The comparative study on molecular phylogenetics and development of microsatellite primers from durian chloroplast genomes

The comparative study on molecular phylogenetics and development of microsatellite primers from durian chloroplast genomes | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL Ecology and Evolution This is a preprint and has not been peer reviewed. Data may be preliminary. 29 January 2025 V1 Latest version Share on The comparative study on molecular phylogenetics and development of microsatellite primers from durian chloroplast genomes Authors : Tran Huy 0009-0008-2449-3731 [email protected] , Tan Khang Do , Tran Nam , Pham Anh Thi Nguyen , and Pham Phuc 0009-0001-0278-2582 Authors Info & Affiliations https://doi.org/10.22541/au.173812332.26926667/v1 Published Ecology and Evolution Version of record Peer review timeline 392 views 242 downloads Contents Abstract Abstract Introduction Variants analysis References Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Durian, or Durio zibethinus, is an exotic fruit with high economic value in Southeast Asia. This study aims to determine the genetic variants based on the chloroplast genome between species and cultivars in the Durio genus and design the molecular marker based on microsatellite resources. The research was conducted by collecting the data of 8 chloroplast genomes followed by the genome structure and organization analysis, variants analysis, phylogenetic relationship analysis, and possibly, primer designing. Overall, the results showed that regions with high Pi values for the nucleotide diversity analysis were the regions in ycf1, psbZ-rps14, accD, and rpl33-rps18. Although the nucleotide diversity analysis had shown various hotspots from the current data of complete chloroplast genomes of the Durio genus, the accD region showed to have a high Pi value between species but failed to distinguish between variants of the same species. Furthermore, 13 primer SSR regions were selected from 135 SSRs, and the corresponding primer pairs were designed for amplification. Durio zibethinus cv. Ri6 has a close relationship to other Durio zibethinus cultivars but has high genetic divergence from other Durio genus species. The Durio genus had a close relationship to Reevesia genus according to the phylogenetic tree of Malvaceae family. The cp genomes are stated to be a useful tool in studying the phylogenetic relationship. In conclusion, the cp genomes are a useful tool and could be further utilized for molecular markers designing, the evolution history of the Durio genus. \received DD MMMM YYYY \acceptedDD MMMM YYYY The comparative study on molecular phylogenetics and development of microsatellite primers from durian chloroplast genomes Tran Gia Huy 1* , Pham Thanh Phuc 1 , Nguyen Pham Anh Thi 1 , Tran Van Be Nam 1 , Do Tan Khang 1 1 Institute of Food and Biotechnology, Can Tho University, Address: Research Laboratory Complex (RLC) Building - Zone B, Campus II, 3/2 street, Xuan Khanh Ward, Ninh Kieu District, Can Tho City. Tel: (84) 02923 835961. *Corresponding author’s email: [email protected] Abstract Durian, or Durio zibethinus , is an exotic fruit with high economic value in Southeast Asia. This study aims to determine the genetic variants based on the chloroplast genome between species and cultivars in the Durio genus and design the molecular marker based on microsatellite resources. The research was conducted by collecting the data of 8 chloroplast genomes followed by the genome structure and organization analysis, variants analysis, phylogenetic relationship analysis, and possibly, primer designing. Overall, the results showed that regions with high Pi values for the nucleotide diversity analysis were the regions in ycf1, psbZ-rps14, accD, and rpl33-rps18. Although the nucleotide diversity analysis had shown various hotspots from the current data of complete chloroplast genomes of the Durio genus, the accD region showed to have a high Pi value between species but failed to distinguish between variants of the same species. Furthermore, 13 primer SSR regions were selected from 135 SSRs, and the corresponding primer pairs were designed for amplification. Durio zibethinus cv. Ri6 has a close relationship to other Durio zibethinus cultivars but has high genetic divergence from other Durio genus species. The Durio genus had a close relationship to Reevesia genus according to the phylogenetic tree of Malvaceae family. The cp genomes are stated to be a useful tool in studying the phylogenetic relationship. In conclusion, the cp genomes are a useful tool and could be further utilized for molecular markers designing, the evolution history of the Durio genus. Keywords: Chloroplast genome, Durio zibethinus , microsatellite DNA, phylogenetic. COVER LETTER To Editor-in-Chief Date: 28 th , February 2025 Ecology and Evolution Dear Sir / Madam I am happy to submit the genetic notes titled “The comparative study on molecular phylogenetics and development of microsatellite primers from durian chloroplast genomes” for consideration for publication in Ecology and Evolution. In this manuscript, we wish to highlight the potential application of the chloroplast genomes and Simple Sequence Repeat (SSR) markers for durian genotyping and phylogenetics. I believe that this manuscript is appropriate for publication in Ecology and Evolution because this study focused on the genetic and genomic resources of durians as well as the application of bioinformatics tools to evaluate the genetic diversity and genotyping of the durian species and cultivars. I shall be acting as the corresponding author on behalf of all my co-authors and will be responsible for communicating with other authors the revisions and final approval of the article proofs. This manuscript has not been published and is not under consideration for publication elsewhere and all authors have approved of and have agreed to submit the manuscript to Ecology and Evolution. All actual/potential conflicts of interest, financial or otherwise, relationships and activities have been disclosed. Yours sincerely, Tran Gia Huy, Institute of Food and Biotechnology, Can Tho University. DD MMMM YYYY \acceptedDD MMMM YYYY Introduction The chloroplast genome has emerged as a powerful tool in the study of plant evolution, phylogeny, and genetic diversity. Chloroplasts, the organelles responsible for photosynthesis in plant cells, possess their genomes, which are typically circular and encode a set of essential genes involved in photosynthesis, transcription, and other vital cellular processes (Jensen & Leister, 2014). Due to the relatively conserved nature of chloroplast genomes across plant species, they have become valuable in phylogenetic studies, enabling researchers to trace evolutionary relationships and species divergence with high precision (Caycho et al., 2023; Machado et al., 2022; Xue et al., 2019). One of the significant advances in plant molecular biology is the use of the chloroplast genome as a newly transferred plasmid as many occurrences have been observed to have transferred the gene from the chloroplast genome into the nuclear genome, but this phenomenon has not been researched deeper into its application or mechanism (Filip & Skuza, 2021; Stegemann et al., 2003). By integrating the entire chloroplast genome or specific regions of it into phylogenetic models, researchers can generate more accurate and resolved phylogenies. Chloroplast genomes have also gained prominence as sources of species-specific markers and biomarkers or barcoding for elite mother plants as the chloroplast genomes are maternal inheritance, the genetic material inherited from the mother plant (She et al., 2022; Teske et al., 2020). Species-specific markers derived from the chloroplast genome are highly valuable in distinguishing between closely related species and in identifying hybrids. One of the key applications of chloroplast genome analysis is in studying the genetic differences between cultivated and wild plant species. By looking into the genetic profiles of domesticated plants and wild-type plants, we can observe how the domestication process affects and changes the inheritance material between these plants in the same species or genus (Daniell et al., 2016; Moner et al., 2020). These differences are evident in both the chloroplast genome and nuclear genome, reflecting the impact of domestication and selective breeding on the genetic makeup of cultivated plants. Chloroplast genome analysis provides a detailed understanding of these genetic differences, offering insights into the evolutionary history of durian and the genetic basis of traits important for cultivation. This information is critical for developing strategies to conserve the genetic diversity of wild durian species, which may harbor valuable traits that could be reintroduced into cultivated varieties to improve resilience and adaptability. Durian, often referred to as the ”king of fruits,” is an exotic tropical fruit that holds immense economic and cultural significance in Southeast Asia (Ketsa et al., 2019). In Vietnam, the durian ( Durio zibethinus L. (1774)) is highly economic, and the varieties that the farmer mainly cultivates and commercializes are Sua Hat Lep, Monthong, Ri6 (Hau & Hieu, 2017). Not only is durian popular in Southeast Asia but also popular in the international marketplace (Ketsa et al., 2019). According to the Ministry of Agriculture and Rural Development of Vietnam (2023), the area for cultivating durian of Vietnam was over 150,000 ha, with a yield of approximately 1.2 million ton, and 50% of the yield was exported to the international marketplace. The most widely cultivated species, Durio zibethinus , is prized for its unique flavor, aroma, and nutritional value. The durian industry contributes significantly to the economies of countries like Thailand, Malaysia, and Indonesia, where the fruit is a major export commodity (Ketsa et al., 2019). In recent years, the global demand for durian has surged, driven by increasing popularity in China and other international markets. Beyond its economic value, durian has considerable scientific value, particularly in the fields of plant genetics, breeding, and conservation biology. The genus Durio comprises approximately 30 species and over a hundred cultivars, many of which are endemic to the rainforests of Southeast Asia (Ketsa et al., 2019). While Durio zibethinus is the only species widely cultivated for its fruit, other species such as Durio graveolens , Durio oxleyanus , and Durio kutejensis have also garnered interest for their unique fruit characteristics and potential for hybridization (Thorogood et al., 2022). The genetic diversity within the genus Durio makes it a fascinating subject for scientific research, particularly in understanding the evolutionary processes that have shaped the diversity of fruit traits, such as aroma, flavor, and seed size, across different species. Not only that the difference between wild durian species with its numerous under-species cultivars raises a highly biodiversity within just the Durio genus. In addition, cultivated durians often exhibit reduced genetic diversity compared to their wild counterparts, a consequence of selective breeding for specific traits such as fruit size, flavor, and yield. In the case of durian, with the propagation methods of grafting the branch of durian cultivars ( D. zibethinus ) capable of producing high quality durian fruit with wild durians ( D. oxeylanus or D. graveolens). This technique not only produce high yield durian plants with significant genetic divergence but also cuts the down needed to wait for the durian seedlings to sprout (Hasanah & Mariana, 2024). D. zibethinus cultivar Ri6, is an exclusive durian cultivar in Vietnam which is made by using the grafting technique by a Vietnamese farmer. According to Huy (2024), although being in the same species, the cultivar Ri6 has some noticeable differences that make it separate to the Monthong cultivar, but not so different that it is still related close enough to be on the same branch of the phylogenetic tree. Although the durian cultivar Ri6 or Durio zibethinus cv. Ri6 is considered the best durian in Vietnam with high economic value, but not much research has been conducted to study the genetic information. Although the physiological appearances are noticeable between different varieties of durian, these characteristics are easily influenced by the growing environment and therefore, are not stable in determining. But when it comes to DNA, it is much more stable as it is the genetic information located inside the cells and cannot be influenced by environmental conditions. One of the primary areas of scientific interest in durian research is the study of its chloroplast genome, which provides insights into the evolutionary history and phylogenetic relationships among durian species. Chloroplast genome sequencing has revealed significant variation in the genome structure and gene content among different durian species. These variations are not only important for resolving phylogenetic relationships but also for understanding the genetic basis of traits that are unique to certain species. For instance, the distinct aroma of durian, which is a key factor in its commercial value, has been linked to specific genes involved in sulfur metabolism. Comparative analysis of chloroplast genomes across durian species can help identify the evolutionary origins of these traits and their role in species differentiation (Kanzaki et al., 1998). Based on the current data of Durian chloroplast genomes from NCBI database, this study aims to identify the variants for both gene coding and repeat regions; visualize the phylogenetic relationship of D. zibethinus cv. Ri6, an indigenous Vietnam cultivar, among other species of the Durio genus as well as other species of Malvaceae family. DD MMMM YYYY \acceptedDD MMMM YYYY Materials and methods DD MMMM YYYY \acceptedDD MMMM YYYY Data collection As we are using the data of the genome of Durio zibethinus cv. Ri6 from our last published research, which was extracted, sequenced and sent into GenBank database. No genome extraction or sequencing was performed in this research. For the collection of other cp genomes, the data will be collected by the latest dates this research has been conducted. The data will be collected on NCBI (National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov)) based on the phylogenetic relationship from Plants of the World Online website (https://powo.science.kew.org) of Royal Botanic Gardens Kew. The criteria for the data collection will be: 1. The collected genomes are references sequences with the “NC” tag in the accession number for all cp genomes of Malvaceae; 2. For the genus in Malvaceae that have the number of reference sequences equal or over three, three sequences of different species will be collected, For the genus that have less than three reference sequences, all will be collected. 3. All complete cp sequences of the species of Durio genus are collected whether or not they have the “NC” tag or not. The genomes are cp genomes of the Malvaceae family and two species from Dipterocarpaceae family to use as an outgroup when reconstructing the phylogenetics tree; 4. The cp genomes are completed genome sequences. All nine (up-to-date) completed chloroplast genomes of Durio species will be collected for the analysis, including Durio ribethinus cv. Ri6 (OR731187.1), Durio ribethinus cv. Monthong (NC_036829.1), Durio ribethinus cv. Monthong (MT321069), Durio testudinarius (PP668204.1), Durio oxleyanus (NC_064728), Durio lowianus (PP668207.1), Durio kutejensis (PP668203.1), Durio graveolens (PP668202.1), Durio dulcis (NC_073110.1). For other species in the Malvaceae family, two to three available completed sequences of each group will be collected. For the outgroup species, two species from Dipterocarpaceae family, Dipterocarpus turbinatus (NC_041191.1), Vatica odorata (NC_054172), and Neobalanocarpus heimii (NC_046842.1). After collecting all the data, the range of size of the cp genomes of nine cultivars and species will be recorded. Then, the cp genomes will be analyzed the structure for the size of each region of the cp genome, including Large-single copy (LSC), Small-single copy (SSC) and two Inverted Repeats (IRs). After that, the numbers of protein-coding genes (PCGs), tRNA genes and rRNA genes will be recorded. The GC content will also be collected as well as analyze the genes they are having in similarity and difference. The numbers of gene having one intron, or two introns will also be collected. Variants analysis To calculate the nucleotide diversity (Pi values) among the chloroplast genomes of Durio genus, DnaSP v6 had been used (Rozas et al., 2017). Before the software could be utilized, the alignment of nine species/cultivar are employed using MAFFT v1.1.2 with default parameter. Then the alignment file is exported as. meg or .fasta file. If the aligned sequences have any ambiguous codes, the fasta file first needs to be converted by the tools on the DnaSP v6 to remove the ambiguous codes for the calculation. The aligned sequences are then imported to the DnaSP for calculating the Pi values and performing sliding window analysis with the window size of 2000 and step size of 100 (Khoa, 2022). To detect the SNPs or indel variants, the coding sequences of all sampled species will be first aligned using MAFFT v1.1.2 (Katoh & Standley, 2013) with default parameters. Then, the tools find variation of SNPs/indels in Geneious Prime will be implied with default options to search for the SNPs and indels of the alignment of selected. Then by selecting all the SNPs/indels, it can be extracted for further analysis. The information of types of polymorphisms (SNPs or indels), the location of those polymorphisms (IGS or CDS) will be collected. To analyze the repeat sequences, an Inverted Repeat (IR) in the cp genome will be removed as the genetic sequences of two Inverted Repeat are identical but inverted so the number of inverted sequences will be double if the two IRs are present. SSR identification, and primer design To find short repeat sequences (SSRs), MISA (MIcroSAtellite identification tool) (Beier et al., 2017) webserver was utilized to find mono-, di-, tri-, tetra-, penta-, and hexa-nucleotide with the minimum length of 10 bp, 6 bp, 5 bp, 5 bp, 5 bp, and 5 bp, respectively (default parameter). After collecting the SSR data, Primer3Plus tool (https://www.primer3plus.com/primer3plusPackage.html) was employed to design the primer for each SSR (Untergasser et al., 2012), with the amplicon size varied from 200 to 1000 bp. Then the NetPrimer tool of PREMIER Biosoft (http://www.premierbiosoft.com/NetPrimer/AnalyzePrimer.jsp) was employed to check the quality as well as the melting temperature (Tm) of the primer, the criteria for choosing the primer pair was both of the primers need to have the rating score of at least 85. For those primer pair with one of the pair having the rating score above 95, the other pair can be choosing the rating score of at least 80. Tandem repeat identification and analysis The Phobos program (Leese et al., 2008) in Geneious Prime is ultilized to the find long tandem repeats with the configuration of choosing perfect search model, enabling remove hidden repeat, min of repeat length and maximum repeat length of 10 and 200, respectively. To analyze the phylogenetic relationships of D. zibethinus cv. Ri6 with other species from Malvaceae family, nine completed cp genome of cultivars and species of Malvaceae family will be collected and three completed cp genome of two species from Dipterocarpaceae family, Dipterocarpus turbinatus (NC_046842.1), Vatica odorata (NC_054172), and Neobalanocarpus heimii (NC_041191.1). Both of the selected family is in the Malvales order will be collected and used for reconstructing the phylogenetics tree. Two phylogenetic trees will be reconstructed based on different objective: the first phylogenetic tree will be reconstructed based on PCGs while the second phylogenetic tree will be reconstructed based on the SNPs regions. To reconstruct two different phylogenetic trees, two types of data are needed. For the PCGs phylogenetic tree, the coding sequences of all sampled species will be extracted and aligned using MAFFT v1.1.2 (Katoh & Standley, 2013) with default parameters. The intergenic spacings will be removed using Geneious Prime, and then the sequences will be concatenated to produce a complete PCGs database. For the SNPs phylogenetic tree, the coding sequences of all sampled species will be extracted and aligned using MAFFT v1.1.2 (Katoh & Standley, 2013) with default parameters. Then, the SNPs from both the intergenic spacer and CDS will be extracted as well as removing non-SNPs sequences for better processing. Before reconstructing the Maximum Likelihood phylogenetic tree, the optimal evolutionary model for two phylogenetic trees will be calculated using jModelTest v2.1.10 (Santorum et al., 2014). Then, the IQ-TREE webserver will be employed to reconstruct the phylogenetic trees by the maximum likelihood method with 1,000 replication bootstraps (Minh et al., 2020). FigTree v1.4.4 will be utilized to visualize the resulting tree (Drummond et al., 2012). Results and discussion Genome structure and organization analysis According to the NCBI database, only eight over 24 species of Durio genus have been sequenced and published the complete chloroplast genome on to the GenBank database of NCBI, of which two cultivars of the Durio zibethinus have been uploaded on the GenBank. The cp genome sizes of the species of Durio genus are varied between 163,974 – 166,346 bp. The average GC content of eight sequenced cp genome of Durio species is 35.8% with the highest GC content is 35.9% of Durio oxleyanus (NC_064728) and Durio graveolens (PP668202) and the lowest GC content is 35.6% of Durio testudinarius (PP668204). The average GC content of LSC, SSC and IRs are 33.7%, 30.8% and 42.4%, respectively. All species in the Durio genus have the same amounts of protein-coding genes (PCGs), tRNA genes and rRNA genes, which are 83, 37 and eight, respectively. Within that, 15 genes have one intron ( ndh A, ndh B, atp F, pet B, pet D, rpl 2, rpl 16, rpo C1, rps 16, trn A-UGC, trn G-UGC, trn I-GAU, trn K-UUU, trn L-UAA, and trn V-UAC) and 2 genes have two introns ( clp P, and ycf 3). Within the IRs, five PCGs ( ndh B , rps 7 , rps 12 and ycf 2), four rRNA genes ( rrn 5 , rrn 4.5 , rrn 23 , rrn 16), and seven tRNA genes ( trn N-GUU, trn R-ACG, trn A-UGC, trn I-GAU, trn V-GAC, trn L-CAA and trn I-CAU) were duplicated. Although being in the same species as Durio zibethinus , the cultivar Ri6 has a larger size of cp genome when compared to the cultivar Monthong. The major changes that lead to the differences in size are the Inverted repeats. The cultivar Ri6 has 24,185 bp per repeat, which when compared in pair leads to 918 more bp than cultivar Monthong. Other small changes are a slight increase of about 400 bp in the LSC region and the addition of one extra bp in the SSC region. Not only that, but the cultivar also Ri6 is larger than other cultivars of the same species. The IRs of the Ri6 is the largest IRs among other species in the Durio genus, with noticeable difference in size of bp, which leads to the potential region for searching for biomarkers and consequently, designing primer for the identification of D. zibethinus cultivar Ri6. Although not mentioned in Table 1, there are two other species in the Durio genus that have lost one IR phenomena, which are Durio dulcis (NC_073110.1) and one cultivar of Durio zibethinus cv. Monthong (MT321069). This phenomenon has led to the reduction of about 20 kbp in the size of the cp genome of these two cases. Consequently, the loss of one IR copy leads to the loss of PCGs, tRNA genes and rRNA genes in this region. Although this phenomenon is not new in the history of the plant cp genome, it is uncommon in the Durio genus or in Malvaceae family overall. But since not all cp genomes of the species in the Durio genus have been sequenced and completed, the uncommon of this phenomenon might be resulting from this. The cases might change when all the cp genomes in this genus have been sequenced. Table 1. Durio species and their accession number, length and GC% of whole cp genome, LSC, SSC and IR (bp). CP LSC SSC IR CP LSC SSC IRs Durio ribethinus cv. Ri6 OR731187 165,304 96,115 20,819 24,185 35.7 33.6 30.7 42.1 Durio ribethinus cv. Monthong NC_036829 163,974 95,704 20,818 23,726 35.8 33.6 30.8 42.5 Durio lowianus PP668207 165,468 96,671 21,281 23,758 35.8 33.7 30.7 42.5 Durio oxleyanus NC_064728 166,346 97,513 21,319 23,757 35.9 33.9 30.9 42.5 D. kutejensis PP668203 165,149 96,533 21,010 23,803 35.7 33.6 30.7 42.3 D. graveolens PP668202 164,233 95,559 21,312 23,681 35.9 33.8 30.7 42.6 D. testudinarius PP668204 165,462 97,013 21,009 23,720 35.6 33.4 30.8 42.3 Variants analysis Nucleotide diversity in chloroplast genomes of Durio genus From figure 1, the nucleotide diversity analysis of current sequenced genomes has shown some statistical information of Pi value from the alignment analysis of their chloroplast genome. The highest Pi value recorded in sliding window analysis of Durio genus is the ycf 1 gene. Regions with high Pi value noticeable from the figure include the region in psb C -rps 14 , rbc L -acc D , rpl 33 -ycf 3 , and ndh F. These regions with high Pi value mean that there are noticeable differences among the durian species used in this analysis. Therefore, these peaks of high Pi value can be potential candidates for designing specific primers to distinguish different species in the genus or even different subspecies, cultivar in the species. In contrast, regions with low Pi value meaning there are low to no differences between species within the same genus. In extent, these low Pi value regions can be used as a potential region of recognition for Durio genus in general. Figure 1 Sliding window analysis of the whole chloroplast genomes of Durio species. (window length: 2000 bp, step size: 100 bp) X- axis, nucleotide position, Y-axis: Pi value of each window. SNPs/indels analysis After the alignment of seven Durio species, the tool to find the Single nucleotide polymorphisms (SNPs) and insertions and deletions (indels) was utilized. As a result, a total of 5,561 nucleotide locations with polymorphic properties of seven Durio species have been recorded. Within those 5,561 polymorphic nucleotides, over 90 percent of the case were indels (5,122 nucleotides), the small percentage left belonged to SNPs with 449 polymorphic nucleotides. A large number of SNP loci are located on the ycf 1 genes among seven Durio species which have a total of 102 bp differences in SNP loci. Some small differences in the SSC regions among the Durio species are located in the ndh F and ndh D genes. For IRs, only ycf 2 gene was detected with 7 SNPs loci. For LSC, although having many more genes with SNP detected, most of them had only one SNP detected; genes like acc D, and rpo B are genes on the LSC region that have more than one SNP loci which are 26 bp and 5 bp, respectively. Within the indel polymorphism cases, there is a big difference in the distribution between the amount of those indel in the Coding sequence (CDS) and intergenic spacer (IGS). For instance, the number of indels in the CDS region was 1,872 while it is 3,240 in the IGS, almost 2 times more than the amount of the indels in the CDS region. For the SNPs, there is not much difference between the number of SNPs in CDS and in IGS, which are 190 and 259, respectively. Similar to the number of SNPs of the SSC region, most loci of indels were detected on the SSC region of seven Durio species and specifically, on the ycf 1 gene. In addition, the ycf 1 genes in the SSC region were detected with 970 loci of indels. Repeat sequences analysis SSR identification, analysis and primer design The SSR sequences analysis results have shown differently between species in the Durio genus (Figure 2). The species with the most SSR sequences is D. zibethinus cv. Ri 6 with 135 sequences, and the least is D. graveolens with only 110 recorded. Although the tool was set up to find all six types of SSR, any tetra- or penta-nucleotide have been recorded. The most abundant type of SSR is mono-nucleotide, with 809 cases among seven species, and the second abundance is di-nucleotide, with 65 cases. For much rarer cases, only two species ( D. oxleyanus and D. testudinarius) were detected with trinucleotide, and only D. kutejensis is detected with one hexanucleotide. For the size of the repeat, most of them are varied from 11-20 bp, of which the species with the most SSR detected is D. zibethinus cv. Ri6 , followed up by D. zibethinus cv. Monthong, D. lowianus , which are 134, 127, and 126, respectively. Besides that, SSR with the size from 21-30 bp were also detected with a low amount ranging from one to six. The SSR data of Durio zibethinus cv. Ri6 was selected for primer design specific on SSRs using Primer3Plus and evaluated the rating score using NetPrimer. Among 135 SSR markers of D. zibethinus cv. Ri6 were detected with lengths ranging from 10 to 330 bp, only some of the SSRs can be utilized for primer designing. Consequently, a total of 13 different primer pairs were able to be designed with high rating scores with the amplicon size varied from 236 to 962 bp (Table 2). These primer pairs can potentially be used for phylogenetic relationship studies or identifying different Durio zibethinus varieties. For instance, as for applying, theoretically, the same primer pair Durio zibethinus cv. Ri6 for various cultivars, specific DNA profiles could be acquired. Table 2: Primer pairs from SSR data of D. zibethinus cv. Ri6 sequences, melting temperature (Tm) and Amplicon length. \received DD MMMM YYYY \acceptedDD MMMM YYYY 1 Forward TCCGCGATCTAGGCATAGGT 59.83 236 Reverse ACCTGCTATGCACAAAACACA 56.61 2 Forward TCTCTTTTGATGGAAAGGGAGCA 62.95 284 Reverse TTGGTAATTGGTCAAGCTCGA 58.41 3 Forward CGCAATTCTCTCCGGTGGTTA 62.55 334 Reverse TTTTGATGGATTCGGCGGAT 62.58 4 Forward TGAACAACCGTACAGGCATT 56.26 379 Reverse CCCATCTCAGGCGTCACAAA 61.48 5 Forward TGATGGAGAGTGAGTGCGAA 56.81 393 Reverse TACCCCTCTCCCTCCATCAA 59.09 6 Forward CGATCAATCCCTTTGCCCCT 63.52 423 Reverse TTCGGGATTTTCCTTGGGGG 65.55 7 Forward GGTTCGGTGGACAAAGCAAA 60.78 428 Reverse GCCAAAAGCCCCTTATCGGA 63.85 8 Forward AAAGCCAGTTGTTGCTGCTG 58.92 444 Reverse AAGGAGTATTGATTATCGAACCGA 59.46 9 Forward GTGGTGGAGGAACTGGATCG 59.74 481 Reverse TTCGGGGGTCCAAGAGTTTT 60.93 10 Forward GTCCAGTAGCGACAACCGTT 57.5 519 Reverse ACCAATCAGAATTGCCTCCCA 61.69 11 Forward TCGTTGCATTGAATGAAATCGACT 63.67 547 Reverse CAGCCGTTCCTATACCTGTCA 57.85 12 Forward AGAGAGATCCACCAGGGCAA 62.77 696 Reverse AGAGAGATCCACCAGGGCAA 59.19 13 Forward AAAATGACCCCTCCCACGAA 61.51 962 Reverse ACTTTCTTCAGTTCAGGGCGA 59.1 \received DD MMMM YYYY \acceptedDD MMMM YYYY Tandem repeat identification and analysis For the tandem repeat sequences analysis results between species in Durio genus (Figure 3). For the size of the repeat unit, for the group having 10-20 bp repeat unit, two cultivars of the same species D. zibethinus are having an approximate amount which are 114 for Ri6 cultivar and 115 for Monthong cultivar. The species with the most amount of repeat unit of 10-20 bp is D. testudinarius and the species with the least amount of repeat unit of 10-20 bp is D. graveolens . For the group of 21-30 bp repeat units, it is much less than the group of 10-20 bp repeat units, which is between 22-32. For the group having more than 30 repeat unit bp, most of the species do not have much of this group as D. zibethinus cv. Monthong, D. zibethinus cv. Ri6 and D. graveolens only have 10 tandem repeats that have over 30 bp repeat units. The CDS of all Durio species that were detected with the tandem repeat are acc D, ndh A, ndh F, ycf 1, and ycf 2. Other CDS regions that also detected in most Durio species with the tandem repeat were ycf 3, rps 3, and rps19. Only some Durio species that detected the tandem repeat in certain CDS region, including ndh B (in D. oxleyanus ), rpo A (in D. lowanius ), rps 2 (in D. graveolens ), rps 18 (in D. testudinarius ). Figure 2. Number of SSR in chloroplast genomes of species in Durio genus. A. Types of SSR. B. Length of SSR Figure 3 Number of long repeats in chloroplast genomes of species inf Durio genus. A. Repeat unit size. B. Length of repeat \received DD MMMM YYYY \acceptedDD MMMM YYYY Phylogenetic tree analysis Durio genus phylogenetic tree To analyze the phylogenetic relationship of current sequences of Durio species on the NCBI database. Two types of models were used to reconstruct the phylogenetic tree of the species in Durio genus, which were the SNPs/indels model and CDS model. From the calculation of Maximum Likelihood evolutionary models of IQ-Tree web server, the model GTR+F+R2 was indicated as the best-fit model according to the BIC for the CDS-based model; for the SNPs/indels-based model, K3Pu+F+G4 model was chosen as the best-fit model. Figure 4 ML phylogenetic tree of nine complete chloroplast DNA sequences of species in Durio genus and Theobroma cacao as an outgroup. A. CDS-based model. B. SNPs/indels-based model. From figure 4A, which is the phylogenetic tree reconstructed by the CDS region, Durio zibethinus cv. Ri6 is closely related to other Durio zibethinus cultivars, particularly Monthong (NC_036829.1 and MT321069). The bootstrap values 63 support the close relationship among these cultivars. The branch lengths in this tree indicate minimal genetic divergence within the Durio zibethinus group. The genetic distance between Durio zibethinus cv. Ri6 and other Durio zibethinus cultivars is very small, reflecting their high level of genetic similarity in terms of the coding sequence regions. The tree also reflects a general trend of minimal divergence within the Durio zibethinus group, suggesting that coding sequences are highly conserved among these cultivars. The close clustering of Durio zibethinus cv. Ri6 with Monthong indicates that these cultivars likely share a very recent common ancestor. The Durio zibethinus cultivars, including Ri6, form a distinct cluster separate from other Durio species like Durio graveolens , Durio kutejensis , Durio dulcis , Durio oxleyanus , and Durio lowianus . The genetic distances between Durio zibethinus cultivars are minimal compared to the distances between different Durio species, as shown by the branch lengths. Similarly, in figure 4B, Durio zibethinus cv. Ri6 also clusters closely with the same Durio zibethinus cultivars Monthong (NC_036829.1 and MT321069). Unlike figure 4A, the bootstrap value of 100 at the node where Ri6 and Monthong split strongly supports this relationship. The branch lengths in this tree are slightly longer than in the CDS-based tree, suggesting a higher degree of genetic differentiation captured by SNPs and indels. The genetic distance between Durio zibethinus cv. Ri6 and other cultivars is slightly greater compared to the CDS-based tree, indicating that SNPs and indels capture more genetic variability. This tree suggests that while the cultivars are still very closely related, there are detectable differences in their SNP and indel profiles, which may not be as apparent when analyzing only coding sequences. Durio zibethinus cultivars, including Ri6, form a distinct cluster that is separate from other Durio species, such as Durio kutejensis , Durio graveolens , Durio dulcis , Durio oxleyanus , and Durio lowianus . The branch lengths between Durio zibethinus cultivars are relatively short, suggesting a close evolutionary relationship, while the branch lengths separating them from other Durio species are longer, indicating greater genetic divergence. Theobroma cacao is used as an outgroup, which is used to root the phylogenetic tree to analyze the similarity and grouping of species in the same genus. And similar to the previous tree, it is clearly separated from the Durio species, demonstrating the distinct evolutionary lineage of Theobroma cacao compared to the Durio genus. Although, the distance between Theobroma cacao , an outgroup, of two phylogenetic trees reconstructed by different methods showed different length. Overall, Both the CDS-based and SNP/indel-based phylogenetic trees demonstrate that Durio zibethinus cv. Ri6 is closely related to other Durio zibethinus cultivars, particularly Monthong . The consistency in their placement across both trees indicates strong genetic ties, likely due to a recent common ancestor or selective breeding. However, The SNP/indel-based tree provides slightly more resolution in terms of genetic differentiation between the cultivars, suggesting that this method captures additional genetic variation that may not be evident in CDS analysis alone. This suggests that while coding sequences are highly conserved, there is additional genetic variation in the non-coding regions or minor coding changes that are better captured through SNPs and indels. The higher bootstrap values in the SNP/indel-based tree also suggest greater confidence in the relationships among the cultivars, likely due to the increased number of informative sites provided by SNPs and indels. Therefore, the SNP/indel model was applied to reconstruct and analyze further the phylogenetic relationship of the Durio genus within the Malvaceae family. \received DD MMMM YYYY \acceptedDD MMMM YYYY Malvaceae family phylogenetic tree From the analyzing result of the phylogenetic trees reconstructed by two different models, the CDS-based model and SNPs/indels-based model. The SNPs/indels-based model was selected to reconstruct the phylogenetic tree of the Malvaceae family. From the calculation of the IQ-Tree web server, the best-fit ML evolutionary model is TVM+F+R4 based on the BIC. Figure 5 ML phylogenetic tree of 69 complete chloroplast DNA sequences of Malvaceae family based on SNPs/indels. The left tree is phylogram which show the true distance of each clade. The right tree is cladogram for better observation. For the expansion analysis of the phylogenetic relationship of the Durio genus, the Malvaceae tree was reconstructed using SNPs (Single Nucleotide Polymorphisms) and indels (insertions and deletions), providing a detailed picture of the genetic relationships within the family, including the Durio genus and other related genera. The tree’s branching patterns and bootstrap values indicate the evolutionary relationships and the confidence level in those relationships. Three species in Dipterocarpaceae family, Neobalanocarpus heimii (NC_041191), Dipterocarpus turbinatus (NC_046842), and Vatica odorata (NC_054172), were used as an outgroup to root the phylogenetic tree and successfully separate themselves from other genus and species in the Malvaceae family. From the phylogram, we can clearly see that there are six separate clades, excluding the outgroup. The first clade includes at least 7 genera, including Malva, Abutilon, Sida, Gossypium, Thespesia, Abelmoschus, and Talipariti . The second clade includes the species Ceiba specosa, Pachira macrocarpa and Bombax ceiba. The third clade includes at least two genera, Tilia and Pterospermum . The fourth clade includes at least three genera, Heritiera, Sterculia, and Firmiana . The fifth clade is the clade of species from the Durio and Reevesia genus. The sixth clade includes species from the genus of Grewia, Coichuris, and Theobroma . The Durio genus forms a monophyly well-defined clade, which is supported by a high bootstrap value of 99, indicating strong confidence in the grouping of these species within this genus, as well as the similarity in genetic differentiation. The Durio genus forms a distinct and well-supported clade within the tree, situated closer to certain genera like Reevesia and Firmiana than to others like Theobroma and Grewia . The position and branch lengths provide clues about the relativeness. Reevesia is one of the genera most similar to Durio in terms of clade location and branch lengths. The close closeness of these clades reflects a very recent common ancestor, implying that Durio and Reevesia diverged more recently than other taxa. The shorter branch lengths between Durio and Reevesia show that fewer genetic changes have occurred between these groupings than others, supporting the notion of a tighter connection. In summary, for the Durio genus, the chloroplast genome is a useful tool in distinguishing between domesticated species, or cultivars, with another domesticated one and between domesticated species with wild species. These differences are minor yet many when combined contributed to the evolution of the species, or the whole genus, and can clearly be observed through the reconstructed phylogenetic tree. The analysis of the reconstructed phylogenetic tree had shown that the differences analyze by the SNPs/indels are well more observable and provides slightly more resolution in terms of genetic differentiation which was visualized via the comparation between two model of phylogenetic tree. Although the current sequenced species in the Durio genus have shown us a clear picture and their location on the phylogenetic tree based on the chloroplast genomes. More samples of Durio genus should be collected to complete the phylogenetic relationship between species in the genus as well as cover the gap in the Malvaceae family. Competing Interests Statement The authors declare no conflicts of interest. Author Contributions section Tran G. Huy : data curation (equal), investigation (equal), methodology (equal), writing – original draft (equal), writing – review and editing (equal). Pham T. Phuc : conceptualization (equal), data curation (equal), writing – review and editing (equal). Do T. Khang : data curation (equal), formal analysis (equal), funding acquisition(equal), writing – review and editing (equal). Tran V.B. Nam , and Nguyen P.A. Thi : conceptualization (equal), data curation (equal), funding acquisition (equal), project administration (equal), resources (equal), writing – re-view and editing (equal). Acknowledgments This study is funded by the Can Tho University, Code: T2024-131. References 1. Beier, S, Thiel, T, Münch, T, Scholz, U, & Mascher, M. 2017. MISA-web: a web server for microsatellite prediction. Bioinformatics 33 (16): 2583–2585. https://doi.org/10.1093/BIOINFORMATICS/BTX198Caycho, E, La Torre, R, & Orjeda, G. 2023. Assembly, annotation and analysis of the chloroplast genome of the Algarrobo tree Neltuma pallida (subfamily: Caesalpinioideae). BMC Plant Biology 23 (1): 1–19. https://doi.org/10.1186/S12870-023-04581-5Daniell, H, Lin, CS, Yu, M, & Chang, WJ. 2016. Chloroplast genomes: diversity, evolution, and applications in genetic engineering. Genome Biology 17 (1): 1–29. https://doi.org/10.1186/S13059-016-1004-2Drummond, AJ, Suchard, MA, Xie, D, & Rambaut, A. 2012. Bayesian Phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution 29 (8): 1969–1973. https://doi.org/10.1093/MOLBEV/MSS075Filip, E, & Skuza, L. 2021. Horizontal Gene Transfer Involving Chloroplasts. International Journal of Molecular Sciences 22 (9): 4484. https://doi.org/10.3390/IJMS22094484Hasanah, E, & Mariana, A. 2024. Grafting Durian Seedlings (Durio zibethinus Murr.) Using the P1-P5 Technique. Nusantara Science and Technology Proceedings 52–57. https://doi.org/doi.org/10.11594/nstp.2024.3910Hau, T V., & Hieu, TS. 2017. Off-season production of durian in the Mekong delta, Viet Nam. Acta Horticulturae 1186 : 85–98. https://doi.org/10.17660/ACTAHORTIC.2017.1186.13Huy, TG, Thi, NPA, Do, HDK, & Khang, DT. 2024. The complete chloroplast genome of Durio zibethinus L. cultivar Ri6 (Helicteroideae, Malvaceae). Mitochondrial DNA Part B 9 (5): 625–630. https://doi.org/10.1080/23802359.2024.2350619Jensen, PE, & Leister, D. 2014. Chloroplast evolution, structure and functions. F1000Prime Reports 6 :. https://doi.org/10.12703/P6-40Kanzaki, S, Yonemori, K, Sugiura, A, & Subhadrabandhu, S. 1998. Phylogenetic relationships of the common durian (Durio zibethinus Murray) to other edible fruited Durio spp. by RFLP analysis of an amplified region of cpDNA. The Journal of Horticultural Science and Biotechnology 73 (3): 317–321. https://doi.org/10.1080/14620316.1998.11510980Katoh, K, & Standley, DM. 2013. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Molecular Biology and Evolution 30 (4): 772. https://doi.org/10.1093/MOLBEV/MST010Ketsa, S, Wisutiamonkul, A, Palapol, Y, & Paull, RE. 2019. The Durian. Horticultural Reviews 125–211. https://doi.org/10.1002/9781119625407.CH4Khoa, DHD. 2022. Analyzing genetic diversity of chloroplast genomes in Liliales. Journal of Science and Technology 4 (4): 14. https://doi.org/10.55401/JST.V4I4.304Leese, F, Mayer, C, & Held, C. 2008. Isolation of microsatellites from unknown genomes using known genomes as enrichment templates. Limnology and Oceanography: Methods 6 (9): 412–426. https://doi.org/10.4319/LOM.2008.6.412Machado, L de O, Stefenon, VM, Vieira, LDN, & Nodari, RO. 2022. Structural and evolutive features of the Plinia phitrantha and P. cauliflora plastid genomes and evolutionary relationships within tribe Myrteae (Myrtaceae). Genetics and Molecular Biology 45 (1): e20210193. https://doi.org/10.1590/1678-4685-GMB-2021-0193Minh, BQ, Schmidt, HA, Chernomor, O, Schrempf, D, Woodhams, MD, Von Haeseler, A, Lanfear, R, & Teeling, E. 2020. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Molecular Biology and Evolution 37 (5): 1530–1534. https://doi.org/10.1093/MOLBEV/MSAA015Moner, AM, Furtado, A, & Henry, RJ. 2020. Two divergent chloroplast genome sequence clades captured in the domesticated rice gene pool may have significance for rice production. BMC Plant Biology 20 (1): 1–9. https://doi.org/10.1186/S12870-020-02689-6/TABLES/3Rozas, J, Ferrer-Mata, A, Sanchez-DelBarrio, JC, Guirao-Rico, S, Librado, P, Ramos-Onsins, SE, & Sanchez-Gracia, A. 2017. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Molecular Biology and Evolution 34 (12): 3299–3302. https://doi.org/10.1093/MOLBEV/MSX248Santorum, JM, Darriba, D, Taboada, GL, & Posada, D. 2014. jmodeltest.org: selection of nucleotide substitution models on the cloud. Bioinformatics 30 (9): 1310–1311. https://doi.org/10.1093/BIOINFORMATICS/BTU032She, H, Liu, Z, Xu, Z, Zhang, H, Cheng, F, Wu, J, Wang, X, & Qian, W. 2022. Comparative chloroplast genome analyses of cultivated spinach and two wild progenitors shed light on the phylogenetic relationships and variation. Scientific Reports 2022 12 (1): 1–12. https://doi.org/10.1038/s41598-022-04918-4Stegemann, S, Hartmann, S, Ruf, S, & Bock, R. 2003. High-frequency gene transfer from the chloroplast genome to the nucleus. Proceedings of the National Academy of Sciences of the United States of America 100 (15): 8828–8833. https://doi.org/10.1073/PNAS.1430924100Teske, D, Peters, A, Möllers, A, & Fischer, M. 2020. Genomic Profiling: The Strengths and Limitations of Chloroplast Genome-Based Plant Variety Authentication. Journal of Agricultural and Food Chemistry 68 (49): 14323–14333. https://doi.org/10.1021/ACS.JAFC.0C03001Thorogood, CJ, Ghazalli, MN, Siti-Munirah, MY, Nikong, D, Kusuma, YWC, Sudarmono, S, & Witono, JR. 2022. The king of fruits. Plants, People, Planet 4 (6): 538–547. https://doi.org/10.1002/PPP3.10288Untergasser, A, Cutcutache, I, Koressaar, T, Ye, J, Faircloth, BC, Remm, M, & Rozen, SG. 2012. Primer3—new capabilities and interfaces. Nucleic Acids Research 40 (15): e115. https://doi.org/10.1093/NAR/GKS596Xue, S, Shi, T, Luo, W, Ni, X, Iqbal, S, Ni, Z, Huang, X, Yao, D, Shen, Z, & Gao, Z. 2019. Comparative analysis of the complete chloroplast genome among Prunus mume, P. armeniaca, and P. salicina. Horticulture Research 6 (1):. https://doi.org/10.1038/S41438-019-0171-1 Data Accessibility Statement The data that support the findings of this study are openly available in the supporting information. Crossref Google Scholar Information & Authors Information Version history V1 Version 1 29 January 2025 Peer review timeline Published Ecology and Evolution Version of Record 7 Oct 2025 Published Copyright This work is licensed under a Non Exclusive No Reuse License. Collection Ecology and Evolution Keywords comparative molecular evolution molecular genetics plants terrestrial theoretical Authors Affiliations Tran Huy 0009-0008-2449-3731 [email protected] Can Tho University View all articles by this author Tan Khang Do Can Tho University View all articles by this author Tran Nam Can Tho University View all articles by this author Pham Anh Thi Nguyen Can Tho University View all articles by this author Pham Phuc 0009-0001-0278-2582 Can Tho University View all articles by this author Metrics & Citations Metrics Article Usage 392 views 242 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Tran Huy, Tan Khang Do, Tran Nam, et al. The comparative study on molecular phylogenetics and development of microsatellite primers from durian chloroplast genomes. Authorea . 29 January 2025. DOI: https://doi.org/10.22541/au.173812332.26926667/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.173812332.26926667/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9ff5ac26d92a0db4',t:'MTc3OTM4ODQzNw=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();