lee H, Cashin AG, Lamb SE, et al. : A Guideline for Reporting Mediation Analyses of Randomized Trials and Observational Studies: The AGReMA Statement. JAMA. 2021; 326 (11): 1045–1056. PubMed Abstract | Publisher Full Text | Free Full Text 37. Cuschieri S: The STROBE guidelines. Saudi J. Anaesth. 2019; 13 : 31–S34. PubMed Abstract | Publisher Full Text | Free Full Text 38. Charan J, Biswas T: How to calculate sample size for different study designs in medical research? Indian J. Psychol. Med. 2013; 35 : 121–126. PubMed Abstract | Publisher Full Text | Free Full Text 39. Setiati S, Soejono CH, Harimurti K, et al. : Frailty and Its Associated Risk Factors: First Phase Analysis of Multicentre Indonesia Longitudinal Aging Study. Front. Med (Lausanne). 2021 Apr 29; 8 . 40. Dwipa L, Apandi M, Utomo PP, et al. : Adaptation and validation of the indonesian version of the frail scale and the sarc-f in older adults. Asian J. Gerontol. Geriatr. 2021; 16 (1). 41. Shimoyama Y, Suzuki K, Hamajima N, et al. : Sirtuin 1 gene polymorphisms are associated with body fat and blood pressure in Japanese. Transl. Res. 2011; 157 (6): 339–347. PubMed Abstract | Publisher Full Text Reference Source 42. Yin G, Mitsuda Y, Ezaki T, et al. : A new PCR method: One primer amplification of PCR-CTPP products. Mol. Biotechnol. 2012; 52 (2). 43. Epskamp S, Cramer AOJ, Waldorp LJ, et al. : Qgraph: Network visualizations of relationships in psychometric data. J. Stat. Softw. 2012; 48 : 48. Publisher Full Text 44. Hayes AF, Rockwood NJ: Conditional Process Analysis: Concepts, Computation, and Advances in the Modeling of the Contingencies of Mechanisms. Am. Behav. Sci. 2020; 64 (1): 19–54. Publisher Full Text 45. Hayes AF, Rockwood NJ: Regression-based statistical mediation and moderation analysis in clinical research: Observations, recommendations, and implementation. Behav. Res. Ther. 2017; 98 : 39–57. PubMed Abstract | Publisher Full Text 46. Hayes AF: Partial, conditional, and moderated moderated mediation: Quantification, inference, and interpretation. Commun. Monogr. 2018; 85 (1): 4–40. Publisher Full Text 47. Baron RM, Kenny DA: The moderator-mediator variable distinction in social psychological research: Conceptual, strategic, and statistical considerations. J. Pers. Soc. Psychol. 1986; 51 (6): 1173–1182. PubMed Abstract | Publisher Full Text 48. Edwards JR, Lambert LS: Methods for integrating moderation and mediation: A general analytical framework using moderated path analysis. Psychol. Methods. 2007; 12 (1): 1–22. PubMed Abstract | Publisher Full Text 49. Preacher KJ, Hayes AF: Asymptotic and resampling strategies for assessing and comparing indirect effects in multiple mediator models. Behav. Res. Methods. 2008; 40 : 879–891. PubMed Abstract | Publisher Full Text 50. Deng A, Knoblich U, Lu J: Applying the Delta Method in Metric Analytics.2018. 51. Tagliari CFdS, de Oliveira CN , Vogel GM, et al. : Investigation of SIRT1 gene variants in HIV-associated lipodystrophy and metabolic syndrome. Genet. Mol. Biol. 2020; 43 (1): e20190142. PubMed Abstract | Publisher Full Text | Free Full Text 52. Pires Corona L, Drumond Andrade FC, de Oliveira Duarte YA , et al. : The relationship between anemia, hemoglobin concentration and frailty in Brazilian older adults. J. Nutr. Health Aging. 2015; 19 (9): 935–940. Publisher Full Text 53. Corona LP, Duarte YA d O, Lebrão ML: Prevalence of anemia and associated factors in older adults: Evidence from the SABE Study. Rev. Saude Publica. 2014; 48 (5): 431–723. PubMed Abstract | Publisher Full Text | Free Full Text 54. Katsumi A, Abe A, Tamura S, et al. : Anemia in older adults as a geriatric syndrome: A review. Geriatr. Gerontol. Int. 2021; 21 (7): 549–554. PubMed Abstract | Publisher Full Text 55. Lee CT, Chen MZ, Yip CYC, et al. : Prevalence of Anemia and Its Association with Frailty, Physical Function and Cognition in Community-Dwelling Older Adults: Findings from the HOPE Study. J. Nutr. Health Aging. 2021; 25 (5): 679–687. PubMed Abstract | Publisher Full Text 56. Roy CN: Anemia in Frailty. Clin. Geriatr. Med. 2011; 27 : 67–78. PubMed Abstract | Publisher Full Text | Free Full Text 57. Baker GT, Martin GR: Biological Aging and Longevity: Underlying Mechanisms and Potential Intervention Strategies. J. Aging Phys. Act. 2016; 2 (4): 304–328. Publisher Full Text 58. Caprara G: Diet and longevity: The effects of traditional eating habits on human lifespan extension. Med. J. Nutrition Metab. 2018; 11 (3): 261–294. Publisher Full Text 59. Pignatti C, D’adamo S, Stefanelli C, et al. : Nutrients and pathways that regulate health span and life span. Geriatrics (Switzerland). 2020; 5 . Publisher Full Text 60. Chen X, Mai H, Chen X, et al. : Rs2015 Polymorphism in miRNA Target Site of Sirtuin2 Gene Is Associated with the Risk of Parkinson’s Disease in Chinese Han Population. Biomed. Res. Int. 2019; 2019 : 1–8. Publisher Full Text 61. Mahmoud AA, Moghazy HM, Ezat MAW: Association of sirtuin 1 gene single nucleotide polymorphisms with type 2 diabetes mellitus in essential hypertension patients. Meta Gene. 2016; 10 : 8–12. Publisher Full Text 62. Zazzara MB, Vetrano DL, Carfì A, et al. : Frailty and chronic disease. Panminerva Med. 2019; 61 . Publisher Full Text 63. Madu AJ, Ughasoro MD: Anaemia of Chronic Disease: An In-Depth Review. Med. Princ. Pract. 2017; 26 : 1–9. PubMed Abstract | Publisher Full Text | Free Full Text 64. Guarente L: Sirtuins, Aging, and Medicine. N. Engl. J. Med. 2011; 364 (23): 2235–2244. Publisher Full Text 65. Zia A, Sahebdel F, Farkhondeh T, et al. : A review study on the modulation of SIRT1 expression by miRNAs in aging and age-associated diseases. Int. J. Biol. Macromol. 2021; 188 : 52–61. Publisher Full Text 66. Chen C, Zhou M, Ge Y, et al. : SIRT1 and aging related signaling pathways. Mech. Ageing Dev. 2020; 187 : 111215. Publisher Full Text 67. Manjula R, Anuja K, Alcain FJ: SIRT1 and SIRT2 Activity Control in Neurodegenerative Diseases. Front. Pharmacol. 2021; 11 . PubMed Abstract | Publisher Full Text | Free Full Text 68. Xin H, Wang M, Tang W, et al. : Hydrogen Sulfide Attenuates Inflammatory Hepcidin by Reducing IL-6 Secretion and Promoting SIRT1-Mediated STAT3 Deacetylation. Antioxid. Redox Signal. 2016; 24 (2): 70–83. PubMed Abstract | Publisher Full Text | Free Full Text 69. Zhou Z, Ye TJ, DeCaro E, et al. : Intestinal SIRT1 Deficiency Protects Mice from Ethanol-Induced Liver Injury by Mitigating Ferroptosis. Am. J. Pathol. 2020; 190 (1): 82–92. PubMed Abstract | Publisher Full Text | Free Full Text 70. Zhang T, Kraus WL: SIRT1-dependent regulation of chromatin and transcription: Linking NAD+ metabolism and signaling to the control of cellular functions. Biochim. Biophys. Acta. 2010; 1804 : 1666–1675. PubMed Abstract | Publisher Full Text | Free Full Text 71. Ardinata D, Harahap NS, Lubis NDA, et al. : Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases. A moderated mediation analysis. Dataset. figshare. 2023. Publisher Full Text Comments on this article Comments (0) Version 3 VERSION 3 PUBLISHED 17 May 2023 ADD YOUR COMMENT Comment Author details Author details 1 Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, North Sumatra, Indonesia 2 Department of Sport Science, Faculty of Sport Science, Universitas Negeri Medan, Medan, North Sumatra, Indonesia 3 Department of Nutrition, Faculty of Medicine, Universitas Sumatera Utara, Medan, North Sumatra, Indonesia 4 Department of Microbiology, Universitas Sumatera Utara, Medan, North Sumatra, Indonesia Dedi Ardinata Roles: Conceptualization, Formal Analysis, Investigation, Methodology, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing Novita Sari Harahap Roles: Data Curation, Formal Analysis, Funding Acquisition, Methodology, Project Administration, Resources Nenni Dwi Aprianti Lubis Roles: Data Curation, Funding Acquisition, Investigation, Methodology, Project Administration, Validation, Writing – Review & Editing Tetty Aman Nasution Roles: Conceptualization, Formal Analysis, Investigation, Methodology, Validation, Writing – Original Draft Preparation, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information This study was funded by the Universitas Sumatera Utara through the TALENTA scheme 2022 with contract No. 335/UN5.2.3.1/PPM/KP-TALENTA/2022. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (3) version 3 Revised Published: 08 May 2024, 12:510 https://doi.org/10.12688/f1000research.133517.3 version 2 Revised Published: 16 Apr 2024, 12:510 https://doi.org/10.12688/f1000research.133517.2 version 1 Published: 17 May 2023, 12:510 https://doi.org/10.12688/f1000research.133517.1 Copyright © 2024 Ardinata D et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Ardinata D, Sari Harahap N, Lubis NDA and Nasution TA. Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.12688/f1000research.133517.3 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 3 VERSION 3 PUBLISHED 08 May 2024 Revised Views 0 Cite How to cite this report: Singh A. Reviewer Report For: Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.5256/f1000research.165990.r266845 ) The direct URL for this report is: https://f1000research.com/articles/12-510/v3#referee-response-266845 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 06 Jun 2024 Amit Singh , LMBI, National Institute on Aging, Baltimore, Maryland, USA Approved VIEWS 0 https://doi.org/10.5256/f1000research.165990.r266845 Authors have answered all my ... Continue reading READ ALL Authors have answered all my concerns, Manuscript can be approved. Competing Interests: No competing interests were disclosed. Reviewer Expertise: Molecular Biology, Immunology and Aging I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Singh A. Reviewer Report For: Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.5256/f1000research.165990.r266845 ) The direct URL for this report is: https://f1000research.com/articles/12-510/v3#referee-response-266845 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Version 2 VERSION 2 PUBLISHED 16 Apr 2024 Revised Views 0 Cite How to cite this report: Semadhi MP. Reviewer Report For: Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.5256/f1000research.164941.r253713 ) The direct URL for this report is: https://f1000research.com/articles/12-510/v2#referee-response-253713 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 02 May 2024 Made Putra Semadhi , Prodia National Reference Laboratory, Jakarta, Indonesia; Padjadjaran University, Sumedang, Indonesia Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.164941.r253713 For the methodology, 1. It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney ... Continue reading READ ALL For the methodology, 1. It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition. 2. For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results. 3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade). It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra. 4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable. 5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions 6. The conclusions drawn will be broader following additional updated explanations Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions drawn adequately supported by the results? Partly Competing Interests: No competing interests were disclosed. Reviewer Expertise: Biochemistry and Geriatrics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Semadhi MP. Reviewer Report For: Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.5256/f1000research.164941.r253713 ) The direct URL for this report is: https://f1000research.com/articles/12-510/v2#referee-response-253713 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 19 Jun 2024 Dedi Ardinata , Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia 19 Jun 2024 Author Response Reviewer's comments: It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled ... Continue reading Reviewer's comments: It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition. For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results. Author's response: Analyses with comorbidities and clustering of BMI scores may have a different impact on the relationship between the variables studied. This would provide some insight into potential differences across comorbidity subgroups and BMI scores. However, this study did not analyze the impact of comorbidities and individual BMI scores due to the high prevalence of multiple comorbidities in the study population and the relatively small sample size in each subgroup, so statistical comparisons could not be made. This is a limitation of this study, which we have added in the limitations section. Reviewer's comment: 3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade). Author's response: I have already added in the background It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra. Author's response: The biological impacts and population distribution of the rs7895833 A>G SNP, particularly in Indonesia and North Sumatra. However, after a thorough literature search, we were unable to find specific data or references regarding the population distribution of this SNP in these regions. This highlights a gap in the current knowledge and underscores the need for future studies to investigate the prevalence and potential effects of this genetic variation in Indonesian and North Sumatran populations. Such research could provide valuable insights into the role of this SNP in different ethnic and geographical contexts and help to better understand its potential implications for health outcomes in these populations. We have added a brief discussion of this limitation and the need for further research in the revised manuscript." Reviewer's comment: 4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable. Author's response: Moreover, we did not collect detailed data on the subjects' lifestyle habits, such as routine exercise and diet, which could potentially influence plasma SIRT1 levels. Previous studies have shown that regular physical activity and certain dietary patterns, such as caloric restriction, can modulate SIRT1 expression and activity. Therefore, the lack of information on these factors is a limitation of our study, as we cannot analysis for their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study. Reviewer's comment: 5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions. Author's response: I've already included the information in the method section. Reviewer's comment: 6. The conclusions drawn will be broader following additional updated explanations. Author's response: We both agree that our introduction, method, and discussion (especially about the study's limitations) could be better if we looked into the effects of some comorbidities, the BMI score subgroup, lifestyle factors (like regular exercise, diet, etc.), gave more information on the rs7895833 SNP, and made sure that everyone was given the same conditions for blood sampling. However, we believe that these factors would not fundamentally alter our core conclusions. Reviewer's comments: It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition. For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results. Author's response: Analyses with comorbidities and clustering of BMI scores may have a different impact on the relationship between the variables studied. This would provide some insight into potential differences across comorbidity subgroups and BMI scores. However, this study did not analyze the impact of comorbidities and individual BMI scores due to the high prevalence of multiple comorbidities in the study population and the relatively small sample size in each subgroup, so statistical comparisons could not be made. This is a limitation of this study, which we have added in the limitations section. Reviewer's comment: 3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade). Author's response: I have already added in the background It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra. Author's response: The biological impacts and population distribution of the rs7895833 A>G SNP, particularly in Indonesia and North Sumatra. However, after a thorough literature search, we were unable to find specific data or references regarding the population distribution of this SNP in these regions. This highlights a gap in the current knowledge and underscores the need for future studies to investigate the prevalence and potential effects of this genetic variation in Indonesian and North Sumatran populations. Such research could provide valuable insights into the role of this SNP in different ethnic and geographical contexts and help to better understand its potential implications for health outcomes in these populations. We have added a brief discussion of this limitation and the need for further research in the revised manuscript." Reviewer's comment: 4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable. Author's response: Moreover, we did not collect detailed data on the subjects' lifestyle habits, such as routine exercise and diet, which could potentially influence plasma SIRT1 levels. Previous studies have shown that regular physical activity and certain dietary patterns, such as caloric restriction, can modulate SIRT1 expression and activity. Therefore, the lack of information on these factors is a limitation of our study, as we cannot analysis for their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study. Reviewer's comment: 5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions. Author's response: I've already included the information in the method section. Reviewer's comment: 6. The conclusions drawn will be broader following additional updated explanations. Author's response: We both agree that our introduction, method, and discussion (especially about the study's limitations) could be better if we looked into the effects of some comorbidities, the BMI score subgroup, lifestyle factors (like regular exercise, diet, etc.), gave more information on the rs7895833 SNP, and made sure that everyone was given the same conditions for blood sampling. However, we believe that these factors would not fundamentally alter our core conclusions. Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 19 Jun 2024 Dedi Ardinata , Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia 19 Jun 2024 Author Response Reviewer's comments: It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled ... Continue reading Reviewer's comments: It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition. For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results. Author's response: Analyses with comorbidities and clustering of BMI scores may have a different impact on the relationship between the variables studied. This would provide some insight into potential differences across comorbidity subgroups and BMI scores. However, this study did not analyze the impact of comorbidities and individual BMI scores due to the high prevalence of multiple comorbidities in the study population and the relatively small sample size in each subgroup, so statistical comparisons could not be made. This is a limitation of this study, which we have added in the limitations section. Reviewer's comment: 3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade). Author's response: I have already added in the background It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra. Author's response: The biological impacts and population distribution of the rs7895833 A>G SNP, particularly in Indonesia and North Sumatra. However, after a thorough literature search, we were unable to find specific data or references regarding the population distribution of this SNP in these regions. This highlights a gap in the current knowledge and underscores the need for future studies to investigate the prevalence and potential effects of this genetic variation in Indonesian and North Sumatran populations. Such research could provide valuable insights into the role of this SNP in different ethnic and geographical contexts and help to better understand its potential implications for health outcomes in these populations. We have added a brief discussion of this limitation and the need for further research in the revised manuscript." Reviewer's comment: 4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable. Author's response: Moreover, we did not collect detailed data on the subjects' lifestyle habits, such as routine exercise and diet, which could potentially influence plasma SIRT1 levels. Previous studies have shown that regular physical activity and certain dietary patterns, such as caloric restriction, can modulate SIRT1 expression and activity. Therefore, the lack of information on these factors is a limitation of our study, as we cannot analysis for their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study. Reviewer's comment: 5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions. Author's response: I've already included the information in the method section. Reviewer's comment: 6. The conclusions drawn will be broader following additional updated explanations. Author's response: We both agree that our introduction, method, and discussion (especially about the study's limitations) could be better if we looked into the effects of some comorbidities, the BMI score subgroup, lifestyle factors (like regular exercise, diet, etc.), gave more information on the rs7895833 SNP, and made sure that everyone was given the same conditions for blood sampling. However, we believe that these factors would not fundamentally alter our core conclusions. Reviewer's comments: It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition. For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results. Author's response: Analyses with comorbidities and clustering of BMI scores may have a different impact on the relationship between the variables studied. This would provide some insight into potential differences across comorbidity subgroups and BMI scores. However, this study did not analyze the impact of comorbidities and individual BMI scores due to the high prevalence of multiple comorbidities in the study population and the relatively small sample size in each subgroup, so statistical comparisons could not be made. This is a limitation of this study, which we have added in the limitations section. Reviewer's comment: 3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade). Author's response: I have already added in the background It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra. Author's response: The biological impacts and population distribution of the rs7895833 A>G SNP, particularly in Indonesia and North Sumatra. However, after a thorough literature search, we were unable to find specific data or references regarding the population distribution of this SNP in these regions. This highlights a gap in the current knowledge and underscores the need for future studies to investigate the prevalence and potential effects of this genetic variation in Indonesian and North Sumatran populations. Such research could provide valuable insights into the role of this SNP in different ethnic and geographical contexts and help to better understand its potential implications for health outcomes in these populations. We have added a brief discussion of this limitation and the need for further research in the revised manuscript." Reviewer's comment: 4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable. Author's response: Moreover, we did not collect detailed data on the subjects' lifestyle habits, such as routine exercise and diet, which could potentially influence plasma SIRT1 levels. Previous studies have shown that regular physical activity and certain dietary patterns, such as caloric restriction, can modulate SIRT1 expression and activity. Therefore, the lack of information on these factors is a limitation of our study, as we cannot analysis for their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study. Reviewer's comment: 5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions. Author's response: I've already included the information in the method section. Reviewer's comment: 6. The conclusions drawn will be broader following additional updated explanations. Author's response: We both agree that our introduction, method, and discussion (especially about the study's limitations) could be better if we looked into the effects of some comorbidities, the BMI score subgroup, lifestyle factors (like regular exercise, diet, etc.), gave more information on the rs7895833 SNP, and made sure that everyone was given the same conditions for blood sampling. However, we believe that these factors would not fundamentally alter our core conclusions. Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Version 1 VERSION 1 PUBLISHED 17 May 2023 Views 0 Cite How to cite this report: Singh A. Reviewer Report For: Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.5256/f1000research.146512.r253712 ) The direct URL for this report is: https://f1000research.com/articles/12-510/v1#referee-response-253712 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 04 Apr 2024 Amit Singh , LMBI, National Institute on Aging, Baltimore, Maryland, USA Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.146512.r253712 Report for Ardinata et al.- Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis. Ardinata et ... Continue reading READ ALL Report for Ardinata et al.- Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis. Ardinata et al claim to study the effects of SIRT1 protein expression and the associated SIRT1 promoter SNP in Indonesian older adult cohort. They further correlated these levels with hemoglobin, age, and frailty with chronic diseases comorbid. Study emphasize the known SIRT1 effects in interesting cohort and will be useful for aging related studies. Study lacks in following areas and should be updated accordingly. Authors claim SIRT1 levels and its relationship with various parameters. It should be corrected in title and also in text that these are plasma levels of SIRT1 not cellular protein. Explanation of plasma source of SIRT1 should be provided. Manuscript holds just one data figure of genotyping gel. In genotyping gel image the marker lane is labelled as 50bp ladder, first, the marker bands are not clear and second if we follow the marker bands (which should be labelled for each band) the size doesn’t matches the genotype product DNA bands'. The 136bp according to the marker will be 75bp and 241bp will be 200bp and so on . Please lable the gel properly. Since, SIRT1 is major focus of the manuscript, authors are encouraged to show at least some correlation plots of all 132 donors with SIRT1 levels and frailty or other important parameter. Repetitions from introduction in discussion part should be avoided. Last paragraph of discussion has many typographical errors and there are also such errors thought out the manuscript, such mistakes should be avoided. Conclusions can be shortened and many extreme speculations can be avoided. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Partly Competing Interests: No competing interests were disclosed. Reviewer Expertise: Immunology, Aging, Inflammation I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Singh A. Reviewer Report For: Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.5256/f1000research.146512.r253712 ) The direct URL for this report is: https://f1000research.com/articles/12-510/v1#referee-response-253712 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 30 Apr 2024 Dedi Ardinata , Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia 30 Apr 2024 Author Response Dear Amit Singh Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on ... Continue reading Dear Amit Singh Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis." We appreciate the opportunity to clarify and improve our manuscript based on your feedback. Below, we address each of your concerns and describe the amendments we have made to the manuscript accordingly. Clarification of SIRT1 Levels (Plasma vs. Cellular): We have revised the title and the manuscript to explicitly state that the SIRT1 levels measured and discussed pertain to plasma levels, not cellular protein levels. To provide clarity, we have also added a brief explanation in the Methods section regarding the plasma source of SIRT1 and its relevance to our study's objectives. Genotyping Gel Image Clarification: We acknowledge the confusion regarding the genotyping gel image and appreciate your pointing out the discrepancies. We have revised the image to include a clearer representation of the marker bands and accurately labelled each band to correspond with the correct DNA size. Inclusion of Correlation Plots: Following your suggestion, we have now included correlation plots that depict the relationship between SIRT1 levels, frailty, and other critical parameters for all 132 participants. These plots provide a visual representation of our findings and strengthen the manuscript. Reduction of Repetitions and Typographical Errors: We carefully reviewed the manuscript to eliminate redundant information between the Introduction and Discussion sections. We have also conducted a thorough proofreading to correct typographical errors throughout the text. These changes aim to improve readability and accuracy, and we believe they significantly enhance the manuscript's quality. Revision of Conclusions: We have streamlined the Conclusions section to succinctly summarize our findings without speculative statements. The revised Conclusions focus on our study's contributions to the field and its implications for future research, avoiding overgeneralization. We hope that these revisions adequately address your concerns and improve the quality and clarity of our manuscript. We are grateful for your constructive feedback and the opportunity to enhance our work. We look forward to your further suggestions and the possibility of our manuscript being accepted for publication. Sincerely, Dedi Ardinata and co-authors Dear Amit Singh Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis." We appreciate the opportunity to clarify and improve our manuscript based on your feedback. Below, we address each of your concerns and describe the amendments we have made to the manuscript accordingly. Clarification of SIRT1 Levels (Plasma vs. Cellular): We have revised the title and the manuscript to explicitly state that the SIRT1 levels measured and discussed pertain to plasma levels, not cellular protein levels. To provide clarity, we have also added a brief explanation in the Methods section regarding the plasma source of SIRT1 and its relevance to our study's objectives. Genotyping Gel Image Clarification: We acknowledge the confusion regarding the genotyping gel image and appreciate your pointing out the discrepancies. We have revised the image to include a clearer representation of the marker bands and accurately labelled each band to correspond with the correct DNA size. Inclusion of Correlation Plots: Following your suggestion, we have now included correlation plots that depict the relationship between SIRT1 levels, frailty, and other critical parameters for all 132 participants. These plots provide a visual representation of our findings and strengthen the manuscript. Reduction of Repetitions and Typographical Errors: We carefully reviewed the manuscript to eliminate redundant information between the Introduction and Discussion sections. We have also conducted a thorough proofreading to correct typographical errors throughout the text. These changes aim to improve readability and accuracy, and we believe they significantly enhance the manuscript's quality. Revision of Conclusions: We have streamlined the Conclusions section to succinctly summarize our findings without speculative statements. The revised Conclusions focus on our study's contributions to the field and its implications for future research, avoiding overgeneralization. We hope that these revisions adequately address your concerns and improve the quality and clarity of our manuscript. We are grateful for your constructive feedback and the opportunity to enhance our work. We look forward to your further suggestions and the possibility of our manuscript being accepted for publication. Sincerely, Dedi Ardinata and co-authors Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 30 Apr 2024 Dedi Ardinata , Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia 30 Apr 2024 Author Response Dear Amit Singh Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on ... Continue reading Dear Amit Singh Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis." We appreciate the opportunity to clarify and improve our manuscript based on your feedback. Below, we address each of your concerns and describe the amendments we have made to the manuscript accordingly. Clarification of SIRT1 Levels (Plasma vs. Cellular): We have revised the title and the manuscript to explicitly state that the SIRT1 levels measured and discussed pertain to plasma levels, not cellular protein levels. To provide clarity, we have also added a brief explanation in the Methods section regarding the plasma source of SIRT1 and its relevance to our study's objectives. Genotyping Gel Image Clarification: We acknowledge the confusion regarding the genotyping gel image and appreciate your pointing out the discrepancies. We have revised the image to include a clearer representation of the marker bands and accurately labelled each band to correspond with the correct DNA size. Inclusion of Correlation Plots: Following your suggestion, we have now included correlation plots that depict the relationship between SIRT1 levels, frailty, and other critical parameters for all 132 participants. These plots provide a visual representation of our findings and strengthen the manuscript. Reduction of Repetitions and Typographical Errors: We carefully reviewed the manuscript to eliminate redundant information between the Introduction and Discussion sections. We have also conducted a thorough proofreading to correct typographical errors throughout the text. These changes aim to improve readability and accuracy, and we believe they significantly enhance the manuscript's quality. Revision of Conclusions: We have streamlined the Conclusions section to succinctly summarize our findings without speculative statements. The revised Conclusions focus on our study's contributions to the field and its implications for future research, avoiding overgeneralization. We hope that these revisions adequately address your concerns and improve the quality and clarity of our manuscript. We are grateful for your constructive feedback and the opportunity to enhance our work. We look forward to your further suggestions and the possibility of our manuscript being accepted for publication. Sincerely, Dedi Ardinata and co-authors Dear Amit Singh Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis." We appreciate the opportunity to clarify and improve our manuscript based on your feedback. Below, we address each of your concerns and describe the amendments we have made to the manuscript accordingly. Clarification of SIRT1 Levels (Plasma vs. Cellular): We have revised the title and the manuscript to explicitly state that the SIRT1 levels measured and discussed pertain to plasma levels, not cellular protein levels. To provide clarity, we have also added a brief explanation in the Methods section regarding the plasma source of SIRT1 and its relevance to our study's objectives. Genotyping Gel Image Clarification: We acknowledge the confusion regarding the genotyping gel image and appreciate your pointing out the discrepancies. We have revised the image to include a clearer representation of the marker bands and accurately labelled each band to correspond with the correct DNA size. Inclusion of Correlation Plots: Following your suggestion, we have now included correlation plots that depict the relationship between SIRT1 levels, frailty, and other critical parameters for all 132 participants. These plots provide a visual representation of our findings and strengthen the manuscript. Reduction of Repetitions and Typographical Errors: We carefully reviewed the manuscript to eliminate redundant information between the Introduction and Discussion sections. We have also conducted a thorough proofreading to correct typographical errors throughout the text. These changes aim to improve readability and accuracy, and we believe they significantly enhance the manuscript's quality. Revision of Conclusions: We have streamlined the Conclusions section to succinctly summarize our findings without speculative statements. The revised Conclusions focus on our study's contributions to the field and its implications for future research, avoiding overgeneralization. We hope that these revisions adequately address your concerns and improve the quality and clarity of our manuscript. We are grateful for your constructive feedback and the opportunity to enhance our work. We look forward to your further suggestions and the possibility of our manuscript being accepted for publication. Sincerely, Dedi Ardinata and co-authors Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Manjula R. Reviewer Report For: Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.5256/f1000research.146512.r243614 ) The direct URL for this report is: https://f1000research.com/articles/12-510/v1#referee-response-243614 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 20 Feb 2024 Ramu Manjula , Yale University, Connecticut, USA Approved VIEWS 0 https://doi.org/10.5256/f1000research.146512.r243614 This study aimed to investigate the relationship between SIRT1 levels, SNP rs7895833, hemoglobin levels, age, and physical frailty (frail score) among 132 older Indonesian adults with comorbid chronic diseases. The present study aligns with recent research suggesting that the association ... Continue reading READ ALL This study aimed to investigate the relationship between SIRT1 levels, SNP rs7895833, hemoglobin levels, age, and physical frailty (frail score) among 132 older Indonesian adults with comorbid chronic diseases. The present study aligns with recent research suggesting that the association between low hemoglobin levels and physical frailty among older adults with one or more chronic diseases is influenced by age. Furthermore, this study revealed that the SNP genotype AG-GG and high SIRT1 levels further moderated the relationship between low hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases. While multiple studies support the protective role of increased SIRT1 expression in the body, the study highlights that SNP rs7895833 A>G affects the expression of the SIRT1 gene. The manuscript is structured well, and the authors have proved their hypothesis. As mentioned by the authors, along with the sample size the strong limitations of this study are lifestyle habits, environmental factors, and medications, which could have influenced the results. I believe that conclusions cannot be drawn based on these results. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? I cannot comment. A qualified statistician is required. Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Sirtuin biology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Manjula R. Reviewer Report For: Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.5256/f1000research.146512.r243614 ) The direct URL for this report is: https://f1000research.com/articles/12-510/v1#referee-response-243614 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 3 VERSION 3 PUBLISHED 17 May 2023 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 Version 3 (revision) 08 May 24 read Version 2 (revision) 16 Apr 24 read Version 1 17 May 23 read read Ramu Manjula , Yale University, Connecticut, USA Amit Singh , National Institute on Aging, Baltimore, USA Made Putra Semadhi , Prodia National Reference Laboratory, Jakarta, Indonesia; Padjadjaran University, Sumedang, Indonesia Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Singh A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions. 06 Jun 2024 | for Version 3 Amit Singh , LMBI, National Institute on Aging, Baltimore, Maryland, USA 0 Views copyright © 2024 Singh A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Authors have answered all my concerns, Manuscript can be approved. Competing Interests No competing interests were disclosed. Reviewer Expertise Molecular Biology, Immunology and Aging I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Singh A. Peer Review Report For: Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.5256/f1000research.165990.r266845) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/12-510/v3#referee-response-266845 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Semadhi M. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 02 May 2024 | for Version 2 Made Putra Semadhi , Prodia National Reference Laboratory, Jakarta, Indonesia; Padjadjaran University, Sumedang, Indonesia 0 Views copyright © 2024 Semadhi M. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions For the methodology, 1. It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition. 2. For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results. 3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade). It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra. 4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable. 5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions 6. The conclusions drawn will be broader following additional updated explanations Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions drawn adequately supported by the results? Partly Competing Interests No competing interests were disclosed. Reviewer Expertise Biochemistry and Geriatrics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 19 Jun 2024 Dedi Ardinata, Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia Reviewer's comments: It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition. For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results. Author's response: Analyses with comorbidities and clustering of BMI scores may have a different impact on the relationship between the variables studied. This would provide some insight into potential differences across comorbidity subgroups and BMI scores. However, this study did not analyze the impact of comorbidities and individual BMI scores due to the high prevalence of multiple comorbidities in the study population and the relatively small sample size in each subgroup, so statistical comparisons could not be made. This is a limitation of this study, which we have added in the limitations section. Reviewer's comment: 3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade). Author's response: I have already added in the background It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra. Author's response: The biological impacts and population distribution of the rs7895833 A>G SNP, particularly in Indonesia and North Sumatra. However, after a thorough literature search, we were unable to find specific data or references regarding the population distribution of this SNP in these regions. This highlights a gap in the current knowledge and underscores the need for future studies to investigate the prevalence and potential effects of this genetic variation in Indonesian and North Sumatran populations. Such research could provide valuable insights into the role of this SNP in different ethnic and geographical contexts and help to better understand its potential implications for health outcomes in these populations. We have added a brief discussion of this limitation and the need for further research in the revised manuscript." Reviewer's comment: 4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable. Author's response: Moreover, we did not collect detailed data on the subjects' lifestyle habits, such as routine exercise and diet, which could potentially influence plasma SIRT1 levels. Previous studies have shown that regular physical activity and certain dietary patterns, such as caloric restriction, can modulate SIRT1 expression and activity. Therefore, the lack of information on these factors is a limitation of our study, as we cannot analysis for their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study. Reviewer's comment: 5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions. Author's response: I've already included the information in the method section. Reviewer's comment: 6. The conclusions drawn will be broader following additional updated explanations. Author's response: We both agree that our introduction, method, and discussion (especially about the study's limitations) could be better if we looked into the effects of some comorbidities, the BMI score subgroup, lifestyle factors (like regular exercise, diet, etc.), gave more information on the rs7895833 SNP, and made sure that everyone was given the same conditions for blood sampling. However, we believe that these factors would not fundamentally alter our core conclusions. View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Semadhi MP. Peer Review Report For: Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.5256/f1000research.164941.r253713) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/12-510/v2#referee-response-253713 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Singh A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions. 04 Apr 2024 | for Version 1 Amit Singh , LMBI, National Institute on Aging, Baltimore, Maryland, USA 0 Views copyright © 2024 Singh A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Report for Ardinata et al.- Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis. Ardinata et al claim to study the effects of SIRT1 protein expression and the associated SIRT1 promoter SNP in Indonesian older adult cohort. They further correlated these levels with hemoglobin, age, and frailty with chronic diseases comorbid. Study emphasize the known SIRT1 effects in interesting cohort and will be useful for aging related studies. Study lacks in following areas and should be updated accordingly. Authors claim SIRT1 levels and its relationship with various parameters. It should be corrected in title and also in text that these are plasma levels of SIRT1 not cellular protein. Explanation of plasma source of SIRT1 should be provided. Manuscript holds just one data figure of genotyping gel. In genotyping gel image the marker lane is labelled as 50bp ladder, first, the marker bands are not clear and second if we follow the marker bands (which should be labelled for each band) the size doesn’t matches the genotype product DNA bands'. The 136bp according to the marker will be 75bp and 241bp will be 200bp and so on . Please lable the gel properly. Since, SIRT1 is major focus of the manuscript, authors are encouraged to show at least some correlation plots of all 132 donors with SIRT1 levels and frailty or other important parameter. Repetitions from introduction in discussion part should be avoided. Last paragraph of discussion has many typographical errors and there are also such errors thought out the manuscript, such mistakes should be avoided. Conclusions can be shortened and many extreme speculations can be avoided. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Partly Competing Interests No competing interests were disclosed. Reviewer Expertise Immunology, Aging, Inflammation I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 30 Apr 2024 Dedi Ardinata, Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia Dear Amit Singh Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis." We appreciate the opportunity to clarify and improve our manuscript based on your feedback. Below, we address each of your concerns and describe the amendments we have made to the manuscript accordingly. Clarification of SIRT1 Levels (Plasma vs. Cellular): We have revised the title and the manuscript to explicitly state that the SIRT1 levels measured and discussed pertain to plasma levels, not cellular protein levels. To provide clarity, we have also added a brief explanation in the Methods section regarding the plasma source of SIRT1 and its relevance to our study's objectives. Genotyping Gel Image Clarification: We acknowledge the confusion regarding the genotyping gel image and appreciate your pointing out the discrepancies. We have revised the image to include a clearer representation of the marker bands and accurately labelled each band to correspond with the correct DNA size. Inclusion of Correlation Plots: Following your suggestion, we have now included correlation plots that depict the relationship between SIRT1 levels, frailty, and other critical parameters for all 132 participants. These plots provide a visual representation of our findings and strengthen the manuscript. Reduction of Repetitions and Typographical Errors: We carefully reviewed the manuscript to eliminate redundant information between the Introduction and Discussion sections. We have also conducted a thorough proofreading to correct typographical errors throughout the text. These changes aim to improve readability and accuracy, and we believe they significantly enhance the manuscript's quality. Revision of Conclusions: We have streamlined the Conclusions section to succinctly summarize our findings without speculative statements. The revised Conclusions focus on our study's contributions to the field and its implications for future research, avoiding overgeneralization. We hope that these revisions adequately address your concerns and improve the quality and clarity of our manuscript. We are grateful for your constructive feedback and the opportunity to enhance our work. We look forward to your further suggestions and the possibility of our manuscript being accepted for publication. Sincerely, Dedi Ardinata and co-authors View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Singh A. Peer Review Report For: Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.5256/f1000research.146512.r253712) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/12-510/v1#referee-response-253712 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Manjula R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 20 Feb 2024 | for Version 1 Ramu Manjula , Yale University, Connecticut, USA 0 Views copyright © 2024 Manjula R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This study aimed to investigate the relationship between SIRT1 levels, SNP rs7895833, hemoglobin levels, age, and physical frailty (frail score) among 132 older Indonesian adults with comorbid chronic diseases. The present study aligns with recent research suggesting that the association between low hemoglobin levels and physical frailty among older adults with one or more chronic diseases is influenced by age. Furthermore, this study revealed that the SNP genotype AG-GG and high SIRT1 levels further moderated the relationship between low hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases. While multiple studies support the protective role of increased SIRT1 expression in the body, the study highlights that SNP rs7895833 A>G affects the expression of the SIRT1 gene. The manuscript is structured well, and the authors have proved their hypothesis. As mentioned by the authors, along with the sample size the strong limitations of this study are lifestyle habits, environmental factors, and medications, which could have influenced the results. I believe that conclusions cannot be drawn based on these results. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? I cannot comment. A qualified statistician is required. Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Sirtuin biology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Manjula R. Peer Review Report For: Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations] . F1000Research 2024, 12 :510 ( https://doi.org/10.5256/f1000research.146512.r243614) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/12-510/v1#referee-response-243614 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Exploring the moderating effects of SIRT1...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/12-510/v3" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/12-510/v3&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/12-510/v3" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Ardinata D et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/12-510/v3/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/12-510", templates : { twitter : "Exploring the moderating effects of SIRT1 and gene polymorphisms.... Ardinata D et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/12-510/v3" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/133517/165990") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "165990"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "253698": 0, "253697": 0, "253696": 0, "222731": 0, "253705": 0, "253711": 0, "222735": 0, "222734": 0, "253709": 0, "222733": 0, "222732": 0, "222739": 0, "253714": 0, "222738": 0, "222737": 0, "253713": 11, "222736": 0, "253712": 21, "207895": 0, "207894": 0, "207893": 0, "253716": 0, "222740": 0, "207892": 0, "207899": 0, "207898": 0, "207897": 0, "207896": 0, "207901": 0, "207900": 0, "227619": 0, "227618": 0, "227623": 0, "227622": 0, "227621": 0, "227620": 0, "227627": 0, "227626": 0, "227625": 0, "227624": 0, "174382": 0, "217903": 0, "174383": 0, "217902": 0, "217901": 0, "217900": 0, "174386": 0, "217907": 0, "174387": 0, "217906": 0, "174384": 0, "217905": 0, "174385": 0, "217904": 0, "217909": 0, "217908": 0, "266844": 0, "266845": 6, "275551": 0, "261475": 0, "275552": 0, "261479": 0, "275553": 0, "261478": 0, "261477": 0, "261476": 0, "261483": 0, "261482": 0, "261481": 0, "261480": 0, "261484": 0, "235121": 0, "243611": 0, "243608": 0, "243614": 10, "243617": 0, "243621": 0, "243627": 0, "243624": 0, "243630": 0, "243633": 0, "243638": 0, "243636": 0, "196547": 0, "196550": 0, "212423": 0, "196551": 0, "212422": 0, "196548": 0, "212421": 0, "196549": 0, "196554": 0, "212427": 0, "196555": 0, "212426": 0, "196552": 0, "212425": 0, "196553": 0, "212424": 0, "212430": 0, "196556": 0, "212429": 0, "212428": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "a68db42b-4df7-4591-9baf-c9ee12fc910c"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00