Transgenic Eucalyptus urophylla × Eucalyptus grandis Superior Clone DH3229: Achieving Glyphosate Resistance through Genetic Modification

Transgenic Eucalyptus urophylla × Eucalyptus grandis Superior Clone DH3229: Achieving Glyphosate Resistance through Genetic Modification | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Transgenic Eucalyptus urophylla × Eucalyptus grandis Superior Clone DH3229: Achieving Glyphosate Resistance through Genetic Modification Xuejun Wang, Haoyu Wei, Shuang Zhang, Jiahui Gao, Binshan Zeng, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5342227/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Feb, 2025 Read the published version in Plant Cell, Tissue and Organ Culture (PCTOC) → Version 1 posted 4 You are reading this latest preprint version Abstract Eucalyptus species are known for their high productivity and adaptability, making them a reliable source of timber. However, hybrid eucalyptus, particularly in the initial months of plantation, is susceptible to weed competition. Glyphosate is the most commonly used herbicide for weed control in eucalyptus plantations. To incorporate glyphosate resistance into eucalyptus cultivars ( Eucalyptus urophylla × E. grandis DH3229), the g10-epsps gene, driven by the 35S promoter, was introduced using an efficient Agrobacterium- mediated genetic transformation method. Following PCR-based selection and detection, six plants were confirmed to have successfully integrated the epsps gene into the eucalyptus genome at various stages. Realtime fluorescence quantitative PCR and enzyme-linked immunosorbent assay further validated the gene's integration and expression in all independent transformation events. Additionally, the transgenic plants demonstrated significant resistance to glyphosate after being treated with a 200-fold diluted Roundup solution. Physiological analysis revealed that maintaining lower levels of shikimic acid in transgenic plants is crucial for glyphosate tolerance. The successful development of herbicide-resistant transgenic eucalyptus in elite clones presents significant potential for future breeding programs and may be directly applicable to plantation after further field testing. eucalyptus genetic transformation herbicide weed control EPSPS Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Eucalyptus, originating from Australia and neighboring islands, is widely cultivated commercially, primarily for pulp and timber production as a significant crop. According to the Global Forest Resources Assessment report by the FAO, the worldwide commercial plantation area of eucalyptus covers nearly 22.57 million hectares, representing only 0.5% of the global forest area while producing approximately 10% of roundwood products (Lee, et al. 2023 ). Therefore, the eucalyptus genus is regarded as one of the most valuable species for the future, as it alleviates pressure on native forests for wood demand (Avisar, Azulay, et al. 2023) and contributes to atmospheric CO 2 sequestration (Behera, et al. 2020 ). To achieve high-quality and high-quantity wood production, effective plantation management has become increasingly essential throughout the establishment of eucalyptus plantations. Weeds compete with young eucalyptus for water, light, and minerals, severely affecting the establishment, development, and productivity of eucalyptus roundwood. Weed competition has gradually become a limiting factor in eucalyptus plantations. During the initial stages of eucalyptus plantation, weeding is performed at least three times within the first 18 months due to the high sensitivity of young trees to weed competition. Historically, manual weeding was widely practiced in eucalyptus plantations. Currently, due to increasing plantation areas, high costs, labor shortages, and the arduous nature of manual labor, herbicides are extensively recommended for weed management because of their reliability, low cost, and high efficiency (Minogue and Osiecka 2015 ; Carbonari, et al. 2020 ). Glyphosate is the primary herbicide used for weed management in eucalyptus plantations due to its high efficiency, broad spectrum, low toxicity, and rapid degradation (Junior, et al. 2020 ). However, eucalyptus is highly sensitive to glyphosate (Pereira, et al. 2013 ; Junior, et al. 2020 ) and even a slight exposure to herbicide (diluted 800-fold Roundup) can cause severe leaf curling in young eucalyptus plantlets (Santos, JA, et al. 2015 ; Santos, et al. 2019 ; Meloni and Martínez 2021 ). Manual spraying or the use of shields is typically employed to protect young eucalyptus plants from herbicide damage during glyphosate applications. However, these methods are costly and result in excessive chemical use. Therefore, developing herbicide-resistant eucalyptus is the most effective strategy for managing weeds and improving yields (Kumar, et al. 2008 ; Dong, et al. 2021 ). Genetic engineering has proven to be the most efficient method for developing herbicide-resistant crops, such as soybean, maize, cotton, canola, and alfalfa (Kuang, et al. 2024 ). Herbicide resistance is the predominant trait, with plantation areas reaching nearly 90% of all GM crops, and glyphosate-resistant crops being the most widely grown. In eucalyptus, Shell company applied for a patent involving in genetically modified (GM) eucalyptus resistant to glyphosate in 1995 (Bonny 2016 ). There was also an instance of the incorporation of the Bar gene into eucalyptus ( E. camaldulensis ) (Harcourt, et al. 2000 ). Notably, the GM eucalyptus variety event H421 with a trait conferred by the introduction of the cel1 gene from Arabidopsis thaliana was approved for commercial release by Brazil's National Biotechnology Safety Committee (CTNBio) in 2015 (Pinheiro, et al. 2023 ). Lately, another eucalyptus variety (751K032) tolerant to glyphosate herbicide by the introduction of the cp4-epsps gene was also approved by CTNBio (Avisar, Dias, et al. 2023). More recently, a Bt eucalyptus was also approved for controlling caterpillar infestations (Avisar, et al. 2024 ). However, few reports of GM in in elite clones such as the hybrid of E. urophylla and E. grandis clone DH3229 which was the most widely planted clone in South China owing to the lack of an efficient genetic transformation system. More recently, Successfully established genetic and transformation system in DH3229 (Wang, et al. 2023 ) provides an opportunity to create genetically modified eucalyptus. Therefore, the present study aimed to introduce the g10-epsps gene into the elite eucalyptus clone DH3229. The resulting transgenic plants were tested for their resistance to glyphosate herbicide. Additionally, shikimic acid accumulation and other physiological assays were conducted to elucidate the glyphosate resistance mechanisms in the transgenic plants. Material and methods Plant materials The Agrobacterium tumefaciens EHA105 strain containing the pSOY19 plasmid was provided by Prof. Zhicheng Shen from the School of Life Sciences at Zhejiang University, China. In vitro plants of the E. urophylla × E. grandis DH3229 clone were cultivated and propagated by the Research Institute of Tropical Forestry, Chinese Academy of Forestry. All plantlets were cultured in MS medium containing 0.1 mg·L⁻¹ NAA, 0.5 mg·L⁻¹ 6-BA and 30 mg·L⁻¹ sucrose and under a 16h photoperiod (100 mmol·m − 2 ·s − 1 ) at 25 ± 2°C. Genetic transformation The transformation of eucalyptus was carried out using an Agrobacterium -mediated method on in vitro eucalyptus leaves (Wang, Luo, et al. 2022). The details are as follows: In vitro leaves were used as explants and precultured for three days. The explants were then immersed in an A. tumefaciens solution with an OD600 = 0.3 for 30 minutes. After 72 h of cocultivation, the explants were transferred to WPM liquid medium containing 0.02 mg·L⁻¹ NAA, 0.24 mg·L⁻¹ CPPU, 30 g·L⁻¹ sucrose and 1 mg·L⁻¹ hydrolyzed casein with addition of 15 mg·L⁻¹ kanamycin (Kan) and 300 mg·L⁻¹ Cefotaxime (Cef) for 15 days, then adventitious buds were induced in MS medium containing 0.1 mg·L⁻¹ NAA, 0.5 mg·L⁻¹ 6-BA and 30 g·L⁻¹ sucrose, and 15 mg·L⁻¹ sucrose with same concentration of Kan and Cef. The medium was replaced every 15 days until resistant buds appeared. The transgenic eucalyptus plants were confirmed by PCR amplification. After propagation, the regenerated adventitious buds were transferred to 1/2MS medium containing 0.1 mg·L⁻¹ NAA and 20 g·L⁻¹ sucrose with antibiotics to induce adventitious roots, and complete regenerated plants could be obtained. Genomic DNA extraction and transgenic plant verification by PCR amplification Genomic DNA was purified from the leaves using a modified Hexadecyltrimethylammonium bromide (CTAB) method (Carey, et al. 2023 ). The isolated genomic DNA was used as a template for amplification with specific primers for the 35S promoter, nptII gene, and g10-epsps gene (Xiao, et al. 2019 ). The PCR amplification was performed using 2 × Taq PCR StarMix (Genstar, Beijing) with the following conditions: initial denaturation at 94℃ for 5 minutes, followed by 35 cycles of 94℃ for 30 seconds, 58℃ (35S and nptII ) or 56℃ ( g10-epsps ) for 30 seconds, 72℃ for 45 seconds, and a final extension at 72℃ for 5 minutes. Semi-quantitative RT-PCR and qRT- PCR for epsps Total RNA was extracted from leaves of transgenic eucalyptus using the RNAprep Pure Plant Kit (Aidlad Biotech, China). A total of 1 µg of RNA was used to synthesize cDNA with the SuperScript™ III First-Strand Synthesis SuperMix (Invitrogen, USA). For semi-quantitative reverse transcription PCR (RT-PCR) was performed with LaTaq DNA polymerase (TaKaRa, Japan). Quantitative real time PCR (qRT-PCR) was conducted using SYBR Green qPCR Master Mix (TaKaRa, Japan), and gene expression levels calculated 2 –ΔΔCt method (Livak and Schmittgen 2001 ). The reference gene is EgrEF2 (Liu, et al. 2018 ). Specific primers are listed in Table 1 . Table 1 Primer information used for PCR amplification and qRT-PCR Primer name Sequence (5’-3’) Fragments length (bp) 35S-F TGTGCGTCATCCCTTACGTC 328 35S-R TAACATGGTGGAGCACGACA nptII -F TGTCATACCACTTGTCCGCC 357 nptII -R ATCGAGCTGTATGCGGAGTG epsps -F AATCGGCGGTCTCTCTTGCTC 747 epsps -R CCGATTACCCTGATTCCCTTG qepsps- F AGAGCCAATTAAAGTCATCCC 202 qepsps- R CCATTTACGAACGATAGCCAT EgrEF2 -F TCCAATCCGAGTCGCTGTCATTGT 152 EgrEF 2-R TGATGAGCCTCTCTGGTTTGACCT Protein Quantification of g10-epsps The ELISA was used to detect the expression levels of G10-EPSPS in transgenic eucalyptus. The 4th to 5th leaves from the apex were collected when the plants were three months old and had reached a height of 40–50 cm. The ELISA kit for G10-EPSPS was purchased from YouLong Biotech (Shanghai, China), and the experiments were conducted according to the manufacturer’s instructions. Glyphosate tolerance assay with spraying method Spraying assays were performed to evaluate the glyphosate tolerance of putative transgenic plants. After transplanting the plantlets to adventitious root induction medium (1/2MS medium containing 0.1 mg·L⁻¹ NAA and 20 g·L⁻¹ sucrose with antibiotics) with 4 mM glyphosate, the glyphosate-tolerant plants were transferred to pots with peat soil and placed in a greenhouse. The transgenic plants were then sprayed with Roundup® at a rate of 1000 g a.e. ha⁻¹ when they reached a height of 40–50 cm. Phytotoxicity symptoms were examined one week after spraying. All experiments were conducted with three replicates. Analysis of physiological content or activities of transgenic plants Chlorophyll (Chl a and Chl b) was extracted from 0.1 g of fresh leaves using 80% acetone, and the absorbance of the extract was measured at 440 nm, 645 nm, and 663 nm with a Varioskan LUX Multimode Microplate Reader (Thermo Fisher Scientific, Finland). Chlorophyll content was then determined (Fan, et al. 2018 ). To measure the activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) in transgenic plants, 100 mg of fresh leaf samples were used. Antioxidant enzyme extraction was performed according to the manufacturer's instructions using assay kits from Nanjing Jiancheng Bioengineering Institute ( Nanjing Jiancheng Bioengineering Institute , Nanjing, China). The absorbance of enzyme extracts was measured with a Varioskan LUX Multimode Microplate Reader (Thermo Fisher Scientific) at 550 nm, 420 nm and 405 nm, respectively. Enzyme activities were calculated according to previously reported methods (Fan, et al. 2018 ). Additionally, malondialdehyde (MDA) and proline were extracted using kits ( Nanjing Jiancheng Bioengineering Institute , Nanjing, China), and their contents were estimated by measuring absorbance at 530 nm and 520 nm, respectively. Shikimic acid accumulation studies Leaves were collected eight days after glyphosate treatment and immediately transferred to a drying oven set at 105℃ for 5 minutes, then dried at 75℃ for 1–2 h until the weight remained constant. The dried leaves were then powdered, and 100 mg was used for extraction and determination of shikimic acid using a high-performance liquid chromatography and mass spectrometry system (Wang, et al. 2011 ). All experiments were conducted with three replicates. Data collection and Statistical analysis The experiments, including qRT-PCR, protein quantification, and physiological assessments, were conducted with three replicates. One-way ANOVA was used with a 5% Duncan Means Test in cases of multiple comparisons. The statistical analysis was carried out using SPSS statistical analysis software. Data presented are mean ± SE of replicates. The different letters in the graphs indicate significant differences among treatments ( p < 0.05). To ensure data accuracy and avoid errors, three technical replicates are set for each strain. Result Development and molecular detection of putative transgenic eucalyptus Following our established Agrobacterium -mediated transformation protocol for Eucalyptus urophylla × E. grandis DH3229, leaves were used as explants and infected with A. tumefaciens EHA105. After cocultivation (Fig. 1 a), the leaves were transferred to a selection medium containing kanamycin to callus formation and adventitious buds (Fig. 1 b). The medium was refreshed every 15 days and browning or necrotic explants were removed (Fig. 1 c). Resistant adventitious buds appeared after 4–6 cycles of medium replacement (Fig. 1 d). Individual buds were then separated, and the putative transgenic plants were initially screened for confirmation by PCR assays. PCR detection of internal fragments corresponding to the 35S promoter, nptII gene and epsps gene confirmed T-DNA integration (Fig. 2 a). Buds showing all the DNA fragments were classified as transgenic and were propagated further (Fig. 1 e). Robust transgenic buds were subsequently cut for root induction (Fig. 1 f). Then rooting plants were transplanted into the soil and prepared for planting in a greenhouse (Fig. 1 g, h). To confirm stable integration of the epsps gene, PCR assays were performed at various stages including propagation, rooting, and after approximately 2 months of growth in the greenhouse. As shown in Fig. 2 b, the epsps gene was consistently detected across all stages. Similarly, 35S and nptII fragments were detected in all transgenic lines (data not shown), indicating stable inheritance of the epsps gene. Gene expression of epsps in different lines was assessed using semi-quantitative PCR and qRT-PCR (Fig. 3 a, b). Semi-quantitative PCR indicated that epsps expression was significantly higher in Lines A4 and A9 compared to other lines (Fig. 3 a). qRT-PCR results confirmed the functionality of the g10-epsps gene in transgenic eucalyptus (Fig. 3 b). Consistent with epsps gene expression, higher levels of EPSPS protein were observed in Lines A4 and A9 (Fig. 3 c). Consequently, Lines A4 and A9 were selected for further glyphosate tolerance analysis. Glyphosate tolerance analysis of transgenic eucalyptus In addition to kanamycin selection, glyphosate resistance was also used to identify transgenic plants. Sensitivity to glyphosate was assessed in hybrid eucalyptus DH3229. As shown in Fig. 4 a, adventitious buds were highly sensitive to glyphosate. Application of 0.5 mM glyphosate in the rooting induction medium significantly reduced the adventitious root induction rate to 27.4%, compared to 98.5% in the control. Increasing glyphosate concentration further decreased root induction, with 4 mM glyphosate causing complete inhibition of adventitious root formation and browning or death of shoots (Fig. 4 b). This indicates that 4 mM glyphosate is suitable for selecting glyphosate-resistant transgenic plants. Propagation buds from epsps -overexpressing lines were used for root induction in 4 mM glyphosate medium. As shown in Fig. 5 , transgenic lines A4 and A9 demonstrated clear glyphosate resistance. In contrast to wild-type (WT) DH3229, which exhibited withered leaves and brown shoots, Lines A4 and A9 continued to grow and formed adventitious roots in glyphosate-containing medium. Physiological and phenotypic characterization of transgenic eucalyptus upon glyphosate application To further evaluate herbicide resistance, shoots of 30–40 cm height were sprayed with a 200-fold diluted Roundup solution. Typical glyphosate symptoms were observed in both transgenic lines A4 and A9 and WT plants (Fig. 6 ). WT plants showed chlorosis, withering, and eventual death within 8 days after glyphosate application (Fig. 6 ). In contrast, transgenic plants initially displayed slight burn symptoms at the leaf edges but eventually recovered, demonstrating high glyphosate tolerance. To elucidate the mechanism of glyphosate resistance, physiological characteristics were analyzed. WT plants accumulated approximately 2.61 mg/g dried leaves of shikimic acid after glyphosate treatment, a significant increase compared to untreated plants. In contrast, transgenic plants showed only a slight increase in shikimic acid levels post-treatment. The high shikimic acid accumulation in WT plants was associated with their death, whereas transgenic plants exhibited minimal changes. Chl a and Chl b levels decreased significantly in WT plants but remained stable or showed only slight reductions in Line A9. The activities of the antioxidant enzymes SOD, POD, and CAT increased in WT plants after glyphosate treatment, while only slight increases were observed in transgenic plants. Similar trends were noted for MDA and proline content. Discussion Weed interference poses a significant challenge to eucalyptus plantation management, particularly during the first eighteen months to two years after planting (Minogue and Osiecka 2015 ). Effective weeding is crucial for optimizing productivity in commercial eucalyptus plantations. Mechanical and chemical weeding are the most commonly employed methods (Deng, et al. 2020 ), with glyphosate being a preferred herbicide due to its low labor requirements and high efficacy (George and Brennan 2002 ; Junior, et al. 2020 ; Barroso, et al. 2022 ). However, glyphosate drift can severely damage young eucalyptus plants, leading to leaf necrosis, reduced biomass accumulation, and stunted growth, which ultimately impacts wood productivity (Santos, JA, et al. 2015 ; Santos, et al. 2019 ; Meloni and Martínez 2021 ; Barroso, et al. 2022 ). To address these issues, cultivating glyphosate-tolerant eucalyptus cultivars offers a promising solution. Such cultivars would facilitate easier weed management and potentially reduce costs compared to traditional weeding methods. Genetically modified crops, such as corn, cotton, and soybean, have successfully incorporated glyphosate resistance by expressing insensitive forms of the EPSPS enzyme, including mutated ( tips-epsps ) or microbial ( cp4-epsps ) variants, leading to enhanced farm productivity and profitability (Achary, et al. 2020 ; Avisar, Dias, et al. 2023). Despite these advancements, only two herbicide-resistant transgenic events have been developed for eucalyptus: one involving the bar gene in E. camaldulensis (Harcourt, et al. 2000 ) and another with the cp4-epsps gene (Avisar, Azulay, et al. 2023). Meanwhile, the risk assessments of GM eucalyptus overexpressed the EPSPS gene were also further verified their safety and approved for commercial use. However, the transgenic eucalyptus with glyphosate resistance is still very limited in cultivated species. The limited progress in developing glyphosate-resistant eucalyptus is likely due to challenges associated with the recalcitrance of eucalyptus regeneration and low transformation efficiency in elite clones. Our study aimed to introduce the g10-epsps gene into the hybrid E. urophylla × E. grandis superior clone DH3229 to confer resistance against glyphosate. The g10-epsps gene, derived from Streptococcus and driven by the 35S promoter (Lu, et al. 2014 ), has been successfully used in other crops. For instance, transgenic soybean expressing g10-epsps demonstrated glyphosate tolerance and withstood Roundup® applications up to 6 kg/hectare-4.9 times the recommended field rate (Lu, et al. 2014 ; Wang, Li, et al. 2022). Similarly, transgenic maize with the g10-epsps gene survived glyphosate applications, while non-transgenic maize did not (Wang, Li, et al. 2022). In our study, eucalyptus plants carrying the g10-epsps gene also exhibited notable glyphosate tolerance, although initial symptoms such as slight damage to young leaves and shoot apices were observed. Fortunately, these plants recovered rapidly, showing no significant adverse effects on stem height or biomass. Nonetheless, selecting additional transgenic lines and monitoring phenotypic effects in field conditions remain essential. EPSPS , which catalyzes a key step in the shikimate pathway for aromatic amino acid synthesis, is inhibited by glyphosate, leading to shikimic acid accumulation and plant death (Pline, et al. 2002 ). Thus, shikimic acid content is a reliable marker for assessing glyphosate resistance. In our study, transgenic lines A4 and A9 showed only minimal shikimic acid accumulation after glyphosate application, consistent with their high glyphosate resistance. Recent research has indicated that residual glyphosate does not adversely affect fungal growth or the distribution and development of soil microorganisms in eucalyptus plantations (Rabelo, et al. 2023 ). Additionally, studies with transgenic eucalyptus expressing cp4-epsps have shown no negative effects on arthropods or soil microorganisms (Avisar, Azulay, et al. 2023). These findings suggest that glyphosate-tolerant eucalyptus is safe for plantation and wood production, providing a foundation for its future use in South China. Furthermore, emerging genome editing technologies, such as CRISPR/Cas 9-based methods, hold promise for enhancing herbicide resistance traits, potentially leading to increased wood productivity and more efficient weed management. Conclusion This study achieved the successful transformation of the g10-epsps gene into Eucalyptus urophylla × E. grandis , this is the first time to transfer g10-epsps into eucalyptus, resulting in glyphosate-resistant lines. Through ELISA, semi-quantitative PCR, and qRT-PCR, we identified lines A4 and A9 with high g10-epsps expression. These lines exhibited significantly reduced levels of antioxidant enzyme activity, malondialdehyde, proline, and shikimic acid, with line A9 showing superior glyphosate resistance compared to A4. This shows that the transgenic eucalyptus obtained in this study has high resistance to glyphosate, which will be used in afforestation to effectively manage weeds, offering a promising approach for improved weed management in forestry. Declarations Authors contribution The authors confirm contribution to the paper as follows: Fan C and Wang X conducted experiment and wrote manuscript, Wang X, Zhang S, Wei H and Gao J performed experiments and collected supporting data, Fan C and Zeng B supervised experiments and revised manuscript. All authors reviewed the results and approved the final version of the manuscript. Acknowledge This work was supported by the National Key R&D Program of China during the 14th Five-year Plan Period (2021YFD2200102) and Fundamental Research Funds for the Central Non-profit Research Institution of CAF (CAFYBB2020ZB004). This article does not contain any investigation of human participants or animals undertaken by any of the authors. The authors declare that they have no conflict of interest. Data availability The data obtained and analyzed during the present study are available on reasonable request to the corresponding author. References Achary VMM, Sheri V, Manna M et al (2020) Overexpression of improved EPSPS gene results in field level glyphosate tolerance and higher grain yield in rice. Plant Biotechnol J 18:2504–2519 Avisar D, Azulay S, Bombonato L et al (2023) Safety Assessment of the CP4 EPSPS and NPTII Proteins in Eucalyptus. GM Crops Food 14:1–14 Avisar D, Dias TB, Santos AA et al (2023) Safety of genetically modified glyphosate-tolerant eucalyptus designed for integrated weed management. Adv Weed Sci 41 Avisar D, Manoeli A, Dos Santos AA et al (2024) Genetically engineered eucalyptus expressing pesticidal proteins from Bacillus thuringiensis for insect resistance: a risk assessment evaluation perspective. Front Bioeng Biotechnol 12:1322985 Barroso GM, De Carvalho AJ, Custódio IG et al (2022) Sensitivity of eucalyptus clones to herbicides associated with foliar fertilizers. Forests 13:1490 Behera L, Ray L, Ranjan Nayak M et al (2020) Carbon sequestration potential of Eucalyptus spp.: A review. E-Planet 18:79–84 Bonny S (2016) Genetically Modified Herbicide-Tolerant Crops, Weeds, and Herbicides: Overview and Impact. Environ Manage 57:31–48 Carbonari CA, Gomes GL, Krenchinski FH et al (2020) Dynamics and efficacy of sulfentrazone, flumioxazin, and isoxaflutole herbicides applied on eucalyptus harvest residues. New Forest 51:723–737 Carey SJ, Becklund LE, Fabre PP et al (2023) Optimizing the lysis step in CTAB DNA extractions of silica-dried and herbarium leaf tissues. Appl plant Sci 11:11522 Deng Y, Yang G, Xie Z et al (2020) Effects of different weeding methods on the biomass of vegetation and soil evaporation in eucalyptus plantations. Sustainability 12:3669 Dong H, Huang Y, Wang K (2021) The development of herbicide resistance crop plants using CRISPR/Cas9-mediated gene editing. Genes 12:912 Fan C, Qiu Z, Zeng B et al (2018) Physiological adaptation and gene expression analysis of Casuarina equisetifolia under salt stress. Biol Plant 62:489–500 George B, Brennan P (2002) Herbicides are more cost-effective than alternative weed control methods for increasing early growth of Eucalyptus dunnii and Eucalyptus saligna. New Forest 24:147–163 Harcourt R, Kyozuka J, Floyd R et al (2000) Insect-and herbicide-resistant transgenic eucalypts. Mol Breeding 6:307–315 Junior WR, Costa YK, Carbonari CA et al (2020) Growth, morphological, metabolic and photosynthetic responses of clones of eucalyptus to glyphosate. For Ecol Manag 470:118218 Kuang Y, Yu H, Qi F et al (2024) Developing herbicide-resistant crops through genome editing technologies: A review. Crop Prot 183:106745 Kumar V, Bellinder R, Gupta R et al (2008) Role of herbicide-resistant rice in promoting resource conservation technologies in rice–wheat cropping systems of India: a review. Crop Prot 27:290–301 Lee SH, Dahali R, Nik Hashim NH et al (2023) Eucalyptus Plantation Worldwide, Its Hybridization and Cloning Development. Springer Nat Singap, :1–15 Liu Q, Guo G, Qiu Z et al (2018) Exogenous GA 3 application altered morphology, anatomic and transcriptional regulatory networks of hormones in Eucalyptus grandis. Int J Cell Biology 255:1107–1119 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method. Methods 25:402–408 Lu L, Han Q, Li L et al (2014) Establishment of an efficient transformation protocol for soybean using glyphosate as selective agent and the development of glyphosate-tolerant transgenic soybean lines. entia Sinica(Vitae) 44:406–415 Meloni DA, Martínez CA (2021) Physiological responses of Eucalyptus camaldulensis (Dehnh.) to simulated glyphosate drift. Biodix Sci J 6:46–53 Minogue PJ, Osiecka A (2015) Selective herbicides for cultivation of Eucalyptus urograndis clones. International Journal of Forestry Research 2015:341314 Pereira FC, Nepomuceno M, Pires RN et al (2013) Response of eucalyptus (Eucalyptus urograndis) plants at different doses of glyphosate. J Agric Sci 5:66 Pinheiro AC, Dos Santos AA, Avisar D et al (2023) Five-years post commercial approval monitoring of eucalyptus H421. Front Bioeng Biotechnol 11:1257576 Pline WA, Wilcut JW, Duke SO et al (2002) Tolerance and accumulation of shikimic acid in response to glyphosate applications in glyphosate-resistant and nonglyphosate-resistant cotton (Gossypium hirsutum L). J Agricultural Food Chem 50:506–512 Rabelo JS, Santos EA, Melo EI et al (2023) Tolerance of microorganisms to residual herbicides found in eucalyptus plantations. Chemosphere 329:138630 Santos SA, Santos LD, Tanaka FAO et al (2019) Carfentrazone-ethyl and glyphosate drift inhibits uredinial formation of Austropuccinia psidii on Eucalyptus grandis leaves. Pest Manag Sci 75:53–62 Santos JA, Tuffi Santos L, Ferreira F et al (2015) Glyphosate drift in eucalyptus plants. Planta Daninha 33:615–621 Wang G, Hu W, Huang B et al (2011) Illicium verum: a review on its botany, traditional use, chemistry and pharmacology. J Ethnopharmacol 136:10–20 Wang X, Chen S, Zhang H et al (2023) Agrobacterium-mediated genetic transformation of the most widely cultivated superior clone Eucalyptus urophylla × E. grandis DH32-29 in Southern China. Front Plant Sci 13:1011245 Wang X, Luo P, Qiu Z et al (2022) Adventitious bud regeneration and Agrobacterium tumefaciens-mediated genetic transformation of Eucalyptus urophylla × E. tereticornis interspecific hybrid. Vitro Cell Dev Biology - Plant 58:416–426 Wang Y, Li Z, Chen X et al (2022) An efficient soybean transformation protocol for use with elite Lines. Tissue Organ Cult (PCTOC) 151:457–466 Xiao P, Yi L, Yue C (2019) Overexpression of G10-EPSPS in soybean provides high glyphosate tolerance. J Integr Agric 18:1851–1858 Cite Share Download PDF Status: Published Journal Publication published 03 Feb, 2025 Read the published version in Plant Cell, Tissue and Organ Culture (PCTOC) → Version 1 posted Reviewers agreed at journal 05 Nov, 2024 Reviewers invited by journal 04 Nov, 2024 Editor assigned by journal 01 Nov, 2024 First submitted to journal 29 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5342227","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":373847207,"identity":"66c3050f-ab71-44c7-865d-df224927ce43","order_by":0,"name":"Xuejun Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6ElEQVRIie3PsWvCQBTH8RceXJajGVyuJHj/QkKgf08OwU2wS7lBaMTybqjdA/4Tjo7Jkumqa8aI/0Dd3Kp7SxI3h/vM7wu/B+A4D4jJw/l00b8oZbVsM73oT54EpClY9JMCV3Fr6/5kLOBl5BEG0Pj0fPzAAcPCfIqvxEJvsyStcgaB+cy6k6isT8Wep35UUaN2EQj7ve1OQJmYv4mJl6tbYhnEYtaXTJjgLH7PS0VzRTggEVMWcsoQGkUwLOEWk8KWmKyrlchszXt/kWbttT+6ROmb4/miF+PAfHUnf/D7zh3HcZx/XQHVOUoNQ18KcAAAAABJRU5ErkJggg==","orcid":"","institution":"Research Institute of Tropical Forestry Chinese Academy of Forestry","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xuejun","middleName":"","lastName":"Wang","suffix":""},{"id":373847208,"identity":"d3e1c1cd-8b85-40ab-93ef-99b2241b133f","order_by":1,"name":"Haoyu Wei","email":"","orcid":"","institution":"Northeast Forestry University School of Forestry","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Haoyu","middleName":"","lastName":"Wei","suffix":""},{"id":373847209,"identity":"0394674c-0de4-4c54-9572-4659eb6dfdde","order_by":2,"name":"Shuang Zhang","email":"","orcid":"","institution":"Research Institute of Tropical Forestry Chinese Academy of Forestry","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shuang","middleName":"","lastName":"Zhang","suffix":""},{"id":373847210,"identity":"7d1c50da-c9ba-4160-b3b7-fe30a7c7c3a3","order_by":3,"name":"Jiahui Gao","email":"","orcid":"","institution":"Northeast Forestry University School of Forestry","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jiahui","middleName":"","lastName":"Gao","suffix":""},{"id":373847211,"identity":"886a24fd-63e5-4dbd-aa85-05f503d02f89","order_by":4,"name":"Binshan Zeng","email":"","orcid":"","institution":"Research Institute of Tropical Forestry Chinese Academy of Forestry","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Binshan","middleName":"","lastName":"Zeng","suffix":""},{"id":373847212,"identity":"c9cddb66-55d9-4912-a2a6-a2093a8ad79f","order_by":5,"name":"Chunjie Fan","email":"","orcid":"https://orcid.org/0000-0003-1152-3539","institution":"Research Institute of Tropical Forestry Chinese Academy of Forestry","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chunjie","middleName":"","lastName":"Fan","suffix":""}],"badges":[],"createdAt":"2024-10-27 16:52:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5342227/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5342227/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11240-025-02967-x","type":"published","date":"2025-02-03T15:57:24+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":69279713,"identity":"d645ab68-c13b-4f88-aa5e-46c76483ac99","added_by":"auto","created_at":"2024-11-18 18:14:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":25323872,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic overview of the genetic transformation process for \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEucalyptus urophylla\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003e×\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. grandis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Infection of eucalyptus leaves with \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e EHA105, (b) Explants were transferred to selection medium containing kanamycin, (c) Callus formation, (d) Resistant adventitious buds appeared, (e) Resistant buds propagation, (f) Adventitious rooting inducing, (g) Transplantation of transgenic plants, (h) Transgenic plants grown into the greenhouse.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-5342227/v1/a692b0ada16f54a0361457b5.png"},{"id":69279752,"identity":"896e3882-c0a8-41ae-b16e-e251b972fc49","added_by":"auto","created_at":"2024-11-18 18:14:39","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3069779,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDetection and verification of transgenic plants by PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) PCR analysis of transgenic plants for the presence of \u003cem\u003eg10-epsps\u003c/em\u003e gene. M represents\u003c/p\u003e\n\u003cp\u003emarker, + represents plasmid control, represents untransformed wild type, A1, A4, A5, A7, A9 and A10 represent transformed plant lines, (b) PCR analysis for confirmation of transgenic lines. M represents marker, + represents plasmid control, - represents untransformed wild type, A1, A4, A5, A7, A9 and A10 represent transformed plant lines.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-5342227/v1/c68400e52ea88281b1349c35.png"},{"id":69279684,"identity":"aebb0c89-8025-433f-a573-6dc4ed8dfae2","added_by":"auto","created_at":"2024-11-18 18:13:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3487496,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGene expression and protein quantification of G10-EPSPS in transgenic Lines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Semi-quantitative PCR analysis of G10-EPSPS gene expression in various transgenic lines, (b) qRT-PCR analysis of G10-\u003cem\u003eEPSPS\u003c/em\u003egene expression. Different letters indicate significant differences among treatments using Duncan’s multiple range test at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, (c) Protein quantification of G10-EPSPS by ELISA. Quantitative analysis of G10-EPSPS protein levels in various transgenic lines, indicating higher accumulation in certain lines. Different letters indicate significant differences among treatments using Duncan’s multiple range test at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-5342227/v1/62113d68421143fe743d2e33.png"},{"id":69279798,"identity":"c9d319a9-ec8d-413e-a7ee-f2802677ca85","added_by":"auto","created_at":"2024-11-18 18:15:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":20336419,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOptimal glyphosate concentration for inducing adventitious roots in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEucalyptus urophylla \u003c/strong\u003e\u003c/em\u003e×\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. grandis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e in\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e vitro\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e(a) Sensitivity of hybrid eucalyptus DH3229 to glyphosate. Data are means±SE of 3 replicates. Different letters indicate significant differences among treatments using Duncan’s multiple range test at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05. The rooting characteristics indicate that there is a significant difference in the average values between the absence and addition of glyphosate，(b) Growth status of eucalyptus DH3229 under different glyphosate concentrations.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-5342227/v1/ec1e087b95bfac8091e5b978.png"},{"id":69279751,"identity":"3e26c6d3-3adb-4346-a9e3-92c03159cf5d","added_by":"auto","created_at":"2024-11-18 18:14:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":8321851,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of resistance of transgenic \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEucalyptus urophylla\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003e× \u003cem\u003e\u003cstrong\u003eE. grandis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eto glyphosate\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-5342227/v1/412d46fad533fe1f438b2227.png"},{"id":69279789,"identity":"bdd076b3-79b7-453f-aae4-62bbe08a0d8b","added_by":"auto","created_at":"2024-11-18 18:14:54","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3321473,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGrowth and herbicide resistance of transgenic eucalyptus lines under glyphosate treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Symptoms of glyphosate treatment on transgenic eucalyptus lines A4 and A9 and wild-type plants，(b) Growth status of eucalyptus DH3229 under different glyphosate concentrations.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-5342227/v1/d683ad1a0139637becf551cc.png"},{"id":69279685,"identity":"39ead6df-e8bd-477d-b9bd-a12c2f92a464","added_by":"auto","created_at":"2024-11-18 18:13:39","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":8103908,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhysiological characteristics of transgenic eucalyptus lines under glyphosate treatment.\u003c/strong\u003e (a) Shikimic acid content, (b) Chlorophyll a content, (c) Chlorophyll b content, (d) SOD enzyme activities, (e) POD enzymes activities, (f) CAT enzymes activities, (g) MDA content and (h) Proline content in transgenic eucalyptus lines and control under glyphosate treatment. Data are means±SE of 3 replicates. Different letters indicate significant differences among treatments using Duncan’s multiple range test at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05. Character indicate the mean values are significantly different between WT and transgenic plants.\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-5342227/v1/cbde8d0eac65cee64ec7c3da.png"},{"id":75930395,"identity":"0ddef4d0-67f7-45ef-accc-e4389823d807","added_by":"auto","created_at":"2025-02-10 16:11:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":64929049,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5342227/v1/e02baabb-2094-4105-82fe-9f942a1a07c1.pdf"}],"financialInterests":"","formattedTitle":"Transgenic Eucalyptus urophylla × Eucalyptus grandis Superior Clone DH3229: Achieving Glyphosate Resistance through Genetic Modification","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEucalyptus, originating from Australia and neighboring islands, is widely cultivated commercially, primarily for pulp and timber production as a significant crop. According to the Global Forest Resources Assessment report by the FAO, the worldwide commercial plantation area of eucalyptus covers nearly 22.57\u0026nbsp;million hectares, representing only 0.5% of the global forest area while producing approximately 10% of roundwood products (Lee, et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Therefore, the eucalyptus genus is regarded as one of the most valuable species for the future, as it alleviates pressure on native forests for wood demand (Avisar, Azulay, et al. 2023) and contributes to atmospheric CO\u003csub\u003e2\u003c/sub\u003e sequestration (Behera, et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo achieve high-quality and high-quantity wood production, effective plantation management has become increasingly essential throughout the establishment of eucalyptus plantations. Weeds compete with young eucalyptus for water, light, and minerals, severely affecting the establishment, development, and productivity of eucalyptus roundwood. Weed competition has gradually become a limiting factor in eucalyptus plantations. During the initial stages of eucalyptus plantation, weeding is performed at least three times within the first 18 months due to the high sensitivity of young trees to weed competition. Historically, manual weeding was widely practiced in eucalyptus plantations. Currently, due to increasing plantation areas, high costs, labor shortages, and the arduous nature of manual labor, herbicides are extensively recommended for weed management because of their reliability, low cost, and high efficiency (Minogue and Osiecka \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Carbonari, et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGlyphosate is the primary herbicide used for weed management in eucalyptus plantations due to its high efficiency, broad spectrum, low toxicity, and rapid degradation (Junior, et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, eucalyptus is highly sensitive to glyphosate (Pereira, et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Junior, et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) and even a slight exposure to herbicide (diluted 800-fold Roundup) can cause severe leaf curling in young eucalyptus plantlets (Santos, JA, et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Santos, et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Meloni and Mart\u0026iacute;nez \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Manual spraying or the use of shields is typically employed to protect young eucalyptus plants from herbicide damage during glyphosate applications. However, these methods are costly and result in excessive chemical use. Therefore, developing herbicide-resistant eucalyptus is the most effective strategy for managing weeds and improving yields (Kumar, et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Dong, et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Genetic engineering has proven to be the most efficient method for developing herbicide-resistant crops, such as soybean, maize, cotton, canola, and alfalfa (Kuang, et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Herbicide resistance is the predominant trait, with plantation areas reaching nearly 90% of all GM crops, and glyphosate-resistant crops being the most widely grown.\u003c/p\u003e \u003cp\u003eIn eucalyptus, Shell company applied for a patent involving in genetically modified (GM) eucalyptus resistant to glyphosate in 1995 (Bonny \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). There was also an instance of the incorporation of the Bar gene into eucalyptus (\u003cem\u003eE. camaldulensis\u003c/em\u003e) (Harcourt, et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Notably, the GM eucalyptus variety event H421 with a trait conferred by the introduction of the cel1 gene from \u003cem\u003eArabidopsis thaliana\u003c/em\u003e was approved for commercial release by Brazil's National Biotechnology Safety Committee (CTNBio) in 2015 (Pinheiro, et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Lately, another eucalyptus variety (751K032) tolerant to glyphosate herbicide by the introduction of the \u003cem\u003ecp4-epsps\u003c/em\u003e gene was also approved by CTNBio (Avisar, Dias, et al. 2023). More recently, a Bt eucalyptus was also approved for controlling caterpillar infestations (Avisar, et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHowever, few reports of GM in in elite clones such as the hybrid of \u003cem\u003eE. urophylla\u003c/em\u003e and \u003cem\u003eE. grandis\u003c/em\u003e clone DH3229 which was the most widely planted clone in South China owing to the lack of an efficient genetic transformation system. More recently, Successfully established genetic and transformation system in DH3229 (Wang, et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) provides an opportunity to create genetically modified eucalyptus.\u003c/p\u003e \u003cp\u003eTherefore, the present study aimed to introduce the \u003cem\u003eg10-epsps\u003c/em\u003e gene into the elite eucalyptus clone DH3229. The resulting transgenic plants were tested for their resistance to glyphosate herbicide. Additionally, shikimic acid accumulation and other physiological assays were conducted to elucidate the glyphosate resistance mechanisms in the transgenic plants.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant materials\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e EHA105 strain containing the pSOY19 plasmid was provided by Prof. Zhicheng Shen from the School of Life Sciences at Zhejiang University, China. \u003cem\u003eIn vitro\u003c/em\u003e plants of the \u003cem\u003eE. urophylla\u003c/em\u003e \u0026times; \u003cem\u003eE. grandis\u003c/em\u003e DH3229 clone were cultivated and propagated by the Research Institute of Tropical Forestry, Chinese Academy of Forestry. All plantlets were cultured in MS medium containing 0.1 mg\u0026middot;L⁻\u0026sup1; NAA, 0.5 mg\u0026middot;L⁻\u0026sup1; 6-BA and 30 mg\u0026middot;L⁻\u0026sup1; sucrose and under a 16h photoperiod (100 mmol\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u0026middot;s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eGenetic transformation\u003c/h3\u003e\n\u003cp\u003eThe transformation of eucalyptus was carried out using an \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated method on in \u003cem\u003evitro\u003c/em\u003e eucalyptus leaves (Wang, Luo, et al. 2022). The details are as follows: In \u003cem\u003evitro\u003c/em\u003e leaves were used as explants and precultured for three days. The explants were then immersed in an \u003cem\u003eA. tumefaciens\u003c/em\u003e solution with an OD600\u0026thinsp;=\u0026thinsp;0.3 for 30 minutes. After 72 h of cocultivation, the explants were transferred to WPM liquid medium containing 0.02 mg\u0026middot;L⁻\u0026sup1; NAA, 0.24 mg\u0026middot;L⁻\u0026sup1; CPPU, 30 g\u0026middot;L⁻\u0026sup1; sucrose and 1 mg\u0026middot;L⁻\u0026sup1; hydrolyzed casein with addition of 15 mg\u0026middot;L⁻\u0026sup1; kanamycin (Kan) and 300 mg\u0026middot;L⁻\u0026sup1; Cefotaxime (Cef) for 15 days, then adventitious buds were induced in MS medium containing 0.1 mg\u0026middot;L⁻\u0026sup1; NAA, 0.5 mg\u0026middot;L⁻\u0026sup1; 6-BA and 30 g\u0026middot;L⁻\u0026sup1; sucrose, and 15 mg\u0026middot;L⁻\u0026sup1; sucrose with same concentration of Kan and Cef. The medium was replaced every 15 days until resistant buds appeared. The transgenic eucalyptus plants were confirmed by PCR amplification. After propagation, the regenerated adventitious buds were transferred to 1/2MS medium containing 0.1 mg\u0026middot;L⁻\u0026sup1; NAA and 20 g\u0026middot;L⁻\u0026sup1; sucrose with antibiotics to induce adventitious roots, and complete regenerated plants could be obtained.\u003c/p\u003e\n\u003ch3\u003eGenomic DNA extraction and transgenic plant verification by PCR amplification\u003c/h3\u003e\n\u003cp\u003eGenomic DNA was purified from the leaves using a modified Hexadecyltrimethylammonium bromide (CTAB) method (Carey, et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The isolated genomic DNA was used as a template for amplification with specific primers for the 35S promoter, \u003cem\u003enptII\u003c/em\u003e gene, and \u003cem\u003eg10-epsps\u003c/em\u003e gene (Xiao, et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The PCR amplification was performed using 2 \u0026times; Taq PCR StarMix (Genstar, Beijing) with the following conditions: initial denaturation at 94℃ for 5 minutes, followed by 35 cycles of 94℃ for 30 seconds, 58℃ (35S and \u003cem\u003enptII\u003c/em\u003e) or 56℃ (\u003cem\u003eg10-epsps\u003c/em\u003e) for 30 seconds, 72℃ for 45 seconds, and a final extension at 72℃ for 5 minutes.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSemi-quantitative RT-PCR and qRT- PCR for\u003c/b\u003e \u003cb\u003eepsps\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTotal RNA was extracted from leaves of transgenic eucalyptus using the RNAprep Pure Plant Kit (Aidlad Biotech, China). A total of 1 \u0026micro;g of RNA was used to synthesize cDNA with the SuperScript\u0026trade; III First-Strand Synthesis SuperMix (Invitrogen, USA). For semi-quantitative reverse transcription PCR (RT-PCR) was performed with LaTaq DNA polymerase (TaKaRa, Japan). Quantitative real time PCR (qRT-PCR) was conducted using SYBR Green qPCR Master Mix (TaKaRa, Japan), and gene expression levels calculated 2\u003csup\u003e\u0026ndash;ΔΔCt\u003c/sup\u003e method (Livak and Schmittgen \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). The reference gene is \u003cem\u003eEgrEF2\u003c/em\u003e (Liu, et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Specific primers are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer information used for PCR amplification and qRT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFragments length (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e35S-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTGCGTCATCCCTTACGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e328\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e35S-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAACATGGTGGAGCACGACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003enptII\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTCATACCACTTGTCCGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e357\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003enptII\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCGAGCTGTATGCGGAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eepsps\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATCGGCGGTCTCTCTTGCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e747\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eepsps\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGATTACCCTGATTCCCTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eqepsps-\u003c/em\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAGCCAATTAAAGTCATCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e202\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eqepsps-\u003c/em\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCATTTACGAACGATAGCCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEgrEF2\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCAATCCGAGTCGCTGTCATTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e152\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEgrEF\u003c/em\u003e2-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGATGAGCCTCTCTGGTTTGACCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eProtein Quantification of\u003c/b\u003e \u003cb\u003eg10-epsps\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe ELISA was used to detect the expression levels of G10-EPSPS in transgenic eucalyptus. The 4th to 5th leaves from the apex were collected when the plants were three months old and had reached a height of 40\u0026ndash;50 cm. The ELISA kit for G10-EPSPS was purchased from YouLong Biotech (Shanghai, China), and the experiments were conducted according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003ch3\u003eGlyphosate tolerance assay with spraying method\u003c/h3\u003e\n\u003cp\u003eSpraying assays were performed to evaluate the glyphosate tolerance of putative transgenic plants. After transplanting the plantlets to adventitious root induction medium (1/2MS medium containing 0.1 mg\u0026middot;L⁻\u0026sup1; NAA and 20 g\u0026middot;L⁻\u0026sup1; sucrose with antibiotics) with 4 mM glyphosate, the glyphosate-tolerant plants were transferred to pots with peat soil and placed in a greenhouse. The transgenic plants were then sprayed with Roundup\u0026reg; at a rate of 1000 g a.e. ha⁻\u0026sup1; when they reached a height of 40\u0026ndash;50 cm. Phytotoxicity symptoms were examined one week after spraying. All experiments were conducted with three replicates.\u003c/p\u003e\n\u003ch3\u003eAnalysis of physiological content or activities of transgenic plants\u003c/h3\u003e\n\u003cp\u003eChlorophyll (Chl a and Chl b) was extracted from 0.1 g of fresh leaves using 80% acetone, and the absorbance of the extract was measured at 440 nm, 645 nm, and 663 nm with a Varioskan LUX Multimode Microplate Reader (Thermo Fisher Scientific, Finland). Chlorophyll content was then determined (Fan, et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). To measure the activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) in transgenic plants, 100 mg of fresh leaf samples were used. Antioxidant enzyme extraction was performed according to the manufacturer's instructions using assay kits from Nanjing Jiancheng Bioengineering Institute (\u003cem\u003eNanjing Jiancheng Bioengineering Institute\u003c/em\u003e, Nanjing, China). The absorbance of enzyme extracts was measured with a Varioskan LUX Multimode Microplate Reader (Thermo Fisher Scientific) at 550 nm, 420 nm and 405 nm, respectively. Enzyme activities were calculated according to previously reported methods (Fan, et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Additionally, malondialdehyde (MDA) and proline were extracted using kits (\u003cem\u003eNanjing Jiancheng Bioengineering Institute\u003c/em\u003e, Nanjing, China), and their contents were estimated by measuring absorbance at 530 nm and 520 nm, respectively.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eShikimic acid accumulation studies\u003c/h2\u003e \u003cp\u003eLeaves were collected eight days after glyphosate treatment and immediately transferred to a drying oven set at 105℃ for 5 minutes, then dried at 75℃ for 1\u0026ndash;2 h until the weight remained constant. The dried leaves were then powdered, and 100 mg was used for extraction and determination of shikimic acid using a high-performance liquid chromatography and mass spectrometry system (Wang, et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). All experiments were conducted with three replicates.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eData collection and Statistical analysis\u003c/h3\u003e\n\u003cp\u003eThe experiments, including qRT-PCR, protein quantification, and physiological assessments, were conducted with three replicates. One-way ANOVA was used with a 5% Duncan Means Test in cases of multiple comparisons. The statistical analysis was carried out using SPSS statistical analysis software. Data presented are mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE of replicates. The different letters in the graphs indicate significant differences among treatments (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). To ensure data accuracy and avoid errors, three technical replicates are set for each strain.\u003c/p\u003e"},{"header":"Result","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eDevelopment and molecular detection of putative transgenic eucalyptus\u003c/h2\u003e \u003cp\u003eFollowing our established \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation protocol for \u003cem\u003eEucalyptus urophylla\u003c/em\u003e \u0026times; \u003cem\u003eE. grandis\u003c/em\u003e DH3229, leaves were used as explants and infected with A. tumefaciens EHA105. After cocultivation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea), the leaves were transferred to a selection medium containing kanamycin to callus formation and adventitious buds (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). The medium was refreshed every 15 days and browning or necrotic explants were removed (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Resistant adventitious buds appeared after 4\u0026ndash;6 cycles of medium replacement (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). Individual buds were then separated, and the putative transgenic plants were initially screened for confirmation by PCR assays. PCR detection of internal fragments corresponding to the 35S promoter, \u003cem\u003enptII\u003c/em\u003e gene and \u003cem\u003eepsps\u003c/em\u003e gene confirmed T-DNA integration (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Buds showing all the DNA fragments were classified as transgenic and were propagated further (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee). Robust transgenic buds were subsequently cut for root induction (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef). Then rooting plants were transplanted into the soil and prepared for planting in a greenhouse (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg, h).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo confirm stable integration of the \u003cem\u003eepsps\u003c/em\u003e gene, PCR assays were performed at various stages including propagation, rooting, and after approximately 2 months of growth in the greenhouse. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, the \u003cem\u003eepsps\u003c/em\u003e gene was consistently detected across all stages. Similarly, 35S and \u003cem\u003enptII\u003c/em\u003e fragments were detected in all transgenic lines (data not shown), indicating stable inheritance of the \u003cem\u003eepsps\u003c/em\u003e gene.\u003c/p\u003e \u003cp\u003eGene expression of \u003cem\u003eepsps\u003c/em\u003e in different lines was assessed using semi-quantitative PCR and qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b). Semi-quantitative PCR indicated that \u003cem\u003eepsps\u003c/em\u003e expression was significantly higher in Lines A4 and A9 compared to other lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). qRT-PCR results confirmed the functionality of the \u003cem\u003eg10-epsps\u003c/em\u003e gene in transgenic eucalyptus (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). Consistent with \u003cem\u003eepsps\u003c/em\u003e gene expression, higher levels of \u003cem\u003eEPSPS\u003c/em\u003e protein were observed in Lines A4 and A9 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Consequently, Lines A4 and A9 were selected for further glyphosate tolerance analysis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eGlyphosate tolerance analysis of transgenic eucalyptus\u003c/h2\u003e \u003cp\u003eIn addition to kanamycin selection, glyphosate resistance was also used to identify transgenic plants. Sensitivity to glyphosate was assessed in hybrid eucalyptus DH3229. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, adventitious buds were highly sensitive to glyphosate. Application of 0.5 mM glyphosate in the rooting induction medium significantly reduced the adventitious root induction rate to 27.4%, compared to 98.5% in the control. Increasing glyphosate concentration further decreased root induction, with 4 mM glyphosate causing complete inhibition of adventitious root formation and browning or death of shoots (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). This indicates that 4 mM glyphosate is suitable for selecting glyphosate-resistant transgenic plants.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003ePropagation buds from \u003cem\u003eepsps\u003c/em\u003e-overexpressing lines were used for root induction in 4 mM glyphosate medium. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, transgenic lines A4 and A9 demonstrated clear glyphosate resistance. In contrast to wild-type (WT) DH3229, which exhibited withered leaves and brown shoots, Lines A4 and A9 continued to grow and formed adventitious roots in glyphosate-containing medium.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePhysiological and phenotypic characterization of transgenic eucalyptus upon glyphosate application\u003c/h2\u003e \u003cp\u003eTo further evaluate herbicide resistance, shoots of 30\u0026ndash;40 cm height were sprayed with a 200-fold diluted Roundup solution. Typical glyphosate symptoms were observed in both transgenic lines A4 and A9 and WT plants (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). WT plants showed chlorosis, withering, and eventual death within 8 days after glyphosate application (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). In contrast, transgenic plants initially displayed slight burn symptoms at the leaf edges but eventually recovered, demonstrating high glyphosate tolerance.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo elucidate the mechanism of glyphosate resistance, physiological characteristics were analyzed. WT plants accumulated approximately 2.61 mg/g dried leaves of shikimic acid after glyphosate treatment, a significant increase compared to untreated plants. In contrast, transgenic plants showed only a slight increase in shikimic acid levels post-treatment. The high shikimic acid accumulation in WT plants was associated with their death, whereas transgenic plants exhibited minimal changes. Chl a and Chl b levels decreased significantly in WT plants but remained stable or showed only slight reductions in Line A9. The activities of the antioxidant enzymes SOD, POD, and CAT increased in WT plants after glyphosate treatment, while only slight increases were observed in transgenic plants. Similar trends were noted for MDA and proline content.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eWeed interference poses a significant challenge to eucalyptus plantation management, particularly during the first eighteen months to two years after planting (Minogue and Osiecka \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Effective weeding is crucial for optimizing productivity in commercial eucalyptus plantations. Mechanical and chemical weeding are the most commonly employed methods (Deng, et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), with glyphosate being a preferred herbicide due to its low labor requirements and high efficacy (George and Brennan \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Junior, et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Barroso, et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). However, glyphosate drift can severely damage young eucalyptus plants, leading to leaf necrosis, reduced biomass accumulation, and stunted growth, which ultimately impacts wood productivity (Santos, JA, et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Santos, et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Meloni and Mart\u0026iacute;nez \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Barroso, et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo address these issues, cultivating glyphosate-tolerant eucalyptus cultivars offers a promising solution. Such cultivars would facilitate easier weed management and potentially reduce costs compared to traditional weeding methods. Genetically modified crops, such as corn, cotton, and soybean, have successfully incorporated glyphosate resistance by expressing insensitive forms of the EPSPS enzyme, including mutated (\u003cem\u003etips-epsps\u003c/em\u003e) or microbial (\u003cem\u003ecp4-epsps\u003c/em\u003e) variants, leading to enhanced farm productivity and profitability (Achary, et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Avisar, Dias, et al. 2023). Despite these advancements, only two herbicide-resistant transgenic events have been developed for eucalyptus: one involving the bar gene in \u003cem\u003eE. camaldulensis\u003c/em\u003e (Harcourt, et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2000\u003c/span\u003e) and another with the \u003cem\u003ecp4-epsps\u003c/em\u003e gene (Avisar, Azulay, et al. 2023). Meanwhile, the risk assessments of GM eucalyptus overexpressed the EPSPS gene were also further verified their safety and approved for commercial use. However, the transgenic eucalyptus with glyphosate resistance is still very limited in cultivated species. The limited progress in developing glyphosate-resistant eucalyptus is likely due to challenges associated with the recalcitrance of eucalyptus regeneration and low transformation efficiency in elite clones.\u003c/p\u003e \u003cp\u003eOur study aimed to introduce the \u003cem\u003eg10-epsps\u003c/em\u003e gene into the hybrid \u003cem\u003eE. urophylla\u003c/em\u003e \u0026times; \u003cem\u003eE. grandis\u003c/em\u003e superior clone DH3229 to confer resistance against glyphosate. The \u003cem\u003eg10-epsps\u003c/em\u003e gene, derived from Streptococcus and driven by the 35S promoter (Lu, et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), has been successfully used in other crops. For instance, transgenic soybean expressing \u003cem\u003eg10-epsps\u003c/em\u003e demonstrated glyphosate tolerance and withstood Roundup\u0026reg; applications up to 6 kg/hectare-4.9 times the recommended field rate (Lu, et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Wang, Li, et al. 2022). Similarly, transgenic maize with the \u003cem\u003eg10-epsps\u003c/em\u003e gene survived glyphosate applications, while non-transgenic maize did not (Wang, Li, et al. 2022). In our study, eucalyptus plants carrying the \u003cem\u003eg10-epsps\u003c/em\u003e gene also exhibited notable glyphosate tolerance, although initial symptoms such as slight damage to young leaves and shoot apices were observed. Fortunately, these plants recovered rapidly, showing no significant adverse effects on stem height or biomass. Nonetheless, selecting additional transgenic lines and monitoring phenotypic effects in field conditions remain essential.\u003c/p\u003e \u003cp\u003e \u003cem\u003eEPSPS\u003c/em\u003e, which catalyzes a key step in the shikimate pathway for aromatic amino acid synthesis, is inhibited by glyphosate, leading to shikimic acid accumulation and plant death (Pline, et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Thus, shikimic acid content is a reliable marker for assessing glyphosate resistance. In our study, transgenic lines A4 and A9 showed only minimal shikimic acid accumulation after glyphosate application, consistent with their high glyphosate resistance.\u003c/p\u003e \u003cp\u003eRecent research has indicated that residual glyphosate does not adversely affect fungal growth or the distribution and development of soil microorganisms in eucalyptus plantations (Rabelo, et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Additionally, studies with transgenic eucalyptus expressing \u003cem\u003ecp4-epsps\u003c/em\u003e have shown no negative effects on arthropods or soil microorganisms (Avisar, Azulay, et al. 2023). These findings suggest that glyphosate-tolerant eucalyptus is safe for plantation and wood production, providing a foundation for its future use in South China. Furthermore, emerging genome editing technologies, such as CRISPR/Cas 9-based methods, hold promise for enhancing herbicide resistance traits, potentially leading to increased wood productivity and more efficient weed management.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study achieved the successful transformation of the \u003cem\u003eg10-epsps\u003c/em\u003e gene into \u003cem\u003eEucalyptus urophylla\u003c/em\u003e \u0026times; \u003cem\u003eE. grandis\u003c/em\u003e, this is the first time to transfer \u003cem\u003eg10-epsps\u003c/em\u003e into eucalyptus, resulting in glyphosate-resistant lines. Through ELISA, semi-quantitative PCR, and qRT-PCR, we identified lines A4 and A9 with high \u003cem\u003eg10-epsps\u003c/em\u003e expression. These lines exhibited significantly reduced levels of antioxidant enzyme activity, malondialdehyde, proline, and shikimic acid, with line A9 showing superior glyphosate resistance compared to A4. This shows that the transgenic eucalyptus obtained in this study has high resistance to glyphosate, which will be used in afforestation to effectively manage weeds, offering a promising approach for improved weed management in forestry.\u003c/p\u003e"},{"header":"Declarations","content":" \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eAuthors contribution\u003c/h2\u003e \u003cp\u003eThe authors confirm contribution to the paper as follows: Fan C and Wang X conducted experiment and wrote manuscript, Wang X, Zhang S, Wei H and Gao J performed experiments and collected supporting data, Fan C and Zeng B supervised experiments and revised manuscript. All authors reviewed the results and approved the final version of the manuscript.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eAcknowledge\u003c/h2\u003e \u003cp\u003eThis work was supported by the National Key R\u0026amp;D Program of China during the 14th Five-year Plan Period (2021YFD2200102) and Fundamental Research Funds for the Central Non-profit Research Institution of CAF (CAFYBB2020ZB004).\u003c/p\u003e \u003c/div\u003e \u003cp\u003eThis article does not contain any investigation of human participants or animals undertaken by any of the authors. The authors declare that they have no conflict of interest.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe data obtained and analyzed during the present study are available on reasonable request to the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAchary VMM, Sheri V, Manna M et al (2020) Overexpression of improved EPSPS gene results in field level glyphosate tolerance and higher grain yield in rice. Plant Biotechnol J 18:2504\u0026ndash;2519\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAvisar D, Azulay S, Bombonato L et al (2023) Safety Assessment of the CP4 EPSPS and NPTII Proteins in Eucalyptus. GM Crops Food 14:1\u0026ndash;14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAvisar D, Dias TB, Santos AA et al (2023) Safety of genetically modified glyphosate-tolerant eucalyptus designed for integrated weed management. Adv Weed Sci 41\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAvisar D, Manoeli A, Dos Santos AA et al (2024) Genetically engineered eucalyptus expressing pesticidal proteins from Bacillus thuringiensis for insect resistance: a risk assessment evaluation perspective. Front Bioeng Biotechnol 12:1322985\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarroso GM, De Carvalho AJ, Cust\u0026oacute;dio IG et al (2022) Sensitivity of eucalyptus clones to herbicides associated with foliar fertilizers. Forests 13:1490\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBehera L, Ray L, Ranjan Nayak M et al (2020) Carbon sequestration potential of Eucalyptus spp.: A review. E-Planet 18:79\u0026ndash;84\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonny S (2016) Genetically Modified Herbicide-Tolerant Crops, Weeds, and Herbicides: Overview and Impact. Environ Manage 57:31\u0026ndash;48\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarbonari CA, Gomes GL, Krenchinski FH et al (2020) Dynamics and efficacy of sulfentrazone, flumioxazin, and isoxaflutole herbicides applied on eucalyptus harvest residues. New Forest 51:723\u0026ndash;737\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarey SJ, Becklund LE, Fabre PP et al (2023) Optimizing the lysis step in CTAB DNA extractions of silica-dried and herbarium leaf tissues. Appl plant Sci 11:11522\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng Y, Yang G, Xie Z et al (2020) Effects of different weeding methods on the biomass of vegetation and soil evaporation in eucalyptus plantations. Sustainability 12:3669\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong H, Huang Y, Wang K (2021) The development of herbicide resistance crop plants using CRISPR/Cas9-mediated gene editing. Genes 12:912\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan C, Qiu Z, Zeng B et al (2018) Physiological adaptation and gene expression analysis of Casuarina equisetifolia under salt stress. Biol Plant 62:489\u0026ndash;500\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeorge B, Brennan P (2002) Herbicides are more cost-effective than alternative weed control methods for increasing early growth of Eucalyptus dunnii and Eucalyptus saligna. New Forest 24:147\u0026ndash;163\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarcourt R, Kyozuka J, Floyd R et al (2000) Insect-and herbicide-resistant transgenic eucalypts. Mol Breeding 6:307\u0026ndash;315\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJunior WR, Costa YK, Carbonari CA et al (2020) Growth, morphological, metabolic and photosynthetic responses of clones of eucalyptus to glyphosate. For Ecol Manag 470:118218\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuang Y, Yu H, Qi F et al (2024) Developing herbicide-resistant crops through genome editing technologies: A review. Crop Prot 183:106745\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar V, Bellinder R, Gupta R et al (2008) Role of herbicide-resistant rice in promoting resource conservation technologies in rice\u0026ndash;wheat cropping systems of India: a review. Crop Prot 27:290\u0026ndash;301\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee SH, Dahali R, Nik Hashim NH et al (2023) Eucalyptus Plantation Worldwide, Its Hybridization and Cloning Development. Springer Nat Singap, :1\u0026ndash;15\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Q, Guo G, Qiu Z et al (2018) Exogenous GA 3 application altered morphology, anatomic and transcriptional regulatory networks of hormones in Eucalyptus grandis. Int J Cell Biology 255:1107\u0026ndash;1119\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2\u0026thinsp;\u0026ndash; ∆∆CT method. Methods 25:402\u0026ndash;408\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu L, Han Q, Li L et al (2014) Establishment of an efficient transformation protocol for soybean using glyphosate as selective agent and the development of glyphosate-tolerant transgenic soybean lines. entia Sinica(Vitae) 44:406\u0026ndash;415\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeloni DA, Mart\u0026iacute;nez CA (2021) Physiological responses of Eucalyptus camaldulensis (Dehnh.) to simulated glyphosate drift. Biodix Sci J 6:46\u0026ndash;53\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinogue PJ, Osiecka A (2015) Selective herbicides for cultivation of Eucalyptus urograndis clones. International Journal of Forestry Research 2015:341314\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePereira FC, Nepomuceno M, Pires RN et al (2013) Response of eucalyptus (Eucalyptus urograndis) plants at different doses of glyphosate. J Agric Sci 5:66\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePinheiro AC, Dos Santos AA, Avisar D et al (2023) Five-years post commercial approval monitoring of eucalyptus H421. Front Bioeng Biotechnol 11:1257576\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePline WA, Wilcut JW, Duke SO et al (2002) Tolerance and accumulation of shikimic acid in response to glyphosate applications in glyphosate-resistant and nonglyphosate-resistant cotton (Gossypium hirsutum L). J Agricultural Food Chem 50:506\u0026ndash;512\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRabelo JS, Santos EA, Melo EI et al (2023) Tolerance of microorganisms to residual herbicides found in eucalyptus plantations. Chemosphere 329:138630\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos SA, Santos LD, Tanaka FAO et al (2019) Carfentrazone-ethyl and glyphosate drift inhibits uredinial formation of Austropuccinia psidii on Eucalyptus grandis leaves. Pest Manag Sci 75:53\u0026ndash;62\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos JA, Tuffi Santos L, Ferreira F et al (2015) Glyphosate drift in eucalyptus plants. Planta Daninha 33:615\u0026ndash;621\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang G, Hu W, Huang B et al (2011) Illicium verum: a review on its botany, traditional use, chemistry and pharmacology. J Ethnopharmacol 136:10\u0026ndash;20\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Chen S, Zhang H et al (2023) Agrobacterium-mediated genetic transformation of the most widely cultivated superior clone Eucalyptus urophylla \u0026times; E. grandis DH32-29 in Southern China. Front Plant Sci 13:1011245\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Luo P, Qiu Z et al (2022) Adventitious bud regeneration and Agrobacterium tumefaciens-mediated genetic transformation of Eucalyptus urophylla \u0026times; E. tereticornis interspecific hybrid. Vitro Cell Dev Biology - Plant 58:416\u0026ndash;426\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Li Z, Chen X et al (2022) An efficient soybean transformation protocol for use with elite Lines. Tissue Organ Cult (PCTOC) 151:457\u0026ndash;466\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao P, Yi L, Yue C (2019) Overexpression of G10-EPSPS in soybean provides high glyphosate tolerance. J Integr Agric 18:1851\u0026ndash;1858\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"plant-cell-tissue-and-organ-culture-pctoc","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcto","sideBox":"Learn more about [Plant Cell, Tissue and Organ Culture (PCTOC)](https://www.springer.com/journal/11240)","snPcode":"11240","submissionUrl":"https://submission.nature.com/new-submission/11240/3","title":"Plant Cell, Tissue and Organ Culture (PCTOC)","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"eucalyptus, genetic transformation, herbicide, weed control, EPSPS","lastPublishedDoi":"10.21203/rs.3.rs-5342227/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5342227/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEucalyptus species are known for their high productivity and adaptability, making them a reliable source of timber. However, hybrid eucalyptus, particularly in the initial months of plantation, is susceptible to weed competition. Glyphosate is the most commonly used herbicide for weed control in eucalyptus plantations. To incorporate glyphosate resistance into eucalyptus cultivars (\u003cem\u003eEucalyptus urophylla\u003c/em\u003e \u0026times; \u003cem\u003eE. grandis\u003c/em\u003e DH3229), the \u003cem\u003eg10-epsps\u003c/em\u003e gene, driven by the 35S promoter, was introduced using an efficient \u003cem\u003eAgrobacterium-\u003c/em\u003emediated genetic transformation method. Following PCR-based selection and detection, six plants were confirmed to have successfully integrated the \u003cem\u003eepsps\u003c/em\u003e gene into the eucalyptus genome at various stages. Realtime fluorescence quantitative PCR and enzyme-linked immunosorbent assay further validated the gene's integration and expression in all independent transformation events. Additionally, the transgenic plants demonstrated significant resistance to glyphosate after being treated with a 200-fold diluted Roundup solution. Physiological analysis revealed that maintaining lower levels of shikimic acid in transgenic plants is crucial for glyphosate tolerance. The successful development of herbicide-resistant transgenic eucalyptus in elite clones presents significant potential for future breeding programs and may be directly applicable to plantation after further field testing.\u003c/p\u003e","manuscriptTitle":"Transgenic Eucalyptus urophylla × Eucalyptus grandis Superior Clone DH3229: Achieving Glyphosate Resistance through Genetic Modification","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-18 16:51:54","doi":"10.21203/rs.3.rs-5342227/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2024-11-05T08:44:32+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-11-04T12:28:41+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-11-01T05:25:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"Plant Cell, Tissue and Organ Culture (PCTOC)","date":"2024-10-30T00:53:41+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"plant-cell-tissue-and-organ-culture-pctoc","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcto","sideBox":"Learn more about [Plant Cell, Tissue and Organ Culture (PCTOC)](https://www.springer.com/journal/11240)","snPcode":"11240","submissionUrl":"https://submission.nature.com/new-submission/11240/3","title":"Plant Cell, Tissue and Organ Culture (PCTOC)","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"8ced06be-26f2-4771-a6a0-d20b9e64b495","owner":[],"postedDate":"November 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-02-10T16:01:22+00:00","versionOfRecord":{"articleIdentity":"rs-5342227","link":"https://doi.org/10.1007/s11240-025-02967-x","journal":{"identity":"plant-cell-tissue-and-organ-culture-pctoc","isVorOnly":false,"title":"Plant Cell, Tissue and Organ Culture (PCTOC)"},"publishedOn":"2025-02-03 15:57:24","publishedOnDateReadable":"February 3rd, 2025"},"versionCreatedAt":"2024-11-18 16:51:54","video":"","vorDoi":"10.1007/s11240-025-02967-x","vorDoiUrl":"https://doi.org/10.1007/s11240-025-02967-x","workflowStages":[]},"version":"v1","identity":"rs-5342227","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5342227","identity":"rs-5342227","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}